>Feature sequence1 579 1259 gene locus_tag LOCUS_00010 579 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1268 2551 gene locus_tag LOCUS_00020 1268 2551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2548 3060 gene locus_tag LOCUS_00030 2548 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3161 3973 gene locus_tag LOCUS_00040 gene thiM 3161 3973 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047875.1 protein_id gnl|my_center|LOCUS_00040 3970 4632 gene locus_tag LOCUS_00050 gene thiE 3970 4632 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939635.1 protein_id gnl|my_center|LOCUS_00050 4629 5474 gene locus_tag LOCUS_00060 4629 5474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00060 5906 5463 gene locus_tag LOCUS_00070 5906 5463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 6100 7110 gene locus_tag LOCUS_00080 6100 7110 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029976.1 protein_id gnl|my_center|LOCUS_00080 7107 7955 gene locus_tag LOCUS_00090 7107 7955 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466752.1 protein_id gnl|my_center|LOCUS_00090 7975 8358 gene locus_tag LOCUS_00100 7975 8358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 9189 8389 gene locus_tag LOCUS_00110 9189 8389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 9254 9697 gene locus_tag LOCUS_00120 9254 9697 CDS product DUF5997 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285721.1 protein_id gnl|my_center|LOCUS_00120 10507 9860 gene locus_tag LOCUS_00130 10507 9860 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777116.1 protein_id gnl|my_center|LOCUS_00130 10774 11358 gene locus_tag LOCUS_00140 10774 11358 CDS product NUDIX hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870383.1 protein_id gnl|my_center|LOCUS_00140 11521 12912 gene locus_tag LOCUS_00150 11521 12912 CDS product IS1380-like element ISCgl4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015202.1 protein_id gnl|my_center|LOCUS_00150 14020 13055 gene locus_tag LOCUS_00160 14020 13055 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975162.1 protein_id gnl|my_center|LOCUS_00160 14723 14229 gene locus_tag LOCUS_00170 14723 14229 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065210.1 protein_id gnl|my_center|LOCUS_00170 14658 14951 gene locus_tag LOCUS_00180 14658 14951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 16562 14973 gene locus_tag LOCUS_00190 16562 14973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 17579 16860 gene locus_tag LOCUS_00200 17579 16860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 18261 17698 gene locus_tag LOCUS_00210 18261 17698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 18305 18745 gene locus_tag LOCUS_00220 18305 18745 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188679977.1 protein_id gnl|my_center|LOCUS_00220 18801 20060 gene locus_tag LOCUS_00230 18801 20060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 20070 20615 gene locus_tag LOCUS_00240 20070 20615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 20653 20955 gene locus_tag LOCUS_00250 20653 20955 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057607.1 protein_id gnl|my_center|LOCUS_00250 21391 21005 gene locus_tag LOCUS_00260 21391 21005 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143490.1 protein_id gnl|my_center|LOCUS_00260 22016 21522 gene locus_tag LOCUS_00270 22016 21522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 23175 22009 gene locus_tag LOCUS_00280 23175 22009 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049749196.1 protein_id gnl|my_center|LOCUS_00280 23884 23306 gene locus_tag LOCUS_00290 23884 23306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 24910 24041 gene locus_tag LOCUS_00300 24910 24041 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028594.1 protein_id gnl|my_center|LOCUS_00300 25184 28675 gene locus_tag LOCUS_00310 gene rpoB 25184 28675 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029792.1 protein_id gnl|my_center|LOCUS_00310 28716 32612 gene locus_tag LOCUS_00320 28716 32612 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776388.1 protein_id gnl|my_center|LOCUS_00320 32729 37219 gene locus_tag LOCUS_00330 32729 37219 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776163.1 protein_id gnl|my_center|LOCUS_00330 37279 37614 gene locus_tag LOCUS_00340 37279 37614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 37648 37959 gene locus_tag LOCUS_00350 37648 37959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 37956 39236 gene locus_tag LOCUS_00360 37956 39236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029712.1 protein_id gnl|my_center|LOCUS_00360 39233 39787 gene locus_tag LOCUS_00370 39233 39787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 39780 40406 gene locus_tag LOCUS_00380 39780 40406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 40403 40984 gene locus_tag LOCUS_00390 40403 40984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 41070 42233 gene locus_tag LOCUS_00400 41070 42233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 42233 48214 gene locus_tag LOCUS_00410 42233 48214 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193495474.1 protein_id gnl|my_center|LOCUS_00410 48235 49230 gene locus_tag LOCUS_00420 48235 49230 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929980.1 protein_id gnl|my_center|LOCUS_00420 49426 49235 gene locus_tag LOCUS_00430 49426 49235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 49329 50597 gene locus_tag LOCUS_00440 49329 50597 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776170.1 protein_id gnl|my_center|LOCUS_00440 50594 53113 gene locus_tag LOCUS_00450 50594 53113 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776169.1 protein_id gnl|my_center|LOCUS_00450 53106 54350 gene locus_tag LOCUS_00460 53106 54350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 54347 55036 gene locus_tag LOCUS_00470 54347 55036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 55691 55065 gene locus_tag LOCUS_00480 gene satP 55691 55065 CDS product acetate uptake transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368353.1 protein_id gnl|my_center|LOCUS_00480 55956 58880 gene locus_tag LOCUS_00490 55956 58880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 58955 60625 gene locus_tag LOCUS_00500 58955 60625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 60645 62018 gene locus_tag LOCUS_00510 60645 62018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 62023 63252 gene locus_tag LOCUS_00520 62023 63252 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_00520 63374 63781 gene locus_tag LOCUS_00530 63374 63781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 63906 64331 gene locus_tag LOCUS_00540 63906 64331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 64334 64900 gene locus_tag LOCUS_00550 64334 64900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 64894 66378 gene locus_tag LOCUS_00560 64894 66378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 66398 67441 gene locus_tag LOCUS_00570 gene pilM 66398 67441 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887416.1 protein_id gnl|my_center|LOCUS_00570 67438 68103 gene locus_tag LOCUS_00580 67438 68103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 68106 68792 gene locus_tag LOCUS_00590 68106 68792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 68924 69340 gene locus_tag LOCUS_00600 68924 69340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 69449 69865 gene locus_tag LOCUS_00610 69449 69865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 69867 70436 gene locus_tag LOCUS_00620 69867 70436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 70427 71854 gene locus_tag LOCUS_00630 70427 71854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 71874 72917 gene locus_tag LOCUS_00640 gene pilM 71874 72917 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228636.1 protein_id gnl|my_center|LOCUS_00640 72914 73579 gene locus_tag LOCUS_00650 72914 73579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 73582 74307 gene locus_tag LOCUS_00660 73582 74307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 74434 74721 gene locus_tag LOCUS_00670 74434 74721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 74785 75639 gene locus_tag LOCUS_00680 74785 75639 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226289.1 protein_id gnl|my_center|LOCUS_00680 75724 76647 gene locus_tag LOCUS_00690 75724 76647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 76781 77269 gene locus_tag LOCUS_00700 76781 77269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 77296 77946 gene locus_tag LOCUS_00710 77296 77946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 78255 78629 gene locus_tag LOCUS_00720 gene rpsL 78255 78629 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102113.1 protein_id gnl|my_center|LOCUS_00720 78629 79099 gene locus_tag LOCUS_00730 gene rpsG 78629 79099 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776385.1 protein_id gnl|my_center|LOCUS_00730 79190 81304 gene locus_tag LOCUS_00740 gene fusA 79190 81304 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055595.1 protein_id gnl|my_center|LOCUS_00740 81441 82634 gene locus_tag LOCUS_00750 gene tuf 81441 82634 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776383.1 protein_id gnl|my_center|LOCUS_00750 83108 83416 gene locus_tag LOCUS_00760 gene rpsJ 83108 83416 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776378.1 protein_id gnl|my_center|LOCUS_00760 83425 84084 gene locus_tag LOCUS_00770 gene rplC 83425 84084 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776377.1 protein_id gnl|my_center|LOCUS_00770 84090 84740 gene locus_tag LOCUS_00780 gene rplD 84090 84740 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222605.1 protein_id gnl|my_center|LOCUS_00780 84740 85042 gene locus_tag LOCUS_00790 gene rplW 84740 85042 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776375.1 protein_id gnl|my_center|LOCUS_00790 85067 85906 gene locus_tag LOCUS_00800 gene rplB 85067 85906 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776374.1 protein_id gnl|my_center|LOCUS_00800 85916 86197 gene locus_tag LOCUS_00810 gene rpsS 85916 86197 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974263.1 protein_id gnl|my_center|LOCUS_00810 86224 86589 gene locus_tag LOCUS_00820 gene rplV 86224 86589 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776372.1 protein_id gnl|my_center|LOCUS_00820 86589 87371 gene locus_tag LOCUS_00830 gene rpsC 86589 87371 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776371.1 protein_id gnl|my_center|LOCUS_00830 87371 87790 gene locus_tag LOCUS_00840 gene rplP 87371 87790 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974260.1 protein_id gnl|my_center|LOCUS_00840 87790 88137 gene locus_tag LOCUS_00850 87790 88137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 88140 88439 gene locus_tag LOCUS_00860 gene rpsQ 88140 88439 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974258.1 protein_id gnl|my_center|LOCUS_00860 88473 88841 gene locus_tag LOCUS_00870 gene rplN 88473 88841 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974257.1 protein_id gnl|my_center|LOCUS_00870 88844 89203 gene locus_tag LOCUS_00880 gene rplX 88844 89203 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776365.1 protein_id gnl|my_center|LOCUS_00880 89203 89805 gene locus_tag LOCUS_00890 gene rplE 89203 89805 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974255.1 protein_id gnl|my_center|LOCUS_00890 89936 90334 gene locus_tag LOCUS_00900 gene rpsH 89936 90334 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974254.1 protein_id gnl|my_center|LOCUS_00900 90341 90877 gene locus_tag LOCUS_00910 gene rplF 90341 90877 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403673.1 protein_id gnl|my_center|LOCUS_00910 90880 91251 gene locus_tag LOCUS_00920 gene rplR 90880 91251 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776361.1 protein_id gnl|my_center|LOCUS_00920 91248 91961 gene locus_tag LOCUS_00930 gene rpsE 91248 91961 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776360.1 protein_id gnl|my_center|LOCUS_00930 91961 92143 gene locus_tag LOCUS_00940 gene rpmD 91961 92143 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974250.1 protein_id gnl|my_center|LOCUS_00940 92143 92715 gene locus_tag LOCUS_00950 gene rplO 92143 92715 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776358.1 protein_id gnl|my_center|LOCUS_00950 92834 94156 gene locus_tag LOCUS_00960 gene secY 92834 94156 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974248.1 protein_id gnl|my_center|LOCUS_00960 94153 94746 gene locus_tag LOCUS_00970 94153 94746 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776356.1 protein_id gnl|my_center|LOCUS_00970 94787 95617 gene locus_tag LOCUS_00980 gene map 94787 95617 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029827.1 protein_id gnl|my_center|LOCUS_00980 97827 95938 gene locus_tag LOCUS_00990 97827 95938 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861809.1 protein_id gnl|my_center|LOCUS_00990 98007 98318 gene locus_tag LOCUS_01000 98007 98318 CDS product PTS lactose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732400.1 protein_id gnl|my_center|LOCUS_01000 98357 98623 gene locus_tag LOCUS_01010 98357 98623 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973180.1 protein_id gnl|my_center|LOCUS_01010 98633 100333 gene locus_tag LOCUS_01020 gene ptsP 98633 100333 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814167.1 protein_id gnl|my_center|LOCUS_01020 100335 101825 gene locus_tag LOCUS_01030 100335 101825 CDS product PTS mannitol transporter subunit IICB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886406.1 protein_id gnl|my_center|LOCUS_01030 101822 102259 gene locus_tag LOCUS_01040 101822 102259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01040 102256 103404 gene locus_tag LOCUS_01050 102256 103404 CDS product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804337.1 protein_id gnl|my_center|LOCUS_01050 103535 103756 gene locus_tag LOCUS_01060 gene infA 103535 103756 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558881.1 protein_id gnl|my_center|LOCUS_01060 104107 104481 gene locus_tag LOCUS_01070 gene rpsM 104107 104481 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004571523.1 protein_id gnl|my_center|LOCUS_01070 104526 104924 gene locus_tag LOCUS_01080 gene rpsK 104526 104924 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814580.1 protein_id gnl|my_center|LOCUS_01080 105044 106033 gene locus_tag LOCUS_01090 105044 106033 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003966937.1 protein_id gnl|my_center|LOCUS_01090 106083 106604 gene locus_tag LOCUS_01100 106083 106604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 106817 107845 gene locus_tag LOCUS_01110 106817 107845 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079997.1 protein_id gnl|my_center|LOCUS_01110 107980 109023 gene locus_tag LOCUS_01120 107980 109023 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079997.1 protein_id gnl|my_center|LOCUS_01120 109045 110046 gene locus_tag LOCUS_01130 109045 110046 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089460.1 protein_id gnl|my_center|LOCUS_01130 110128 110787 gene locus_tag LOCUS_01140 110128 110787 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976769.1 protein_id gnl|my_center|LOCUS_01140 110784 111776 gene locus_tag LOCUS_01150 110784 111776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 111894 113447 gene locus_tag LOCUS_01160 gene istA 111894 113447 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015262274.1 protein_id gnl|my_center|LOCUS_01160 113444 114193 gene locus_tag LOCUS_01170 gene istB 113444 114193 CDS product IS21-like element ISFK1 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090937.1 protein_id gnl|my_center|LOCUS_01170 114324 114614 gene locus_tag LOCUS_01180 114324 114614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 115051 114629 gene locus_tag LOCUS_01190 115051 114629 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081160608.1 protein_id gnl|my_center|LOCUS_01190 115275 115048 gene locus_tag LOCUS_01200 115275 115048 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066875765.1 protein_id gnl|my_center|LOCUS_01200 115947 115441 gene locus_tag LOCUS_01210 115947 115441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 116248 117885 gene locus_tag LOCUS_01220 116248 117885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 119732 117789 gene locus_tag LOCUS_01230 119732 117789 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378047.1 protein_id gnl|my_center|LOCUS_01230 119836 120738 gene locus_tag LOCUS_01240 gene truA 119836 120738 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776325.1 protein_id gnl|my_center|LOCUS_01240 120923 121369 gene locus_tag LOCUS_01250 gene rplM 120923 121369 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776324.1 protein_id gnl|my_center|LOCUS_01250 121418 121903 gene locus_tag LOCUS_01260 gene rpsI 121418 121903 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776323.1 protein_id gnl|my_center|LOCUS_01260 121929 123290 gene locus_tag LOCUS_01270 gene glmM 121929 123290 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974237.1 protein_id gnl|my_center|LOCUS_01270 124387 123443 gene locus_tag LOCUS_01280 gene coaA 124387 123443 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222129.1 protein_id gnl|my_center|LOCUS_01280 124433 126283 gene locus_tag LOCUS_01290 gene glmS 124433 126283 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974233.1 protein_id gnl|my_center|LOCUS_01290 126318 126674 gene locus_tag LOCUS_01300 126318 126674 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974229.1 protein_id gnl|my_center|LOCUS_01300 126699 127196 gene locus_tag LOCUS_01310 gene tsaE 126699 127196 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029837.1 protein_id gnl|my_center|LOCUS_01310 127310 128137 gene locus_tag LOCUS_01320 127310 128137 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016507544.1 protein_id gnl|my_center|LOCUS_01320 128163 128813 gene locus_tag LOCUS_01330 gene tsaB 128163 128813 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029839.1 protein_id gnl|my_center|LOCUS_01330 128814 129344 gene locus_tag LOCUS_01340 gene rimI 128814 129344 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029840.1 protein_id gnl|my_center|LOCUS_01340 129341 130408 gene locus_tag LOCUS_01350 gene tsaD 129341 130408 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029841.1 protein_id gnl|my_center|LOCUS_01350 130493 130936 gene locus_tag LOCUS_01360 130493 130936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 131014 131580 gene locus_tag LOCUS_01370 131014 131580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 131685 132089 gene locus_tag LOCUS_01380 131685 132089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 133794 132292 gene locus_tag LOCUS_01390 133794 132292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 135099 133909 gene locus_tag LOCUS_01400 135099 133909 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804479.1 protein_id gnl|my_center|LOCUS_01400 135232 135528 gene locus_tag LOCUS_01410 gene groES 135232 135528 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559922.1 protein_id gnl|my_center|LOCUS_01410 135643 136599 gene locus_tag LOCUS_01420 gene rarD 135643 136599 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029749.1 protein_id gnl|my_center|LOCUS_01420 136716 137417 gene locus_tag LOCUS_01430 136716 137417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 137545 138843 gene locus_tag LOCUS_01440 137545 138843 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337850.1 protein_id gnl|my_center|LOCUS_01440 140038 139271 gene locus_tag LOCUS_01450 140038 139271 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055908.1 protein_id gnl|my_center|LOCUS_01450 140993 140025 gene locus_tag LOCUS_01460 140993 140025 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073601368.1 protein_id gnl|my_center|LOCUS_01460 141966 140983 gene locus_tag LOCUS_01470 141966 140983 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391162.1 protein_id gnl|my_center|LOCUS_01470 143237 141975 gene locus_tag LOCUS_01480 143237 141975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 143540 145042 gene locus_tag LOCUS_01490 gene guaB 143540 145042 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804497.1 protein_id gnl|my_center|LOCUS_01490 145141 146259 gene locus_tag LOCUS_01500 145141 146259 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813354.1 protein_id gnl|my_center|LOCUS_01500 146345 148093 gene locus_tag LOCUS_01510 146345 148093 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974200.1 protein_id gnl|my_center|LOCUS_01510 149214 148222 gene locus_tag LOCUS_01520 149214 148222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148043383.1 protein_id gnl|my_center|LOCUS_01520 149479 150006 gene locus_tag LOCUS_01530 149479 150006 CDS product TrkA C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173527.1 protein_id gnl|my_center|LOCUS_01530 150010 151494 gene locus_tag LOCUS_01540 150010 151494 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031626.1 protein_id gnl|my_center|LOCUS_01540 151521 152273 gene locus_tag LOCUS_01550 151521 152273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 152284 152733 gene locus_tag LOCUS_01560 152284 152733 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857996.1 protein_id gnl|my_center|LOCUS_01560 152730 154355 gene locus_tag LOCUS_01570 gene guaA 152730 154355 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974187.1 protein_id gnl|my_center|LOCUS_01570 154610 154464 gene locus_tag LOCUS_01580 154610 154464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 156520 154628 gene locus_tag LOCUS_01590 156520 154628 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015482.1 protein_id gnl|my_center|LOCUS_01590 156747 158156 gene locus_tag LOCUS_01600 156747 158156 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_159656430.1 protein_id gnl|my_center|LOCUS_01600 158894 158211 gene locus_tag LOCUS_01610 158894 158211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 160857 158926 gene locus_tag LOCUS_01620 160857 158926 CDS product primary-amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040688119.1 protein_id gnl|my_center|LOCUS_01620 160992 161588 gene locus_tag LOCUS_01630 160992 161588 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093947468.1 protein_id gnl|my_center|LOCUS_01630 161690 162658 gene locus_tag LOCUS_01640 161690 162658 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487139.1 protein_id gnl|my_center|LOCUS_01640 162790 164295 gene locus_tag LOCUS_01650 162790 164295 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528554.1 protein_id gnl|my_center|LOCUS_01650 165140 164361 gene locus_tag LOCUS_01660 165140 164361 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804432.1 protein_id gnl|my_center|LOCUS_01660 165750 165238 gene locus_tag LOCUS_01670 165750 165238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 165794 166798 gene locus_tag LOCUS_01680 165794 166798 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921105.1 protein_id gnl|my_center|LOCUS_01680 166876 169344 gene locus_tag LOCUS_01690 gene pcrA 166876 169344 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029870.1 protein_id gnl|my_center|LOCUS_01690 169344 170429 gene locus_tag LOCUS_01700 169344 170429 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777023.1 protein_id gnl|my_center|LOCUS_01700 171288 170320 gene locus_tag LOCUS_01710 171288 170320 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726968.1 protein_id gnl|my_center|LOCUS_01710 171324 172223 gene locus_tag LOCUS_01720 171324 172223 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726969.1 protein_id gnl|my_center|LOCUS_01720 172378 173712 gene locus_tag LOCUS_01730 172378 173712 CDS product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225544.1 protein_id gnl|my_center|LOCUS_01730 173709 174230 gene locus_tag LOCUS_01740 173709 174230 CDS product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225543.1 protein_id gnl|my_center|LOCUS_01740 174214 174987 gene locus_tag LOCUS_01750 174214 174987 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223631.1 protein_id gnl|my_center|LOCUS_01750 175094 175255 gene locus_tag LOCUS_01760 175094 175255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 175770 175249 gene locus_tag LOCUS_01770 175770 175249 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223356.1 protein_id gnl|my_center|LOCUS_01770 175876 176520 gene locus_tag LOCUS_01780 175876 176520 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977891.1 protein_id gnl|my_center|LOCUS_01780 176923 176534 gene locus_tag LOCUS_01790 176923 176534 CDS product DUF3054 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079821.1 protein_id gnl|my_center|LOCUS_01790 177647 176937 gene locus_tag LOCUS_01800 177647 176937 CDS product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893323.1 protein_id gnl|my_center|LOCUS_01800 177847 179016 gene locus_tag LOCUS_01810 gene sucC 177847 179016 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804537.1 protein_id gnl|my_center|LOCUS_01810 179036 179938 gene locus_tag LOCUS_01820 gene sucD 179036 179938 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063434.1 protein_id gnl|my_center|LOCUS_01820 180066 181373 gene locus_tag LOCUS_01830 180066 181373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 181479 182099 gene locus_tag LOCUS_01840 gene purN 181479 182099 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776406.1 protein_id gnl|my_center|LOCUS_01840 182096 183799 gene locus_tag LOCUS_01850 gene purH 182096 183799 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222720.1 protein_id gnl|my_center|LOCUS_01850 183979 185058 gene locus_tag LOCUS_01860 183979 185058 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091859.1 protein_id gnl|my_center|LOCUS_01860 185915 185226 gene locus_tag LOCUS_01870 185915 185226 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107019778.1 protein_id gnl|my_center|LOCUS_01870 186353 188203 gene locus_tag LOCUS_01880 186353 188203 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803870.1 protein_id gnl|my_center|LOCUS_01880 188200 190020 gene locus_tag LOCUS_01890 188200 190020 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803869.1 protein_id gnl|my_center|LOCUS_01890 190265 190050 gene locus_tag LOCUS_01900 190265 190050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 190630 192057 gene locus_tag LOCUS_01910 190630 192057 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229411.1 protein_id gnl|my_center|LOCUS_01910 193671 192280 gene locus_tag LOCUS_01920 193671 192280 CDS product IS1380-like element ISCgl4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015202.1 protein_id gnl|my_center|LOCUS_01920 195464 194070 gene locus_tag LOCUS_01930 195464 194070 CDS product IS1380-like element ISCgl4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015202.1 protein_id gnl|my_center|LOCUS_01930 195973 195647 gene locus_tag LOCUS_01940 195973 195647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 196425 195973 gene locus_tag LOCUS_01950 196425 195973 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224053.1 protein_id gnl|my_center|LOCUS_01950 196572 197801 gene locus_tag LOCUS_01960 196572 197801 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222746.1 protein_id gnl|my_center|LOCUS_01960 197912 199819 gene locus_tag LOCUS_01970 197912 199819 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642848.1 protein_id gnl|my_center|LOCUS_01970 199949 203614 gene locus_tag LOCUS_01980 199949 203614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 203851 207453 gene locus_tag LOCUS_01990 203851 207453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 207563 208792 gene locus_tag LOCUS_02000 207563 208792 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728183.1 protein_id gnl|my_center|LOCUS_02000 209681 208767 gene locus_tag LOCUS_02010 209681 208767 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029384.1 protein_id gnl|my_center|LOCUS_02010 210064 209687 gene locus_tag LOCUS_02020 210064 209687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 210955 210086 gene locus_tag LOCUS_02030 210955 210086 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805142.1 protein_id gnl|my_center|LOCUS_02030 211143 212423 gene locus_tag LOCUS_02040 211143 212423 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728975.1 protein_id gnl|my_center|LOCUS_02040 214082 212532 gene locus_tag LOCUS_02050 214082 212532 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313426.1 protein_id gnl|my_center|LOCUS_02050 214233 216533 gene locus_tag LOCUS_02060 214233 216533 CDS product Na+/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727236.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02060 216534 217235 gene locus_tag LOCUS_02070 216534 217235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02070 217232 217735 gene locus_tag LOCUS_02080 217232 217735 CDS product Na(+)/H(+) antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085546.1 protein_id gnl|my_center|LOCUS_02080 217732 219291 gene locus_tag LOCUS_02090 217732 219291 CDS product Na+/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892272.1 protein_id gnl|my_center|LOCUS_02090 219288 219896 gene locus_tag LOCUS_02100 219288 219896 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972189.1 protein_id gnl|my_center|LOCUS_02100 219896 220162 gene locus_tag LOCUS_02110 219896 220162 CDS product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892270.1 protein_id gnl|my_center|LOCUS_02110 220159 220542 gene locus_tag LOCUS_02120 gene mnhG 220159 220542 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727233.1 protein_id gnl|my_center|LOCUS_02120 220658 221956 gene locus_tag LOCUS_02130 gene glyA 220658 221956 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856790.1 protein_id gnl|my_center|LOCUS_02130 222164 223051 gene locus_tag LOCUS_02140 222164 223051 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893053.1 protein_id gnl|my_center|LOCUS_02140 223734 223198 gene locus_tag LOCUS_02150 223734 223198 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730372.1 protein_id gnl|my_center|LOCUS_02150 223772 224278 gene locus_tag LOCUS_02160 223772 224278 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224204.1 protein_id gnl|my_center|LOCUS_02160 224340 225239 gene locus_tag LOCUS_02170 224340 225239 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894624.1 protein_id gnl|my_center|LOCUS_02170 226551 225361 gene locus_tag LOCUS_02180 gene galK 226551 225361 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224288.1 protein_id gnl|my_center|LOCUS_02180 227756 226548 gene locus_tag LOCUS_02190 gene galT 227756 226548 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230058.1 protein_id gnl|my_center|LOCUS_02190 227841 228680 gene locus_tag LOCUS_02200 gene agaR 227841 228680 CDS product transcriptional repressor AgaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209875.1 protein_id gnl|my_center|LOCUS_02200 228685 229632 gene locus_tag LOCUS_02210 228685 229632 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230161.1 protein_id gnl|my_center|LOCUS_02210 229641 230927 gene locus_tag LOCUS_02220 229641 230927 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222356.1 protein_id gnl|my_center|LOCUS_02220 231123 232853 gene locus_tag LOCUS_02230 231123 232853 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880806.1 protein_id gnl|my_center|LOCUS_02230 232854 233147 gene locus_tag LOCUS_02240 232854 233147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 233138 234181 gene locus_tag LOCUS_02250 233138 234181 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902224.1 protein_id gnl|my_center|LOCUS_02250 234632 234129 gene locus_tag LOCUS_02260 234632 234129 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859290.1 protein_id gnl|my_center|LOCUS_02260 235402 234629 gene locus_tag LOCUS_02270 235402 234629 CDS product Rv2466c family mycothiol-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412664.1 protein_id gnl|my_center|LOCUS_02270 237167 235509 gene locus_tag LOCUS_02280 237167 235509 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230221.1 protein_id gnl|my_center|LOCUS_02280 237352 238572 gene locus_tag LOCUS_02290 237352 238572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 239152 238592 gene locus_tag LOCUS_02300 239152 238592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 239623 239550 gene locus_tag LOCUS_t00010 239623 239550 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 239746 240375 gene locus_tag LOCUS_02310 239746 240375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013364002.1 protein_id gnl|my_center|LOCUS_02310 240644 241240 gene locus_tag LOCUS_02320 gene sigK 240644 241240 CDS product ECF RNA polymerase sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191314022.1 protein_id gnl|my_center|LOCUS_02320 241237 242076 gene locus_tag LOCUS_02330 241237 242076 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027262.1 protein_id gnl|my_center|LOCUS_02330 242123 243010 gene locus_tag LOCUS_02340 242123 243010 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804031.1 protein_id gnl|my_center|LOCUS_02340 243958 243179 gene locus_tag LOCUS_02350 gene pstB 243958 243179 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776544.1 protein_id gnl|my_center|LOCUS_02350 245102 244014 gene locus_tag LOCUS_02360 gene pstA 245102 244014 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974829.1 protein_id gnl|my_center|LOCUS_02360 246046 245102 gene locus_tag LOCUS_02370 gene pstC 246046 245102 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068423.1 protein_id gnl|my_center|LOCUS_02370 247284 246190 gene locus_tag LOCUS_02380 gene pstS 247284 246190 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776547.1 protein_id gnl|my_center|LOCUS_02380 248363 247413 gene locus_tag LOCUS_02390 248363 247413 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776549.1 protein_id gnl|my_center|LOCUS_02390 250534 248360 gene locus_tag LOCUS_02400 250534 248360 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270140.1 protein_id gnl|my_center|LOCUS_02400 251544 250600 gene locus_tag LOCUS_02410 251544 250600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 252202 251513 gene locus_tag LOCUS_02420 gene glnR 252202 251513 CDS product two-component system response regulator GlnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029474.1 protein_id gnl|my_center|LOCUS_02420 252277 252540 gene locus_tag LOCUS_02430 252277 252540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 252731 253345 gene locus_tag LOCUS_02440 252731 253345 CDS product FABP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974791.1 protein_id gnl|my_center|LOCUS_02440 253402 254595 gene locus_tag LOCUS_02450 253402 254595 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930019.1 protein_id gnl|my_center|LOCUS_02450 254632 255384 gene locus_tag LOCUS_02460 254632 255384 CDS product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222392.1 protein_id gnl|my_center|LOCUS_02460 256104 255448 gene locus_tag LOCUS_02470 gene phoU 256104 255448 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974747.1 protein_id gnl|my_center|LOCUS_02470 256283 257455 gene locus_tag LOCUS_02480 256283 257455 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974746.1 protein_id gnl|my_center|LOCUS_02480 257452 258135 gene locus_tag LOCUS_02490 gene regX 257452 258135 CDS product two-component sensory transduction protein RegX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876914.1 protein_id gnl|my_center|LOCUS_02490 258709 258221 gene locus_tag LOCUS_02500 258709 258221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 258882 259364 gene locus_tag LOCUS_02510 258882 259364 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804554.1 protein_id gnl|my_center|LOCUS_02510 259469 260731 gene locus_tag LOCUS_02520 259469 260731 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389364.1 protein_id gnl|my_center|LOCUS_02520 260734 262143 gene locus_tag LOCUS_02530 gene cysS 260734 262143 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868385.1 protein_id gnl|my_center|LOCUS_02530 262143 263276 gene locus_tag LOCUS_02540 gene rlmB 262143 263276 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230407.1 protein_id gnl|my_center|LOCUS_02540 263901 263638 gene locus_tag LOCUS_02550 263901 263638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 264408 263914 gene locus_tag LOCUS_02560 264408 263914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 264349 264660 gene locus_tag LOCUS_02570 264349 264660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 266145 264823 gene locus_tag LOCUS_02580 266145 264823 CDS product DUF4032 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804886.1 protein_id gnl|my_center|LOCUS_02580 267325 266228 gene locus_tag LOCUS_02590 gene msiK 267325 266228 CDS product diacetylchitobiose ABC transporter ATP-binding protein MsiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029527.1 protein_id gnl|my_center|LOCUS_02590 267592 268506 gene locus_tag LOCUS_02600 267592 268506 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041323874.1 protein_id gnl|my_center|LOCUS_02600 268541 268616 gene locus_tag LOCUS_t00020 268541 268616 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 269091 268660 gene locus_tag LOCUS_02610 269091 268660 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392404.1 protein_id gnl|my_center|LOCUS_02610 269218 270249 gene locus_tag LOCUS_02620 269218 270249 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804303.1 protein_id gnl|my_center|LOCUS_02620 270262 271257 gene locus_tag LOCUS_02630 270262 271257 CDS product arginine deiminase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533364.1 protein_id gnl|my_center|LOCUS_02630 271461 272456 gene locus_tag LOCUS_02640 271461 272456 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114440.1 protein_id gnl|my_center|LOCUS_02640 273036 272470 gene locus_tag LOCUS_02650 273036 272470 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114828.1 protein_id gnl|my_center|LOCUS_02650 273440 273039 gene locus_tag LOCUS_02660 gene msrB 273440 273039 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972860.1 protein_id gnl|my_center|LOCUS_02660 273676 273972 gene locus_tag LOCUS_02670 273676 273972 CDS product DUF3263 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892262.1 protein_id gnl|my_center|LOCUS_02670 274123 274587 gene locus_tag LOCUS_02680 274123 274587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 274838 275041 gene locus_tag LOCUS_02690 274838 275041 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010551414.1 protein_id gnl|my_center|LOCUS_02690 275110 276165 gene locus_tag LOCUS_02700 275110 276165 CDS product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258677.1 protein_id gnl|my_center|LOCUS_02700 276295 277923 gene locus_tag LOCUS_02710 gene groL 276295 277923 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892307.1 protein_id gnl|my_center|LOCUS_02710 279557 277995 gene locus_tag LOCUS_02720 279557 277995 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776259.1 protein_id gnl|my_center|LOCUS_02720 281094 279580 gene locus_tag LOCUS_02730 281094 279580 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208292971.1 protein_id gnl|my_center|LOCUS_02730 283229 281091 gene locus_tag LOCUS_02740 gene betT 283229 281091 CDS product choline BCCT transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097646.1 protein_id gnl|my_center|LOCUS_02740 283644 283354 gene locus_tag LOCUS_02750 283644 283354 CDS product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812525.1 protein_id gnl|my_center|LOCUS_02750 285449 283761 gene locus_tag LOCUS_02760 285449 283761 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812532.1 protein_id gnl|my_center|LOCUS_02760 286174 285482 gene locus_tag LOCUS_02770 286174 285482 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804420.1 protein_id gnl|my_center|LOCUS_02770 286283 287191 gene locus_tag LOCUS_02780 gene folP 286283 287191 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776664.1 protein_id gnl|my_center|LOCUS_02780 287201 287911 gene locus_tag LOCUS_02790 287201 287911 CDS product pyrimidine reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224546.1 protein_id gnl|my_center|LOCUS_02790 289643 288000 gene locus_tag LOCUS_02800 289643 288000 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230272.1 protein_id gnl|my_center|LOCUS_02800 291606 289687 gene locus_tag LOCUS_02810 291606 289687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 291886 291611 gene locus_tag LOCUS_02820 291886 291611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 291987 292367 gene locus_tag LOCUS_02830 291987 292367 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053193.1 protein_id gnl|my_center|LOCUS_02830 292360 292977 gene locus_tag LOCUS_02840 292360 292977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 293172 292939 gene locus_tag LOCUS_02850 293172 292939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 294317 293199 gene locus_tag LOCUS_02860 gene serC 294317 293199 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230187.1 protein_id gnl|my_center|LOCUS_02860 294403 295110 gene locus_tag LOCUS_02870 294403 295110 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974588.1 protein_id gnl|my_center|LOCUS_02870 295547 296215 gene locus_tag LOCUS_02880 295547 296215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 296538 297038 gene locus_tag LOCUS_02890 296538 297038 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086840499.1 protein_id gnl|my_center|LOCUS_02890 297150 297656 gene locus_tag LOCUS_02900 297150 297656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 297764 297838 gene locus_tag LOCUS_t00030 297764 297838 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 298051 298461 gene locus_tag LOCUS_02910 298051 298461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 298728 300002 gene locus_tag LOCUS_02920 298728 300002 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776842.1 protein_id gnl|my_center|LOCUS_02920 300090 301679 gene locus_tag LOCUS_02930 300090 301679 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013391.1 protein_id gnl|my_center|LOCUS_02930 301749 302711 gene locus_tag LOCUS_02940 301749 302711 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405050.1 protein_id gnl|my_center|LOCUS_02940 304181 302727 gene locus_tag LOCUS_02950 304181 302727 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161617985.1 protein_id gnl|my_center|LOCUS_02950 305020 304178 gene locus_tag LOCUS_02960 305020 304178 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479973.1 protein_id gnl|my_center|LOCUS_02960 305203 306228 gene locus_tag LOCUS_02970 305203 306228 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878198.1 protein_id gnl|my_center|LOCUS_02970 306219 306497 gene locus_tag LOCUS_02980 306219 306497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 306815 306519 gene locus_tag LOCUS_02990 306815 306519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 307112 311083 gene locus_tag LOCUS_03000 307112 311083 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731067.1 protein_id gnl|my_center|LOCUS_03000 311091 312419 gene locus_tag LOCUS_03010 311091 312419 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086878.1 protein_id gnl|my_center|LOCUS_03010 313001 312429 gene locus_tag LOCUS_03020 313001 312429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 313081 314097 gene locus_tag LOCUS_03030 gene corA 313081 314097 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223003.1 protein_id gnl|my_center|LOCUS_03030 314430 318227 gene locus_tag LOCUS_03040 314430 318227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 318227 318445 gene locus_tag LOCUS_03050 318227 318445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 319989 318556 gene locus_tag LOCUS_03060 319989 318556 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013450.1 protein_id gnl|my_center|LOCUS_03060 320740 320318 gene locus_tag LOCUS_03070 gene mscL 320740 320318 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230043.1 protein_id gnl|my_center|LOCUS_03070 321125 320766 gene locus_tag LOCUS_03080 321125 320766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 321758 321180 gene locus_tag LOCUS_03090 321758 321180 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814444.1 protein_id gnl|my_center|LOCUS_03090 321745 322689 gene locus_tag LOCUS_03100 gene galU 321745 322689 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975635.1 protein_id gnl|my_center|LOCUS_03100 322741 323400 gene locus_tag LOCUS_03110 322741 323400 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804925.1 protein_id gnl|my_center|LOCUS_03110 323521 324465 gene locus_tag LOCUS_03120 323521 324465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 324630 324705 gene locus_tag LOCUS_t00040 324630 324705 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 325601 324801 gene locus_tag LOCUS_03130 325601 324801 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079975.1 protein_id gnl|my_center|LOCUS_03130 325801 326532 gene locus_tag LOCUS_03140 325801 326532 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889327.1 protein_id gnl|my_center|LOCUS_03140 326544 327200 gene locus_tag LOCUS_03150 326544 327200 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889326.1 protein_id gnl|my_center|LOCUS_03150 327197 328390 gene locus_tag LOCUS_03160 327197 328390 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086701.1 protein_id gnl|my_center|LOCUS_03160 328509 329273 gene locus_tag LOCUS_03170 328509 329273 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731005.1 protein_id gnl|my_center|LOCUS_03170 329278 330885 gene locus_tag LOCUS_03180 329278 330885 CDS product 5-oxoprolinase/urea amidolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266442.1 protein_id gnl|my_center|LOCUS_03180 330890 332635 gene locus_tag LOCUS_03190 330890 332635 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105457.1 protein_id gnl|my_center|LOCUS_03190 332665 333351 gene locus_tag LOCUS_03200 332665 333351 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230108.1 protein_id gnl|my_center|LOCUS_03200 334449 333643 gene locus_tag LOCUS_03210 334449 333643 CDS product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015201.1 protein_id gnl|my_center|LOCUS_03210 335684 334455 gene locus_tag LOCUS_03220 335684 334455 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014042.1 protein_id gnl|my_center|LOCUS_03220 336006 336251 gene locus_tag LOCUS_03230 336006 336251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 337358 336309 gene locus_tag LOCUS_03240 gene hpaD 337358 336309 CDS product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479777.1 protein_id gnl|my_center|LOCUS_03240 337791 337375 gene locus_tag LOCUS_03250 337791 337375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 337864 339321 gene locus_tag LOCUS_03260 337864 339321 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225993.1 protein_id gnl|my_center|LOCUS_03260 340187 339318 gene locus_tag LOCUS_03270 340187 339318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187364534.1 protein_id gnl|my_center|LOCUS_03270 340405 340283 gene locus_tag LOCUS_03280 340405 340283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 340641 340892 gene locus_tag LOCUS_03290 340641 340892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 341168 341449 gene locus_tag LOCUS_03300 341168 341449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 342911 341451 gene locus_tag LOCUS_03310 342911 341451 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189292.1 protein_id gnl|my_center|LOCUS_03310 343156 342911 gene locus_tag LOCUS_03320 343156 342911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 343869 343222 gene locus_tag LOCUS_03330 343869 343222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 343787 343963 gene locus_tag LOCUS_03340 343787 343963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 345681 344338 gene locus_tag LOCUS_03350 345681 344338 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230391.1 protein_id gnl|my_center|LOCUS_03350 346605 345697 gene locus_tag LOCUS_03360 346605 345697 CDS product DUF4349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077222.1 protein_id gnl|my_center|LOCUS_03360 346763 346963 gene locus_tag LOCUS_03370 346763 346963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 346967 347848 gene locus_tag LOCUS_03380 346967 347848 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979459.1 protein_id gnl|my_center|LOCUS_03380 348189 347866 gene locus_tag LOCUS_03390 348189 347866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 349211 348192 gene locus_tag LOCUS_03400 349211 348192 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384492.1 protein_id gnl|my_center|LOCUS_03400 349421 349837 gene locus_tag LOCUS_03410 349421 349837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 350792 349839 gene locus_tag LOCUS_03420 350792 349839 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899238.1 protein_id gnl|my_center|LOCUS_03420 350956 351108 gene locus_tag LOCUS_03430 350956 351108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 351193 352179 gene locus_tag LOCUS_03440 351193 352179 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222236.1 protein_id gnl|my_center|LOCUS_03440 353161 352337 gene locus_tag LOCUS_03450 353161 352337 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031003.1 protein_id gnl|my_center|LOCUS_03450 354498 353326 gene locus_tag LOCUS_03460 354498 353326 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113745.1 protein_id gnl|my_center|LOCUS_03460 354628 355443 gene locus_tag LOCUS_03470 354628 355443 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114312.1 protein_id gnl|my_center|LOCUS_03470 355955 355440 gene locus_tag LOCUS_03480 gene pdxH 355955 355440 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056186.1 protein_id gnl|my_center|LOCUS_03480 356098 357036 gene locus_tag LOCUS_03490 356098 357036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 357120 358106 gene locus_tag LOCUS_03500 357120 358106 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082397.1 protein_id gnl|my_center|LOCUS_03500 358103 359245 gene locus_tag LOCUS_03510 358103 359245 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167455028.1 protein_id gnl|my_center|LOCUS_03510 359245 360090 gene locus_tag LOCUS_03520 359245 360090 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013802.1 protein_id gnl|my_center|LOCUS_03520 360143 361162 gene locus_tag LOCUS_03530 360143 361162 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013805.1 protein_id gnl|my_center|LOCUS_03530 361483 362373 gene locus_tag LOCUS_03540 361483 362373 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894624.1 protein_id gnl|my_center|LOCUS_03540 362377 363375 gene locus_tag LOCUS_03550 362377 363375 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894625.1 protein_id gnl|my_center|LOCUS_03550 363372 364178 gene locus_tag LOCUS_03560 363372 364178 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973712.1 protein_id gnl|my_center|LOCUS_03560 368581 364430 gene locus_tag LOCUS_03570 368581 364430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 368637 369059 gene locus_tag LOCUS_03580 368637 369059 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183065.1 protein_id gnl|my_center|LOCUS_03580 369109 369942 gene locus_tag LOCUS_03590 369109 369942 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567680.1 protein_id gnl|my_center|LOCUS_03590 370145 370810 gene locus_tag LOCUS_03600 gene pnuC 370145 370810 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805208.1 protein_id gnl|my_center|LOCUS_03600 370833 372737 gene locus_tag LOCUS_03610 370833 372737 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119948893.1 protein_id gnl|my_center|LOCUS_03610 372806 373234 gene locus_tag LOCUS_03620 372806 373234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 373464 375221 gene locus_tag LOCUS_03630 373464 375221 CDS product stealth conserved region 3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908769.1 protein_id gnl|my_center|LOCUS_03630 376101 375148 gene locus_tag LOCUS_03640 gene cpdA 376101 375148 CDS product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404120.1 protein_id gnl|my_center|LOCUS_03640 376252 377154 gene locus_tag LOCUS_03650 376252 377154 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230362.1 protein_id gnl|my_center|LOCUS_03650 377647 378549 gene locus_tag LOCUS_03660 377647 378549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 378614 379843 gene locus_tag LOCUS_03670 378614 379843 CDS product type III polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804101.1 protein_id gnl|my_center|LOCUS_03670 379840 380619 gene locus_tag LOCUS_03680 379840 380619 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889586.1 protein_id gnl|my_center|LOCUS_03680 380612 381739 gene locus_tag LOCUS_03690 380612 381739 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187767773.1 protein_id gnl|my_center|LOCUS_03690 381771 383333 gene locus_tag LOCUS_03700 381771 383333 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776589.1 protein_id gnl|my_center|LOCUS_03700 383467 384903 gene locus_tag LOCUS_03710 383467 384903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 385629 384862 gene locus_tag LOCUS_03720 385629 384862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 385983 385729 gene locus_tag LOCUS_03730 385983 385729 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868779.1 protein_id gnl|my_center|LOCUS_03730 386798 386115 gene locus_tag LOCUS_03740 386798 386115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 388538 386940 gene locus_tag LOCUS_03750 388538 386940 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224529.1 protein_id gnl|my_center|LOCUS_03750 388592 389506 gene locus_tag LOCUS_03760 388592 389506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225316.1 protein_id gnl|my_center|LOCUS_03760 389503 390612 gene locus_tag LOCUS_03770 gene menC 389503 390612 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225317.1 protein_id gnl|my_center|LOCUS_03770 390662 391594 gene locus_tag LOCUS_03780 390662 391594 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973710.1 protein_id gnl|my_center|LOCUS_03780 391599 392573 gene locus_tag LOCUS_03790 391599 392573 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230915.1 protein_id gnl|my_center|LOCUS_03790 392570 393370 gene locus_tag LOCUS_03800 392570 393370 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973712.1 protein_id gnl|my_center|LOCUS_03800 394227 393394 gene locus_tag LOCUS_03810 394227 393394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 394817 394203 gene locus_tag LOCUS_03820 394817 394203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 394943 395410 gene locus_tag LOCUS_03830 gene rraA 394943 395410 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731282.1 protein_id gnl|my_center|LOCUS_03830 396041 395481 gene locus_tag LOCUS_03840 396041 395481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 396223 397032 gene locus_tag LOCUS_03850 396223 397032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 397133 397951 gene locus_tag LOCUS_03860 397133 397951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 398542 398000 gene locus_tag LOCUS_03870 398542 398000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 398682 399356 gene locus_tag LOCUS_03880 398682 399356 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225438.1 protein_id gnl|my_center|LOCUS_03880 399356 400729 gene locus_tag LOCUS_03890 399356 400729 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225439.1 protein_id gnl|my_center|LOCUS_03890 401667 400879 gene locus_tag LOCUS_03900 401667 400879 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804305.1 protein_id gnl|my_center|LOCUS_03900 401785 403275 gene locus_tag LOCUS_03910 401785 403275 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226378.1 protein_id gnl|my_center|LOCUS_03910 403773 403279 gene locus_tag LOCUS_03920 403773 403279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 405343 404057 gene locus_tag LOCUS_03930 405343 404057 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111336.1 protein_id gnl|my_center|LOCUS_03930 405516 407354 gene locus_tag LOCUS_03940 405516 407354 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975023.1 protein_id gnl|my_center|LOCUS_03940 407529 408191 gene locus_tag LOCUS_03950 407529 408191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 409422 408253 gene locus_tag LOCUS_03960 409422 408253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 411077 409611 gene locus_tag LOCUS_03970 gene cycA 411077 409611 CDS product D-serine/D-alanine/glycine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729183.1 protein_id gnl|my_center|LOCUS_03970 412358 411222 gene locus_tag LOCUS_03980 gene ald 412358 411222 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229678.1 protein_id gnl|my_center|LOCUS_03980 412653 413861 gene locus_tag LOCUS_03990 412653 413861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 415053 413884 gene locus_tag LOCUS_04000 gene alr 415053 413884 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029835.1 protein_id gnl|my_center|LOCUS_04000 417607 415124 gene locus_tag LOCUS_04010 417607 415124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 418668 417691 gene locus_tag LOCUS_04020 418668 417691 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975111.1 protein_id gnl|my_center|LOCUS_04020 418861 420528 gene locus_tag LOCUS_04030 418861 420528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 421115 420570 gene locus_tag LOCUS_04040 421115 420570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 422155 421142 gene locus_tag LOCUS_04050 422155 421142 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227165.1 protein_id gnl|my_center|LOCUS_04050 422306 423841 gene locus_tag LOCUS_04060 422306 423841 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142741014.1 protein_id gnl|my_center|LOCUS_04060 423875 425041 gene locus_tag LOCUS_04070 423875 425041 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258369.1 protein_id gnl|my_center|LOCUS_04070 426192 425149 gene locus_tag LOCUS_04080 426192 425149 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528461.1 protein_id gnl|my_center|LOCUS_04080 426877 426239 gene locus_tag LOCUS_04090 426877 426239 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003595940.1 protein_id gnl|my_center|LOCUS_04090 427981 426956 gene locus_tag LOCUS_04100 427981 426956 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031126.1 protein_id gnl|my_center|LOCUS_04100 429402 427978 gene locus_tag LOCUS_04110 429402 427978 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286145.1 protein_id gnl|my_center|LOCUS_04110 430279 429440 gene locus_tag LOCUS_04120 430279 429440 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227021.1 protein_id gnl|my_center|LOCUS_04120 431268 430276 gene locus_tag LOCUS_04130 431268 430276 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227020.1 protein_id gnl|my_center|LOCUS_04130 432760 431486 gene locus_tag LOCUS_04140 432760 431486 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227019.1 protein_id gnl|my_center|LOCUS_04140 434474 433071 gene locus_tag LOCUS_04150 434474 433071 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229411.1 protein_id gnl|my_center|LOCUS_04150 435357 436376 gene locus_tag LOCUS_04160 435357 436376 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085410.1 protein_id gnl|my_center|LOCUS_04160 436554 437606 gene locus_tag LOCUS_04170 436554 437606 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089174.1 protein_id gnl|my_center|LOCUS_04170 437661 438242 gene locus_tag LOCUS_04180 437661 438242 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808807.1 protein_id gnl|my_center|LOCUS_04180 438239 439519 gene locus_tag LOCUS_04190 gene dctM 438239 439519 CDS product C4-dicarboxylate TRAP transporter large permease protein DctM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085927.1 protein_id gnl|my_center|LOCUS_04190 440251 439550 gene locus_tag LOCUS_04200 440251 439550 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893583.1 protein_id gnl|my_center|LOCUS_04200 441442 440300 gene locus_tag LOCUS_04210 441442 440300 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038779.1 protein_id gnl|my_center|LOCUS_04210 442009 441446 gene locus_tag LOCUS_04220 gene ripB 442009 441446 CDS product (R)-specific enoyl-CoA hydratase RipB/Ich inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212069.1 protein_id gnl|my_center|LOCUS_04220 442176 443375 gene locus_tag LOCUS_04230 442176 443375 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089980.1 protein_id gnl|my_center|LOCUS_04230 443606 444445 gene locus_tag LOCUS_04240 443606 444445 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925778.1 protein_id gnl|my_center|LOCUS_04240 445146 444463 gene locus_tag LOCUS_04250 445146 444463 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228758.1 protein_id gnl|my_center|LOCUS_04250 445297 446487 gene locus_tag LOCUS_04260 445297 446487 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086838427.1 protein_id gnl|my_center|LOCUS_04260 446484 448151 gene locus_tag LOCUS_04270 446484 448151 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327174.1 protein_id gnl|my_center|LOCUS_04270 448148 449566 gene locus_tag LOCUS_04280 448148 449566 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083638.1 protein_id gnl|my_center|LOCUS_04280 449570 450754 gene locus_tag LOCUS_04290 449570 450754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 450790 451737 gene locus_tag LOCUS_04300 450790 451737 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210056.1 protein_id gnl|my_center|LOCUS_04300 451730 452146 gene locus_tag LOCUS_04310 451730 452146 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193492227.1 protein_id gnl|my_center|LOCUS_04310 452205 453296 gene locus_tag LOCUS_04320 452205 453296 CDS product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229618.1 protein_id gnl|my_center|LOCUS_04320 453293 454474 gene locus_tag LOCUS_04330 gene tarD 453293 454474 CDS product D(-)-tartrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089469.1 protein_id gnl|my_center|LOCUS_04330 456137 454710 gene locus_tag LOCUS_04340 456137 454710 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229411.1 protein_id gnl|my_center|LOCUS_04340 456988 456260 gene locus_tag LOCUS_04350 456988 456260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 457734 457120 gene locus_tag LOCUS_04360 457734 457120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 458067 457792 gene locus_tag LOCUS_04370 458067 457792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 458440 459459 gene locus_tag LOCUS_04380 458440 459459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 460305 459484 gene locus_tag LOCUS_04390 460305 459484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 461411 461076 gene locus_tag LOCUS_04400 461411 461076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 461775 461554 gene locus_tag LOCUS_04410 461775 461554 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230952.1 protein_id gnl|my_center|LOCUS_04410 461876 462646 gene locus_tag LOCUS_04420 gene map 461876 462646 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730281.1 protein_id gnl|my_center|LOCUS_04420 463154 462900 gene locus_tag LOCUS_04430 gene yoeB 463154 462900 CDS product type II toxin-antitoxin system mRNA interferase toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767829.1 protein_id gnl|my_center|LOCUS_04430 463396 463151 gene locus_tag LOCUS_04440 463396 463151 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976578.1 protein_id gnl|my_center|LOCUS_04440 463867 463439 gene locus_tag LOCUS_04450 463867 463439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 463796 464083 gene locus_tag LOCUS_04460 463796 464083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 464177 464446 gene locus_tag LOCUS_04470 464177 464446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 464446 464748 gene locus_tag LOCUS_04480 464446 464748 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414602.1 protein_id gnl|my_center|LOCUS_04480 465065 465859 gene locus_tag LOCUS_04490 465065 465859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 466164 466553 gene locus_tag LOCUS_04500 466164 466553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112674.1 protein_id gnl|my_center|LOCUS_04500 466562 467275 gene locus_tag LOCUS_04510 466562 467275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 467642 467340 gene locus_tag LOCUS_04520 467642 467340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247553.1 protein_id gnl|my_center|LOCUS_04520 468127 467639 gene locus_tag LOCUS_04530 468127 467639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 468216 468677 gene locus_tag LOCUS_04540 468216 468677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 468719 470998 gene locus_tag LOCUS_04550 468719 470998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 471211 471588 gene locus_tag LOCUS_04560 471211 471588 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854931.1 protein_id gnl|my_center|LOCUS_04560 471585 474431 gene locus_tag LOCUS_04570 471585 474431 CDS product DUF3427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014158.1 protein_id gnl|my_center|LOCUS_04570 474547 475941 gene locus_tag LOCUS_04580 474547 475941 CDS product IS1380-like element ISCgl4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015202.1 protein_id gnl|my_center|LOCUS_04580 476543 476235 gene locus_tag LOCUS_04590 476543 476235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 476451 477509 gene locus_tag LOCUS_04600 476451 477509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 477790 479967 gene locus_tag LOCUS_04610 477790 479967 CDS product elongation factor G-like protein EF-G2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227139.1 protein_id gnl|my_center|LOCUS_04610 479983 480573 gene locus_tag LOCUS_04620 479983 480573 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532259.1 protein_id gnl|my_center|LOCUS_04620 480827 480612 gene locus_tag LOCUS_04630 480827 480612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 481182 480916 gene locus_tag LOCUS_04640 481182 480916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 481447 482532 gene locus_tag LOCUS_04650 481447 482532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 482910 484259 gene locus_tag LOCUS_04660 482910 484259 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229411.1 protein_id gnl|my_center|LOCUS_04660 485378 484311 gene locus_tag LOCUS_04670 485378 484311 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730979.1 protein_id gnl|my_center|LOCUS_04670 486501 485764 gene locus_tag LOCUS_04680 486501 485764 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227372.1 protein_id gnl|my_center|LOCUS_04680 486672 487490 gene locus_tag LOCUS_04690 486672 487490 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568207.1 protein_id gnl|my_center|LOCUS_04690 487492 488346 gene locus_tag LOCUS_04700 487492 488346 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089227.1 protein_id gnl|my_center|LOCUS_04700 488378 489421 gene locus_tag LOCUS_04710 488378 489421 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808730.1 protein_id gnl|my_center|LOCUS_04710 489568 490803 gene locus_tag LOCUS_04720 489568 490803 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728095.1 protein_id gnl|my_center|LOCUS_04720 490803 491726 gene locus_tag LOCUS_04730 490803 491726 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728096.1 protein_id gnl|my_center|LOCUS_04730 492428 491772 gene locus_tag LOCUS_04740 492428 491772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 493270 492458 gene locus_tag LOCUS_04750 493270 492458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 493449 493859 gene locus_tag LOCUS_04760 493449 493859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 494290 493916 gene locus_tag LOCUS_04770 494290 493916 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029761.1 protein_id gnl|my_center|LOCUS_04770 494369 494554 gene locus_tag LOCUS_04780 494369 494554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 494603 495100 gene locus_tag LOCUS_04790 494603 495100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04790 495117 495359 gene locus_tag LOCUS_04800 495117 495359 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529138.1 protein_id gnl|my_center|LOCUS_04800 495352 495777 gene locus_tag LOCUS_04810 495352 495777 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972683.1 protein_id gnl|my_center|LOCUS_04810 496398 495904 gene locus_tag LOCUS_04820 496398 495904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 496692 498143 gene locus_tag LOCUS_04830 496692 498143 CDS product DUF3375 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039229.1 protein_id gnl|my_center|LOCUS_04830 498140 498898 gene locus_tag LOCUS_04840 498140 498898 CDS product DUF4194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039228.1 protein_id gnl|my_center|LOCUS_04840 498895 502281 gene locus_tag LOCUS_04850 498895 502281 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039227.1 protein_id gnl|my_center|LOCUS_04850 502281 503525 gene locus_tag LOCUS_04860 502281 503525 CDS product DUF2220 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015393.1 protein_id gnl|my_center|LOCUS_04860 503803 504636 gene locus_tag LOCUS_04870 503803 504636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 504822 505952 gene locus_tag LOCUS_04880 504822 505952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 506665 505970 gene locus_tag LOCUS_04890 506665 505970 CDS product cold shock and DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091021504.1 protein_id gnl|my_center|LOCUS_04890 506937 511781 gene locus_tag LOCUS_04900 506937 511781 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028707.1 protein_id gnl|my_center|LOCUS_04900 512015 512836 gene locus_tag LOCUS_04910 512015 512836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 513684 512833 gene locus_tag LOCUS_04920 513684 512833 CDS product DUF429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057978.1 protein_id gnl|my_center|LOCUS_04920 514604 513834 gene locus_tag LOCUS_04930 514604 513834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04930 515157 515573 gene locus_tag LOCUS_04940 515157 515573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 515772 517532 gene locus_tag LOCUS_04950 515772 517532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 518182 517556 gene locus_tag LOCUS_04960 518182 517556 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229801.1 protein_id gnl|my_center|LOCUS_04960 519276 518182 gene locus_tag LOCUS_04970 519276 518182 CDS product S-(hydroxymethyl)mycothiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729747.1 protein_id gnl|my_center|LOCUS_04970 519697 519416 gene locus_tag LOCUS_04980 519697 519416 CDS product mycoredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053276.1 protein_id gnl|my_center|LOCUS_04980 520747 519752 gene locus_tag LOCUS_04990 520747 519752 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978446.1 protein_id gnl|my_center|LOCUS_04990 520870 521559 gene locus_tag LOCUS_05000 520870 521559 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179719124.1 protein_id gnl|my_center|LOCUS_05000 521660 523450 gene locus_tag LOCUS_05010 521660 523450 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811125.1 protein_id gnl|my_center|LOCUS_05010 524363 523593 gene locus_tag LOCUS_05020 524363 523593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05020 526506 524356 gene locus_tag LOCUS_05030 526506 524356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05030 528308 526518 gene locus_tag LOCUS_05040 gene gcl 528308 526518 CDS product glyoxylate carboligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730561.1 protein_id gnl|my_center|LOCUS_05040 529254 528376 gene locus_tag LOCUS_05050 529254 528376 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804444.1 protein_id gnl|my_center|LOCUS_05050 530060 529251 gene locus_tag LOCUS_05060 530060 529251 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804445.1 protein_id gnl|my_center|LOCUS_05060 531988 530360 gene locus_tag LOCUS_05070 gene aceB 531988 530360 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804448.1 protein_id gnl|my_center|LOCUS_05070 532091 532861 gene locus_tag LOCUS_05080 gene allR 532091 532861 CDS product allantoin degradation transcriptional regulator AllR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972681.1 protein_id gnl|my_center|LOCUS_05080 533147 535567 gene locus_tag LOCUS_05090 gene ppsA 533147 535567 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838605.1 protein_id gnl|my_center|LOCUS_05090 535959 535579 gene locus_tag LOCUS_05100 535959 535579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 536668 536024 gene locus_tag LOCUS_05110 536668 536024 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086030.1 protein_id gnl|my_center|LOCUS_05110 537645 536671 gene locus_tag LOCUS_05120 537645 536671 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086031.1 protein_id gnl|my_center|LOCUS_05120 539535 537826 gene locus_tag LOCUS_05130 539535 537826 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228668.1 protein_id gnl|my_center|LOCUS_05130 539933 539673 gene locus_tag LOCUS_05140 539933 539673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 540829 540026 gene locus_tag LOCUS_05150 gene heR 540829 540026 CDS product heliorhodopsin HeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013296133.1 protein_id gnl|my_center|LOCUS_05150 541511 540912 gene locus_tag LOCUS_05160 541511 540912 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067204.1 protein_id gnl|my_center|LOCUS_05160 541649 543052 gene locus_tag LOCUS_05170 541649 543052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 543074 543805 gene locus_tag LOCUS_05180 543074 543805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 545503 544070 gene locus_tag LOCUS_05190 545503 544070 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229411.1 protein_id gnl|my_center|LOCUS_05190 545369 545287 gene locus_tag LOCUS_t00050 545369 545287 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 546213 545842 gene locus_tag LOCUS_05200 546213 545842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784803.1 protein_id gnl|my_center|LOCUS_05200 546430 546224 gene locus_tag LOCUS_05210 546430 546224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 546485 547147 gene locus_tag LOCUS_05220 546485 547147 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804666.1 protein_id gnl|my_center|LOCUS_05220 547254 548138 gene locus_tag LOCUS_05230 547254 548138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 548816 548271 gene locus_tag LOCUS_05240 548816 548271 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480299.1 protein_id gnl|my_center|LOCUS_05240 548903 549367 gene locus_tag LOCUS_05250 548903 549367 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082637.1 protein_id gnl|my_center|LOCUS_05250 549837 549451 gene locus_tag LOCUS_05260 549837 549451 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704453.1 protein_id gnl|my_center|LOCUS_05260 549895 550920 gene locus_tag LOCUS_05270 gene mgrA 549895 550920 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224864.1 protein_id gnl|my_center|LOCUS_05270 554066 551040 gene locus_tag LOCUS_05280 554066 551040 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168152430.1 protein_id gnl|my_center|LOCUS_05280 554197 555399 gene locus_tag LOCUS_05290 554197 555399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 555455 555640 gene locus_tag LOCUS_05300 555455 555640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05300 556360 555689 gene locus_tag LOCUS_05310 556360 555689 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227392.1 protein_id gnl|my_center|LOCUS_05310 557111 556443 gene locus_tag LOCUS_05320 557111 556443 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227393.1 protein_id gnl|my_center|LOCUS_05320 559353 557203 gene locus_tag LOCUS_05330 559353 557203 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730837.1 protein_id gnl|my_center|LOCUS_05330 560431 559736 gene locus_tag LOCUS_05340 560431 559736 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030490.1 protein_id gnl|my_center|LOCUS_05340 562127 560412 gene locus_tag LOCUS_05350 562127 560412 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014807.1 protein_id gnl|my_center|LOCUS_05350 563970 562111 gene locus_tag LOCUS_05360 563970 562111 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485497.1 protein_id gnl|my_center|LOCUS_05360 564862 563975 gene locus_tag LOCUS_05370 564862 563975 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811978.1 protein_id gnl|my_center|LOCUS_05370 565815 564859 gene locus_tag LOCUS_05380 565815 564859 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385051.1 protein_id gnl|my_center|LOCUS_05380 567481 565823 gene locus_tag LOCUS_05390 567481 565823 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965798.1 protein_id gnl|my_center|LOCUS_05390 567647 568315 gene locus_tag LOCUS_05400 567647 568315 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222233.1 protein_id gnl|my_center|LOCUS_05400 568325 568768 gene locus_tag LOCUS_05410 568325 568768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 571030 568781 gene locus_tag LOCUS_05420 571030 568781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 571608 571201 gene locus_tag LOCUS_05430 571608 571201 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226972.1 protein_id gnl|my_center|LOCUS_05430 571711 572505 gene locus_tag LOCUS_05440 571711 572505 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804094.1 protein_id gnl|my_center|LOCUS_05440 572502 573122 gene locus_tag LOCUS_05450 572502 573122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05450 573110 574141 gene locus_tag LOCUS_05460 573110 574141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05460 575031 574138 gene locus_tag LOCUS_05470 575031 574138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 575465 575034 gene locus_tag LOCUS_05480 575465 575034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 575500 578979 gene locus_tag LOCUS_05490 575500 578979 CDS product TM0106 family RecB-like putative nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406332.1 protein_id gnl|my_center|LOCUS_05490 579598 578966 gene locus_tag LOCUS_05500 579598 578966 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054642.1 protein_id gnl|my_center|LOCUS_05500 579977 579699 gene locus_tag LOCUS_05510 579977 579699 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804336.1 protein_id gnl|my_center|LOCUS_05510 581724 580024 gene locus_tag LOCUS_05520 gene ptsP 581724 580024 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804335.1 protein_id gnl|my_center|LOCUS_05520 583800 581776 gene locus_tag LOCUS_05530 583800 581776 CDS product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726656.1 protein_id gnl|my_center|LOCUS_05530 584783 583797 gene locus_tag LOCUS_05540 584783 583797 CDS product hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891418.1 protein_id gnl|my_center|LOCUS_05540 585568 584780 gene locus_tag LOCUS_05550 585568 584780 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891419.1 protein_id gnl|my_center|LOCUS_05550 585737 586903 gene locus_tag LOCUS_05560 585737 586903 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977530.1 protein_id gnl|my_center|LOCUS_05560 586900 589836 gene locus_tag LOCUS_05570 586900 589836 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027705.1 protein_id gnl|my_center|LOCUS_05570 590635 590015 gene locus_tag LOCUS_05580 590635 590015 CDS product Pr6Pr family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650958.1 protein_id gnl|my_center|LOCUS_05580 591572 590772 gene locus_tag LOCUS_05590 gene tcyC 591572 590772 CDS product cystine ABC transporter ATP-binding protein TcyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246629.1 protein_id gnl|my_center|LOCUS_05590 592227 591559 gene locus_tag LOCUS_05600 592227 591559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05600 593049 592237 gene locus_tag LOCUS_05610 593049 592237 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027948.1 protein_id gnl|my_center|LOCUS_05610 592940 593161 gene locus_tag LOCUS_05620 592940 593161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 594648 593158 gene locus_tag LOCUS_05630 594648 593158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 594910 595977 gene locus_tag LOCUS_05640 594910 595977 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730979.1 protein_id gnl|my_center|LOCUS_05640 596613 595981 gene locus_tag LOCUS_05650 596613 595981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 596829 597572 gene locus_tag LOCUS_05660 596829 597572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 598254 597595 gene locus_tag LOCUS_05670 598254 597595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 598316 599602 gene locus_tag LOCUS_05680 598316 599602 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285177.1 protein_id gnl|my_center|LOCUS_05680 600509 599586 gene locus_tag LOCUS_05690 600509 599586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 600770 602239 gene locus_tag LOCUS_05700 600770 602239 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133829731.1 protein_id gnl|my_center|LOCUS_05700 602346 603575 gene locus_tag LOCUS_05710 602346 603575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 603979 603593 gene locus_tag LOCUS_05720 603979 603593 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776272.1 protein_id gnl|my_center|LOCUS_05720 604919 604158 gene locus_tag LOCUS_05730 604919 604158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 605107 606543 gene locus_tag LOCUS_05740 605107 606543 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085590.1 protein_id gnl|my_center|LOCUS_05740 606587 608752 gene locus_tag LOCUS_05750 606587 608752 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223026.1 protein_id gnl|my_center|LOCUS_05750 608745 610400 gene locus_tag LOCUS_05760 608745 610400 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223027.1 protein_id gnl|my_center|LOCUS_05760 611002 610775 gene locus_tag LOCUS_05770 611002 610775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 611083 611331 gene locus_tag LOCUS_05780 611083 611331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 611461 611264 gene locus_tag LOCUS_05790 611461 611264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 611713 611973 gene locus_tag LOCUS_05800 611713 611973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05800 611983 612213 gene locus_tag LOCUS_05810 611983 612213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 613169 612210 gene locus_tag LOCUS_05820 613169 612210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 613214 613753 gene locus_tag LOCUS_05830 613214 613753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 614202 613816 gene locus_tag LOCUS_05840 614202 613816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 615570 614743 gene locus_tag LOCUS_05850 615570 614743 CDS product putative protein N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226080.1 protein_id gnl|my_center|LOCUS_05850 617186 615615 gene locus_tag LOCUS_05860 617186 615615 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112402.1 protein_id gnl|my_center|LOCUS_05860 617429 619969 gene locus_tag LOCUS_05870 617429 619969 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222778.1 protein_id gnl|my_center|LOCUS_05870 621081 620059 gene locus_tag LOCUS_05880 621081 620059 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976006.1 protein_id gnl|my_center|LOCUS_05880 621209 623278 gene locus_tag LOCUS_05890 621209 623278 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031640.1 protein_id gnl|my_center|LOCUS_05890 623275 624216 gene locus_tag LOCUS_05900 623275 624216 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225935.1 protein_id gnl|my_center|LOCUS_05900 624213 625121 gene locus_tag LOCUS_05910 624213 625121 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225934.1 protein_id gnl|my_center|LOCUS_05910 625213 626538 gene locus_tag LOCUS_05920 625213 626538 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225936.1 protein_id gnl|my_center|LOCUS_05920 626642 628744 gene locus_tag LOCUS_05930 626642 628744 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185048585.1 protein_id gnl|my_center|LOCUS_05930 628884 629921 gene locus_tag LOCUS_05940 628884 629921 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975953.1 protein_id gnl|my_center|LOCUS_05940 630524 630027 gene locus_tag LOCUS_05950 630524 630027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 632012 630636 gene locus_tag LOCUS_05960 632012 630636 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037978.1 protein_id gnl|my_center|LOCUS_05960 632706 632119 gene locus_tag LOCUS_05970 632706 632119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 634396 633002 gene locus_tag LOCUS_05980 634396 633002 CDS product IS1380-like element ISCgl4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015202.1 protein_id gnl|my_center|LOCUS_05980 636923 634518 gene locus_tag LOCUS_05990 636923 634518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 637963 636923 gene locus_tag LOCUS_06000 637963 636923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227468.1 protein_id gnl|my_center|LOCUS_06000 639208 638036 gene locus_tag LOCUS_06010 639208 638036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 639921 639340 gene locus_tag LOCUS_06020 639921 639340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 640644 640063 gene locus_tag LOCUS_06030 640644 640063 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891579.1 protein_id gnl|my_center|LOCUS_06030 641936 640641 gene locus_tag LOCUS_06040 641936 640641 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726769.1 protein_id gnl|my_center|LOCUS_06040 642110 642433 gene locus_tag LOCUS_06050 642110 642433 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152231551.1 protein_id gnl|my_center|LOCUS_06050 643427 642447 gene locus_tag LOCUS_06060 643427 642447 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929959.1 protein_id gnl|my_center|LOCUS_06060 644622 643522 gene locus_tag LOCUS_06070 644622 643522 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804775.1 protein_id gnl|my_center|LOCUS_06070 646315 644780 gene locus_tag LOCUS_06080 646315 644780 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930192.1 protein_id gnl|my_center|LOCUS_06080 646374 647237 gene locus_tag LOCUS_06090 gene rsmI 646374 647237 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110588590.1 protein_id gnl|my_center|LOCUS_06090 647334 648320 gene locus_tag LOCUS_06100 647334 648320 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228428.1 protein_id gnl|my_center|LOCUS_06100 648387 649949 gene locus_tag LOCUS_06110 gene metG 648387 649949 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975149.1 protein_id gnl|my_center|LOCUS_06110 649942 650889 gene locus_tag LOCUS_06120 649942 650889 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028796.1 protein_id gnl|my_center|LOCUS_06120 650886 651764 gene locus_tag LOCUS_06130 gene rsmA 650886 651764 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229977.1 protein_id gnl|my_center|LOCUS_06130 651879 652445 gene locus_tag LOCUS_06140 651879 652445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 652455 653390 gene locus_tag LOCUS_06150 652455 653390 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405199.1 protein_id gnl|my_center|LOCUS_06150 653449 655242 gene locus_tag LOCUS_06160 653449 655242 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729311.1 protein_id gnl|my_center|LOCUS_06160 655456 656346 gene locus_tag LOCUS_06170 655456 656346 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068221.1 protein_id gnl|my_center|LOCUS_06170 656401 657429 gene locus_tag LOCUS_06180 656401 657429 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082323.1 protein_id gnl|my_center|LOCUS_06180 657432 658091 gene locus_tag LOCUS_06190 657432 658091 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057738.1 protein_id gnl|my_center|LOCUS_06190 658178 660466 gene locus_tag LOCUS_06200 658178 660466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 660482 662773 gene locus_tag LOCUS_06210 660482 662773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 663485 663180 gene locus_tag LOCUS_06220 663485 663180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 664728 663922 gene locus_tag LOCUS_06230 664728 663922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 664802 665155 gene locus_tag LOCUS_06240 gene arr 664802 665155 CDS product NAD(+)--rifampin ADP-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727512.1 protein_id gnl|my_center|LOCUS_06240 665974 665183 gene locus_tag LOCUS_06250 665974 665183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 666065 667342 gene locus_tag LOCUS_06260 666065 667342 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804430.1 protein_id gnl|my_center|LOCUS_06260 668069 667413 gene locus_tag LOCUS_06270 668069 667413 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259269.1 protein_id gnl|my_center|LOCUS_06270 669380 668115 gene locus_tag LOCUS_06280 669380 668115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 670546 669377 gene locus_tag LOCUS_06290 670546 669377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 671839 670637 gene locus_tag LOCUS_06300 671839 670637 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229667.1 protein_id gnl|my_center|LOCUS_06300 673277 671946 gene locus_tag LOCUS_06310 673277 671946 CDS product bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229668.1 protein_id gnl|my_center|LOCUS_06310 674510 673410 gene locus_tag LOCUS_06320 674510 673410 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245573.1 protein_id gnl|my_center|LOCUS_06320 674561 675316 gene locus_tag LOCUS_06330 674561 675316 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804604.1 protein_id gnl|my_center|LOCUS_06330 677044 675416 gene locus_tag LOCUS_06340 677044 675416 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223483.1 protein_id gnl|my_center|LOCUS_06340 677388 677041 gene locus_tag LOCUS_06350 677388 677041 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049745379.1 protein_id gnl|my_center|LOCUS_06350 679467 677491 gene locus_tag LOCUS_06360 679467 677491 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229993.1 protein_id gnl|my_center|LOCUS_06360 679555 680268 gene locus_tag LOCUS_06370 679555 680268 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804820.1 protein_id gnl|my_center|LOCUS_06370 680283 681818 gene locus_tag LOCUS_06380 680283 681818 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804819.1 protein_id gnl|my_center|LOCUS_06380 681818 682735 gene locus_tag LOCUS_06390 gene prpB 681818 682735 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804818.1 protein_id gnl|my_center|LOCUS_06390 682745 683923 gene locus_tag LOCUS_06400 682745 683923 CDS product bifunctional 2-methylcitrate synthase/citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804817.1 protein_id gnl|my_center|LOCUS_06400 684037 684756 gene locus_tag LOCUS_06410 684037 684756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 685232 685141 gene locus_tag LOCUS_t00060 685232 685141 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 685453 686031 gene locus_tag LOCUS_06420 685453 686031 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104495.1 protein_id gnl|my_center|LOCUS_06420 686872 686069 gene locus_tag LOCUS_06430 686872 686069 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207902.1 protein_id gnl|my_center|LOCUS_06430 686907 688346 gene locus_tag LOCUS_06440 686907 688346 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226072.1 protein_id gnl|my_center|LOCUS_06440 689764 688535 gene locus_tag LOCUS_06450 689764 688535 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144955419.1 protein_id gnl|my_center|LOCUS_06450 689955 691424 gene locus_tag LOCUS_06460 gene putP 689955 691424 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730456.1 protein_id gnl|my_center|LOCUS_06460 693570 691504 gene locus_tag LOCUS_06470 693570 691504 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876865.1 protein_id gnl|my_center|LOCUS_06470 693748 694164 gene locus_tag LOCUS_06480 693748 694164 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058377.1 protein_id gnl|my_center|LOCUS_06480 694230 695705 gene locus_tag LOCUS_06490 694230 695705 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083610.1 protein_id gnl|my_center|LOCUS_06490 696140 695775 gene locus_tag LOCUS_06500 696140 695775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 697645 696140 gene locus_tag LOCUS_06510 697645 696140 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027415.1 protein_id gnl|my_center|LOCUS_06510 698484 697690 gene locus_tag LOCUS_06520 698484 697690 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729009.1 protein_id gnl|my_center|LOCUS_06520 699260 698481 gene locus_tag LOCUS_06530 699260 698481 CDS product arginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223656.1 protein_id gnl|my_center|LOCUS_06530 700015 699368 gene locus_tag LOCUS_06540 700015 699368 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388219.1 protein_id gnl|my_center|LOCUS_06540 700785 700054 gene locus_tag LOCUS_06550 700785 700054 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811261.1 protein_id gnl|my_center|LOCUS_06550 700917 701798 gene locus_tag LOCUS_06560 700917 701798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 703057 701828 gene locus_tag LOCUS_06570 703057 701828 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094666698.1 protein_id gnl|my_center|LOCUS_06570 704650 703145 gene locus_tag LOCUS_06580 704650 703145 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189099273.1 protein_id gnl|my_center|LOCUS_06580 705078 704647 gene locus_tag LOCUS_06590 705078 704647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 708517 705197 gene locus_tag LOCUS_06600 708517 705197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 709311 708559 gene locus_tag LOCUS_06610 709311 708559 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804799.1 protein_id gnl|my_center|LOCUS_06610 710540 709308 gene locus_tag LOCUS_06620 710540 709308 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804800.1 protein_id gnl|my_center|LOCUS_06620 710742 711728 gene locus_tag LOCUS_06630 710742 711728 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224183.1 protein_id gnl|my_center|LOCUS_06630 711709 711885 gene locus_tag LOCUS_06640 711709 711885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 712033 712575 gene locus_tag LOCUS_06650 gene rimJ 712033 712575 CDS product ribosomal protein S5-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704794.1 protein_id gnl|my_center|LOCUS_06650 712614 713141 gene locus_tag LOCUS_06660 712614 713141 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035476.1 protein_id gnl|my_center|LOCUS_06660 713143 714171 gene locus_tag LOCUS_06670 713143 714171 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289537.1 protein_id gnl|my_center|LOCUS_06670 714823 714383 gene locus_tag LOCUS_06680 714823 714383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 714920 715528 gene locus_tag LOCUS_06690 714920 715528 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975821.1 protein_id gnl|my_center|LOCUS_06690 715644 717071 gene locus_tag LOCUS_06700 715644 717071 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229411.1 protein_id gnl|my_center|LOCUS_06700 717786 717118 gene locus_tag LOCUS_06710 717786 717118 CDS product DUF4166 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227829.1 protein_id gnl|my_center|LOCUS_06710 718388 717783 gene locus_tag LOCUS_06720 718388 717783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227828.1 protein_id gnl|my_center|LOCUS_06720 718957 718517 gene locus_tag LOCUS_06730 718957 718517 CDS product OsmC family peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224811.1 protein_id gnl|my_center|LOCUS_06730 719465 719019 gene locus_tag LOCUS_06740 719465 719019 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222264.1 protein_id gnl|my_center|LOCUS_06740 721362 719509 gene locus_tag LOCUS_06750 721362 719509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 722017 721661 gene locus_tag LOCUS_06760 722017 721661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 722386 722042 gene locus_tag LOCUS_06770 722386 722042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 722726 722403 gene locus_tag LOCUS_06780 722726 722403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 722872 723306 gene locus_tag LOCUS_06790 722872 723306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085100849.1 protein_id gnl|my_center|LOCUS_06790 723411 724313 gene locus_tag LOCUS_06800 723411 724313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06800 724633 726024 gene locus_tag LOCUS_06810 724633 726024 CDS product IS1380-like element ISCgl4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015202.1 protein_id gnl|my_center|LOCUS_06810 726414 726665 gene locus_tag LOCUS_06820 gene yefM 726414 726665 CDS product YoeB-YefM toxin-antitoxin system antitoxin YefM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259255.1 protein_id gnl|my_center|LOCUS_06820 726662 726922 gene locus_tag LOCUS_06830 gene yoeB 726662 726922 CDS product type II toxin-antitoxin system mRNA interferase toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767829.1 protein_id gnl|my_center|LOCUS_06830 727462 726989 gene locus_tag LOCUS_06840 gene soxR 727462 726989 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089301.1 protein_id gnl|my_center|LOCUS_06840 727525 728214 gene locus_tag LOCUS_06850 727525 728214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005130168.1 protein_id gnl|my_center|LOCUS_06850 728942 728493 gene locus_tag LOCUS_06860 728942 728493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 729354 728935 gene locus_tag LOCUS_06870 729354 728935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 729794 730102 gene locus_tag LOCUS_06880 729794 730102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 730457 730861 gene locus_tag LOCUS_06890 730457 730861 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113894.1 protein_id gnl|my_center|LOCUS_06890 731187 731453 gene locus_tag LOCUS_06900 731187 731453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06900 731657 731995 gene locus_tag LOCUS_06910 731657 731995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 732251 732526 gene locus_tag LOCUS_06920 732251 732526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 732523 732786 gene locus_tag LOCUS_06930 732523 732786 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971059.1 protein_id gnl|my_center|LOCUS_06930 733206 732820 gene locus_tag LOCUS_06940 733206 732820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 733750 734142 gene locus_tag LOCUS_06950 733750 734142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085100849.1 protein_id gnl|my_center|LOCUS_06950 734142 735149 gene locus_tag LOCUS_06960 734142 735149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06960 735274 735516 gene locus_tag LOCUS_06970 735274 735516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 736054 735692 gene locus_tag LOCUS_06980 736054 735692 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730360.1 protein_id gnl|my_center|LOCUS_06980 737088 736051 gene locus_tag LOCUS_06990 737088 736051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 737421 737164 gene locus_tag LOCUS_07000 737421 737164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 738851 737457 gene locus_tag LOCUS_07010 738851 737457 CDS product IS1380-like element ISCgl4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015202.1 protein_id gnl|my_center|LOCUS_07010 739052 739372 gene locus_tag LOCUS_07020 739052 739372 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405871.1 protein_id gnl|my_center|LOCUS_07020 739466 740104 gene locus_tag LOCUS_07030 739466 740104 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805114.1 protein_id gnl|my_center|LOCUS_07030 740569 740240 gene locus_tag LOCUS_07040 740569 740240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 741660 740692 gene locus_tag LOCUS_07050 741660 740692 CDS product IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058916821.1 protein_id gnl|my_center|LOCUS_07050 741930 741763 gene locus_tag LOCUS_07060 741930 741763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 743116 742019 gene locus_tag LOCUS_07070 743116 742019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156232331.1 protein_id gnl|my_center|LOCUS_07070 743285 743689 gene locus_tag LOCUS_07080 743285 743689 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113894.1 protein_id gnl|my_center|LOCUS_07080 743821 744282 gene locus_tag LOCUS_07090 743821 744282 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067248.1 protein_id gnl|my_center|LOCUS_07090 744603 744815 gene locus_tag LOCUS_07100 744603 744815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 744910 745095 gene locus_tag LOCUS_07110 744910 745095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07110 745150 746631 gene locus_tag LOCUS_07120 745150 746631 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228668.1 protein_id gnl|my_center|LOCUS_07120 748081 747131 gene locus_tag LOCUS_07130 748081 747131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 748440 748078 gene locus_tag LOCUS_07140 748440 748078 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724743.1 protein_id gnl|my_center|LOCUS_07140 750245 748851 gene locus_tag LOCUS_07150 750245 748851 CDS product IS1380-like element ISCgl4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015202.1 protein_id gnl|my_center|LOCUS_07150 750781 750425 gene locus_tag LOCUS_07160 750781 750425 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222929.1 protein_id gnl|my_center|LOCUS_07160 751701 750778 gene locus_tag LOCUS_07170 751701 750778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 752039 752590 gene locus_tag LOCUS_07180 752039 752590 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088057164.1 protein_id gnl|my_center|LOCUS_07180 753125 752691 gene locus_tag LOCUS_07190 753125 752691 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027865.1 protein_id gnl|my_center|LOCUS_07190 753284 753889 gene locus_tag LOCUS_07200 753284 753889 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854745.1 protein_id gnl|my_center|LOCUS_07200 754943 754158 gene locus_tag LOCUS_07210 754943 754158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 755622 755550 gene locus_tag LOCUS_t00070 755622 755550 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 756298 755660 gene locus_tag LOCUS_07220 756298 755660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 756341 758017 gene locus_tag LOCUS_07230 gene argS 756341 758017 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730214.1 protein_id gnl|my_center|LOCUS_07230 758020 758772 gene locus_tag LOCUS_07240 758020 758772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 758956 760395 gene locus_tag LOCUS_07250 gene lysA 758956 760395 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030202.1 protein_id gnl|my_center|LOCUS_07250 760392 761726 gene locus_tag LOCUS_07260 760392 761726 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229542.1 protein_id gnl|my_center|LOCUS_07260 761726 762856 gene locus_tag LOCUS_07270 gene thrC 761726 762856 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973642.1 protein_id gnl|my_center|LOCUS_07270 762853 763803 gene locus_tag LOCUS_07280 gene thrB 762853 763803 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030204.1 protein_id gnl|my_center|LOCUS_07280 764123 766456 gene locus_tag LOCUS_07290 764123 766456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 766456 767535 gene locus_tag LOCUS_07300 gene prfA 766456 767535 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973637.1 protein_id gnl|my_center|LOCUS_07300 767688 768614 gene locus_tag LOCUS_07310 767688 768614 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268501.1 protein_id gnl|my_center|LOCUS_07310 768709 769020 gene locus_tag LOCUS_07320 768709 769020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 769044 769478 gene locus_tag LOCUS_07330 769044 769478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085100849.1 protein_id gnl|my_center|LOCUS_07330 769583 770485 gene locus_tag LOCUS_07340 769583 770485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07340 770530 770799 gene locus_tag LOCUS_07350 770530 770799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 771443 770853 gene locus_tag LOCUS_07360 gene cysE 771443 770853 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006286028.1 protein_id gnl|my_center|LOCUS_07360 772426 771488 gene locus_tag LOCUS_07370 gene cysK 772426 771488 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066567803.1 protein_id gnl|my_center|LOCUS_07370 772511 773422 gene locus_tag LOCUS_07380 gene prmC 772511 773422 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973636.1 protein_id gnl|my_center|LOCUS_07380 773474 774238 gene locus_tag LOCUS_07390 773474 774238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 774242 775486 gene locus_tag LOCUS_07400 774242 775486 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775946.1 protein_id gnl|my_center|LOCUS_07400 775483 775980 gene locus_tag LOCUS_07410 775483 775980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 776219 776941 gene locus_tag LOCUS_07420 gene atpB 776219 776941 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854856.1 protein_id gnl|my_center|LOCUS_07420 776991 777224 gene locus_tag LOCUS_07430 gene atpE 776991 777224 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775943.1 protein_id gnl|my_center|LOCUS_07430 777255 777821 gene locus_tag LOCUS_07440 777255 777821 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014201.1 protein_id gnl|my_center|LOCUS_07440 777825 778622 gene locus_tag LOCUS_07450 777825 778622 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327277.1 protein_id gnl|my_center|LOCUS_07450 778706 780346 gene locus_tag LOCUS_07460 gene atpA 778706 780346 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051480.1 protein_id gnl|my_center|LOCUS_07460 780430 781332 gene locus_tag LOCUS_07470 780430 781332 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973625.1 protein_id gnl|my_center|LOCUS_07470 781350 782813 gene locus_tag LOCUS_07480 gene atpD 781350 782813 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004120484.1 protein_id gnl|my_center|LOCUS_07480 782816 783079 gene locus_tag LOCUS_07490 782816 783079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 783085 783864 gene locus_tag LOCUS_07500 gene yaaA 783085 783864 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223956.1 protein_id gnl|my_center|LOCUS_07500 783906 784898 gene locus_tag LOCUS_07510 783906 784898 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226477.1 protein_id gnl|my_center|LOCUS_07510 785515 784910 gene locus_tag LOCUS_07520 785515 784910 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222967.1 protein_id gnl|my_center|LOCUS_07520 786012 785512 gene locus_tag LOCUS_07530 786012 785512 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017896.1 protein_id gnl|my_center|LOCUS_07530 787255 786107 gene locus_tag LOCUS_07540 787255 786107 CDS product N(5)-(carboxyethyl)ornithine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225455.1 protein_id gnl|my_center|LOCUS_07540 787356 788321 gene locus_tag LOCUS_07550 787356 788321 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203754103.1 protein_id gnl|my_center|LOCUS_07550 788385 788996 gene locus_tag LOCUS_07560 788385 788996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 789005 790738 gene locus_tag LOCUS_07570 789005 790738 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014012.1 protein_id gnl|my_center|LOCUS_07570 790735 792699 gene locus_tag LOCUS_07580 790735 792699 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014011.1 protein_id gnl|my_center|LOCUS_07580 792810 794045 gene locus_tag LOCUS_07590 792810 794045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 794534 794046 gene locus_tag LOCUS_07600 794534 794046 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877152.1 protein_id gnl|my_center|LOCUS_07600 794634 795776 gene locus_tag LOCUS_07610 794634 795776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 795828 796661 gene locus_tag LOCUS_07620 795828 796661 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776167.1 protein_id gnl|my_center|LOCUS_07620 796782 798083 gene locus_tag LOCUS_07630 796782 798083 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144955419.1 protein_id gnl|my_center|LOCUS_07630 798225 799712 gene locus_tag LOCUS_07640 798225 799712 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776165.1 protein_id gnl|my_center|LOCUS_07640 799709 805645 gene locus_tag LOCUS_07650 799709 805645 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193495474.1 protein_id gnl|my_center|LOCUS_07650 805662 806651 gene locus_tag LOCUS_07660 805662 806651 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929980.1 protein_id gnl|my_center|LOCUS_07660 806704 807969 gene locus_tag LOCUS_07670 806704 807969 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776170.1 protein_id gnl|my_center|LOCUS_07670 807966 810335 gene locus_tag LOCUS_07680 807966 810335 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776169.1 protein_id gnl|my_center|LOCUS_07680 810332 810919 gene locus_tag LOCUS_07690 810332 810919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 811011 813938 gene locus_tag LOCUS_07700 811011 813938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 815055 813940 gene locus_tag LOCUS_07710 gene ald 815055 813940 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229678.1 protein_id gnl|my_center|LOCUS_07710 815143 816087 gene locus_tag LOCUS_07720 815143 816087 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027281.1 protein_id gnl|my_center|LOCUS_07720 817030 816038 gene locus_tag LOCUS_07730 817030 816038 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230730.1 protein_id gnl|my_center|LOCUS_07730 818480 817113 gene locus_tag LOCUS_07740 gene gabT 818480 817113 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892002.1 protein_id gnl|my_center|LOCUS_07740 818559 819044 gene locus_tag LOCUS_07750 818559 819044 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891973.1 protein_id gnl|my_center|LOCUS_07750 819838 819371 gene locus_tag LOCUS_07760 819838 819371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 821295 819946 gene locus_tag LOCUS_07770 gene gabT 821295 819946 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892002.1 protein_id gnl|my_center|LOCUS_07770 822120 821338 gene locus_tag LOCUS_07780 822120 821338 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222957.1 protein_id gnl|my_center|LOCUS_07780 822165 823244 gene locus_tag LOCUS_07790 gene dxr 822165 823244 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414613.1 protein_id gnl|my_center|LOCUS_07790 824167 823253 gene locus_tag LOCUS_07800 824167 823253 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225136.1 protein_id gnl|my_center|LOCUS_07800 824702 824229 gene locus_tag LOCUS_07810 824702 824229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 825892 824699 gene locus_tag LOCUS_07820 825892 824699 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225012.1 protein_id gnl|my_center|LOCUS_07820 826069 827442 gene locus_tag LOCUS_07830 826069 827442 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804643.1 protein_id gnl|my_center|LOCUS_07830 828910 827726 gene locus_tag LOCUS_07840 828910 827726 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030221.1 protein_id gnl|my_center|LOCUS_07840 829047 830207 gene locus_tag LOCUS_07850 gene ispG 829047 830207 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973330.1 protein_id gnl|my_center|LOCUS_07850 830255 832018 gene locus_tag LOCUS_07860 830255 832018 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804649.1 protein_id gnl|my_center|LOCUS_07860 832090 833100 gene locus_tag LOCUS_07870 gene nusA 832090 833100 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030401.1 protein_id gnl|my_center|LOCUS_07870 833524 836328 gene locus_tag LOCUS_07880 833524 836328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 836452 836919 gene locus_tag LOCUS_07890 gene rbfA 836452 836919 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804655.1 protein_id gnl|my_center|LOCUS_07890 837963 837010 gene locus_tag LOCUS_07900 837963 837010 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230424.1 protein_id gnl|my_center|LOCUS_07900 837987 838607 gene locus_tag LOCUS_07910 837987 838607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 840172 838781 gene locus_tag LOCUS_07920 840172 838781 CDS product IS1380-like element ISCgl4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015202.1 protein_id gnl|my_center|LOCUS_07920 841280 840294 gene locus_tag LOCUS_07930 841280 840294 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115945.1 protein_id gnl|my_center|LOCUS_07930 841358 842302 gene locus_tag LOCUS_07940 gene truB 841358 842302 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804656.1 protein_id gnl|my_center|LOCUS_07940 842299 842667 gene locus_tag LOCUS_07950 842299 842667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 842735 843178 gene locus_tag LOCUS_07960 842735 843178 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222283.1 protein_id gnl|my_center|LOCUS_07960 843175 844125 gene locus_tag LOCUS_07970 843175 844125 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014798.1 protein_id gnl|my_center|LOCUS_07970 844304 846766 gene locus_tag LOCUS_07980 844304 846766 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930028.1 protein_id gnl|my_center|LOCUS_07980 846822 847469 gene locus_tag LOCUS_07990 gene cprB 846822 847469 CDS product transcriptional regulator CprB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030630.1 protein_id gnl|my_center|LOCUS_07990 847495 848712 gene locus_tag LOCUS_08000 847495 848712 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086030.1 protein_id gnl|my_center|LOCUS_08000 849673 848726 gene locus_tag LOCUS_08010 849673 848726 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403330.1 protein_id gnl|my_center|LOCUS_08010 849803 850753 gene locus_tag LOCUS_08020 849803 850753 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894480.1 protein_id gnl|my_center|LOCUS_08020 850807 851820 gene locus_tag LOCUS_08030 gene deoC 850807 851820 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029945.1 protein_id gnl|my_center|LOCUS_08030 851831 853360 gene locus_tag LOCUS_08040 851831 853360 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029944.1 protein_id gnl|my_center|LOCUS_08040 853357 854220 gene locus_tag LOCUS_08050 853357 854220 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715428.1 protein_id gnl|my_center|LOCUS_08050 854744 854328 gene locus_tag LOCUS_08060 854744 854328 CDS product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897694.1 protein_id gnl|my_center|LOCUS_08060 854894 856387 gene locus_tag LOCUS_08070 854894 856387 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804095.1 protein_id gnl|my_center|LOCUS_08070 856453 857013 gene locus_tag LOCUS_08080 856453 857013 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836482.1 protein_id gnl|my_center|LOCUS_08080 857062 858942 gene locus_tag LOCUS_08090 857062 858942 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130155962.1 protein_id gnl|my_center|LOCUS_08090 858942 859277 gene locus_tag LOCUS_08100 858942 859277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 859456 861624 gene locus_tag LOCUS_08110 859456 861624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 861717 862745 gene locus_tag LOCUS_08120 861717 862745 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804723.1 protein_id gnl|my_center|LOCUS_08120 862795 863019 gene locus_tag LOCUS_08130 862795 863019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 864454 863054 gene locus_tag LOCUS_08140 864454 863054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 865266 864451 gene locus_tag LOCUS_08150 865266 864451 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091316930.1 protein_id gnl|my_center|LOCUS_08150 865663 865409 gene locus_tag LOCUS_08160 865663 865409 CDS product mycoredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973789.1 protein_id gnl|my_center|LOCUS_08160 865741 866214 gene locus_tag LOCUS_08170 865741 866214 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028247.1 protein_id gnl|my_center|LOCUS_08170 866207 867400 gene locus_tag LOCUS_08180 866207 867400 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223175.1 protein_id gnl|my_center|LOCUS_08180 867397 867744 gene locus_tag LOCUS_08190 867397 867744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 869139 867862 gene locus_tag LOCUS_08200 869139 867862 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804302.1 protein_id gnl|my_center|LOCUS_08200 869200 870771 gene locus_tag LOCUS_08210 869200 870771 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899145.1 protein_id gnl|my_center|LOCUS_08210 870978 872345 gene locus_tag LOCUS_08220 870978 872345 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891985.1 protein_id gnl|my_center|LOCUS_08220 873227 872361 gene locus_tag LOCUS_08230 873227 872361 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728461.1 protein_id gnl|my_center|LOCUS_08230 873639 873241 gene locus_tag LOCUS_08240 873639 873241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 874026 873811 gene locus_tag LOCUS_08250 874026 873811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08250 874983 874108 gene locus_tag LOCUS_08260 874983 874108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 876556 875051 gene locus_tag LOCUS_08270 876556 875051 CDS product Ada metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091823.1 protein_id gnl|my_center|LOCUS_08270 876731 878125 gene locus_tag LOCUS_08280 876731 878125 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975885.1 protein_id gnl|my_center|LOCUS_08280 878161 879318 gene locus_tag LOCUS_08290 878161 879318 CDS product PrsW family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804994.1 protein_id gnl|my_center|LOCUS_08290 879486 879857 gene locus_tag LOCUS_08300 879486 879857 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897079.1 protein_id gnl|my_center|LOCUS_08300 880099 879854 gene locus_tag LOCUS_08310 880099 879854 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895291.1 protein_id gnl|my_center|LOCUS_08310 880172 880582 gene locus_tag LOCUS_08320 880172 880582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 881019 880594 gene locus_tag LOCUS_08330 881019 880594 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082943.1 protein_id gnl|my_center|LOCUS_08330 881172 882920 gene locus_tag LOCUS_08340 881172 882920 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804291.1 protein_id gnl|my_center|LOCUS_08340 883179 882940 gene locus_tag LOCUS_08350 883179 882940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 883280 884167 gene locus_tag LOCUS_08360 883280 884167 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222172.1 protein_id gnl|my_center|LOCUS_08360 884268 885341 gene locus_tag LOCUS_08370 884268 885341 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950360.1 protein_id gnl|my_center|LOCUS_08370 886454 885399 gene locus_tag LOCUS_08380 886454 885399 CDS product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206671.1 protein_id gnl|my_center|LOCUS_08380 887003 887272 gene locus_tag LOCUS_08390 gene rpsO 887003 887272 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814361.1 protein_id gnl|my_center|LOCUS_08390 887475 888995 gene locus_tag LOCUS_08400 887475 888995 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053015.1 protein_id gnl|my_center|LOCUS_08400 889167 890345 gene locus_tag LOCUS_08410 889167 890345 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223202.1 protein_id gnl|my_center|LOCUS_08410 890347 890964 gene locus_tag LOCUS_08420 890347 890964 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223203.1 protein_id gnl|my_center|LOCUS_08420 891091 893379 gene locus_tag LOCUS_08430 891091 893379 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929901.1 protein_id gnl|my_center|LOCUS_08430 893469 894380 gene locus_tag LOCUS_08440 893469 894380 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229662.1 protein_id gnl|my_center|LOCUS_08440 894424 894765 gene locus_tag LOCUS_08450 894424 894765 CDS product lsr2/espR transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400657.1 protein_id gnl|my_center|LOCUS_08450 896342 894843 gene locus_tag LOCUS_08460 896342 894843 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400663.1 protein_id gnl|my_center|LOCUS_08460 897790 896342 gene locus_tag LOCUS_08470 897790 896342 CDS product hydrogenase HycQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400662.1 protein_id gnl|my_center|LOCUS_08470 898449 897790 gene locus_tag LOCUS_08480 898449 897790 CDS product hydrogenase HycP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400661.1 protein_id gnl|my_center|LOCUS_08480 899403 898456 gene locus_tag LOCUS_08490 899403 898456 CDS product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900802.1 protein_id gnl|my_center|LOCUS_08490 901418 899400 gene locus_tag LOCUS_08500 901418 899400 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003907280.1 protein_id gnl|my_center|LOCUS_08500 901900 901415 gene locus_tag LOCUS_08510 901900 901415 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400658.1 protein_id gnl|my_center|LOCUS_08510 902493 902014 gene locus_tag LOCUS_08520 902493 902014 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803700.1 protein_id gnl|my_center|LOCUS_08520 902562 903752 gene locus_tag LOCUS_08530 gene pdhA 902562 903752 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112796.1 protein_id gnl|my_center|LOCUS_08530 903749 904786 gene locus_tag LOCUS_08540 903749 904786 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803702.1 protein_id gnl|my_center|LOCUS_08540 904789 906159 gene locus_tag LOCUS_08550 904789 906159 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029246.1 protein_id gnl|my_center|LOCUS_08550 906222 906884 gene locus_tag LOCUS_08560 906222 906884 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728478.1 protein_id gnl|my_center|LOCUS_08560 907006 908397 gene locus_tag LOCUS_08570 907006 908397 CDS product IS1380-like element ISCgl4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015202.1 protein_id gnl|my_center|LOCUS_08570 908433 908666 gene locus_tag LOCUS_08580 908433 908666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 910529 908583 gene locus_tag LOCUS_08590 910529 908583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 911291 910686 gene locus_tag LOCUS_08600 911291 910686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 911190 911591 gene locus_tag LOCUS_08610 911190 911591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 911631 912287 gene locus_tag LOCUS_08620 911631 912287 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226074.1 protein_id gnl|my_center|LOCUS_08620 913049 912582 gene locus_tag LOCUS_08630 913049 912582 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228108.1 protein_id gnl|my_center|LOCUS_08630 913820 913221 gene locus_tag LOCUS_08640 913820 913221 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412790.1 protein_id gnl|my_center|LOCUS_08640 913940 915547 gene locus_tag LOCUS_08650 913940 915547 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028579.1 protein_id gnl|my_center|LOCUS_08650 915556 917649 gene locus_tag LOCUS_08660 915556 917649 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878115.1 protein_id gnl|my_center|LOCUS_08660 917646 918812 gene locus_tag LOCUS_08670 917646 918812 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896109.1 protein_id gnl|my_center|LOCUS_08670 918847 919617 gene locus_tag LOCUS_08680 918847 919617 CDS product succinyl-CoA--3-ketoacid CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412786.1 protein_id gnl|my_center|LOCUS_08680 919614 920285 gene locus_tag LOCUS_08690 919614 920285 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031118.1 protein_id gnl|my_center|LOCUS_08690 920282 920767 gene locus_tag LOCUS_08700 920282 920767 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036448818.1 protein_id gnl|my_center|LOCUS_08700 920764 921570 gene locus_tag LOCUS_08710 gene citE 920764 921570 CDS product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412766.1 protein_id gnl|my_center|LOCUS_08710 922117 921614 gene locus_tag LOCUS_08720 gene bsaA 922117 921614 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219440.1 protein_id gnl|my_center|LOCUS_08720 922418 922594 gene locus_tag LOCUS_08730 922418 922594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 922873 924558 gene locus_tag LOCUS_08740 922873 924558 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776880.1 protein_id gnl|my_center|LOCUS_08740 926361 924748 gene locus_tag LOCUS_08750 926361 924748 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727596.1 protein_id gnl|my_center|LOCUS_08750 926606 927661 gene locus_tag LOCUS_08760 926606 927661 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230820.1 protein_id gnl|my_center|LOCUS_08760 928264 927674 gene locus_tag LOCUS_08770 928264 927674 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225839.1 protein_id gnl|my_center|LOCUS_08770 928460 929809 gene locus_tag LOCUS_08780 928460 929809 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973289.1 protein_id gnl|my_center|LOCUS_08780 929877 930479 gene locus_tag LOCUS_08790 929877 930479 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971926.1 protein_id gnl|my_center|LOCUS_08790 930979 930491 gene locus_tag LOCUS_08800 930979 930491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 931036 931791 gene locus_tag LOCUS_08810 gene dapB 931036 931791 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030428.1 protein_id gnl|my_center|LOCUS_08810 931788 932231 gene locus_tag LOCUS_08820 931788 932231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728513.1 protein_id gnl|my_center|LOCUS_08820 933217 932327 gene locus_tag LOCUS_08830 933217 932327 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870932.1 protein_id gnl|my_center|LOCUS_08830 933655 933224 gene locus_tag LOCUS_08840 933655 933224 CDS product OsmC family peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803963.1 protein_id gnl|my_center|LOCUS_08840 934203 933745 gene locus_tag LOCUS_08850 934203 933745 CDS product DUF4395 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897207.1 protein_id gnl|my_center|LOCUS_08850 934627 934196 gene locus_tag LOCUS_08860 934627 934196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 934746 935456 gene locus_tag LOCUS_08870 gene thyX 934746 935456 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030430.1 protein_id gnl|my_center|LOCUS_08870 935538 936485 gene locus_tag LOCUS_08880 gene dapA 935538 936485 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804668.1 protein_id gnl|my_center|LOCUS_08880 936518 938194 gene locus_tag LOCUS_08890 936518 938194 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973282.1 protein_id gnl|my_center|LOCUS_08890 938296 939333 gene locus_tag LOCUS_08900 938296 939333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 939330 940031 gene locus_tag LOCUS_08910 939330 940031 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681678.1 protein_id gnl|my_center|LOCUS_08910 940028 941263 gene locus_tag LOCUS_08920 940028 941263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 941699 942088 gene locus_tag LOCUS_08930 941699 942088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08930 942091 942393 gene locus_tag LOCUS_08940 942091 942393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 942611 945343 gene locus_tag LOCUS_08950 942611 945343 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929902.1 protein_id gnl|my_center|LOCUS_08950 945349 945966 gene locus_tag LOCUS_08960 gene pgsA 945349 945966 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228068.1 protein_id gnl|my_center|LOCUS_08960 945959 946489 gene locus_tag LOCUS_08970 945959 946489 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228067.1 protein_id gnl|my_center|LOCUS_08970 946585 946956 gene locus_tag LOCUS_08980 946585 946956 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804673.1 protein_id gnl|my_center|LOCUS_08980 947067 947291 gene locus_tag LOCUS_08990 947067 947291 CDS product DUF3046 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057168.1 protein_id gnl|my_center|LOCUS_08990 947593 948720 gene locus_tag LOCUS_09000 gene recA 947593 948720 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224217.1 protein_id gnl|my_center|LOCUS_09000 948777 949529 gene locus_tag LOCUS_09010 948777 949529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 949590 951221 gene locus_tag LOCUS_09020 gene miaB 949590 951221 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930170.1 protein_id gnl|my_center|LOCUS_09020 951226 952158 gene locus_tag LOCUS_09030 gene miaA 951226 952158 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804679.1 protein_id gnl|my_center|LOCUS_09030 952168 953046 gene locus_tag LOCUS_09040 gene dapF 952168 953046 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804680.1 protein_id gnl|my_center|LOCUS_09040 953244 953732 gene locus_tag LOCUS_09050 953244 953732 CDS product toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111636.1 protein_id gnl|my_center|LOCUS_09050 953806 954651 gene locus_tag LOCUS_09060 953806 954651 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088307.1 protein_id gnl|my_center|LOCUS_09060 954682 955644 gene locus_tag LOCUS_09070 954682 955644 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029634.1 protein_id gnl|my_center|LOCUS_09070 955641 956477 gene locus_tag LOCUS_09080 955641 956477 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974578.1 protein_id gnl|my_center|LOCUS_09080 957098 956490 gene locus_tag LOCUS_09090 957098 956490 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389654.1 protein_id gnl|my_center|LOCUS_09090 957188 958681 gene locus_tag LOCUS_09100 gene hflX 957188 958681 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804682.1 protein_id gnl|my_center|LOCUS_09100 958949 959974 gene locus_tag LOCUS_09110 958949 959974 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803922.1 protein_id gnl|my_center|LOCUS_09110 959971 962304 gene locus_tag LOCUS_09120 gene metE 959971 962304 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803923.1 protein_id gnl|my_center|LOCUS_09120 963601 962327 gene locus_tag LOCUS_09130 963601 962327 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393641.1 protein_id gnl|my_center|LOCUS_09130 964674 963970 gene locus_tag LOCUS_09140 gene lexA 964674 963970 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804684.1 protein_id gnl|my_center|LOCUS_09140 964969 965316 gene locus_tag LOCUS_09150 964969 965316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 965345 966442 gene locus_tag LOCUS_09160 965345 966442 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224128.1 protein_id gnl|my_center|LOCUS_09160 966452 967075 gene locus_tag LOCUS_09170 gene hisB 966452 967075 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052519.1 protein_id gnl|my_center|LOCUS_09170 967072 967704 gene locus_tag LOCUS_09180 gene hisH 967072 967704 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057924.1 protein_id gnl|my_center|LOCUS_09180 967750 968496 gene locus_tag LOCUS_09190 gene priA 967750 968496 CDS product bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776203.1 protein_id gnl|my_center|LOCUS_09190 968480 969298 gene locus_tag LOCUS_09200 968480 969298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 969324 973931 gene locus_tag LOCUS_09210 969324 973931 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109508967.1 protein_id gnl|my_center|LOCUS_09210 973924 974703 gene locus_tag LOCUS_09220 gene nei2 973924 974703 CDS product endonuclease VIII Nei2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095691.1 protein_id gnl|my_center|LOCUS_09220 975002 974763 gene locus_tag LOCUS_09230 975002 974763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 975359 975006 gene locus_tag LOCUS_09240 975359 975006 CDS product DUF1844 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929982.1 protein_id gnl|my_center|LOCUS_09240 975726 976271 gene locus_tag LOCUS_09250 975726 976271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09250 976264 976458 gene locus_tag LOCUS_09260 gene rpmI 976264 976458 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776198.1 protein_id gnl|my_center|LOCUS_09260 976498 976887 gene locus_tag LOCUS_09270 gene rplT 976498 976887 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977226.1 protein_id gnl|my_center|LOCUS_09270 976961 977761 gene locus_tag LOCUS_09280 976961 977761 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027873.1 protein_id gnl|my_center|LOCUS_09280 977866 978654 gene locus_tag LOCUS_09290 977866 978654 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973246.1 protein_id gnl|my_center|LOCUS_09290 978707 979576 gene locus_tag LOCUS_09300 978707 979576 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894111.1 protein_id gnl|my_center|LOCUS_09300 979693 980340 gene locus_tag LOCUS_09310 979693 980340 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224234.1 protein_id gnl|my_center|LOCUS_09310 980337 981248 gene locus_tag LOCUS_09320 980337 981248 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224233.1 protein_id gnl|my_center|LOCUS_09320 981318 982331 gene locus_tag LOCUS_09330 gene pheS 981318 982331 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776193.1 protein_id gnl|my_center|LOCUS_09330 982331 984856 gene locus_tag LOCUS_09340 gene pheT 982331 984856 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776192.1 protein_id gnl|my_center|LOCUS_09340 985018 985419 gene locus_tag LOCUS_09350 985018 985419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 985521 986564 gene locus_tag LOCUS_09360 gene argC 985521 986564 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776182.1 protein_id gnl|my_center|LOCUS_09360 986561 987733 gene locus_tag LOCUS_09370 gene argJ 986561 987733 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027859.1 protein_id gnl|my_center|LOCUS_09370 987733 988635 gene locus_tag LOCUS_09380 gene argB 987733 988635 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813526.1 protein_id gnl|my_center|LOCUS_09380 988632 989831 gene locus_tag LOCUS_09390 988632 989831 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776179.1 protein_id gnl|my_center|LOCUS_09390 989868 990794 gene locus_tag LOCUS_09400 gene argF 989868 990794 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776178.1 protein_id gnl|my_center|LOCUS_09400 990941 992143 gene locus_tag LOCUS_09410 990941 992143 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776176.1 protein_id gnl|my_center|LOCUS_09410 992151 993587 gene locus_tag LOCUS_09420 gene argH 992151 993587 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776175.1 protein_id gnl|my_center|LOCUS_09420 994298 993747 gene locus_tag LOCUS_09430 994298 993747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 994517 994323 gene locus_tag LOCUS_09440 994517 994323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 994632 995324 gene locus_tag LOCUS_09450 994632 995324 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977030.1 protein_id gnl|my_center|LOCUS_09450 995994 995404 gene locus_tag LOCUS_09460 995994 995404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 996620 995991 gene locus_tag LOCUS_09470 996620 995991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 996735 998036 gene locus_tag LOCUS_09480 gene tyrS 996735 998036 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027993.1 protein_id gnl|my_center|LOCUS_09480 998560 1000091 gene locus_tag LOCUS_r00010 998560 1000091 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1000561 1003681 gene locus_tag LOCUS_r00020 1000561 1003681 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1003798 1003908 gene locus_tag LOCUS_r00030 1003798 1003908 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1004020 1006137 gene locus_tag LOCUS_09490 1004020 1006137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 1006142 1007248 gene locus_tag LOCUS_09500 1006142 1007248 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027978.1 protein_id gnl|my_center|LOCUS_09500 1007258 1007422 gene locus_tag LOCUS_09510 1007258 1007422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 1007419 1008351 gene locus_tag LOCUS_09520 gene tlyA 1007419 1008351 CDS product 16S/23S rRNA (cytidine-2'-O)-methyltransferase TlyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408382.1 protein_id gnl|my_center|LOCUS_09520 1008351 1009271 gene locus_tag LOCUS_09530 1008351 1009271 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027973.1 protein_id gnl|my_center|LOCUS_09530 1009281 1010984 gene locus_tag LOCUS_09540 gene recN 1009281 1010984 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325905.1 protein_id gnl|my_center|LOCUS_09540 1010999 1012717 gene locus_tag LOCUS_09550 1010999 1012717 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091806.1 protein_id gnl|my_center|LOCUS_09550 1012710 1012895 gene locus_tag LOCUS_09560 1012710 1012895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 1012892 1013533 gene locus_tag LOCUS_09570 1012892 1013533 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977050.1 protein_id gnl|my_center|LOCUS_09570 1013530 1014468 gene locus_tag LOCUS_09580 gene xerD 1013530 1014468 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286377.1 protein_id gnl|my_center|LOCUS_09580 1014556 1014780 gene locus_tag LOCUS_09590 1014556 1014780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 1014882 1015769 gene locus_tag LOCUS_09600 1014882 1015769 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805130.1 protein_id gnl|my_center|LOCUS_09600 1015753 1016562 gene locus_tag LOCUS_09610 1015753 1016562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 1016552 1017202 gene locus_tag LOCUS_09620 gene scpB 1016552 1017202 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729301.1 protein_id gnl|my_center|LOCUS_09620 1017199 1018077 gene locus_tag LOCUS_09630 1017199 1018077 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895185.1 protein_id gnl|my_center|LOCUS_09630 1018077 1019192 gene locus_tag LOCUS_09640 1018077 1019192 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805132.1 protein_id gnl|my_center|LOCUS_09640 1019197 1019889 gene locus_tag LOCUS_09650 1019197 1019889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09650 1019882 1021393 gene locus_tag LOCUS_09660 gene der 1019882 1021393 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977066.1 protein_id gnl|my_center|LOCUS_09660 1021592 1023205 gene locus_tag LOCUS_09670 1021592 1023205 CDS product T2SS-translocated chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193152.1 protein_id gnl|my_center|LOCUS_09670 1023811 1023209 gene locus_tag LOCUS_09680 1023811 1023209 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199702189.1 protein_id gnl|my_center|LOCUS_09680 1023945 1024019 gene locus_tag LOCUS_t00080 1023945 1024019 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1026179 1024257 gene locus_tag LOCUS_09690 1026179 1024257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 1027174 1026176 gene locus_tag LOCUS_09700 1027174 1026176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 1028171 1027266 gene locus_tag LOCUS_09710 1028171 1027266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 1028500 1028168 gene locus_tag LOCUS_09720 1028500 1028168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 1028834 1028505 gene locus_tag LOCUS_09730 1028834 1028505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 1029196 1028834 gene locus_tag LOCUS_09740 1029196 1028834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 1029399 1029911 gene locus_tag LOCUS_09750 1029399 1029911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 1030265 1030861 gene locus_tag LOCUS_09760 1030265 1030861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 1031032 1031871 gene locus_tag LOCUS_09770 1031032 1031871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 1033668 1032166 gene locus_tag LOCUS_09780 1033668 1032166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 1033794 1033976 gene locus_tag LOCUS_09790 1033794 1033976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 1034483 1036432 gene locus_tag LOCUS_09800 1034483 1036432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 1037554 1036652 gene locus_tag LOCUS_09810 1037554 1036652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09810 1038093 1037659 gene locus_tag LOCUS_09820 1038093 1037659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085100849.1 protein_id gnl|my_center|LOCUS_09820 1038887 1040440 gene locus_tag LOCUS_09830 gene istA 1038887 1040440 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015262274.1 protein_id gnl|my_center|LOCUS_09830 1040437 1041186 gene locus_tag LOCUS_09840 gene istB 1040437 1041186 CDS product IS21-like element ISFK1 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090937.1 protein_id gnl|my_center|LOCUS_09840 1041768 1041583 gene locus_tag LOCUS_09850 1041768 1041583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 1043083 1043691 gene locus_tag LOCUS_09860 1043083 1043691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 1043697 1044335 gene locus_tag LOCUS_09870 1043697 1044335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 1044329 1045273 gene locus_tag LOCUS_09880 1044329 1045273 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233028.1 protein_id gnl|my_center|LOCUS_09880 1045306 1045653 gene locus_tag LOCUS_09890 1045306 1045653 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222521.1 protein_id gnl|my_center|LOCUS_09890 1045656 1046627 gene locus_tag LOCUS_09900 1045656 1046627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 1048921 1047692 gene locus_tag LOCUS_09910 1048921 1047692 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225591.1 protein_id gnl|my_center|LOCUS_09910 1049058 1049921 gene locus_tag LOCUS_09920 1049058 1049921 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225597.1 protein_id gnl|my_center|LOCUS_09920 1050022 1052811 gene locus_tag LOCUS_09930 1050022 1052811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 1052916 1054223 gene locus_tag LOCUS_09940 1052916 1054223 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030754.1 protein_id gnl|my_center|LOCUS_09940 1054367 1055320 gene locus_tag LOCUS_09950 1054367 1055320 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030753.1 protein_id gnl|my_center|LOCUS_09950 1055317 1056231 gene locus_tag LOCUS_09960 1055317 1056231 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030752.1 protein_id gnl|my_center|LOCUS_09960 1056228 1058789 gene locus_tag LOCUS_09970 1056228 1058789 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225596.1 protein_id gnl|my_center|LOCUS_09970 1058792 1059790 gene locus_tag LOCUS_09980 1058792 1059790 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403330.1 protein_id gnl|my_center|LOCUS_09980 1059888 1060895 gene locus_tag LOCUS_09990 gene gmuG 1059888 1060895 CDS product mannan endo-1,4-beta-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244107.1 protein_id gnl|my_center|LOCUS_09990 1061139 1062065 gene locus_tag LOCUS_10000 1061139 1062065 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085150668.1 protein_id gnl|my_center|LOCUS_10000 1062164 1063753 gene locus_tag LOCUS_10010 gene istA 1062164 1063753 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015262274.1 protein_id gnl|my_center|LOCUS_10010 1063753 1064520 gene locus_tag LOCUS_10020 gene istB 1063753 1064520 CDS product IS21-like element ISRsp2 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167668023.1 protein_id gnl|my_center|LOCUS_10020 1064682 1064948 gene locus_tag LOCUS_10030 1064682 1064948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10030 1065866 1065102 gene locus_tag LOCUS_10040 gene tatC 1065866 1065102 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805201.1 protein_id gnl|my_center|LOCUS_10040 1066208 1065984 gene locus_tag LOCUS_10050 1066208 1065984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 1066310 1066573 gene locus_tag LOCUS_10060 1066310 1066573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 1066678 1067382 gene locus_tag LOCUS_10070 1066678 1067382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 1067441 1067968 gene locus_tag LOCUS_10080 1067441 1067968 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939219.1 protein_id gnl|my_center|LOCUS_10080 1068121 1069800 gene locus_tag LOCUS_10090 1068121 1069800 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612392.1 protein_id gnl|my_center|LOCUS_10090 1069820 1070539 gene locus_tag LOCUS_10100 1069820 1070539 CDS product gluconate 2-dehydrogenase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612390.1 protein_id gnl|my_center|LOCUS_10100 1070603 1071742 gene locus_tag LOCUS_10110 1070603 1071742 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815495.1 protein_id gnl|my_center|LOCUS_10110 1071868 1072578 gene locus_tag LOCUS_10120 1071868 1072578 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561207.1 protein_id gnl|my_center|LOCUS_10120 1072774 1074393 gene locus_tag LOCUS_10130 1072774 1074393 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223211.1 protein_id gnl|my_center|LOCUS_10130 1074390 1075466 gene locus_tag LOCUS_10140 1074390 1075466 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082910121.1 protein_id gnl|my_center|LOCUS_10140 1075463 1076473 gene locus_tag LOCUS_10150 1075463 1076473 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082910121.1 protein_id gnl|my_center|LOCUS_10150 1076543 1077715 gene locus_tag LOCUS_10160 1076543 1077715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 1077797 1078462 gene locus_tag LOCUS_10170 1077797 1078462 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803802.1 protein_id gnl|my_center|LOCUS_10170 1078459 1079421 gene locus_tag LOCUS_10180 1078459 1079421 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029030.1 protein_id gnl|my_center|LOCUS_10180 1080317 1079451 gene locus_tag LOCUS_10190 1080317 1079451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 1080998 1080363 gene locus_tag LOCUS_10200 gene dhaL 1080998 1080363 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728173.1 protein_id gnl|my_center|LOCUS_10200 1081855 1080995 gene locus_tag LOCUS_10210 gene dhaK 1081855 1080995 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972071.1 protein_id gnl|my_center|LOCUS_10210 1082134 1082331 gene locus_tag LOCUS_10220 1082134 1082331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 1083541 1082534 gene locus_tag LOCUS_10230 1083541 1082534 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467588.1 protein_id gnl|my_center|LOCUS_10230 1084709 1083570 gene locus_tag LOCUS_10240 1084709 1083570 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097689.1 protein_id gnl|my_center|LOCUS_10240 1085683 1084709 gene locus_tag LOCUS_10250 1085683 1084709 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707197.1 protein_id gnl|my_center|LOCUS_10250 1087192 1085684 gene locus_tag LOCUS_10260 1087192 1085684 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082910117.1 protein_id gnl|my_center|LOCUS_10260 1088388 1087198 gene locus_tag LOCUS_10270 1088388 1087198 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161951924.1 protein_id gnl|my_center|LOCUS_10270 1089679 1088522 gene locus_tag LOCUS_10280 1089679 1088522 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243020.1 protein_id gnl|my_center|LOCUS_10280 1090556 1089717 gene locus_tag LOCUS_10290 1090556 1089717 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223781.1 protein_id gnl|my_center|LOCUS_10290 1090853 1091968 gene locus_tag LOCUS_10300 1090853 1091968 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223433.1 protein_id gnl|my_center|LOCUS_10300 1092205 1092420 gene locus_tag LOCUS_10310 1092205 1092420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 1092611 1092432 gene locus_tag LOCUS_10320 1092611 1092432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10320 1093472 1092624 gene locus_tag LOCUS_10330 1093472 1092624 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054866.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10330 1094425 1093469 gene locus_tag LOCUS_10340 1094425 1093469 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053138.1 protein_id gnl|my_center|LOCUS_10340 1095627 1094422 gene locus_tag LOCUS_10350 1095627 1094422 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053137.1 protein_id gnl|my_center|LOCUS_10350 1095871 1096113 gene locus_tag LOCUS_10360 1095871 1096113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 1096462 1096205 gene locus_tag LOCUS_10370 1096462 1096205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 1097286 1096486 gene locus_tag LOCUS_10380 1097286 1096486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 1098215 1097466 gene locus_tag LOCUS_10390 gene istB 1098215 1097466 CDS product IS21-like element ISFK1 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090937.1 protein_id gnl|my_center|LOCUS_10390 1099765 1098212 gene locus_tag LOCUS_10400 gene istA 1099765 1098212 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015262274.1 protein_id gnl|my_center|LOCUS_10400 1099841 1102837 gene locus_tag LOCUS_10410 1099841 1102837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 1102834 1103427 gene locus_tag LOCUS_10420 1102834 1103427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 1105140 1103749 gene locus_tag LOCUS_10430 1105140 1103749 CDS product IS1380-like element ISCgl4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015202.1 protein_id gnl|my_center|LOCUS_10430 1106590 1105262 gene locus_tag LOCUS_10440 1106590 1105262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 1106998 1106768 gene locus_tag LOCUS_10450 1106998 1106768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 1107929 1107159 gene locus_tag LOCUS_10460 1107929 1107159 CDS product DUF6338 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224786.1 protein_id gnl|my_center|LOCUS_10460 1108236 1108916 gene locus_tag LOCUS_10470 1108236 1108916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 1109149 1108889 gene locus_tag LOCUS_10480 1109149 1108889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 1109242 1110183 gene locus_tag LOCUS_10490 1109242 1110183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 1110978 1113023 gene locus_tag LOCUS_10500 1110978 1113023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207299.1 protein_id gnl|my_center|LOCUS_10500 1113317 1113727 gene locus_tag LOCUS_10510 1113317 1113727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 1113854 1114099 gene locus_tag LOCUS_10520 1113854 1114099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 1115784 1115218 gene locus_tag LOCUS_10530 1115784 1115218 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971593.1 protein_id gnl|my_center|LOCUS_10530 1115921 1116892 gene locus_tag LOCUS_10540 1115921 1116892 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028905.1 protein_id gnl|my_center|LOCUS_10540 1117015 1117632 gene locus_tag LOCUS_10550 1117015 1117632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 1118270 1117701 gene locus_tag LOCUS_10560 1118270 1117701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 1119975 1118968 gene locus_tag LOCUS_10570 1119975 1118968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10570 1120409 1119975 gene locus_tag LOCUS_10580 1120409 1119975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085100849.1 protein_id gnl|my_center|LOCUS_10580 1122030 1120597 gene locus_tag LOCUS_10590 1122030 1120597 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225330.1 protein_id gnl|my_center|LOCUS_10590 1122707 1122138 gene locus_tag LOCUS_10600 1122707 1122138 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284050.1 protein_id gnl|my_center|LOCUS_10600 1122809 1123963 gene locus_tag LOCUS_10610 1122809 1123963 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027238.1 protein_id gnl|my_center|LOCUS_10610 1124550 1124257 gene locus_tag LOCUS_10620 1124550 1124257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 1125014 1124607 gene locus_tag LOCUS_10630 1125014 1124607 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223391.1 protein_id gnl|my_center|LOCUS_10630 1125094 1125474 gene locus_tag LOCUS_10640 1125094 1125474 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315823.1 protein_id gnl|my_center|LOCUS_10640 1126623 1125628 gene locus_tag LOCUS_10650 1126623 1125628 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259109.1 protein_id gnl|my_center|LOCUS_10650 1127258 1126650 gene locus_tag LOCUS_10660 1127258 1126650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 1127383 1128417 gene locus_tag LOCUS_10670 1127383 1128417 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168472.1 protein_id gnl|my_center|LOCUS_10670 1129613 1128414 gene locus_tag LOCUS_10680 1129613 1128414 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188971.1 protein_id gnl|my_center|LOCUS_10680 1129708 1130313 gene locus_tag LOCUS_10690 1129708 1130313 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104364.1 protein_id gnl|my_center|LOCUS_10690 1131572 1130394 gene locus_tag LOCUS_10700 1131572 1130394 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231015.1 protein_id gnl|my_center|LOCUS_10700 1132372 1131638 gene locus_tag LOCUS_10710 1132372 1131638 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114809.1 protein_id gnl|my_center|LOCUS_10710 1133200 1132475 gene locus_tag LOCUS_10720 1133200 1132475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 1134183 1133287 gene locus_tag LOCUS_10730 1134183 1133287 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776493.1 protein_id gnl|my_center|LOCUS_10730 1134290 1135624 gene locus_tag LOCUS_10740 1134290 1135624 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031803.1 protein_id gnl|my_center|LOCUS_10740 1135615 1136277 gene locus_tag LOCUS_10750 1135615 1136277 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030771.1 protein_id gnl|my_center|LOCUS_10750 1136719 1136294 gene locus_tag LOCUS_10760 1136719 1136294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 1136882 1137784 gene locus_tag LOCUS_10770 1136882 1137784 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485278.1 protein_id gnl|my_center|LOCUS_10770 1137952 1138332 gene locus_tag LOCUS_10780 1137952 1138332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 1138360 1138560 gene locus_tag LOCUS_10790 1138360 1138560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 1138684 1138869 gene locus_tag LOCUS_10800 1138684 1138869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 1140276 1138864 gene locus_tag LOCUS_10810 1140276 1138864 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223121.1 protein_id gnl|my_center|LOCUS_10810 1140722 1140459 gene locus_tag LOCUS_10820 1140722 1140459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 1140828 1140610 gene locus_tag LOCUS_10830 1140828 1140610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 1141135 1140962 gene locus_tag LOCUS_10840 1141135 1140962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 1141758 1141156 gene locus_tag LOCUS_10850 1141758 1141156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 1143555 1142434 gene locus_tag LOCUS_10860 1143555 1142434 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225076.1 protein_id gnl|my_center|LOCUS_10860 1143792 1143995 gene locus_tag LOCUS_10870 1143792 1143995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 1145045 1144098 gene locus_tag LOCUS_10880 gene bla 1145045 1144098 CDS product class A beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231385.1 protein_id gnl|my_center|LOCUS_10880 1145829 1145263 gene locus_tag LOCUS_10890 1145829 1145263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803992.1 protein_id gnl|my_center|LOCUS_10890 1146036 1146812 gene locus_tag LOCUS_10900 1146036 1146812 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114809.1 protein_id gnl|my_center|LOCUS_10900 1148493 1146901 gene locus_tag LOCUS_10910 1148493 1146901 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223121.1 protein_id gnl|my_center|LOCUS_10910 1148104 1148007 gene locus_tag LOCUS_t00090 1148104 1148007 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1148844 1149770 gene locus_tag LOCUS_10920 1148844 1149770 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228283.1 protein_id gnl|my_center|LOCUS_10920 1149792 1150649 gene locus_tag LOCUS_10930 1149792 1150649 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030858.1 protein_id gnl|my_center|LOCUS_10930 1150902 1152458 gene locus_tag LOCUS_10940 1150902 1152458 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729073.1 protein_id gnl|my_center|LOCUS_10940 1155299 1152567 gene locus_tag LOCUS_10950 1155299 1152567 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030729.1 protein_id gnl|my_center|LOCUS_10950 1155959 1155321 gene locus_tag LOCUS_10960 1155959 1155321 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112976.1 protein_id gnl|my_center|LOCUS_10960 1156397 1156011 gene locus_tag LOCUS_10970 1156397 1156011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 1156522 1156983 gene locus_tag LOCUS_10980 1156522 1156983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 1157015 1158220 gene locus_tag LOCUS_10990 1157015 1158220 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975443.1 protein_id gnl|my_center|LOCUS_10990 1158217 1158882 gene locus_tag LOCUS_11000 1158217 1158882 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230966.1 protein_id gnl|my_center|LOCUS_11000 1158966 1159727 gene locus_tag LOCUS_11010 1158966 1159727 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860245.1 protein_id gnl|my_center|LOCUS_11010 1159724 1161124 gene locus_tag LOCUS_11020 1159724 1161124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 1161706 1163295 gene locus_tag LOCUS_11030 gene istA 1161706 1163295 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015262274.1 protein_id gnl|my_center|LOCUS_11030 1163295 1164062 gene locus_tag LOCUS_11040 gene istB 1163295 1164062 CDS product IS21-like element ISRsp2 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167668023.1 protein_id gnl|my_center|LOCUS_11040 1164059 1164883 gene locus_tag LOCUS_11050 1164059 1164883 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410047.1 protein_id gnl|my_center|LOCUS_11050 1164949 1165707 gene locus_tag LOCUS_11060 1164949 1165707 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410047.1 protein_id gnl|my_center|LOCUS_11060 1167424 1166003 gene locus_tag LOCUS_11070 1167424 1166003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 1167633 1168676 gene locus_tag LOCUS_11080 1167633 1168676 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026966.1 protein_id gnl|my_center|LOCUS_11080 1168676 1169500 gene locus_tag LOCUS_11090 1168676 1169500 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026967.1 protein_id gnl|my_center|LOCUS_11090 1169497 1170531 gene locus_tag LOCUS_11100 1169497 1170531 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728056.1 protein_id gnl|my_center|LOCUS_11100 1172415 1171129 gene locus_tag LOCUS_11110 1172415 1171129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 1174914 1173430 gene locus_tag LOCUS_11120 1174914 1173430 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013720.1 protein_id gnl|my_center|LOCUS_11120 1175558 1174914 gene locus_tag LOCUS_11130 1175558 1174914 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860600.1 protein_id gnl|my_center|LOCUS_11130 1176856 1175564 gene locus_tag LOCUS_11140 1176856 1175564 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013721.1 protein_id gnl|my_center|LOCUS_11140 1177170 1176859 gene locus_tag LOCUS_11150 1177170 1176859 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013722.1 protein_id gnl|my_center|LOCUS_11150 1177986 1177180 gene locus_tag LOCUS_11160 1177986 1177180 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013723.1 protein_id gnl|my_center|LOCUS_11160 1179904 1177979 gene locus_tag LOCUS_11170 1179904 1177979 CDS product PEP-utilizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013724.1 protein_id gnl|my_center|LOCUS_11170 1181112 1180006 gene locus_tag LOCUS_11180 1181112 1180006 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013725.1 protein_id gnl|my_center|LOCUS_11180 1182446 1181109 gene locus_tag LOCUS_11190 1182446 1181109 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013726.1 protein_id gnl|my_center|LOCUS_11190 1183334 1182510 gene locus_tag LOCUS_11200 1183334 1182510 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013727.1 protein_id gnl|my_center|LOCUS_11200 1183563 1184744 gene locus_tag LOCUS_11210 1183563 1184744 CDS product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229335.1 protein_id gnl|my_center|LOCUS_11210 1184807 1185607 gene locus_tag LOCUS_11220 gene pcaH 1184807 1185607 CDS product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728462.1 protein_id gnl|my_center|LOCUS_11220 1185600 1186214 gene locus_tag LOCUS_11230 gene pcaG 1185600 1186214 CDS product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728463.1 protein_id gnl|my_center|LOCUS_11230 1186207 1187658 gene locus_tag LOCUS_11240 gene pcaB 1186207 1187658 CDS product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031114.1 protein_id gnl|my_center|LOCUS_11240 1187658 1188875 gene locus_tag LOCUS_11250 gene pcaD 1187658 1188875 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189284957.1 protein_id gnl|my_center|LOCUS_11250 1188888 1189688 gene locus_tag LOCUS_11260 1188888 1189688 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727991.1 protein_id gnl|my_center|LOCUS_11260 1189688 1190377 gene locus_tag LOCUS_11270 1189688 1190377 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031118.1 protein_id gnl|my_center|LOCUS_11270 1190374 1191591 gene locus_tag LOCUS_11280 1190374 1191591 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877333.1 protein_id gnl|my_center|LOCUS_11280 1192577 1192119 gene locus_tag LOCUS_11290 1192577 1192119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 1193134 1194087 gene locus_tag LOCUS_11300 1193134 1194087 CDS product iron-containing redox enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027336.1 protein_id gnl|my_center|LOCUS_11300 1194465 1196516 gene locus_tag LOCUS_11310 gene glgX 1194465 1196516 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971803.1 protein_id gnl|my_center|LOCUS_11310 1197564 1196638 gene locus_tag LOCUS_11320 1197564 1196638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 1198858 1198091 gene locus_tag LOCUS_11330 gene istB 1198858 1198091 CDS product IS21-like element ISRsp2 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167668023.1 protein_id gnl|my_center|LOCUS_11330 1200447 1198858 gene locus_tag LOCUS_11340 gene istA 1200447 1198858 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015262274.1 protein_id gnl|my_center|LOCUS_11340 1201172 1200627 gene locus_tag LOCUS_11350 1201172 1200627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 1201404 1202426 gene locus_tag LOCUS_11360 1201404 1202426 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804319.1 protein_id gnl|my_center|LOCUS_11360 1203333 1202725 gene locus_tag LOCUS_11370 1203333 1202725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 1203889 1203320 gene locus_tag LOCUS_11380 1203889 1203320 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225197.1 protein_id gnl|my_center|LOCUS_11380 1205142 1204393 gene locus_tag LOCUS_11390 gene istB 1205142 1204393 CDS product IS21-like element ISFK1 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090937.1 protein_id gnl|my_center|LOCUS_11390 1206689 1205139 gene locus_tag LOCUS_11400 gene istA 1206689 1205139 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015262274.1 protein_id gnl|my_center|LOCUS_11400 1206926 1207174 gene locus_tag LOCUS_11410 1206926 1207174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 1209209 1207332 gene locus_tag LOCUS_11420 1209209 1207332 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229244.1 protein_id gnl|my_center|LOCUS_11420 1210279 1209266 gene locus_tag LOCUS_11430 1210279 1209266 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225188.1 protein_id gnl|my_center|LOCUS_11430 1210503 1211810 gene locus_tag LOCUS_11440 1210503 1211810 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028349.1 protein_id gnl|my_center|LOCUS_11440 1211814 1212824 gene locus_tag LOCUS_11450 1211814 1212824 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776905.1 protein_id gnl|my_center|LOCUS_11450 1212821 1213699 gene locus_tag LOCUS_11460 1212821 1213699 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384837.1 protein_id gnl|my_center|LOCUS_11460 1213706 1214692 gene locus_tag LOCUS_11470 1213706 1214692 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103129516.1 protein_id gnl|my_center|LOCUS_11470 1214741 1215670 gene locus_tag LOCUS_11480 1214741 1215670 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804906.1 protein_id gnl|my_center|LOCUS_11480 1216068 1216808 gene locus_tag LOCUS_11490 1216068 1216808 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227392.1 protein_id gnl|my_center|LOCUS_11490 1217105 1218541 gene locus_tag LOCUS_11500 1217105 1218541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 1218951 1219544 gene locus_tag LOCUS_11510 1218951 1219544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 1219723 1220250 gene locus_tag LOCUS_11520 1219723 1220250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 1222451 1220550 gene locus_tag LOCUS_11530 1222451 1220550 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031376.1 protein_id gnl|my_center|LOCUS_11530 1224627 1222804 gene locus_tag LOCUS_11540 1224627 1222804 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085442.1 protein_id gnl|my_center|LOCUS_11540 1225112 1224765 gene locus_tag LOCUS_11550 1225112 1224765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 1225677 1226420 gene locus_tag LOCUS_11560 1225677 1226420 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227572.1 protein_id gnl|my_center|LOCUS_11560 1227235 1226540 gene locus_tag LOCUS_11570 1227235 1226540 CDS product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903895.1 protein_id gnl|my_center|LOCUS_11570 1228131 1227244 gene locus_tag LOCUS_11580 1228131 1227244 CDS product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014113.1 protein_id gnl|my_center|LOCUS_11580 1229212 1228196 gene locus_tag LOCUS_11590 1229212 1228196 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727501.1 protein_id gnl|my_center|LOCUS_11590 1229783 1229349 gene locus_tag LOCUS_11600 1229783 1229349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 1230308 1229790 gene locus_tag LOCUS_11610 1230308 1229790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11610 1231461 1230352 gene locus_tag LOCUS_11620 1231461 1230352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 1231650 1231462 gene locus_tag LOCUS_11630 1231650 1231462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 1232004 1232825 gene locus_tag LOCUS_11640 1232004 1232825 CDS product TIGR03084 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110556.1 protein_id gnl|my_center|LOCUS_11640 1232836 1233429 gene locus_tag LOCUS_11650 1232836 1233429 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726863.1 protein_id gnl|my_center|LOCUS_11650 1234644 1233493 gene locus_tag LOCUS_11660 1234644 1233493 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726858.1 protein_id gnl|my_center|LOCUS_11660 1234675 1235163 gene locus_tag LOCUS_11670 gene arfB 1234675 1235163 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125377.1 protein_id gnl|my_center|LOCUS_11670 1235233 1236021 gene locus_tag LOCUS_11680 1235233 1236021 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479811.1 protein_id gnl|my_center|LOCUS_11680 1236018 1236401 gene locus_tag LOCUS_11690 1236018 1236401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 1237505 1236438 gene locus_tag LOCUS_11700 1237505 1236438 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974028.1 protein_id gnl|my_center|LOCUS_11700 1239574 1237673 gene locus_tag LOCUS_11710 1239574 1237673 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156232373.1 protein_id gnl|my_center|LOCUS_11710 1239794 1240567 gene locus_tag LOCUS_11720 1239794 1240567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 1240636 1240956 gene locus_tag LOCUS_11730 1240636 1240956 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293844.1 protein_id gnl|my_center|LOCUS_11730 1240943 1242775 gene locus_tag LOCUS_11740 1240943 1242775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 1242860 1243669 gene locus_tag LOCUS_11750 1242860 1243669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 1243861 1245996 gene locus_tag LOCUS_11760 gene malQ 1243861 1245996 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804935.1 protein_id gnl|my_center|LOCUS_11760 1246173 1246664 gene locus_tag LOCUS_11770 1246173 1246664 CDS product FBP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804237.1 protein_id gnl|my_center|LOCUS_11770 1246787 1246987 gene locus_tag LOCUS_11780 1246787 1246987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 1247109 1247933 gene locus_tag LOCUS_11790 1247109 1247933 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225290.1 protein_id gnl|my_center|LOCUS_11790 1248565 1247942 gene locus_tag LOCUS_11800 1248565 1247942 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728894.1 protein_id gnl|my_center|LOCUS_11800 1249537 1248650 gene locus_tag LOCUS_11810 1249537 1248650 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094646.1 protein_id gnl|my_center|LOCUS_11810 1249937 1250185 gene locus_tag LOCUS_11820 1249937 1250185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11820 1250182 1250679 gene locus_tag LOCUS_11830 1250182 1250679 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973265.1 protein_id gnl|my_center|LOCUS_11830 1251813 1250713 gene locus_tag LOCUS_11840 1251813 1250713 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897538.1 protein_id gnl|my_center|LOCUS_11840 1251920 1252459 gene locus_tag LOCUS_11850 1251920 1252459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 1252504 1253175 gene locus_tag LOCUS_11860 1252504 1253175 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028987.1 protein_id gnl|my_center|LOCUS_11860 1253234 1253911 gene locus_tag LOCUS_11870 1253234 1253911 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029090.1 protein_id gnl|my_center|LOCUS_11870 1254907 1253957 gene locus_tag LOCUS_11880 1254907 1253957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 1254876 1256678 gene locus_tag LOCUS_11890 1254876 1256678 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143814.1 protein_id gnl|my_center|LOCUS_11890 1256864 1256688 gene locus_tag LOCUS_11900 1256864 1256688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 1257160 1257624 gene locus_tag LOCUS_11910 1257160 1257624 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224900.1 protein_id gnl|my_center|LOCUS_11910 1257673 1258332 gene locus_tag LOCUS_11920 1257673 1258332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 1258619 1259281 gene locus_tag LOCUS_11930 1258619 1259281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805165.1 protein_id gnl|my_center|LOCUS_11930 1259361 1260863 gene locus_tag LOCUS_11940 1259361 1260863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 1262985 1261213 gene locus_tag LOCUS_11950 1262985 1261213 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090032.1 protein_id gnl|my_center|LOCUS_11950 1263151 1263471 gene locus_tag LOCUS_11960 1263151 1263471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 1263468 1264634 gene locus_tag LOCUS_11970 1263468 1264634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 1264631 1264939 gene locus_tag LOCUS_11980 1264631 1264939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 1264936 1265421 gene locus_tag LOCUS_11990 1264936 1265421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 1265421 1266212 gene locus_tag LOCUS_12000 1265421 1266212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 1266344 1267990 gene locus_tag LOCUS_12010 1266344 1267990 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495702.1 protein_id gnl|my_center|LOCUS_12010 1267987 1268955 gene locus_tag LOCUS_12020 1267987 1268955 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139305256.1 protein_id gnl|my_center|LOCUS_12020 1268952 1269797 gene locus_tag LOCUS_12030 1268952 1269797 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537723.1 protein_id gnl|my_center|LOCUS_12030 1269794 1271326 gene locus_tag LOCUS_12040 1269794 1271326 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729789.1 protein_id gnl|my_center|LOCUS_12040 1272226 1271354 gene locus_tag LOCUS_12050 1272226 1271354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 1272256 1272444 gene locus_tag LOCUS_12060 1272256 1272444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 1272444 1272698 gene locus_tag LOCUS_12070 1272444 1272698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 1272845 1273366 gene locus_tag LOCUS_12080 gene msrA 1272845 1273366 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530793.1 protein_id gnl|my_center|LOCUS_12080 1273523 1274515 gene locus_tag LOCUS_12090 1273523 1274515 CDS product DUF389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029666.1 protein_id gnl|my_center|LOCUS_12090 1274612 1275634 gene locus_tag LOCUS_12100 gene ligD 1274612 1275634 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972287.1 protein_id gnl|my_center|LOCUS_12100 1275749 1276558 gene locus_tag LOCUS_12110 1275749 1276558 CDS product DUF1206 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776922.1 protein_id gnl|my_center|LOCUS_12110 1277436 1276555 gene locus_tag LOCUS_12120 1277436 1276555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226805.1 protein_id gnl|my_center|LOCUS_12120 1277493 1279181 gene locus_tag LOCUS_12130 1277493 1279181 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188700193.1 protein_id gnl|my_center|LOCUS_12130 1279618 1279178 gene locus_tag LOCUS_12140 1279618 1279178 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993326.1 protein_id gnl|my_center|LOCUS_12140 1279738 1280151 gene locus_tag LOCUS_12150 1279738 1280151 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325767.1 protein_id gnl|my_center|LOCUS_12150 1280243 1282477 gene locus_tag LOCUS_12160 1280243 1282477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 1282480 1283886 gene locus_tag LOCUS_12170 1282480 1283886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 1285343 1283844 gene locus_tag LOCUS_12180 1285343 1283844 CDS product cellulose binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028592.1 protein_id gnl|my_center|LOCUS_12180 1285972 1285487 gene locus_tag LOCUS_12190 1285972 1285487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 1285907 1286200 gene locus_tag LOCUS_12200 1285907 1286200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 1286710 1286144 gene locus_tag LOCUS_12210 1286710 1286144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 1287374 1286817 gene locus_tag LOCUS_12220 1287374 1286817 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977747.1 protein_id gnl|my_center|LOCUS_12220 1287552 1288550 gene locus_tag LOCUS_12230 1287552 1288550 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094369.1 protein_id gnl|my_center|LOCUS_12230 1288560 1288877 gene locus_tag LOCUS_12240 1288560 1288877 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350540.1 protein_id gnl|my_center|LOCUS_12240 1289257 1288964 gene locus_tag LOCUS_12250 1289257 1288964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 1290021 1289290 gene locus_tag LOCUS_12260 1290021 1289290 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971514.1 protein_id gnl|my_center|LOCUS_12260 1289996 1290970 gene locus_tag LOCUS_12270 1289996 1290970 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742245.1 protein_id gnl|my_center|LOCUS_12270 1291040 1291366 gene locus_tag LOCUS_12280 1291040 1291366 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015550.1 protein_id gnl|my_center|LOCUS_12280 1291487 1292878 gene locus_tag LOCUS_12290 1291487 1292878 CDS product IS1380-like element ISCgl4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015202.1 protein_id gnl|my_center|LOCUS_12290 1296267 1293037 gene locus_tag LOCUS_12300 1296267 1293037 CDS product glucodextranase DOMON-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227692.1 protein_id gnl|my_center|LOCUS_12300 1297011 1296565 gene locus_tag LOCUS_12310 1297011 1296565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 1298067 1297051 gene locus_tag LOCUS_12320 1298067 1297051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 1298561 1298067 gene locus_tag LOCUS_12330 1298561 1298067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 1298841 1299476 gene locus_tag LOCUS_12340 1298841 1299476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 1299638 1300741 gene locus_tag LOCUS_12350 1299638 1300741 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228314.1 protein_id gnl|my_center|LOCUS_12350 1300738 1301547 gene locus_tag LOCUS_12360 1300738 1301547 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191851039.1 protein_id gnl|my_center|LOCUS_12360 1301544 1302557 gene locus_tag LOCUS_12370 1301544 1302557 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731011.1 protein_id gnl|my_center|LOCUS_12370 1304331 1302682 gene locus_tag LOCUS_12380 1304331 1302682 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141301.1 protein_id gnl|my_center|LOCUS_12380 1305977 1304328 gene locus_tag LOCUS_12390 1305977 1304328 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141300.1 protein_id gnl|my_center|LOCUS_12390 1307236 1305977 gene locus_tag LOCUS_12400 1307236 1305977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 1308655 1307252 gene locus_tag LOCUS_12410 1308655 1307252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 1309545 1308652 gene locus_tag LOCUS_12420 1309545 1308652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 1310459 1309542 gene locus_tag LOCUS_12430 1310459 1309542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 1310702 1311928 gene locus_tag LOCUS_12440 1310702 1311928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 1311929 1313569 gene locus_tag LOCUS_12450 1311929 1313569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 1313623 1317273 gene locus_tag LOCUS_12460 gene metH 1313623 1317273 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027904.1 protein_id gnl|my_center|LOCUS_12460 1318417 1317350 gene locus_tag LOCUS_12470 1318417 1317350 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730979.1 protein_id gnl|my_center|LOCUS_12470 1320448 1319006 gene locus_tag LOCUS_12480 1320448 1319006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 1320541 1321470 gene locus_tag LOCUS_12490 1320541 1321470 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529581.1 protein_id gnl|my_center|LOCUS_12490 1322224 1321436 gene locus_tag LOCUS_12500 1322224 1321436 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230734.1 protein_id gnl|my_center|LOCUS_12500 1324326 1322245 gene locus_tag LOCUS_12510 1324326 1322245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 1324526 1324326 gene locus_tag LOCUS_12520 1324526 1324326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 1326211 1324883 gene locus_tag LOCUS_12530 1326211 1324883 CDS product bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893059.1 protein_id gnl|my_center|LOCUS_12530 1327473 1326292 gene locus_tag LOCUS_12540 1327473 1326292 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027320.1 protein_id gnl|my_center|LOCUS_12540 1327651 1328409 gene locus_tag LOCUS_12550 1327651 1328409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 1328960 1328424 gene locus_tag LOCUS_12560 1328960 1328424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 1330439 1329057 gene locus_tag LOCUS_12570 1330439 1329057 CDS product MHS family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406233.1 protein_id gnl|my_center|LOCUS_12570 1331412 1330555 gene locus_tag LOCUS_12580 1331412 1330555 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730686.1 protein_id gnl|my_center|LOCUS_12580 1332465 1331482 gene locus_tag LOCUS_12590 1332465 1331482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12590 1332932 1332450 gene locus_tag LOCUS_12600 1332932 1332450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12600 1333227 1333934 gene locus_tag LOCUS_12610 1333227 1333934 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226620.1 protein_id gnl|my_center|LOCUS_12610 1334751 1333969 gene locus_tag LOCUS_12620 1334751 1333969 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971721.1 protein_id gnl|my_center|LOCUS_12620 1334846 1336348 gene locus_tag LOCUS_12630 1334846 1336348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 1336341 1337039 gene locus_tag LOCUS_12640 1336341 1337039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 1337036 1340401 gene locus_tag LOCUS_12650 1337036 1340401 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930290.1 protein_id gnl|my_center|LOCUS_12650 1340436 1341446 gene locus_tag LOCUS_12660 1340436 1341446 CDS product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296757.1 protein_id gnl|my_center|LOCUS_12660 1341664 1341458 gene locus_tag LOCUS_12670 1341664 1341458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 1342275 1341661 gene locus_tag LOCUS_12680 1342275 1341661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 1342332 1343957 gene locus_tag LOCUS_12690 1342332 1343957 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065424.1 protein_id gnl|my_center|LOCUS_12690 1344002 1344979 gene locus_tag LOCUS_12700 1344002 1344979 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086845576.1 protein_id gnl|my_center|LOCUS_12700 1345037 1347271 gene locus_tag LOCUS_12710 1345037 1347271 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804687.1 protein_id gnl|my_center|LOCUS_12710 1348152 1347268 gene locus_tag LOCUS_12720 1348152 1347268 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933138.1 protein_id gnl|my_center|LOCUS_12720 1348792 1348187 gene locus_tag LOCUS_12730 1348792 1348187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12730 1350543 1348702 gene locus_tag LOCUS_12740 1350543 1348702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12740 1351378 1350554 gene locus_tag LOCUS_12750 1351378 1350554 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328122.1 protein_id gnl|my_center|LOCUS_12750 1351954 1352931 gene locus_tag LOCUS_12760 1351954 1352931 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898125.1 protein_id gnl|my_center|LOCUS_12760 1353271 1352921 gene locus_tag LOCUS_12770 1353271 1352921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 1353449 1354069 gene locus_tag LOCUS_12780 1353449 1354069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 1354051 1356066 gene locus_tag LOCUS_12790 1354051 1356066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 1357514 1356099 gene locus_tag LOCUS_12800 1357514 1356099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 1357617 1358015 gene locus_tag LOCUS_12810 1357617 1358015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 1358008 1360056 gene locus_tag LOCUS_12820 1358008 1360056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 1360620 1360111 gene locus_tag LOCUS_12830 1360620 1360111 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058277.1 protein_id gnl|my_center|LOCUS_12830 1361928 1360675 gene locus_tag LOCUS_12840 1361928 1360675 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225761.1 protein_id gnl|my_center|LOCUS_12840 1362297 1363685 gene locus_tag LOCUS_12850 gene sulP 1362297 1363685 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085632.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12850 1364091 1363717 gene locus_tag LOCUS_12860 1364091 1363717 CDS product DUF1622 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199254442.1 protein_id gnl|my_center|LOCUS_12860 1364225 1364662 gene locus_tag LOCUS_12870 1364225 1364662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 1364676 1364993 gene locus_tag LOCUS_12880 1364676 1364993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 1365033 1365539 gene locus_tag LOCUS_12890 1365033 1365539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 1366873 1365866 gene locus_tag LOCUS_12900 1366873 1365866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12900 1367307 1366873 gene locus_tag LOCUS_12910 1367307 1366873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085100849.1 protein_id gnl|my_center|LOCUS_12910 1367530 1368030 gene locus_tag LOCUS_12920 1367530 1368030 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528038.1 protein_id gnl|my_center|LOCUS_12920 1369475 1368036 gene locus_tag LOCUS_12930 1369475 1368036 CDS product trehalose biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776613.1 protein_id gnl|my_center|LOCUS_12930 1369635 1370486 gene locus_tag LOCUS_12940 1369635 1370486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 1371700 1370483 gene locus_tag LOCUS_12950 1371700 1370483 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228153.1 protein_id gnl|my_center|LOCUS_12950 1371776 1372384 gene locus_tag LOCUS_12960 1371776 1372384 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230155.1 protein_id gnl|my_center|LOCUS_12960 1372427 1372933 gene locus_tag LOCUS_12970 1372427 1372933 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059290.1 protein_id gnl|my_center|LOCUS_12970 1373706 1372930 gene locus_tag LOCUS_12980 1373706 1372930 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405712.1 protein_id gnl|my_center|LOCUS_12980 1373834 1375561 gene locus_tag LOCUS_12990 1373834 1375561 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730685.1 protein_id gnl|my_center|LOCUS_12990 1376460 1375582 gene locus_tag LOCUS_13000 1376460 1375582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 1377231 1376473 gene locus_tag LOCUS_13010 1377231 1376473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 1377496 1379034 gene locus_tag LOCUS_13020 1377496 1379034 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029117.1 protein_id gnl|my_center|LOCUS_13020 1380158 1379064 gene locus_tag LOCUS_13030 1380158 1379064 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226146.1 protein_id gnl|my_center|LOCUS_13030 1380302 1382494 gene locus_tag LOCUS_13040 1380302 1382494 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930028.1 protein_id gnl|my_center|LOCUS_13040 1385923 1382507 gene locus_tag LOCUS_13050 gene dnaE 1385923 1382507 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027948.1 protein_id gnl|my_center|LOCUS_13050 1386205 1385933 gene locus_tag LOCUS_13060 1386205 1385933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 1386421 1388463 gene locus_tag LOCUS_13070 1386421 1388463 CDS product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777008.1 protein_id gnl|my_center|LOCUS_13070 1388503 1389651 gene locus_tag LOCUS_13080 1388503 1389651 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039137.1 protein_id gnl|my_center|LOCUS_13080 1389817 1391034 gene locus_tag LOCUS_13090 gene fdhA 1389817 1391034 CDS product formaldehyde dehydrogenase, glutathione-independent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226972.1 protein_id gnl|my_center|LOCUS_13090 1391891 1391109 gene locus_tag LOCUS_13100 1391891 1391109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 1392010 1393128 gene locus_tag LOCUS_13110 gene moaA 1392010 1393128 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532083.1 protein_id gnl|my_center|LOCUS_13110 1393134 1393964 gene locus_tag LOCUS_13120 gene fdhD 1393134 1393964 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891497.1 protein_id gnl|my_center|LOCUS_13120 1396315 1394000 gene locus_tag LOCUS_13130 1396315 1394000 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228501.1 protein_id gnl|my_center|LOCUS_13130 1396477 1397871 gene locus_tag LOCUS_13140 1396477 1397871 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228504.1 protein_id gnl|my_center|LOCUS_13140 1398204 1400408 gene locus_tag LOCUS_13150 1398204 1400408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 1400501 1401718 gene locus_tag LOCUS_13160 1400501 1401718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 1401890 1402897 gene locus_tag LOCUS_13170 1401890 1402897 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207962.1 protein_id gnl|my_center|LOCUS_13170 1402890 1404122 gene locus_tag LOCUS_13180 1402890 1404122 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061002650.1 protein_id gnl|my_center|LOCUS_13180 1404194 1404964 gene locus_tag LOCUS_13190 1404194 1404964 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404735.1 protein_id gnl|my_center|LOCUS_13190 1405129 1406319 gene locus_tag LOCUS_13200 1405129 1406319 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419062.1 protein_id gnl|my_center|LOCUS_13200 1406316 1407584 gene locus_tag LOCUS_13210 gene hpxK 1406316 1407584 CDS product allantoate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705408.1 protein_id gnl|my_center|LOCUS_13210 1407581 1408432 gene locus_tag LOCUS_13220 gene hpxU 1407581 1408432 CDS product MurR/RpiR family transcriptional regulator HpxU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705414.1 protein_id gnl|my_center|LOCUS_13220 1411030 1408436 gene locus_tag LOCUS_13230 1411030 1408436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 1411729 1411115 gene locus_tag LOCUS_13240 1411729 1411115 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223758.1 protein_id gnl|my_center|LOCUS_13240 1411824 1412315 gene locus_tag LOCUS_13250 gene uraD 1411824 1412315 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804455.1 protein_id gnl|my_center|LOCUS_13250 1412312 1412650 gene locus_tag LOCUS_13260 gene uraH 1412312 1412650 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057392.1 protein_id gnl|my_center|LOCUS_13260 1414077 1412647 gene locus_tag LOCUS_13270 1414077 1412647 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296612.1 protein_id gnl|my_center|LOCUS_13270 1415008 1414103 gene locus_tag LOCUS_13280 gene pucL 1415008 1414103 CDS product urate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057393.1 protein_id gnl|my_center|LOCUS_13280 1416317 1415055 gene locus_tag LOCUS_13290 gene allB 1416317 1415055 CDS product allantoinase AllB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972680.1 protein_id gnl|my_center|LOCUS_13290 1416476 1417804 gene locus_tag LOCUS_13300 1416476 1417804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 1417887 1418675 gene locus_tag LOCUS_13310 1417887 1418675 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172561.1 protein_id gnl|my_center|LOCUS_13310 1418789 1419943 gene locus_tag LOCUS_13320 1418789 1419943 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030710.1 protein_id gnl|my_center|LOCUS_13320 1422722 1419948 gene locus_tag LOCUS_13330 1422722 1419948 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088902.1 protein_id gnl|my_center|LOCUS_13330 1423561 1422719 gene locus_tag LOCUS_13340 1423561 1422719 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877026.1 protein_id gnl|my_center|LOCUS_13340 1424314 1423757 gene locus_tag LOCUS_13350 1424314 1423757 CDS product DUF2017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975896.1 protein_id gnl|my_center|LOCUS_13350 1424589 1424311 gene locus_tag LOCUS_13360 gene clpS 1424589 1424311 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896307.1 protein_id gnl|my_center|LOCUS_13360 1424770 1425999 gene locus_tag LOCUS_13370 1424770 1425999 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224700.1 protein_id gnl|my_center|LOCUS_13370 1425996 1426481 gene locus_tag LOCUS_13380 1425996 1426481 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894513.1 protein_id gnl|my_center|LOCUS_13380 1426582 1426971 gene locus_tag LOCUS_13390 1426582 1426971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 1427871 1427116 gene locus_tag LOCUS_13400 1427871 1427116 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235190991.1 protein_id gnl|my_center|LOCUS_13400 1428278 1427898 gene locus_tag LOCUS_13410 1428278 1427898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 1429156 1428275 gene locus_tag LOCUS_13420 gene flgL 1429156 1428275 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392268.1 protein_id gnl|my_center|LOCUS_13420 1430605 1429160 gene locus_tag LOCUS_13430 gene flgK 1430605 1429160 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460797.1 protein_id gnl|my_center|LOCUS_13430 1431101 1430616 gene locus_tag LOCUS_13440 1431101 1430616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 1431310 1432239 gene locus_tag LOCUS_13450 1431310 1432239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 1434155 1432680 gene locus_tag LOCUS_13460 1434155 1432680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 1434343 1435533 gene locus_tag LOCUS_13470 1434343 1435533 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037106.1 protein_id gnl|my_center|LOCUS_13470 1435666 1437009 gene locus_tag LOCUS_13480 1435666 1437009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 1437009 1437449 gene locus_tag LOCUS_13490 gene fliS 1437009 1437449 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860686.1 protein_id gnl|my_center|LOCUS_13490 1437442 1437786 gene locus_tag LOCUS_13500 1437442 1437786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 1437944 1438285 gene locus_tag LOCUS_13510 gene flgB 1437944 1438285 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214564.1 protein_id gnl|my_center|LOCUS_13510 1438285 1438677 gene locus_tag LOCUS_13520 gene flgC 1438285 1438677 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870081.1 protein_id gnl|my_center|LOCUS_13520 1438677 1438982 gene locus_tag LOCUS_13530 1438677 1438982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 1438982 1440574 gene locus_tag LOCUS_13540 gene fliF 1438982 1440574 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880743.1 protein_id gnl|my_center|LOCUS_13540 1440571 1441587 gene locus_tag LOCUS_13550 gene fliG 1440571 1441587 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932791.1 protein_id gnl|my_center|LOCUS_13550 1441577 1442185 gene locus_tag LOCUS_13560 1441577 1442185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 1442182 1443504 gene locus_tag LOCUS_13570 gene fliI 1442182 1443504 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460756.1 protein_id gnl|my_center|LOCUS_13570 1443504 1443956 gene locus_tag LOCUS_13580 1443504 1443956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 1443953 1444594 gene locus_tag LOCUS_13590 1443953 1444594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 1444591 1445898 gene locus_tag LOCUS_13600 1444591 1445898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 1445913 1446344 gene locus_tag LOCUS_13610 1445913 1446344 CDS product flagellar hook capping FlgD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721817.1 protein_id gnl|my_center|LOCUS_13610 1446391 1447581 gene locus_tag LOCUS_13620 gene flgE 1446391 1447581 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657723.1 protein_id gnl|my_center|LOCUS_13620 1448763 1447969 gene locus_tag LOCUS_13630 1448763 1447969 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223778.1 protein_id gnl|my_center|LOCUS_13630 1449818 1448760 gene locus_tag LOCUS_13640 1449818 1448760 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223779.1 protein_id gnl|my_center|LOCUS_13640 1450777 1449815 gene locus_tag LOCUS_13650 1450777 1449815 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223780.1 protein_id gnl|my_center|LOCUS_13650 1451870 1450842 gene locus_tag LOCUS_13660 1451870 1450842 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015602.1 protein_id gnl|my_center|LOCUS_13660 1453007 1451982 gene locus_tag LOCUS_13670 1453007 1451982 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223782.1 protein_id gnl|my_center|LOCUS_13670 1453101 1453334 gene locus_tag LOCUS_13680 1453101 1453334 CDS product flagellar FlbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556881.1 protein_id gnl|my_center|LOCUS_13680 1453334 1454164 gene locus_tag LOCUS_13690 1453334 1454164 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460801.1 protein_id gnl|my_center|LOCUS_13690 1454161 1455015 gene locus_tag LOCUS_13700 1454161 1455015 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391996.1 protein_id gnl|my_center|LOCUS_13700 1455085 1455966 gene locus_tag LOCUS_13710 gene fliM 1455085 1455966 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666990.1 protein_id gnl|my_center|LOCUS_13710 1455966 1456673 gene locus_tag LOCUS_13720 1455966 1456673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 1456675 1457127 gene locus_tag LOCUS_13730 1456675 1457127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 1457124 1458005 gene locus_tag LOCUS_13740 1457124 1458005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 1458005 1458280 gene locus_tag LOCUS_13750 gene fliQ 1458005 1458280 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160414.1 protein_id gnl|my_center|LOCUS_13750 1458280 1459038 gene locus_tag LOCUS_13760 gene fliR 1458280 1459038 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039843.1 protein_id gnl|my_center|LOCUS_13760 1459039 1460166 gene locus_tag LOCUS_13770 gene flhB 1459039 1460166 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063731.1 protein_id gnl|my_center|LOCUS_13770 1460168 1462219 gene locus_tag LOCUS_13780 gene flhA 1460168 1462219 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460749.1 protein_id gnl|my_center|LOCUS_13780 1462194 1463135 gene locus_tag LOCUS_13790 1462194 1463135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 1463145 1463507 gene locus_tag LOCUS_13800 1463145 1463507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 1463611 1465056 gene locus_tag LOCUS_13810 1463611 1465056 CDS product lipase maturation factor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893142.1 protein_id gnl|my_center|LOCUS_13810 1465456 1465085 gene locus_tag LOCUS_13820 1465456 1465085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 1466397 1465498 gene locus_tag LOCUS_13830 1466397 1465498 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804089.1 protein_id gnl|my_center|LOCUS_13830 1466707 1466384 gene locus_tag LOCUS_13840 1466707 1466384 CDS product lycopene cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804090.1 protein_id gnl|my_center|LOCUS_13840 1467027 1466704 gene locus_tag LOCUS_13850 1467027 1466704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 1468631 1467024 gene locus_tag LOCUS_13860 gene crtI 1468631 1467024 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804092.1 protein_id gnl|my_center|LOCUS_13860 1469521 1468628 gene locus_tag LOCUS_13870 1469521 1468628 CDS product squalene/phytoene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930127.1 protein_id gnl|my_center|LOCUS_13870 1470564 1469518 gene locus_tag LOCUS_13880 1470564 1469518 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804096.1 protein_id gnl|my_center|LOCUS_13880 1471102 1470557 gene locus_tag LOCUS_13890 gene idi 1471102 1470557 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804097.1 protein_id gnl|my_center|LOCUS_13890 1471297 1471689 gene locus_tag LOCUS_13900 1471297 1471689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 1471739 1472206 gene locus_tag LOCUS_13910 1471739 1472206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 1474681 1472138 gene locus_tag LOCUS_13920 1474681 1472138 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804342.1 protein_id gnl|my_center|LOCUS_13920 1474782 1475600 gene locus_tag LOCUS_13930 1474782 1475600 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804341.1 protein_id gnl|my_center|LOCUS_13930 1475696 1476289 gene locus_tag LOCUS_13940 1475696 1476289 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221514425.1 protein_id gnl|my_center|LOCUS_13940 1476300 1476797 gene locus_tag LOCUS_13950 1476300 1476797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 1476797 1477492 gene locus_tag LOCUS_13960 1476797 1477492 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027756.1 protein_id gnl|my_center|LOCUS_13960 1477631 1478182 gene locus_tag LOCUS_13970 1477631 1478182 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805153.1 protein_id gnl|my_center|LOCUS_13970 1479157 1478342 gene locus_tag LOCUS_13980 1479157 1478342 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805154.1 protein_id gnl|my_center|LOCUS_13980 1479235 1482639 gene locus_tag LOCUS_13990 1479235 1482639 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027194.1 protein_id gnl|my_center|LOCUS_13990 1482665 1484077 gene locus_tag LOCUS_14000 1482665 1484077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 1484119 1484610 gene locus_tag LOCUS_14010 gene def 1484119 1484610 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224209.1 protein_id gnl|my_center|LOCUS_14010 1486704 1484872 gene locus_tag LOCUS_14020 1486704 1484872 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805025.1 protein_id gnl|my_center|LOCUS_14020 1486887 1487837 gene locus_tag LOCUS_14030 1486887 1487837 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030775.1 protein_id gnl|my_center|LOCUS_14030 1487909 1488598 gene locus_tag LOCUS_14040 1487909 1488598 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080236.1 protein_id gnl|my_center|LOCUS_14040 1488706 1490106 gene locus_tag LOCUS_14050 1488706 1490106 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174265947.1 protein_id gnl|my_center|LOCUS_14050 1492150 1490198 gene locus_tag LOCUS_14060 gene pknB 1492150 1490198 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486214.1 protein_id gnl|my_center|LOCUS_14060 1493489 1492221 gene locus_tag LOCUS_14070 1493489 1492221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 1493642 1493983 gene locus_tag LOCUS_14080 1493642 1493983 CDS product Rv2175c family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805032.1 protein_id gnl|my_center|LOCUS_14080 1494931 1493990 gene locus_tag LOCUS_14090 1494931 1493990 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171512886.1 protein_id gnl|my_center|LOCUS_14090 1495079 1495567 gene locus_tag LOCUS_14100 1495079 1495567 CDS product DUF3040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729665.1 protein_id gnl|my_center|LOCUS_14100 1495859 1496290 gene locus_tag LOCUS_14110 gene mraZ 1495859 1496290 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804693.1 protein_id gnl|my_center|LOCUS_14110 1496390 1497343 gene locus_tag LOCUS_14120 gene rsmH 1496390 1497343 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228045.1 protein_id gnl|my_center|LOCUS_14120 1497340 1497942 gene locus_tag LOCUS_14130 1497340 1497942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 1498101 1499909 gene locus_tag LOCUS_14140 1498101 1499909 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804696.1 protein_id gnl|my_center|LOCUS_14140 1499914 1501467 gene locus_tag LOCUS_14150 1499914 1501467 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028131.1 protein_id gnl|my_center|LOCUS_14150 1501468 1502880 gene locus_tag LOCUS_14160 1501468 1502880 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976727.1 protein_id gnl|my_center|LOCUS_14160 1502877 1503983 gene locus_tag LOCUS_14170 gene mraY 1502877 1503983 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804699.1 protein_id gnl|my_center|LOCUS_14170 1503956 1505467 gene locus_tag LOCUS_14180 gene murD 1503956 1505467 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976729.1 protein_id gnl|my_center|LOCUS_14180 1505472 1506704 gene locus_tag LOCUS_14190 gene ftsW 1505472 1506704 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804701.1 protein_id gnl|my_center|LOCUS_14190 1506761 1507768 gene locus_tag LOCUS_14200 gene murG 1506761 1507768 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976731.1 protein_id gnl|my_center|LOCUS_14200 1507858 1509255 gene locus_tag LOCUS_14210 gene murC 1507858 1509255 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228036.1 protein_id gnl|my_center|LOCUS_14210 1509434 1510264 gene locus_tag LOCUS_14220 1509434 1510264 CDS product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228035.1 protein_id gnl|my_center|LOCUS_14220 1510414 1511649 gene locus_tag LOCUS_14230 1510414 1511649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 1511618 1512352 gene locus_tag LOCUS_14240 1511618 1512352 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028129.1 protein_id gnl|my_center|LOCUS_14240 1512388 1512936 gene locus_tag LOCUS_14250 1512388 1512936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 1512945 1513229 gene locus_tag LOCUS_14260 1512945 1513229 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060938.1 protein_id gnl|my_center|LOCUS_14260 1513390 1514022 gene locus_tag LOCUS_14270 1513390 1514022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 1514114 1514620 gene locus_tag LOCUS_14280 1514114 1514620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 1514617 1515543 gene locus_tag LOCUS_14290 1514617 1515543 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976742.1 protein_id gnl|my_center|LOCUS_14290 1515679 1519146 gene locus_tag LOCUS_14300 gene dnaE 1515679 1519146 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804720.1 protein_id gnl|my_center|LOCUS_14300 1519191 1519961 gene locus_tag LOCUS_14310 1519191 1519961 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084095.1 protein_id gnl|my_center|LOCUS_14310 1520524 1519958 gene locus_tag LOCUS_14320 1520524 1519958 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977747.1 protein_id gnl|my_center|LOCUS_14320 1520595 1521929 gene locus_tag LOCUS_14330 gene hisD 1520595 1521929 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776210.1 protein_id gnl|my_center|LOCUS_14330 1521980 1522474 gene locus_tag LOCUS_14340 gene nrdR 1521980 1522474 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804686.1 protein_id gnl|my_center|LOCUS_14340 1522480 1523517 gene locus_tag LOCUS_14350 1522480 1523517 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977344.1 protein_id gnl|my_center|LOCUS_14350 1524592 1523519 gene locus_tag LOCUS_14360 1524592 1523519 CDS product DUF2183 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930149.1 protein_id gnl|my_center|LOCUS_14360 1524950 1524696 gene locus_tag LOCUS_14370 1524950 1524696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 1524867 1525388 gene locus_tag LOCUS_14380 1524867 1525388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 1525488 1526372 gene locus_tag LOCUS_14390 1525488 1526372 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776968.1 protein_id gnl|my_center|LOCUS_14390 1526369 1527070 gene locus_tag LOCUS_14400 1526369 1527070 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776967.1 protein_id gnl|my_center|LOCUS_14400 1527067 1527774 gene locus_tag LOCUS_14410 1527067 1527774 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776966.1 protein_id gnl|my_center|LOCUS_14410 1527805 1528731 gene locus_tag LOCUS_14420 1527805 1528731 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776965.1 protein_id gnl|my_center|LOCUS_14420 1529782 1528835 gene locus_tag LOCUS_14430 1529782 1528835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 1530197 1529802 gene locus_tag LOCUS_14440 1530197 1529802 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225370.1 protein_id gnl|my_center|LOCUS_14440 1530277 1531686 gene locus_tag LOCUS_14450 1530277 1531686 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227294.1 protein_id gnl|my_center|LOCUS_14450 1531714 1532718 gene locus_tag LOCUS_14460 gene cydB 1531714 1532718 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029331.1 protein_id gnl|my_center|LOCUS_14460 1532719 1534371 gene locus_tag LOCUS_14470 1532719 1534371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 1534364 1536043 gene locus_tag LOCUS_14480 1534364 1536043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 1536688 1536053 gene locus_tag LOCUS_14490 1536688 1536053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 1536751 1538208 gene locus_tag LOCUS_14500 1536751 1538208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 1538286 1540883 gene locus_tag LOCUS_14510 gene leuS 1538286 1540883 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392105.1 protein_id gnl|my_center|LOCUS_14510 1540986 1541663 gene locus_tag LOCUS_14520 1540986 1541663 CDS product ComEA family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392107.1 protein_id gnl|my_center|LOCUS_14520 1541660 1544047 gene locus_tag LOCUS_14530 1541660 1544047 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028431.1 protein_id gnl|my_center|LOCUS_14530 1544096 1545142 gene locus_tag LOCUS_14540 1544096 1545142 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775770.1 protein_id gnl|my_center|LOCUS_14540 1545537 1545157 gene locus_tag LOCUS_14550 1545537 1545157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 1545931 1545668 gene locus_tag LOCUS_14560 gene rpsT 1545931 1545668 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976241.1 protein_id gnl|my_center|LOCUS_14560 1546114 1547325 gene locus_tag LOCUS_14570 1546114 1547325 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230159.1 protein_id gnl|my_center|LOCUS_14570 1547385 1549241 gene locus_tag LOCUS_14580 gene lepA 1547385 1549241 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083190386.1 protein_id gnl|my_center|LOCUS_14580 1549246 1549893 gene locus_tag LOCUS_14590 1549246 1549893 CDS product DUF1990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943975.1 protein_id gnl|my_center|LOCUS_14590 1549898 1551121 gene locus_tag LOCUS_14600 gene hemW 1549898 1551121 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326185.1 protein_id gnl|my_center|LOCUS_14600 1551503 1551126 gene locus_tag LOCUS_14610 1551503 1551126 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266257.1 protein_id gnl|my_center|LOCUS_14610 1552025 1551585 gene locus_tag LOCUS_14620 1552025 1551585 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037733.1 protein_id gnl|my_center|LOCUS_14620 1552204 1553235 gene locus_tag LOCUS_14630 gene hrcA 1552204 1553235 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976249.1 protein_id gnl|my_center|LOCUS_14630 1553313 1554422 gene locus_tag LOCUS_14640 gene dnaJ 1553313 1554422 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976250.1 protein_id gnl|my_center|LOCUS_14640 1554440 1555180 gene locus_tag LOCUS_14650 1554440 1555180 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228402.1 protein_id gnl|my_center|LOCUS_14650 1555200 1555577 gene locus_tag LOCUS_14660 1555200 1555577 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775756.1 protein_id gnl|my_center|LOCUS_14660 1555564 1556661 gene locus_tag LOCUS_14670 1555564 1556661 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976271.1 protein_id gnl|my_center|LOCUS_14670 1556658 1557122 gene locus_tag LOCUS_14680 gene ybeY 1556658 1557122 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775754.1 protein_id gnl|my_center|LOCUS_14680 1557122 1558450 gene locus_tag LOCUS_14690 1557122 1558450 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228398.1 protein_id gnl|my_center|LOCUS_14690 1558434 1559351 gene locus_tag LOCUS_14700 gene era 1558434 1559351 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326176.1 protein_id gnl|my_center|LOCUS_14700 1559522 1561288 gene locus_tag LOCUS_14710 gene leuA 1559522 1561288 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930223.1 protein_id gnl|my_center|LOCUS_14710 1562077 1561385 gene locus_tag LOCUS_14720 1562077 1561385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 1562166 1562888 gene locus_tag LOCUS_14730 gene recO 1562166 1562888 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228390.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14730 1562885 1563736 gene locus_tag LOCUS_14740 1562885 1563736 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775743.1 protein_id gnl|my_center|LOCUS_14740 1563859 1564536 gene locus_tag LOCUS_14750 gene frnE 1563859 1564536 CDS product protein disulfide isomerase FrnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887304.1 protein_id gnl|my_center|LOCUS_14750 1564762 1565934 gene locus_tag LOCUS_14760 gene dusB 1564762 1565934 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010147544.1 protein_id gnl|my_center|LOCUS_14760 1565927 1567192 gene locus_tag LOCUS_14770 1565927 1567192 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775728.1 protein_id gnl|my_center|LOCUS_14770 1567648 1569504 gene locus_tag LOCUS_14780 gene dnaG 1567648 1569504 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775727.1 protein_id gnl|my_center|LOCUS_14780 1569656 1571290 gene locus_tag LOCUS_14790 1569656 1571290 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115413031.1 protein_id gnl|my_center|LOCUS_14790 1571383 1572474 gene locus_tag LOCUS_14800 1571383 1572474 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052566.1 protein_id gnl|my_center|LOCUS_14800 1572476 1573549 gene locus_tag LOCUS_14810 1572476 1573549 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363253.1 protein_id gnl|my_center|LOCUS_14810 1573546 1575246 gene locus_tag LOCUS_14820 1573546 1575246 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052568.1 protein_id gnl|my_center|LOCUS_14820 1575252 1576133 gene locus_tag LOCUS_14830 1575252 1576133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14830 1576335 1576408 gene locus_tag LOCUS_t00100 1576335 1576408 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1576492 1577238 gene locus_tag LOCUS_14840 1576492 1577238 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804665.1 protein_id gnl|my_center|LOCUS_14840 1577235 1577540 gene locus_tag LOCUS_14850 1577235 1577540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 1578140 1577568 gene locus_tag LOCUS_14860 1578140 1577568 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230292.1 protein_id gnl|my_center|LOCUS_14860 1578181 1579095 gene locus_tag LOCUS_14870 1578181 1579095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031110.1 protein_id gnl|my_center|LOCUS_14870 1579266 1580507 gene locus_tag LOCUS_14880 1579266 1580507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 1580532 1580606 gene locus_tag LOCUS_t00110 1580532 1580606 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1580754 1581023 gene locus_tag LOCUS_14890 1580754 1581023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 1581023 1582210 gene locus_tag LOCUS_14900 1581023 1582210 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112911.1 protein_id gnl|my_center|LOCUS_14900 1582458 1583084 gene locus_tag LOCUS_14910 1582458 1583084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 1583837 1583268 gene locus_tag LOCUS_14920 1583837 1583268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 1585005 1583923 gene locus_tag LOCUS_14930 1585005 1583923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 1585526 1585050 gene locus_tag LOCUS_14940 1585526 1585050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 1585757 1587814 gene locus_tag LOCUS_14950 1585757 1587814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 1587814 1589475 gene locus_tag LOCUS_14960 1587814 1589475 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414057.1 protein_id gnl|my_center|LOCUS_14960 1589468 1590604 gene locus_tag LOCUS_14970 1589468 1590604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 1590701 1593916 gene locus_tag LOCUS_14980 1590701 1593916 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257687.1 protein_id gnl|my_center|LOCUS_14980 1594059 1596068 gene locus_tag LOCUS_14990 1594059 1596068 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103655.1 protein_id gnl|my_center|LOCUS_14990 1596256 1596933 gene locus_tag LOCUS_15000 1596256 1596933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 1597577 1597014 gene locus_tag LOCUS_15010 1597577 1597014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 1598044 1597586 gene locus_tag LOCUS_15020 1598044 1597586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 1598455 1599489 gene locus_tag LOCUS_15030 1598455 1599489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 1601546 1599711 gene locus_tag LOCUS_15040 1601546 1599711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 1602533 1601574 gene locus_tag LOCUS_15050 1602533 1601574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 1604087 1602624 gene locus_tag LOCUS_15060 1604087 1602624 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031263.1 protein_id gnl|my_center|LOCUS_15060 1604542 1604111 gene locus_tag LOCUS_15070 1604542 1604111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 1604767 1606161 gene locus_tag LOCUS_15080 1604767 1606161 CDS product IS1380-like element ISCgl4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015202.1 protein_id gnl|my_center|LOCUS_15080 1606648 1608099 gene locus_tag LOCUS_15090 1606648 1608099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 1609931 1608468 gene locus_tag LOCUS_15100 1609931 1608468 CDS product type VII secretion protein EccE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029051.1 protein_id gnl|my_center|LOCUS_15100 1611295 1609934 gene locus_tag LOCUS_15110 1611295 1609934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 1611594 1611325 gene locus_tag LOCUS_15120 1611594 1611325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 1613497 1611728 gene locus_tag LOCUS_15130 1613497 1611728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 1613814 1614356 gene locus_tag LOCUS_15140 1613814 1614356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15140 1614275 1614943 gene locus_tag LOCUS_15150 1614275 1614943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 1615242 1614976 gene locus_tag LOCUS_15160 1615242 1614976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 1616404 1615244 gene locus_tag LOCUS_15170 1616404 1615244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 1617067 1616414 gene locus_tag LOCUS_15180 1617067 1616414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235933774.1 protein_id gnl|my_center|LOCUS_15180 1618184 1617102 gene locus_tag LOCUS_15190 1618184 1617102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 1619005 1618181 gene locus_tag LOCUS_15200 1619005 1618181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 1619436 1619062 gene locus_tag LOCUS_15210 1619436 1619062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 1620426 1619527 gene locus_tag LOCUS_15220 1620426 1619527 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029372.1 protein_id gnl|my_center|LOCUS_15220 1621577 1620426 gene locus_tag LOCUS_15230 1621577 1620426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 1621682 1622200 gene locus_tag LOCUS_15240 1621682 1622200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 1622118 1622672 gene locus_tag LOCUS_15250 1622118 1622672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 1622669 1623679 gene locus_tag LOCUS_15260 1622669 1623679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 1623685 1624833 gene locus_tag LOCUS_15270 1623685 1624833 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047119416.1 protein_id gnl|my_center|LOCUS_15270 1625131 1625886 gene locus_tag LOCUS_15280 1625131 1625886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 1625879 1629313 gene locus_tag LOCUS_15290 1625879 1629313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 1632420 1629343 gene locus_tag LOCUS_15300 1632420 1629343 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918509.1 protein_id gnl|my_center|LOCUS_15300 1633718 1632420 gene locus_tag LOCUS_15310 1633718 1632420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 1635745 1633766 gene locus_tag LOCUS_15320 1635745 1633766 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918506.1 protein_id gnl|my_center|LOCUS_15320 1636761 1635955 gene locus_tag LOCUS_15330 1636761 1635955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 1636991 1637179 gene locus_tag LOCUS_15340 1636991 1637179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 1637336 1637893 gene locus_tag LOCUS_15350 1637336 1637893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 1638781 1637969 gene locus_tag LOCUS_15360 1638781 1637969 CDS product ExeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899491.1 protein_id gnl|my_center|LOCUS_15360 1640190 1638778 gene locus_tag LOCUS_15370 1640190 1638778 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144956692.1 protein_id gnl|my_center|LOCUS_15370 1640717 1641034 gene locus_tag LOCUS_15380 1640717 1641034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 1641232 1641630 gene locus_tag LOCUS_15390 1641232 1641630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 1642234 1641905 gene locus_tag LOCUS_15400 1642234 1641905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 1642176 1645736 gene locus_tag LOCUS_15410 1642176 1645736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 1646099 1647346 gene locus_tag LOCUS_15420 1646099 1647346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 1647346 1648725 gene locus_tag LOCUS_15430 1647346 1648725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 1649361 1649750 gene locus_tag LOCUS_15440 1649361 1649750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 1649874 1650140 gene locus_tag LOCUS_15450 1649874 1650140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 1650274 1651413 gene locus_tag LOCUS_15460 1650274 1651413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 1651838 1651650 gene locus_tag LOCUS_15470 1651838 1651650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 1651888 1652247 gene locus_tag LOCUS_15480 1651888 1652247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 1652496 1652263 gene locus_tag LOCUS_15490 1652496 1652263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 1653921 1652704 gene locus_tag LOCUS_15500 1653921 1652704 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877333.1 protein_id gnl|my_center|LOCUS_15500 1654265 1653918 gene locus_tag LOCUS_15510 1654265 1653918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 1655441 1654485 gene locus_tag LOCUS_15520 1655441 1654485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 1656415 1655438 gene locus_tag LOCUS_15530 1656415 1655438 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223551.1 protein_id gnl|my_center|LOCUS_15530 1657189 1656425 gene locus_tag LOCUS_15540 1657189 1656425 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223550.1 protein_id gnl|my_center|LOCUS_15540 1658196 1657225 gene locus_tag LOCUS_15550 1658196 1657225 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225688.1 protein_id gnl|my_center|LOCUS_15550 1658367 1659269 gene locus_tag LOCUS_15560 1658367 1659269 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729508.1 protein_id gnl|my_center|LOCUS_15560 1659303 1660529 gene locus_tag LOCUS_15570 1659303 1660529 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331310.1 protein_id gnl|my_center|LOCUS_15570 1660532 1661413 gene locus_tag LOCUS_15580 1660532 1661413 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002725043.1 protein_id gnl|my_center|LOCUS_15580 1661413 1662435 gene locus_tag LOCUS_15590 1661413 1662435 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397979.1 protein_id gnl|my_center|LOCUS_15590 1662432 1663190 gene locus_tag LOCUS_15600 1662432 1663190 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083886.1 protein_id gnl|my_center|LOCUS_15600 1663187 1663903 gene locus_tag LOCUS_15610 1663187 1663903 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086609.1 protein_id gnl|my_center|LOCUS_15610 1663900 1664562 gene locus_tag LOCUS_15620 1663900 1664562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 1664559 1665683 gene locus_tag LOCUS_15630 1664559 1665683 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419340.1 protein_id gnl|my_center|LOCUS_15630 1665686 1666519 gene locus_tag LOCUS_15640 1665686 1666519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 1666516 1667298 gene locus_tag LOCUS_15650 1666516 1667298 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808019.1 protein_id gnl|my_center|LOCUS_15650 1667378 1668112 gene locus_tag LOCUS_15660 1667378 1668112 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896244.1 protein_id gnl|my_center|LOCUS_15660 1668109 1669566 gene locus_tag LOCUS_15670 1668109 1669566 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031160740.1 protein_id gnl|my_center|LOCUS_15670 1669568 1670020 gene locus_tag LOCUS_15680 1669568 1670020 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977127.1 protein_id gnl|my_center|LOCUS_15680 1670077 1670820 gene locus_tag LOCUS_15690 gene fabG 1670077 1670820 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051065148.1 protein_id gnl|my_center|LOCUS_15690 1670820 1671710 gene locus_tag LOCUS_15700 gene tesB 1670820 1671710 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067256.1 protein_id gnl|my_center|LOCUS_15700 1671707 1672483 gene locus_tag LOCUS_15710 1671707 1672483 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730375.1 protein_id gnl|my_center|LOCUS_15710 1672597 1673208 gene locus_tag LOCUS_15720 1672597 1673208 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868049.1 protein_id gnl|my_center|LOCUS_15720 1675437 1674706 gene locus_tag LOCUS_15730 gene istB 1675437 1674706 CDS product IS21-like element ISBlo1 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012472066.1 protein_id gnl|my_center|LOCUS_15730 1676927 1675434 gene locus_tag LOCUS_15740 gene istA 1676927 1675434 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100512979.1 protein_id gnl|my_center|LOCUS_15740 1678038 1678349 gene locus_tag LOCUS_15750 1678038 1678349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 1678465 1679856 gene locus_tag LOCUS_15760 1678465 1679856 CDS product IS1380-like element ISCgl4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015202.1 protein_id gnl|my_center|LOCUS_15760 1680020 1682776 gene locus_tag LOCUS_15770 1680020 1682776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 1683367 1683068 gene locus_tag LOCUS_15780 1683367 1683068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 1684637 1683432 gene locus_tag LOCUS_15790 1684637 1683432 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531949.1 protein_id gnl|my_center|LOCUS_15790 1685197 1684862 gene locus_tag LOCUS_15800 1685197 1684862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 1685589 1685209 gene locus_tag LOCUS_15810 1685589 1685209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 1686391 1685960 gene locus_tag LOCUS_15820 1686391 1685960 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028212.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15820 1686667 1687137 gene locus_tag LOCUS_15830 1686667 1687137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 1687549 1687307 gene locus_tag LOCUS_15840 1687549 1687307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 1688213 1687605 gene locus_tag LOCUS_15850 1688213 1687605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 1688097 1688390 gene locus_tag LOCUS_15860 1688097 1688390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 1688502 1688915 gene locus_tag LOCUS_15870 1688502 1688915 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087865.1 protein_id gnl|my_center|LOCUS_15870 1689469 1688942 gene locus_tag LOCUS_15880 1689469 1688942 CDS product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050546857.1 protein_id gnl|my_center|LOCUS_15880 1690269 1689466 gene locus_tag LOCUS_15890 1690269 1689466 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113386.1 protein_id gnl|my_center|LOCUS_15890 1691640 1690510 gene locus_tag LOCUS_15900 1691640 1690510 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224293.1 protein_id gnl|my_center|LOCUS_15900 1691812 1692156 gene locus_tag LOCUS_15910 1691812 1692156 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028740.1 protein_id gnl|my_center|LOCUS_15910 1692342 1692701 gene locus_tag LOCUS_15920 1692342 1692701 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229205.1 protein_id gnl|my_center|LOCUS_15920 1692827 1693228 gene locus_tag LOCUS_15930 1692827 1693228 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804499.1 protein_id gnl|my_center|LOCUS_15930 1693225 1693554 gene locus_tag LOCUS_15940 1693225 1693554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 1693952 1694308 gene locus_tag LOCUS_15950 1693952 1694308 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265538.1 protein_id gnl|my_center|LOCUS_15950 1694489 1694842 gene locus_tag LOCUS_15960 1694489 1694842 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776291.1 protein_id gnl|my_center|LOCUS_15960 1694839 1695525 gene locus_tag LOCUS_15970 1694839 1695525 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495802.1 protein_id gnl|my_center|LOCUS_15970 1695836 1695615 gene locus_tag LOCUS_15980 1695836 1695615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 1695742 1697052 gene locus_tag LOCUS_15990 1695742 1697052 CDS product IS1380-like element ISCgl4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015202.1 protein_id gnl|my_center|LOCUS_15990 1697342 1697650 gene locus_tag LOCUS_16000 1697342 1697650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 1698391 1699524 gene locus_tag LOCUS_16010 1698391 1699524 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408274.1 protein_id gnl|my_center|LOCUS_16010 1699532 1700356 gene locus_tag LOCUS_16020 1699532 1700356 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950573.1 protein_id gnl|my_center|LOCUS_16020 1700350 1701348 gene locus_tag LOCUS_16030 1700350 1701348 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408279.1 protein_id gnl|my_center|LOCUS_16030 1701366 1701914 gene locus_tag LOCUS_16040 1701366 1701914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 1701911 1702303 gene locus_tag LOCUS_16050 1701911 1702303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 1702314 1702481 gene locus_tag LOCUS_16060 1702314 1702481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 1702465 1702788 gene locus_tag LOCUS_16070 1702465 1702788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 1702862 1703131 gene locus_tag LOCUS_16080 1702862 1703131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 1703987 1703670 gene locus_tag LOCUS_16090 1703987 1703670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 1704138 1704752 gene locus_tag LOCUS_16100 1704138 1704752 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064707.1 protein_id gnl|my_center|LOCUS_16100 1705179 1705595 gene locus_tag LOCUS_16110 1705179 1705595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16110 1706262 1705747 gene locus_tag LOCUS_16120 1706262 1705747 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186534941.1 protein_id gnl|my_center|LOCUS_16120 1706451 1706885 gene locus_tag LOCUS_16130 1706451 1706885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 1707587 1707078 gene locus_tag LOCUS_16140 1707587 1707078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16140 1708611 1707781 gene locus_tag LOCUS_16150 1708611 1707781 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226050.1 protein_id gnl|my_center|LOCUS_16150 1709843 1708611 gene locus_tag LOCUS_16160 1709843 1708611 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226537.1 protein_id gnl|my_center|LOCUS_16160 1710160 1709828 gene locus_tag LOCUS_16170 1710160 1709828 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226535.1 protein_id gnl|my_center|LOCUS_16170 1710297 1710632 gene locus_tag LOCUS_16180 1710297 1710632 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229205.1 protein_id gnl|my_center|LOCUS_16180 1712186 1711629 gene locus_tag LOCUS_16190 1712186 1711629 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529753.1 protein_id gnl|my_center|LOCUS_16190 1712971 1714365 gene locus_tag LOCUS_16200 1712971 1714365 CDS product IS1380-like element ISCgl4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015202.1 protein_id gnl|my_center|LOCUS_16200 1716307 1714805 gene locus_tag LOCUS_16210 gene mmcO 1716307 1714805 CDS product multicopper oxidase MmcO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404392.1 protein_id gnl|my_center|LOCUS_16210 1716523 1716852 gene locus_tag LOCUS_16220 1716523 1716852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 1718264 1717299 gene locus_tag LOCUS_16230 1718264 1717299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 1718769 1718257 gene locus_tag LOCUS_16240 1718769 1718257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 1719421 1718762 gene locus_tag LOCUS_16250 1719421 1718762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 1720349 1719756 gene locus_tag LOCUS_16260 1720349 1719756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 1720757 1720416 gene locus_tag LOCUS_16270 1720757 1720416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 1721369 1721190 gene locus_tag LOCUS_16280 1721369 1721190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 1722240 1723139 gene locus_tag LOCUS_16290 1722240 1723139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 1723990 1723259 gene locus_tag LOCUS_16300 gene istB 1723990 1723259 CDS product IS21-like element ISBlo1 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012472066.1 protein_id gnl|my_center|LOCUS_16300 1725482 1724055 gene locus_tag LOCUS_16310 gene istA 1725482 1724055 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100512979.1 protein_id gnl|my_center|LOCUS_16310 1725944 1727155 gene locus_tag LOCUS_16320 1725944 1727155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 1727378 1727722 gene locus_tag LOCUS_16330 1727378 1727722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 1729634 1728903 gene locus_tag LOCUS_16340 1729634 1728903 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932563.1 protein_id gnl|my_center|LOCUS_16340 1730328 1730687 gene locus_tag LOCUS_16350 1730328 1730687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 1731764 1731051 gene locus_tag LOCUS_16360 1731764 1731051 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227392.1 protein_id gnl|my_center|LOCUS_16360 1732465 1731761 gene locus_tag LOCUS_16370 1732465 1731761 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227393.1 protein_id gnl|my_center|LOCUS_16370 1732884 1733606 gene locus_tag LOCUS_16380 1732884 1733606 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227392.1 protein_id gnl|my_center|LOCUS_16380 1734151 1733831 gene locus_tag LOCUS_16390 1734151 1733831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 1734609 1735244 gene locus_tag LOCUS_16400 1734609 1735244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 1735347 1735628 gene locus_tag LOCUS_16410 1735347 1735628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 1735874 1736722 gene locus_tag LOCUS_16420 1735874 1736722 CDS product bromoperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074319.1 protein_id gnl|my_center|LOCUS_16420 1737838 1738155 gene locus_tag LOCUS_16430 1737838 1738155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 1738375 1739877 gene locus_tag LOCUS_16440 1738375 1739877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 1741014 1740661 gene locus_tag LOCUS_16450 1741014 1740661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 1741050 1741313 gene locus_tag LOCUS_16460 1741050 1741313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 1741259 1741582 gene locus_tag LOCUS_16470 1741259 1741582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 1742982 1741951 gene locus_tag LOCUS_16480 1742982 1741951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 1744321 1743155 gene locus_tag LOCUS_16490 1744321 1743155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 1744634 1745593 gene locus_tag LOCUS_16500 1744634 1745593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 1747037 1745610 gene locus_tag LOCUS_16510 1747037 1745610 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256492.1 protein_id gnl|my_center|LOCUS_16510 1747847 1747494 gene locus_tag LOCUS_16520 1747847 1747494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 1748098 1748325 gene locus_tag LOCUS_16530 1748098 1748325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 1748883 1749296 gene locus_tag LOCUS_16540 1748883 1749296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 1749881 1749489 gene locus_tag LOCUS_16550 1749881 1749489 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895709.1 protein_id gnl|my_center|LOCUS_16550 1750154 1750342 gene locus_tag LOCUS_16560 1750154 1750342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 1750811 1750461 gene locus_tag LOCUS_16570 1750811 1750461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 1751713 1751054 gene locus_tag LOCUS_16580 1751713 1751054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 1752495 1751845 gene locus_tag LOCUS_16590 1752495 1751845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 1752773 1753336 gene locus_tag LOCUS_16600 1752773 1753336 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975987.1 protein_id gnl|my_center|LOCUS_16600 1753666 1754841 gene locus_tag LOCUS_16610 1753666 1754841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 1755082 1755738 gene locus_tag LOCUS_16620 1755082 1755738 CDS product chloramphenicol acetyltransferase CAT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081958.1 protein_id gnl|my_center|LOCUS_16620 1756179 1755928 gene locus_tag LOCUS_16630 1756179 1755928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 1756072 1756938 gene locus_tag LOCUS_16640 1756072 1756938 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224885.1 protein_id gnl|my_center|LOCUS_16640 1757858 1757154 gene locus_tag LOCUS_16650 1757858 1757154 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084603133.1 protein_id gnl|my_center|LOCUS_16650 1758976 1758203 gene locus_tag LOCUS_16660 1758976 1758203 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223617.1 protein_id gnl|my_center|LOCUS_16660 1759221 1759763 gene locus_tag LOCUS_16670 1759221 1759763 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929906.1 protein_id gnl|my_center|LOCUS_16670 1760501 1759899 gene locus_tag LOCUS_16680 1760501 1759899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 1761142 1761789 gene locus_tag LOCUS_16690 1761142 1761789 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976175.1 protein_id gnl|my_center|LOCUS_16690 1761921 1763516 gene locus_tag LOCUS_16700 1761921 1763516 CDS product bifunctional 3'-5' exonuclease/DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930206.1 protein_id gnl|my_center|LOCUS_16700 1763634 1764155 gene locus_tag LOCUS_16710 1763634 1764155 CDS product DUF3145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976415.1 protein_id gnl|my_center|LOCUS_16710 1765467 1764232 gene locus_tag LOCUS_16720 1765467 1764232 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028323.1 protein_id gnl|my_center|LOCUS_16720 1765864 1765616 gene locus_tag LOCUS_16730 1765864 1765616 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775709.1 protein_id gnl|my_center|LOCUS_16730 1766968 1765964 gene locus_tag LOCUS_16740 1766968 1765964 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775708.1 protein_id gnl|my_center|LOCUS_16740 1767926 1767006 gene locus_tag LOCUS_16750 1767926 1767006 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028322.1 protein_id gnl|my_center|LOCUS_16750 1769225 1768020 gene locus_tag LOCUS_16760 gene fasR 1769225 1768020 CDS product fatty acid biosynthesis transcriptional regulator FasR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028321.1 protein_id gnl|my_center|LOCUS_16760 1771958 1769232 gene locus_tag LOCUS_16770 gene aceE 1771958 1769232 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110416.1 protein_id gnl|my_center|LOCUS_16770 1772195 1772662 gene locus_tag LOCUS_16780 1772195 1772662 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976435.1 protein_id gnl|my_center|LOCUS_16780 1772731 1772804 gene locus_tag LOCUS_t00120 1772731 1772804 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1773652 1772882 gene locus_tag LOCUS_16790 1773652 1772882 CDS product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028619.1 protein_id gnl|my_center|LOCUS_16790 1774050 1773739 gene locus_tag LOCUS_16800 1774050 1773739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 1774381 1775082 gene locus_tag LOCUS_16810 1774381 1775082 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227393.1 protein_id gnl|my_center|LOCUS_16810 1775092 1775805 gene locus_tag LOCUS_16820 1775092 1775805 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227392.1 protein_id gnl|my_center|LOCUS_16820 1776012 1776347 gene locus_tag LOCUS_16830 1776012 1776347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 1776407 1777231 gene locus_tag LOCUS_16840 1776407 1777231 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028263.1 protein_id gnl|my_center|LOCUS_16840 1777290 1778027 gene locus_tag LOCUS_16850 1777290 1778027 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411501.1 protein_id gnl|my_center|LOCUS_16850 1779197 1778487 gene locus_tag LOCUS_16860 1779197 1778487 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462100.1 protein_id gnl|my_center|LOCUS_16860 1780795 1779194 gene locus_tag LOCUS_16870 1780795 1779194 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191850856.1 protein_id gnl|my_center|LOCUS_16870 1780973 1781971 gene locus_tag LOCUS_16880 1780973 1781971 CDS product tripartite tricarboxylate transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529611.1 protein_id gnl|my_center|LOCUS_16880 1781974 1782525 gene locus_tag LOCUS_16890 1781974 1782525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 1782518 1784071 gene locus_tag LOCUS_16900 1782518 1784071 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172209.1 protein_id gnl|my_center|LOCUS_16900 1785463 1784078 gene locus_tag LOCUS_16910 1785463 1784078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 1787123 1785696 gene locus_tag LOCUS_16920 1787123 1785696 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803973.1 protein_id gnl|my_center|LOCUS_16920 1787885 1787127 gene locus_tag LOCUS_16930 1787885 1787127 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775698.1 protein_id gnl|my_center|LOCUS_16930 1788720 1787902 gene locus_tag LOCUS_16940 gene map 1788720 1787902 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976546.1 protein_id gnl|my_center|LOCUS_16940 1788781 1788969 gene locus_tag LOCUS_16950 1788781 1788969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 1789892 1789005 gene locus_tag LOCUS_16960 gene panB 1789892 1789005 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223113.1 protein_id gnl|my_center|LOCUS_16960 1789964 1791301 gene locus_tag LOCUS_16970 gene glnA 1789964 1791301 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976572.1 protein_id gnl|my_center|LOCUS_16970 1791317 1794373 gene locus_tag LOCUS_16980 1791317 1794373 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028215.1 protein_id gnl|my_center|LOCUS_16980 1795866 1794442 gene locus_tag LOCUS_16990 gene glnA 1795866 1794442 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775685.1 protein_id gnl|my_center|LOCUS_16990 1796011 1796439 gene locus_tag LOCUS_17000 1796011 1796439 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976618.1 protein_id gnl|my_center|LOCUS_17000 1797216 1796509 gene locus_tag LOCUS_17010 1797216 1796509 CDS product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775683.1 protein_id gnl|my_center|LOCUS_17010 1798253 1797264 gene locus_tag LOCUS_17020 gene lipA 1798253 1797264 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223711.1 protein_id gnl|my_center|LOCUS_17020 1798930 1798250 gene locus_tag LOCUS_17030 gene lipB 1798930 1798250 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085308.1 protein_id gnl|my_center|LOCUS_17030 1799090 1800751 gene locus_tag LOCUS_17040 1799090 1800751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 1802162 1800777 gene locus_tag LOCUS_17050 1802162 1800777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 1803604 1802231 gene locus_tag LOCUS_17060 gene lpdA 1803604 1802231 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224051.1 protein_id gnl|my_center|LOCUS_17060 1805175 1803703 gene locus_tag LOCUS_17070 1805175 1803703 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224057.1 protein_id gnl|my_center|LOCUS_17070 1805273 1806196 gene locus_tag LOCUS_17080 1805273 1806196 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908070.1 protein_id gnl|my_center|LOCUS_17080 1806254 1807588 gene locus_tag LOCUS_17090 1806254 1807588 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104427.1 protein_id gnl|my_center|LOCUS_17090 1807780 1809096 gene locus_tag LOCUS_17100 1807780 1809096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 1809106 1810386 gene locus_tag LOCUS_17110 1809106 1810386 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068484.1 protein_id gnl|my_center|LOCUS_17110 1810389 1811114 gene locus_tag LOCUS_17120 1810389 1811114 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041323333.1 protein_id gnl|my_center|LOCUS_17120 1811452 1811216 gene locus_tag LOCUS_17130 1811452 1811216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 1811617 1813695 gene locus_tag LOCUS_17140 1811617 1813695 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805040.1 protein_id gnl|my_center|LOCUS_17140 1814424 1813708 gene locus_tag LOCUS_17150 1814424 1813708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 1816943 1814454 gene locus_tag LOCUS_17160 1816943 1814454 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929932.1 protein_id gnl|my_center|LOCUS_17160 1817065 1818210 gene locus_tag LOCUS_17170 1817065 1818210 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894937.1 protein_id gnl|my_center|LOCUS_17170 1818861 1818271 gene locus_tag LOCUS_17180 1818861 1818271 CDS product DUF3043 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028173.1 protein_id gnl|my_center|LOCUS_17180 1818900 1820336 gene locus_tag LOCUS_17190 1818900 1820336 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412946.1 protein_id gnl|my_center|LOCUS_17190 1820480 1820842 gene locus_tag LOCUS_17200 gene erpA 1820480 1820842 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805013.1 protein_id gnl|my_center|LOCUS_17200 1821174 1821932 gene locus_tag LOCUS_17210 gene coxB 1821174 1821932 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805014.1 protein_id gnl|my_center|LOCUS_17210 1821936 1823654 gene locus_tag LOCUS_17220 gene ctaD 1821936 1823654 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976660.1 protein_id gnl|my_center|LOCUS_17220 1823655 1824077 gene locus_tag LOCUS_17230 1823655 1824077 CDS product cytochrome c oxidase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976661.1 protein_id gnl|my_center|LOCUS_17230 1824984 1824136 gene locus_tag LOCUS_17240 1824984 1824136 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804543.1 protein_id gnl|my_center|LOCUS_17240 1826649 1825015 gene locus_tag LOCUS_17250 1826649 1825015 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805018.1 protein_id gnl|my_center|LOCUS_17250 1827719 1826646 gene locus_tag LOCUS_17260 1827719 1826646 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976666.1 protein_id gnl|my_center|LOCUS_17260 1828603 1827773 gene locus_tag LOCUS_17270 1828603 1827773 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805020.1 protein_id gnl|my_center|LOCUS_17270 1829257 1828628 gene locus_tag LOCUS_17280 1829257 1828628 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976664.1 protein_id gnl|my_center|LOCUS_17280 1829402 1830457 gene locus_tag LOCUS_17290 gene trpD 1829402 1830457 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028166.1 protein_id gnl|my_center|LOCUS_17290 1830531 1831538 gene locus_tag LOCUS_17300 gene dhaK 1830531 1831538 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259135.1 protein_id gnl|my_center|LOCUS_17300 1831542 1832180 gene locus_tag LOCUS_17310 gene dhaL 1831542 1832180 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229494.1 protein_id gnl|my_center|LOCUS_17310 1832177 1832899 gene locus_tag LOCUS_17320 gene dhaM 1832177 1832899 CDS product dihydroxyacetone kinase phosphoryl donor subunit DhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229493.1 protein_id gnl|my_center|LOCUS_17320 1832942 1833193 gene locus_tag LOCUS_17330 1832942 1833193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 1833236 1833898 gene locus_tag LOCUS_17340 1833236 1833898 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929842.1 protein_id gnl|my_center|LOCUS_17340 1833944 1834453 gene locus_tag LOCUS_17350 1833944 1834453 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804554.1 protein_id gnl|my_center|LOCUS_17350 1836990 1834630 gene locus_tag LOCUS_17360 1836990 1834630 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224401.1 protein_id gnl|my_center|LOCUS_17360 1839038 1836987 gene locus_tag LOCUS_17370 1839038 1836987 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227897.1 protein_id gnl|my_center|LOCUS_17370 1839805 1839041 gene locus_tag LOCUS_17380 1839805 1839041 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776018.1 protein_id gnl|my_center|LOCUS_17380 1839936 1840409 gene locus_tag LOCUS_17390 1839936 1840409 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057865.1 protein_id gnl|my_center|LOCUS_17390 1840406 1841347 gene locus_tag LOCUS_17400 1840406 1841347 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027982.1 protein_id gnl|my_center|LOCUS_17400 1841351 1842115 gene locus_tag LOCUS_17410 1841351 1842115 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401625.1 protein_id gnl|my_center|LOCUS_17410 1842225 1842590 gene locus_tag LOCUS_17420 1842225 1842590 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052872.1 protein_id gnl|my_center|LOCUS_17420 1844209 1842650 gene locus_tag LOCUS_17430 gene lnt 1844209 1842650 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805197.1 protein_id gnl|my_center|LOCUS_17430 1846678 1844210 gene locus_tag LOCUS_17440 1846678 1844210 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068114.1 protein_id gnl|my_center|LOCUS_17440 1847438 1846686 gene locus_tag LOCUS_17450 gene tatC 1847438 1846686 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805201.1 protein_id gnl|my_center|LOCUS_17450 1847697 1847485 gene locus_tag LOCUS_17460 1847697 1847485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 1848058 1847687 gene locus_tag LOCUS_17470 1848058 1847687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 1849072 1848062 gene locus_tag LOCUS_17480 1849072 1848062 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226714.1 protein_id gnl|my_center|LOCUS_17480 1850220 1849069 gene locus_tag LOCUS_17490 1850220 1849069 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410775.1 protein_id gnl|my_center|LOCUS_17490 1851229 1850264 gene locus_tag LOCUS_17500 1851229 1850264 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977187.1 protein_id gnl|my_center|LOCUS_17500 1852330 1851299 gene locus_tag LOCUS_17510 1852330 1851299 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027901.1 protein_id gnl|my_center|LOCUS_17510 1853078 1852335 gene locus_tag LOCUS_17520 1853078 1852335 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467175.1 protein_id gnl|my_center|LOCUS_17520 1853187 1854089 gene locus_tag LOCUS_17530 gene parJ 1853187 1854089 CDS product filament polymerization regulator ParJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977163.1 protein_id gnl|my_center|LOCUS_17530 1855406 1854117 gene locus_tag LOCUS_17540 gene mshC 1855406 1854117 CDS product cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977162.1 protein_id gnl|my_center|LOCUS_17540 1856274 1855420 gene locus_tag LOCUS_17550 1856274 1855420 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775661.1 protein_id gnl|my_center|LOCUS_17550 1857655 1856330 gene locus_tag LOCUS_17560 1857655 1856330 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977149.1 protein_id gnl|my_center|LOCUS_17560 1857767 1857852 gene locus_tag LOCUS_t00130 1857767 1857852 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1857978 1858649 gene locus_tag LOCUS_17570 1857978 1858649 CDS product GAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722934.1 protein_id gnl|my_center|LOCUS_17570 1858758 1860869 gene locus_tag LOCUS_17580 1858758 1860869 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729974.1 protein_id gnl|my_center|LOCUS_17580 1861755 1860886 gene locus_tag LOCUS_17590 1861755 1860886 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867471.1 protein_id gnl|my_center|LOCUS_17590 1862740 1861742 gene locus_tag LOCUS_17600 1862740 1861742 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974362.1 protein_id gnl|my_center|LOCUS_17600 1863882 1862737 gene locus_tag LOCUS_17610 1863882 1862737 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974363.1 protein_id gnl|my_center|LOCUS_17610 1864912 1863965 gene locus_tag LOCUS_17620 1864912 1863965 CDS product 5'-3' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027889.1 protein_id gnl|my_center|LOCUS_17620 1865618 1864917 gene locus_tag LOCUS_17630 1865618 1864917 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167468046.1 protein_id gnl|my_center|LOCUS_17630 1865838 1865686 gene locus_tag LOCUS_17640 1865838 1865686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 1865791 1866171 gene locus_tag LOCUS_17650 1865791 1866171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 1866556 1866233 gene locus_tag LOCUS_17660 1866556 1866233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 1866714 1867517 gene locus_tag LOCUS_17670 1866714 1867517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 1867711 1867538 gene locus_tag LOCUS_17680 1867711 1867538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 1868862 1867909 gene locus_tag LOCUS_17690 1868862 1867909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17690 1869195 1869371 gene locus_tag LOCUS_17700 1869195 1869371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 1869432 1869866 gene locus_tag LOCUS_17710 1869432 1869866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085100849.1 protein_id gnl|my_center|LOCUS_17710 1869866 1870873 gene locus_tag LOCUS_17720 1869866 1870873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17720 1870980 1871633 gene locus_tag LOCUS_17730 1870980 1871633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 1871990 1873057 gene locus_tag LOCUS_17740 1871990 1873057 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730979.1 protein_id gnl|my_center|LOCUS_17740 1874026 1873088 gene locus_tag LOCUS_17750 1874026 1873088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 1874186 1874839 gene locus_tag LOCUS_17760 1874186 1874839 CDS product DUF1345 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079604.1 protein_id gnl|my_center|LOCUS_17760 1875026 1874862 gene locus_tag LOCUS_17770 1875026 1874862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 1875587 1875090 gene locus_tag LOCUS_17780 1875587 1875090 CDS product DUF6328 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079520.1 protein_id gnl|my_center|LOCUS_17780 1876322 1875597 gene locus_tag LOCUS_17790 1876322 1875597 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776060.1 protein_id gnl|my_center|LOCUS_17790 1876387 1877238 gene locus_tag LOCUS_17800 1876387 1877238 CDS product DUF3097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728763.1 protein_id gnl|my_center|LOCUS_17800 1877487 1877690 gene locus_tag LOCUS_17810 1877487 1877690 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812516.1 protein_id gnl|my_center|LOCUS_17810 1878288 1877809 gene locus_tag LOCUS_17820 1878288 1877809 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081784.1 protein_id gnl|my_center|LOCUS_17820 1878408 1879613 gene locus_tag LOCUS_17830 1878408 1879613 CDS product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027702.1 protein_id gnl|my_center|LOCUS_17830 1881547 1879784 gene locus_tag LOCUS_17840 1881547 1879784 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975874.1 protein_id gnl|my_center|LOCUS_17840 1881658 1882440 gene locus_tag LOCUS_17850 1881658 1882440 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742086.1 protein_id gnl|my_center|LOCUS_17850 1884773 1882449 gene locus_tag LOCUS_17860 1884773 1882449 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211518764.1 protein_id gnl|my_center|LOCUS_17860 1886116 1884770 gene locus_tag LOCUS_17870 1886116 1884770 CDS product lysine N(6)-hydroxylase/L-ornithine N(5)-oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326291.1 protein_id gnl|my_center|LOCUS_17870 1887650 1886109 gene locus_tag LOCUS_17880 gene desA 1887650 1886109 CDS product lysine decarboxylase DesA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028583.1 protein_id gnl|my_center|LOCUS_17880 1887857 1888321 gene locus_tag LOCUS_17890 1887857 1888321 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030385.1 protein_id gnl|my_center|LOCUS_17890 1888627 1890054 gene locus_tag LOCUS_17900 1888627 1890054 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229411.1 protein_id gnl|my_center|LOCUS_17900 1890745 1890314 gene locus_tag LOCUS_17910 1890745 1890314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 1892184 1890955 gene locus_tag LOCUS_17920 1892184 1890955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 1893034 1892231 gene locus_tag LOCUS_17930 1893034 1892231 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930212.1 protein_id gnl|my_center|LOCUS_17930 1893159 1894079 gene locus_tag LOCUS_17940 1893159 1894079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729967.1 protein_id gnl|my_center|LOCUS_17940 1894076 1894702 gene locus_tag LOCUS_17950 gene phoE 1894076 1894702 CDS product phosphatase PhoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233157.1 protein_id gnl|my_center|LOCUS_17950 1895765 1894674 gene locus_tag LOCUS_17960 1895765 1894674 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143959.1 protein_id gnl|my_center|LOCUS_17960 1896661 1895762 gene locus_tag LOCUS_17970 1896661 1895762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 1896777 1898474 gene locus_tag LOCUS_17980 gene treS 1896777 1898474 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031594.1 protein_id gnl|my_center|LOCUS_17980 1899432 1899199 gene locus_tag LOCUS_17990 1899432 1899199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 1899747 1899442 gene locus_tag LOCUS_18000 1899747 1899442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 1900323 1899808 gene locus_tag LOCUS_18010 1900323 1899808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 1900873 1900316 gene locus_tag LOCUS_18020 1900873 1900316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 1901100 1901786 gene locus_tag LOCUS_18030 1901100 1901786 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030642.1 protein_id gnl|my_center|LOCUS_18030 1902120 1901869 gene locus_tag LOCUS_18040 1902120 1901869 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858446.1 protein_id gnl|my_center|LOCUS_18040 1903062 1902280 gene locus_tag LOCUS_18050 1903062 1902280 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977024.1 protein_id gnl|my_center|LOCUS_18050 1904305 1903124 gene locus_tag LOCUS_18060 gene glgA 1904305 1903124 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805185.1 protein_id gnl|my_center|LOCUS_18060 1904367 1905632 gene locus_tag LOCUS_18070 gene glgC 1904367 1905632 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805186.1 protein_id gnl|my_center|LOCUS_18070 1905629 1906276 gene locus_tag LOCUS_18080 gene serB 1905629 1906276 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812481.1 protein_id gnl|my_center|LOCUS_18080 1907015 1906305 gene locus_tag LOCUS_18090 1907015 1906305 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805189.1 protein_id gnl|my_center|LOCUS_18090 1907150 1907446 gene locus_tag LOCUS_18100 1907150 1907446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 1907443 1907670 gene locus_tag LOCUS_18110 1907443 1907670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 1907667 1908512 gene locus_tag LOCUS_18120 1907667 1908512 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805192.1 protein_id gnl|my_center|LOCUS_18120 1910359 1908761 gene locus_tag LOCUS_18130 1910359 1908761 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976982.1 protein_id gnl|my_center|LOCUS_18130 1911079 1910456 gene locus_tag LOCUS_18140 1911079 1910456 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223792.1 protein_id gnl|my_center|LOCUS_18140 1911534 1911205 gene locus_tag LOCUS_18150 1911534 1911205 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224702.1 protein_id gnl|my_center|LOCUS_18150 1912303 1911539 gene locus_tag LOCUS_18160 gene sufC 1912303 1911539 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805067.1 protein_id gnl|my_center|LOCUS_18160 1912696 1912370 gene locus_tag LOCUS_18170 1912696 1912370 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805066.1 protein_id gnl|my_center|LOCUS_18170 1913913 1912699 gene locus_tag LOCUS_18180 gene sufD 1913913 1912699 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224698.1 protein_id gnl|my_center|LOCUS_18180 1915332 1913914 gene locus_tag LOCUS_18190 gene sufB 1915332 1913914 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976894.1 protein_id gnl|my_center|LOCUS_18190 1915608 1916531 gene locus_tag LOCUS_18200 1915608 1916531 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897656.1 protein_id gnl|my_center|LOCUS_18200 1916661 1917194 gene locus_tag LOCUS_18210 1916661 1917194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 1918277 1917258 gene locus_tag LOCUS_18220 1918277 1917258 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728692.1 protein_id gnl|my_center|LOCUS_18220 1919066 1918278 gene locus_tag LOCUS_18230 1919066 1918278 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070943583.1 protein_id gnl|my_center|LOCUS_18230 1920298 1919063 gene locus_tag LOCUS_18240 1920298 1919063 CDS product betaine/proline/choline family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110021.1 protein_id gnl|my_center|LOCUS_18240 1920956 1920303 gene locus_tag LOCUS_18250 1920956 1920303 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110018.1 protein_id gnl|my_center|LOCUS_18250 1922031 1921114 gene locus_tag LOCUS_18260 1922031 1921114 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805128.1 protein_id gnl|my_center|LOCUS_18260 1922573 1922349 gene locus_tag LOCUS_18270 1922573 1922349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 1922466 1924448 gene locus_tag LOCUS_18280 gene tkt 1922466 1924448 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167022841.1 protein_id gnl|my_center|LOCUS_18280 1924584 1925714 gene locus_tag LOCUS_18290 gene tal 1924584 1925714 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728814.1 protein_id gnl|my_center|LOCUS_18290 1925711 1927318 gene locus_tag LOCUS_18300 1925711 1927318 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224675.1 protein_id gnl|my_center|LOCUS_18300 1927362 1928903 gene locus_tag LOCUS_18310 gene zwf 1927362 1928903 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224674.1 protein_id gnl|my_center|LOCUS_18310 1928900 1929868 gene locus_tag LOCUS_18320 gene opcA 1928900 1929868 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224673.1 protein_id gnl|my_center|LOCUS_18320 1929865 1930635 gene locus_tag LOCUS_18330 gene pgl 1929865 1930635 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976879.1 protein_id gnl|my_center|LOCUS_18330 1931004 1930687 gene locus_tag LOCUS_18340 1931004 1930687 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284344.1 protein_id gnl|my_center|LOCUS_18340 1931382 1931131 gene locus_tag LOCUS_18350 gene secG 1931382 1931131 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115170.1 protein_id gnl|my_center|LOCUS_18350 1932296 1931496 gene locus_tag LOCUS_18360 gene tpiA 1932296 1931496 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976873.1 protein_id gnl|my_center|LOCUS_18360 1933501 1932290 gene locus_tag LOCUS_18370 1933501 1932290 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930207.1 protein_id gnl|my_center|LOCUS_18370 1934520 1933513 gene locus_tag LOCUS_18380 gene gap 1934520 1933513 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224666.1 protein_id gnl|my_center|LOCUS_18380 1935277 1934651 gene locus_tag LOCUS_18390 1935277 1934651 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775980.1 protein_id gnl|my_center|LOCUS_18390 1936393 1935389 gene locus_tag LOCUS_18400 gene whiA 1936393 1935389 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877572.1 protein_id gnl|my_center|LOCUS_18400 1937351 1936476 gene locus_tag LOCUS_18410 gene rapZ 1937351 1936476 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466867.1 protein_id gnl|my_center|LOCUS_18410 1939306 1937414 gene locus_tag LOCUS_18420 gene uvrC 1939306 1937414 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805116.1 protein_id gnl|my_center|LOCUS_18420 1942190 1939323 gene locus_tag LOCUS_18430 gene uvrA 1942190 1939323 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110827.1 protein_id gnl|my_center|LOCUS_18430 1942305 1942913 gene locus_tag LOCUS_18440 1942305 1942913 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804263.1 protein_id gnl|my_center|LOCUS_18440 1942910 1943650 gene locus_tag LOCUS_18450 1942910 1943650 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174265944.1 protein_id gnl|my_center|LOCUS_18450 1943734 1946526 gene locus_tag LOCUS_18460 1943734 1946526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 1948688 1946625 gene locus_tag LOCUS_18470 gene uvrB 1948688 1946625 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805108.1 protein_id gnl|my_center|LOCUS_18470 1949318 1948698 gene locus_tag LOCUS_18480 1949318 1948698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 1950979 1949525 gene locus_tag LOCUS_18490 gene rpsA 1950979 1949525 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805100.1 protein_id gnl|my_center|LOCUS_18490 1952096 1951107 gene locus_tag LOCUS_18500 1952096 1951107 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226301.1 protein_id gnl|my_center|LOCUS_18500 1952710 1952093 gene locus_tag LOCUS_18510 1952710 1952093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 1954391 1952715 gene locus_tag LOCUS_18520 1954391 1952715 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728748.1 protein_id gnl|my_center|LOCUS_18520 1956930 1954462 gene locus_tag LOCUS_18530 1956930 1954462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 1959772 1957085 gene locus_tag LOCUS_18540 gene polA 1959772 1957085 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467407.1 protein_id gnl|my_center|LOCUS_18540 1959830 1960255 gene locus_tag LOCUS_18550 1959830 1960255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 1960943 1960332 gene locus_tag LOCUS_18560 1960943 1960332 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805096.1 protein_id gnl|my_center|LOCUS_18560 1960976 1961060 gene locus_tag LOCUS_t00140 1960976 1961060 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1961670 1961098 gene locus_tag LOCUS_18570 1961670 1961098 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028140.1 protein_id gnl|my_center|LOCUS_18570 1961797 1962411 gene locus_tag LOCUS_18580 1961797 1962411 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227920.1 protein_id gnl|my_center|LOCUS_18580 1962408 1964513 gene locus_tag LOCUS_18590 1962408 1964513 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227921.1 protein_id gnl|my_center|LOCUS_18590 1966226 1964781 gene locus_tag LOCUS_18600 gene pyk 1966226 1964781 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805095.1 protein_id gnl|my_center|LOCUS_18600 1967756 1966299 gene locus_tag LOCUS_18610 1967756 1966299 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899732.1 protein_id gnl|my_center|LOCUS_18610 1972326 1967749 gene locus_tag LOCUS_18620 gene gltB 1972326 1967749 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028104.1 protein_id gnl|my_center|LOCUS_18620 1973424 1972468 gene locus_tag LOCUS_18630 1973424 1972468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 1974328 1973498 gene locus_tag LOCUS_18640 gene trpA 1974328 1973498 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805093.1 protein_id gnl|my_center|LOCUS_18640 1975536 1974325 gene locus_tag LOCUS_18650 gene trpB 1975536 1974325 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976779.1 protein_id gnl|my_center|LOCUS_18650 1976307 1975537 gene locus_tag LOCUS_18660 gene trpC 1976307 1975537 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057938.1 protein_id gnl|my_center|LOCUS_18660 1976542 1976312 gene locus_tag LOCUS_18670 1976542 1976312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 1977234 1976572 gene locus_tag LOCUS_18680 1977234 1976572 CDS product Trp biosynthesis-associated membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805088.1 protein_id gnl|my_center|LOCUS_18680 1978776 1977238 gene locus_tag LOCUS_18690 1978776 1977238 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224165.1 protein_id gnl|my_center|LOCUS_18690 1979132 1978773 gene locus_tag LOCUS_18700 gene hisI 1979132 1978773 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813324.1 protein_id gnl|my_center|LOCUS_18700 1979893 1979129 gene locus_tag LOCUS_18710 gene hisF 1979893 1979129 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976768.1 protein_id gnl|my_center|LOCUS_18710 1980748 1979909 gene locus_tag LOCUS_18720 gene hisG 1980748 1979909 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805206.1 protein_id gnl|my_center|LOCUS_18720 1981109 1980846 gene locus_tag LOCUS_18730 1981109 1980846 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061184.1 protein_id gnl|my_center|LOCUS_18730 1981790 1981119 gene locus_tag LOCUS_18740 gene rpe 1981790 1981119 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977361.1 protein_id gnl|my_center|LOCUS_18740 1982502 1981837 gene locus_tag LOCUS_18750 1982502 1981837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 1982981 1982508 gene locus_tag LOCUS_18760 1982981 1982508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 1983406 1982984 gene locus_tag LOCUS_18770 1983406 1982984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 1985418 1983730 gene locus_tag LOCUS_18780 1985418 1983730 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729718.1 protein_id gnl|my_center|LOCUS_18780 1985488 1986078 gene locus_tag LOCUS_18790 1985488 1986078 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027648.1 protein_id gnl|my_center|LOCUS_18790 1987562 1986177 gene locus_tag LOCUS_18800 1987562 1986177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 1987752 1988138 gene locus_tag LOCUS_18810 1987752 1988138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 1989222 1988410 gene locus_tag LOCUS_18820 1989222 1988410 CDS product ExeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899491.1 protein_id gnl|my_center|LOCUS_18820 1990631 1989219 gene locus_tag LOCUS_18830 1990631 1989219 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144956692.1 protein_id gnl|my_center|LOCUS_18830 1991158 1991475 gene locus_tag LOCUS_18840 1991158 1991475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 1991892 1991614 gene locus_tag LOCUS_18850 1991892 1991614 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706250.1 protein_id gnl|my_center|LOCUS_18850 1992416 1991889 gene locus_tag LOCUS_18860 1992416 1991889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 1993871 1992432 gene locus_tag LOCUS_18870 1993871 1992432 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977354.1 protein_id gnl|my_center|LOCUS_18870 1994782 1993868 gene locus_tag LOCUS_18880 gene fmt 1994782 1993868 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027805.1 protein_id gnl|my_center|LOCUS_18880 1996828 1994783 gene locus_tag LOCUS_18890 1996828 1994783 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224627.1 protein_id gnl|my_center|LOCUS_18890 1998112 1996919 gene locus_tag LOCUS_18900 gene metK 1998112 1996919 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977350.1 protein_id gnl|my_center|LOCUS_18900 1999375 1998164 gene locus_tag LOCUS_18910 gene coaBC 1999375 1998164 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485775.1 protein_id gnl|my_center|LOCUS_18910 1999658 1999401 gene locus_tag LOCUS_18920 gene rpoZ 1999658 1999401 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977348.1 protein_id gnl|my_center|LOCUS_18920 2000632 1999712 gene locus_tag LOCUS_18930 2000632 1999712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 2001521 2000625 gene locus_tag LOCUS_18940 gene pyrF 2001521 2000625 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805080.1 protein_id gnl|my_center|LOCUS_18940 2004805 2001518 gene locus_tag LOCUS_18950 gene carB 2004805 2001518 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977343.1 protein_id gnl|my_center|LOCUS_18950 2005992 2004805 gene locus_tag LOCUS_18960 gene carA 2005992 2004805 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027810.1 protein_id gnl|my_center|LOCUS_18960 2006554 2005994 gene locus_tag LOCUS_18970 2006554 2005994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 2007911 2006547 gene locus_tag LOCUS_18980 2007911 2006547 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977340.1 protein_id gnl|my_center|LOCUS_18980 2008861 2007911 gene locus_tag LOCUS_18990 2008861 2007911 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027811.1 protein_id gnl|my_center|LOCUS_18990 2009400 2008858 gene locus_tag LOCUS_19000 gene pyrR 2009400 2008858 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805074.1 protein_id gnl|my_center|LOCUS_19000 2010404 2009487 gene locus_tag LOCUS_19010 2010404 2009487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 2010845 2010426 gene locus_tag LOCUS_19020 2010845 2010426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 2011405 2010845 gene locus_tag LOCUS_19030 gene efp 2011405 2010845 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005076127.1 protein_id gnl|my_center|LOCUS_19030 2011956 2011519 gene locus_tag LOCUS_19040 gene aroQ 2011956 2011519 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816942.1 protein_id gnl|my_center|LOCUS_19040 2012400 2011984 gene locus_tag LOCUS_19050 2012400 2011984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 2012574 2013923 gene locus_tag LOCUS_19060 2012574 2013923 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510567.1 protein_id gnl|my_center|LOCUS_19060 2014033 2015556 gene locus_tag LOCUS_19070 2014033 2015556 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776830.1 protein_id gnl|my_center|LOCUS_19070 2015686 2016117 gene locus_tag LOCUS_19080 2015686 2016117 CDS product DUF779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027643.1 protein_id gnl|my_center|LOCUS_19080 2017256 2016114 gene locus_tag LOCUS_19090 gene aroB 2017256 2016114 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027813.1 protein_id gnl|my_center|LOCUS_19090 2017783 2017253 gene locus_tag LOCUS_19100 2017783 2017253 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742170.1 protein_id gnl|my_center|LOCUS_19100 2019003 2017786 gene locus_tag LOCUS_19110 gene aroC 2019003 2017786 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977330.1 protein_id gnl|my_center|LOCUS_19110 2019881 2019009 gene locus_tag LOCUS_19120 2019881 2019009 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027816.1 protein_id gnl|my_center|LOCUS_19120 2021283 2019874 gene locus_tag LOCUS_19130 gene mltG 2021283 2019874 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053383.1 protein_id gnl|my_center|LOCUS_19130 2021757 2021287 gene locus_tag LOCUS_19140 gene ruvX 2021757 2021287 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894407.1 protein_id gnl|my_center|LOCUS_19140 2024415 2021761 gene locus_tag LOCUS_19150 gene alaS 2024415 2021761 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093585.1 protein_id gnl|my_center|LOCUS_19150 2024687 2024478 gene locus_tag LOCUS_19160 2024687 2024478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 2025107 2024733 gene locus_tag LOCUS_19170 2025107 2024733 CDS product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224580.1 protein_id gnl|my_center|LOCUS_19170 2025856 2025227 gene locus_tag LOCUS_19180 gene rpsD 2025856 2025227 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775672.1 protein_id gnl|my_center|LOCUS_19180 2026127 2026315 gene locus_tag LOCUS_19190 2026127 2026315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 2027509 2026223 gene locus_tag LOCUS_19200 2027509 2026223 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775673.1 protein_id gnl|my_center|LOCUS_19200 2027647 2028444 gene locus_tag LOCUS_19210 2027647 2028444 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977316.1 protein_id gnl|my_center|LOCUS_19210 2028494 2029771 gene locus_tag LOCUS_19220 2028494 2029771 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325802.1 protein_id gnl|my_center|LOCUS_19220 2029894 2030508 gene locus_tag LOCUS_19230 2029894 2030508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 2032757 2030505 gene locus_tag LOCUS_19240 gene relA 2032757 2030505 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977314.1 protein_id gnl|my_center|LOCUS_19240 2033878 2032847 gene locus_tag LOCUS_19250 gene secF 2033878 2032847 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805001.1 protein_id gnl|my_center|LOCUS_19250 2035593 2033878 gene locus_tag LOCUS_19260 gene secD 2035593 2033878 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805000.1 protein_id gnl|my_center|LOCUS_19260 2036043 2035657 gene locus_tag LOCUS_19270 2036043 2035657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 2037152 2036118 gene locus_tag LOCUS_19280 gene ruvB 2037152 2036118 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977309.1 protein_id gnl|my_center|LOCUS_19280 2037802 2037149 gene locus_tag LOCUS_19290 gene ruvA 2037802 2037149 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804997.1 protein_id gnl|my_center|LOCUS_19290 2038428 2037799 gene locus_tag LOCUS_19300 2038428 2037799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 2039198 2038434 gene locus_tag LOCUS_19310 2039198 2038434 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977306.1 protein_id gnl|my_center|LOCUS_19310 2039904 2039335 gene locus_tag LOCUS_19320 2039904 2039335 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088529.1 protein_id gnl|my_center|LOCUS_19320 2040561 2039956 gene locus_tag LOCUS_19330 gene pdxT 2040561 2039956 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977305.1 protein_id gnl|my_center|LOCUS_19330 2041516 2040614 gene locus_tag LOCUS_19340 gene pdxS 2041516 2040614 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070939476.1 protein_id gnl|my_center|LOCUS_19340 2042197 2041595 gene locus_tag LOCUS_19350 2042197 2041595 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804993.1 protein_id gnl|my_center|LOCUS_19350 2044214 2042199 gene locus_tag LOCUS_19360 gene thrS 2044214 2042199 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804992.1 protein_id gnl|my_center|LOCUS_19360 2044549 2044358 gene locus_tag LOCUS_19370 2044549 2044358 CDS product DUF1918 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285998.1 protein_id gnl|my_center|LOCUS_19370 2045082 2044639 gene locus_tag LOCUS_19380 2045082 2044639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 2046182 2045136 gene locus_tag LOCUS_19390 2046182 2045136 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226304.1 protein_id gnl|my_center|LOCUS_19390 2047149 2046223 gene locus_tag LOCUS_19400 2047149 2046223 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943314.1 protein_id gnl|my_center|LOCUS_19400 2047334 2048836 gene locus_tag LOCUS_19410 2047334 2048836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 2049114 2050583 gene locus_tag LOCUS_19420 2049114 2050583 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113389.1 protein_id gnl|my_center|LOCUS_19420 2050809 2050737 gene locus_tag LOCUS_t00150 2050809 2050737 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2050903 2050830 gene locus_tag LOCUS_t00160 2050903 2050830 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 2051034 2050962 gene locus_tag LOCUS_t00170 2051034 2050962 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2051233 2051306 gene locus_tag LOCUS_t00180 2051233 2051306 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2051378 2052046 gene locus_tag LOCUS_19430 2051378 2052046 CDS product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726960.1 protein_id gnl|my_center|LOCUS_19430 2052412 2052071 gene locus_tag LOCUS_19440 2052412 2052071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 2052522 2053196 gene locus_tag LOCUS_19450 2052522 2053196 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776232.1 protein_id gnl|my_center|LOCUS_19450 2053289 2054131 gene locus_tag LOCUS_19460 2053289 2054131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 2054877 2054149 gene locus_tag LOCUS_19470 2054877 2054149 CDS product DUF2071 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977652.1 protein_id gnl|my_center|LOCUS_19470 2055084 2056265 gene locus_tag LOCUS_19480 2055084 2056265 CDS product MarP family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141863754.1 protein_id gnl|my_center|LOCUS_19480 2057637 2056414 gene locus_tag LOCUS_19490 2057637 2056414 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893791.1 protein_id gnl|my_center|LOCUS_19490 2058928 2057816 gene locus_tag LOCUS_19500 gene zapE 2058928 2057816 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224547.1 protein_id gnl|my_center|LOCUS_19500 2059018 2059923 gene locus_tag LOCUS_19510 2059018 2059923 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077428.1 protein_id gnl|my_center|LOCUS_19510 2059920 2060360 gene locus_tag LOCUS_19520 2059920 2060360 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804009.1 protein_id gnl|my_center|LOCUS_19520 2060440 2061942 gene locus_tag LOCUS_19530 2060440 2061942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 2063389 2062148 gene locus_tag LOCUS_19540 2063389 2062148 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047119416.1 protein_id gnl|my_center|LOCUS_19540 2063449 2064060 gene locus_tag LOCUS_19550 2063449 2064060 CDS product DUF3000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030605.1 protein_id gnl|my_center|LOCUS_19550 2064175 2065374 gene locus_tag LOCUS_19560 2064175 2065374 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972895.1 protein_id gnl|my_center|LOCUS_19560 2065452 2066657 gene locus_tag LOCUS_19570 2065452 2066657 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030603.1 protein_id gnl|my_center|LOCUS_19570 2066654 2068819 gene locus_tag LOCUS_19580 2066654 2068819 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030602.1 protein_id gnl|my_center|LOCUS_19580 2069159 2068929 gene locus_tag LOCUS_19590 2069159 2068929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 2071138 2069189 gene locus_tag LOCUS_19600 gene dxs 2071138 2069189 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972908.1 protein_id gnl|my_center|LOCUS_19600 2074078 2071259 gene locus_tag LOCUS_19610 2074078 2071259 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226785.1 protein_id gnl|my_center|LOCUS_19610 2075078 2074251 gene locus_tag LOCUS_19620 2075078 2074251 CDS product DUF3159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805054.1 protein_id gnl|my_center|LOCUS_19620 2075734 2075105 gene locus_tag LOCUS_19630 2075734 2075105 CDS product DUF3710 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805053.1 protein_id gnl|my_center|LOCUS_19630 2076078 2075731 gene locus_tag LOCUS_19640 2076078 2075731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 2076255 2076710 gene locus_tag LOCUS_19650 2076255 2076710 CDS product DUF3093 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413931.1 protein_id gnl|my_center|LOCUS_19650 2077006 2076707 gene locus_tag LOCUS_19660 2077006 2076707 CDS product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003993510.1 protein_id gnl|my_center|LOCUS_19660 2077198 2078403 gene locus_tag LOCUS_19670 2077198 2078403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 2078628 2079023 gene locus_tag LOCUS_19680 2078628 2079023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 2079038 2080222 gene locus_tag LOCUS_19690 2079038 2080222 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045248209.1 protein_id gnl|my_center|LOCUS_19690 2080269 2081306 gene locus_tag LOCUS_19700 2080269 2081306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 2082075 2081314 gene locus_tag LOCUS_19710 2082075 2081314 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724779.1 protein_id gnl|my_center|LOCUS_19710 2083538 2082072 gene locus_tag LOCUS_19720 2083538 2082072 CDS product amino acid ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896718.1 protein_id gnl|my_center|LOCUS_19720 2084255 2083701 gene locus_tag LOCUS_19730 2084255 2083701 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776424.1 protein_id gnl|my_center|LOCUS_19730 2084408 2085223 gene locus_tag LOCUS_19740 2084408 2085223 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104249.1 protein_id gnl|my_center|LOCUS_19740 2085254 2085748 gene locus_tag LOCUS_19750 2085254 2085748 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229328.1 protein_id gnl|my_center|LOCUS_19750 2085860 2086981 gene locus_tag LOCUS_19760 gene pdhA 2085860 2086981 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467649.1 protein_id gnl|my_center|LOCUS_19760 2086978 2087988 gene locus_tag LOCUS_19770 2086978 2087988 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229326.1 protein_id gnl|my_center|LOCUS_19770 2087988 2089430 gene locus_tag LOCUS_19780 2087988 2089430 CDS product 2-oxo acid dehydrogenase subunit E2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029255.1 protein_id gnl|my_center|LOCUS_19780 2089657 2089998 gene locus_tag LOCUS_19790 2089657 2089998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 2090737 2090015 gene locus_tag LOCUS_19800 2090737 2090015 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973759.1 protein_id gnl|my_center|LOCUS_19800 2090901 2091551 gene locus_tag LOCUS_19810 2090901 2091551 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029248.1 protein_id gnl|my_center|LOCUS_19810 2093283 2091451 gene locus_tag LOCUS_19820 2093283 2091451 CDS product two-component system sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026923.1 protein_id gnl|my_center|LOCUS_19820 2093842 2093570 gene locus_tag LOCUS_19830 2093842 2093570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 2094743 2093958 gene locus_tag LOCUS_19840 2094743 2093958 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113991.1 protein_id gnl|my_center|LOCUS_19840 2095281 2094730 gene locus_tag LOCUS_19850 2095281 2094730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 2095870 2095343 gene locus_tag LOCUS_19860 2095870 2095343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 2097502 2096036 gene locus_tag LOCUS_19870 2097502 2096036 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092091.1 protein_id gnl|my_center|LOCUS_19870 2098669 2097599 gene locus_tag LOCUS_19880 2098669 2097599 CDS product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092926.1 protein_id gnl|my_center|LOCUS_19880 2100451 2098730 gene locus_tag LOCUS_19890 gene treZ 2100451 2098730 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728877.1 protein_id gnl|my_center|LOCUS_19890 2102793 2100493 gene locus_tag LOCUS_19900 gene treY 2102793 2100493 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224464.1 protein_id gnl|my_center|LOCUS_19900 2104997 2102790 gene locus_tag LOCUS_19910 gene glgX 2104997 2102790 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731328.1 protein_id gnl|my_center|LOCUS_19910 2105423 2105088 gene locus_tag LOCUS_19920 2105423 2105088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 2105523 2105900 gene locus_tag LOCUS_19930 2105523 2105900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 2106301 2105927 gene locus_tag LOCUS_19940 2106301 2105927 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728011.1 protein_id gnl|my_center|LOCUS_19940 2106534 2106460 gene locus_tag LOCUS_t00190 2106534 2106460 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2106984 2106607 gene locus_tag LOCUS_19950 gene rsfS 2106984 2106607 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074555.1 protein_id gnl|my_center|LOCUS_19950 2108143 2107052 gene locus_tag LOCUS_19960 2108143 2107052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 2108736 2108140 gene locus_tag LOCUS_19970 gene nadD 2108736 2108140 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485033.1 protein_id gnl|my_center|LOCUS_19970 2108973 2108767 gene locus_tag LOCUS_19980 2108973 2108767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 2110300 2109032 gene locus_tag LOCUS_19990 2110300 2109032 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035137421.1 protein_id gnl|my_center|LOCUS_19990 2111146 2110310 gene locus_tag LOCUS_20000 2111146 2110310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 2112051 2111245 gene locus_tag LOCUS_20010 2112051 2111245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 2113628 2112054 gene locus_tag LOCUS_20020 gene obgE 2113628 2112054 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775853.1 protein_id gnl|my_center|LOCUS_20020 2113974 2113717 gene locus_tag LOCUS_20030 gene rpmA 2113974 2113717 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976205.1 protein_id gnl|my_center|LOCUS_20030 2114300 2113992 gene locus_tag LOCUS_20040 gene rplU 2114300 2113992 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775855.1 protein_id gnl|my_center|LOCUS_20040 2114566 2114838 gene locus_tag LOCUS_20050 2114566 2114838 CDS product DUF4031 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974664.1 protein_id gnl|my_center|LOCUS_20050 2116301 2114844 gene locus_tag LOCUS_20060 2116301 2114844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 2117064 2116291 gene locus_tag LOCUS_20070 2117064 2116291 CDS product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172597933.1 protein_id gnl|my_center|LOCUS_20070 2118025 2117054 gene locus_tag LOCUS_20080 2118025 2117054 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886400.1 protein_id gnl|my_center|LOCUS_20080 2120860 2118200 gene locus_tag LOCUS_20090 2120860 2118200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 2121170 2121769 gene locus_tag LOCUS_20100 2121170 2121769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 2122238 2121819 gene locus_tag LOCUS_20110 gene ndk 2122238 2121819 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804615.1 protein_id gnl|my_center|LOCUS_20110 2122639 2122235 gene locus_tag LOCUS_20120 2122639 2122235 CDS product DUF4233 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976186.1 protein_id gnl|my_center|LOCUS_20120 2124087 2122624 gene locus_tag LOCUS_20130 2124087 2122624 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485025.1 protein_id gnl|my_center|LOCUS_20130 2127499 2124080 gene locus_tag LOCUS_20140 gene ileS 2127499 2124080 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804609.1 protein_id gnl|my_center|LOCUS_20140 2127894 2129561 gene locus_tag LOCUS_20150 2127894 2129561 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495702.1 protein_id gnl|my_center|LOCUS_20150 2129690 2130574 gene locus_tag LOCUS_20160 2129690 2130574 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729787.1 protein_id gnl|my_center|LOCUS_20160 2130571 2131416 gene locus_tag LOCUS_20170 2130571 2131416 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729788.1 protein_id gnl|my_center|LOCUS_20170 2131413 2133047 gene locus_tag LOCUS_20180 2131413 2133047 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729789.1 protein_id gnl|my_center|LOCUS_20180 2133327 2135924 gene locus_tag LOCUS_20190 gene valS 2133327 2135924 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224259.1 protein_id gnl|my_center|LOCUS_20190 2135934 2136380 gene locus_tag LOCUS_20200 2135934 2136380 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391205.1 protein_id gnl|my_center|LOCUS_20200 2136383 2136649 gene locus_tag LOCUS_20210 2136383 2136649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 2137842 2136646 gene locus_tag LOCUS_20220 2137842 2136646 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241160.1 protein_id gnl|my_center|LOCUS_20220 2139232 2137823 gene locus_tag LOCUS_20230 2139232 2137823 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392650.1 protein_id gnl|my_center|LOCUS_20230 2139335 2141380 gene locus_tag LOCUS_20240 2139335 2141380 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226475.1 protein_id gnl|my_center|LOCUS_20240 2141700 2141446 gene locus_tag LOCUS_20250 2141700 2141446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 2143004 2141832 gene locus_tag LOCUS_20260 2143004 2141832 CDS product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329124.1 protein_id gnl|my_center|LOCUS_20260 2144466 2143186 gene locus_tag LOCUS_20270 gene clpX 2144466 2143186 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004562779.1 protein_id gnl|my_center|LOCUS_20270 2145288 2144602 gene locus_tag LOCUS_20280 2145288 2144602 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930165.1 protein_id gnl|my_center|LOCUS_20280 2146051 2145317 gene locus_tag LOCUS_20290 2146051 2145317 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115412275.1 protein_id gnl|my_center|LOCUS_20290 2147545 2146184 gene locus_tag LOCUS_20300 gene tig 2147545 2146184 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804577.1 protein_id gnl|my_center|LOCUS_20300 2147662 2147588 gene locus_tag LOCUS_t00200 2147662 2147588 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2147829 2147902 gene locus_tag LOCUS_t00210 2147829 2147902 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2148764 2147913 gene locus_tag LOCUS_20310 2148764 2147913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 2149722 2148775 gene locus_tag LOCUS_20320 2149722 2148775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 2151197 2149728 gene locus_tag LOCUS_20330 2151197 2149728 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_20330 2152054 2151212 gene locus_tag LOCUS_20340 2152054 2151212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 2152794 2152051 gene locus_tag LOCUS_20350 2152794 2152051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 2153755 2152802 gene locus_tag LOCUS_20360 2153755 2152802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 2154147 2153755 gene locus_tag LOCUS_20370 2154147 2153755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 2154427 2154236 gene locus_tag LOCUS_20380 2154427 2154236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 2156414 2154849 gene locus_tag LOCUS_20390 2156414 2154849 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013995.1 protein_id gnl|my_center|LOCUS_20390 2157892 2156411 gene locus_tag LOCUS_20400 2157892 2156411 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285813.1 protein_id gnl|my_center|LOCUS_20400 2158869 2157880 gene locus_tag LOCUS_20410 2158869 2157880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 2159360 2158872 gene locus_tag LOCUS_20420 2159360 2158872 CDS product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804783.1 protein_id gnl|my_center|LOCUS_20420 2160006 2159374 gene locus_tag LOCUS_20430 2160006 2159374 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730011.1 protein_id gnl|my_center|LOCUS_20430 2160150 2161715 gene locus_tag LOCUS_20440 2160150 2161715 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015605.1 protein_id gnl|my_center|LOCUS_20440 2161840 2163405 gene locus_tag LOCUS_20450 2161840 2163405 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977903.1 protein_id gnl|my_center|LOCUS_20450 2163419 2164126 gene locus_tag LOCUS_20460 2163419 2164126 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226474.1 protein_id gnl|my_center|LOCUS_20460 2164136 2164681 gene locus_tag LOCUS_20470 2164136 2164681 CDS product DUF3090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977160.1 protein_id gnl|my_center|LOCUS_20470 2164681 2165451 gene locus_tag LOCUS_20480 2164681 2165451 CDS product SCO1664 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270002.1 protein_id gnl|my_center|LOCUS_20480 2166124 2165543 gene locus_tag LOCUS_20490 2166124 2165543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100682.1 protein_id gnl|my_center|LOCUS_20490 2166689 2166324 gene locus_tag LOCUS_20500 2166689 2166324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 2167000 2166686 gene locus_tag LOCUS_20510 2167000 2166686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 2167652 2167053 gene locus_tag LOCUS_20520 2167652 2167053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 2167940 2168350 gene locus_tag LOCUS_20530 2167940 2168350 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225759.1 protein_id gnl|my_center|LOCUS_20530 2169850 2168423 gene locus_tag LOCUS_20540 2169850 2168423 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074038115.1 protein_id gnl|my_center|LOCUS_20540 2171321 2170311 gene locus_tag LOCUS_20550 2171321 2170311 CDS product DUF2332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337441.1 protein_id gnl|my_center|LOCUS_20550 2171409 2173955 gene locus_tag LOCUS_20560 gene pepN 2171409 2173955 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028475.1 protein_id gnl|my_center|LOCUS_20560 2174056 2175264 gene locus_tag LOCUS_20570 2174056 2175264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 2175257 2175691 gene locus_tag LOCUS_20580 2175257 2175691 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028501.1 protein_id gnl|my_center|LOCUS_20580 2177123 2175759 gene locus_tag LOCUS_20590 2177123 2175759 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095203.1 protein_id gnl|my_center|LOCUS_20590 2178595 2177120 gene locus_tag LOCUS_20600 2178595 2177120 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776710.1 protein_id gnl|my_center|LOCUS_20600 2179974 2178601 gene locus_tag LOCUS_20610 gene gabT 2179974 2178601 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892002.1 protein_id gnl|my_center|LOCUS_20610 2180252 2180034 gene locus_tag LOCUS_20620 2180252 2180034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 2180139 2181698 gene locus_tag LOCUS_20630 2180139 2181698 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223101.1 protein_id gnl|my_center|LOCUS_20630 2182363 2181680 gene locus_tag LOCUS_20640 2182363 2181680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 2182433 2183308 gene locus_tag LOCUS_20650 2182433 2183308 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804769.1 protein_id gnl|my_center|LOCUS_20650 2183318 2183743 gene locus_tag LOCUS_20660 2183318 2183743 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027960.1 protein_id gnl|my_center|LOCUS_20660 2184248 2183772 gene locus_tag LOCUS_20670 2184248 2183772 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804770.1 protein_id gnl|my_center|LOCUS_20670 2185944 2184262 gene locus_tag LOCUS_20680 gene ettA 2185944 2184262 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804765.1 protein_id gnl|my_center|LOCUS_20680 2186447 2185950 gene locus_tag LOCUS_20690 2186447 2185950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 2187116 2186670 gene locus_tag LOCUS_20700 gene msrA 2187116 2186670 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_20700 2187212 2188216 gene locus_tag LOCUS_20710 gene mgrA 2187212 2188216 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227010.1 protein_id gnl|my_center|LOCUS_20710 2188295 2188537 gene locus_tag LOCUS_20720 2188295 2188537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 2188619 2189401 gene locus_tag LOCUS_20730 2188619 2189401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 2190330 2189491 gene locus_tag LOCUS_20740 gene nadE 2190330 2189491 CDS product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246440.1 protein_id gnl|my_center|LOCUS_20740 2190429 2190947 gene locus_tag LOCUS_20750 2190429 2190947 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922420.1 protein_id gnl|my_center|LOCUS_20750 2191050 2190975 gene locus_tag LOCUS_t00220 2191050 2190975 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2191351 2191091 gene locus_tag LOCUS_20760 2191351 2191091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 2191449 2192069 gene locus_tag LOCUS_20770 gene orn 2191449 2192069 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052450.1 protein_id gnl|my_center|LOCUS_20770 2192115 2192190 gene locus_tag LOCUS_t00230 2192115 2192190 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 2192607 2193884 gene locus_tag LOCUS_20780 2192607 2193884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 2194442 2193894 gene locus_tag LOCUS_20790 2194442 2193894 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898102.1 protein_id gnl|my_center|LOCUS_20790 2195223 2194429 gene locus_tag LOCUS_20800 2195223 2194429 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731491.1 protein_id gnl|my_center|LOCUS_20800 2196647 2195223 gene locus_tag LOCUS_20810 2196647 2195223 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731492.1 protein_id gnl|my_center|LOCUS_20810 2197397 2196750 gene locus_tag LOCUS_20820 2197397 2196750 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898105.1 protein_id gnl|my_center|LOCUS_20820 2198104 2197784 gene locus_tag LOCUS_20830 2198104 2197784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 2199364 2198141 gene locus_tag LOCUS_20840 gene dinB 2199364 2198141 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228056.1 protein_id gnl|my_center|LOCUS_20840 2199880 2199374 gene locus_tag LOCUS_20850 2199880 2199374 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057139.1 protein_id gnl|my_center|LOCUS_20850 2201100 2199994 gene locus_tag LOCUS_20860 2201100 2199994 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015009.1 protein_id gnl|my_center|LOCUS_20860 2201387 2201097 gene locus_tag LOCUS_20870 2201387 2201097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 2202913 2201390 gene locus_tag LOCUS_20880 gene gatB 2202913 2201390 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030281.1 protein_id gnl|my_center|LOCUS_20880 2204463 2202913 gene locus_tag LOCUS_20890 gene gatA 2204463 2202913 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775913.1 protein_id gnl|my_center|LOCUS_20890 2204762 2204466 gene locus_tag LOCUS_20900 gene gatC 2204762 2204466 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973500.1 protein_id gnl|my_center|LOCUS_20900 2206148 2204799 gene locus_tag LOCUS_20910 2206148 2204799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 2206455 2207774 gene locus_tag LOCUS_20920 2206455 2207774 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655286.1 protein_id gnl|my_center|LOCUS_20920 2208404 2207832 gene locus_tag LOCUS_20930 2208404 2207832 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082850.1 protein_id gnl|my_center|LOCUS_20930 2208620 2209498 gene locus_tag LOCUS_20940 2208620 2209498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 2209593 2209904 gene locus_tag LOCUS_20950 2209593 2209904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 2212199 2209932 gene locus_tag LOCUS_20960 gene ligA 2212199 2209932 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030278.1 protein_id gnl|my_center|LOCUS_20960 2213319 2212231 gene locus_tag LOCUS_20970 gene mnmA 2213319 2212231 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973510.1 protein_id gnl|my_center|LOCUS_20970 2214585 2213398 gene locus_tag LOCUS_20980 2214585 2213398 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030274.1 protein_id gnl|my_center|LOCUS_20980 2214670 2216757 gene locus_tag LOCUS_20990 gene glgX 2214670 2216757 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971803.1 protein_id gnl|my_center|LOCUS_20990 2219395 2216807 gene locus_tag LOCUS_21000 2219395 2216807 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486976.1 protein_id gnl|my_center|LOCUS_21000 2219478 2221529 gene locus_tag LOCUS_21010 2219478 2221529 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030248.1 protein_id gnl|my_center|LOCUS_21010 2221526 2223832 gene locus_tag LOCUS_21020 gene glgB 2221526 2223832 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224470.1 protein_id gnl|my_center|LOCUS_21020 2224889 2223930 gene locus_tag LOCUS_21030 2224889 2223930 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973580.1 protein_id gnl|my_center|LOCUS_21030 2226700 2224886 gene locus_tag LOCUS_21040 2226700 2224886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 2226948 2228603 gene locus_tag LOCUS_21050 2226948 2228603 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019261882.1 protein_id gnl|my_center|LOCUS_21050 2228624 2229673 gene locus_tag LOCUS_21060 2228624 2229673 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225393.1 protein_id gnl|my_center|LOCUS_21060 2230421 2229684 gene locus_tag LOCUS_21070 2230421 2229684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 2230762 2230460 gene locus_tag LOCUS_21080 2230762 2230460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229480.1 protein_id gnl|my_center|LOCUS_21080 2231416 2230811 gene locus_tag LOCUS_21090 2231416 2230811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 2232137 2231589 gene locus_tag LOCUS_21100 2232137 2231589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 2233196 2232183 gene locus_tag LOCUS_21110 2233196 2232183 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086852129.1 protein_id gnl|my_center|LOCUS_21110 2233764 2233210 gene locus_tag LOCUS_21120 gene frr 2233764 2233210 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466739.1 protein_id gnl|my_center|LOCUS_21120 2234511 2233795 gene locus_tag LOCUS_21130 gene pyrH 2234511 2233795 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804636.1 protein_id gnl|my_center|LOCUS_21130 2235449 2234622 gene locus_tag LOCUS_21140 gene tsf 2235449 2234622 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893881.1 protein_id gnl|my_center|LOCUS_21140 2236371 2235460 gene locus_tag LOCUS_21150 gene rpsB 2236371 2235460 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804634.1 protein_id gnl|my_center|LOCUS_21150 2236688 2237182 gene locus_tag LOCUS_21160 2236688 2237182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 2238179 2237187 gene locus_tag LOCUS_21170 2238179 2237187 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223859.1 protein_id gnl|my_center|LOCUS_21170 2239120 2238209 gene locus_tag LOCUS_21180 gene cpdA 2239120 2238209 CDS product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404120.1 protein_id gnl|my_center|LOCUS_21180 2239427 2240596 gene locus_tag LOCUS_21190 2239427 2240596 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729117.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21190 2241024 2240605 gene locus_tag LOCUS_21200 2241024 2240605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21200 2241872 2240913 gene locus_tag LOCUS_21210 2241872 2240913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21210 2243404 2241869 gene locus_tag LOCUS_21220 2243404 2241869 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030329.1 protein_id gnl|my_center|LOCUS_21220 2243760 2243404 gene locus_tag LOCUS_21230 2243760 2243404 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081582.1 protein_id gnl|my_center|LOCUS_21230 2244564 2243878 gene locus_tag LOCUS_21240 2244564 2243878 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065397.1 protein_id gnl|my_center|LOCUS_21240 2245708 2244605 gene locus_tag LOCUS_21250 2245708 2244605 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230328.1 protein_id gnl|my_center|LOCUS_21250 2245937 2246935 gene locus_tag LOCUS_21260 2245937 2246935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 2248098 2246980 gene locus_tag LOCUS_21270 2248098 2246980 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083072.1 protein_id gnl|my_center|LOCUS_21270 2248335 2248610 gene locus_tag LOCUS_21280 2248335 2248610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 2250176 2248704 gene locus_tag LOCUS_21290 2250176 2248704 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315085.1 protein_id gnl|my_center|LOCUS_21290 2250559 2250236 gene locus_tag LOCUS_21300 2250559 2250236 CDS product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414710.1 protein_id gnl|my_center|LOCUS_21300 2251216 2250572 gene locus_tag LOCUS_21310 2251216 2250572 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029414600.1 protein_id gnl|my_center|LOCUS_21310 2251891 2251217 gene locus_tag LOCUS_21320 2251891 2251217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 2252407 2252066 gene locus_tag LOCUS_21330 gene rplS 2252407 2252066 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414717.1 protein_id gnl|my_center|LOCUS_21330 2253157 2252606 gene locus_tag LOCUS_21340 2253157 2252606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 2253942 2253223 gene locus_tag LOCUS_21350 gene trmD 2253942 2253223 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804623.1 protein_id gnl|my_center|LOCUS_21350 2254323 2253952 gene locus_tag LOCUS_21360 gene nirD 2254323 2253952 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005100148.1 protein_id gnl|my_center|LOCUS_21360 2254526 2257135 gene locus_tag LOCUS_21370 gene nirB 2254526 2257135 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111865.1 protein_id gnl|my_center|LOCUS_21370 2257139 2257933 gene locus_tag LOCUS_21380 2257139 2257933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 2257933 2259132 gene locus_tag LOCUS_21390 2257933 2259132 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028682.1 protein_id gnl|my_center|LOCUS_21390 2259857 2259192 gene locus_tag LOCUS_21400 2259857 2259192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 2260103 2259867 gene locus_tag LOCUS_21410 2260103 2259867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 2260526 2260107 gene locus_tag LOCUS_21420 2260526 2260107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 2260729 2261865 gene locus_tag LOCUS_21430 2260729 2261865 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224327.1 protein_id gnl|my_center|LOCUS_21430 2262681 2261878 gene locus_tag LOCUS_21440 2262681 2261878 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224195.1 protein_id gnl|my_center|LOCUS_21440 2263191 2262691 gene locus_tag LOCUS_21450 2263191 2262691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 2264838 2263249 gene locus_tag LOCUS_21460 gene ffh 2264838 2263249 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022527326.1 protein_id gnl|my_center|LOCUS_21460 2264935 2265246 gene locus_tag LOCUS_21470 2264935 2265246 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414042.1 protein_id gnl|my_center|LOCUS_21470 2265895 2265392 gene locus_tag LOCUS_21480 2265895 2265392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 2266813 2265938 gene locus_tag LOCUS_21490 2266813 2265938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 2270506 2267042 gene locus_tag LOCUS_21500 2270506 2267042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21500 2270851 2271561 gene locus_tag LOCUS_21510 2270851 2271561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 2271833 2273539 gene locus_tag LOCUS_21520 gene sirA 2271833 2273539 CDS product sulfite reductase SirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972818.1 protein_id gnl|my_center|LOCUS_21520 2273536 2274327 gene locus_tag LOCUS_21530 2273536 2274327 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729897.1 protein_id gnl|my_center|LOCUS_21530 2274324 2275250 gene locus_tag LOCUS_21540 gene cysD 2274324 2275250 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972822.1 protein_id gnl|my_center|LOCUS_21540 2275250 2276305 gene locus_tag LOCUS_21550 2275250 2276305 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223440.1 protein_id gnl|my_center|LOCUS_21550 2276310 2277752 gene locus_tag LOCUS_21560 2276310 2277752 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228435.1 protein_id gnl|my_center|LOCUS_21560 2277749 2278558 gene locus_tag LOCUS_21570 2277749 2278558 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972825.1 protein_id gnl|my_center|LOCUS_21570 2278548 2279465 gene locus_tag LOCUS_21580 2278548 2279465 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223442.1 protein_id gnl|my_center|LOCUS_21580 2279511 2280908 gene locus_tag LOCUS_21590 2279511 2280908 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221998.1 protein_id gnl|my_center|LOCUS_21590 2280905 2281234 gene locus_tag LOCUS_21600 2280905 2281234 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804733.1 protein_id gnl|my_center|LOCUS_21600 2281227 2282189 gene locus_tag LOCUS_21610 2281227 2282189 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226059.1 protein_id gnl|my_center|LOCUS_21610 2282779 2282204 gene locus_tag LOCUS_21620 gene ves 2282779 2282204 CDS product environmental stress-induced protein Ves inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097026.1 protein_id gnl|my_center|LOCUS_21620 2286444 2282827 gene locus_tag LOCUS_21630 gene smc 2286444 2282827 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030315.1 protein_id gnl|my_center|LOCUS_21630 2286618 2287625 gene locus_tag LOCUS_21640 2286618 2287625 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804257.1 protein_id gnl|my_center|LOCUS_21640 2288556 2287633 gene locus_tag LOCUS_21650 gene mutM 2288556 2287633 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223692.1 protein_id gnl|my_center|LOCUS_21650 2289263 2288571 gene locus_tag LOCUS_21660 2289263 2288571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 2289491 2289288 gene locus_tag LOCUS_21670 2289491 2289288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 2290075 2289494 gene locus_tag LOCUS_21680 2290075 2289494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 2292533 2290077 gene locus_tag LOCUS_21690 2292533 2290077 CDS product DUF3488 and transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486200.1 protein_id gnl|my_center|LOCUS_21690 2293854 2292499 gene locus_tag LOCUS_21700 2293854 2292499 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486197.1 protein_id gnl|my_center|LOCUS_21700 2294967 2293867 gene locus_tag LOCUS_21710 2294967 2293867 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976721.1 protein_id gnl|my_center|LOCUS_21710 2295452 2294964 gene locus_tag LOCUS_21720 gene coaD 2295452 2294964 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389543.1 protein_id gnl|my_center|LOCUS_21720 2297680 2295515 gene locus_tag LOCUS_21730 gene recG 2297680 2295515 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973428.1 protein_id gnl|my_center|LOCUS_21730 2297860 2298432 gene locus_tag LOCUS_21740 gene rsmD 2297860 2298432 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466716.1 protein_id gnl|my_center|LOCUS_21740 2299457 2298450 gene locus_tag LOCUS_21750 2299457 2298450 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223640.1 protein_id gnl|my_center|LOCUS_21750 2299482 2299979 gene locus_tag LOCUS_21760 2299482 2299979 CDS product DUF3515 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775877.1 protein_id gnl|my_center|LOCUS_21760 2301084 2299987 gene locus_tag LOCUS_21770 2301084 2299987 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973434.1 protein_id gnl|my_center|LOCUS_21770 2302117 2300990 gene locus_tag LOCUS_21780 2302117 2300990 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030308.1 protein_id gnl|my_center|LOCUS_21780 2302907 2302107 gene locus_tag LOCUS_21790 2302907 2302107 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223626.1 protein_id gnl|my_center|LOCUS_21790 2304321 2302915 gene locus_tag LOCUS_21800 gene murA 2304321 2302915 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975861.1 protein_id gnl|my_center|LOCUS_21800 2304936 2304325 gene locus_tag LOCUS_21810 gene leuD 2304936 2304325 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893754.1 protein_id gnl|my_center|LOCUS_21810 2306393 2304939 gene locus_tag LOCUS_21820 gene leuC 2306393 2304939 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728310.1 protein_id gnl|my_center|LOCUS_21820 2307215 2306532 gene locus_tag LOCUS_21830 2307215 2306532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 2307117 2307440 gene locus_tag LOCUS_21840 2307117 2307440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 2308495 2307437 gene locus_tag LOCUS_21850 2308495 2307437 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051920.1 protein_id gnl|my_center|LOCUS_21850 2308799 2309842 gene locus_tag LOCUS_21860 gene tdh 2308799 2309842 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031190.1 protein_id gnl|my_center|LOCUS_21860 2309892 2311061 gene locus_tag LOCUS_21870 2309892 2311061 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803931.1 protein_id gnl|my_center|LOCUS_21870 2311216 2311143 gene locus_tag LOCUS_t00240 2311216 2311143 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2311337 2311984 gene locus_tag LOCUS_21880 2311337 2311984 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230765.1 protein_id gnl|my_center|LOCUS_21880 2312092 2312865 gene locus_tag LOCUS_21890 2312092 2312865 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357457.1 protein_id gnl|my_center|LOCUS_21890 2312862 2314151 gene locus_tag LOCUS_21900 2312862 2314151 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357458.1 protein_id gnl|my_center|LOCUS_21900 2314151 2314783 gene locus_tag LOCUS_21910 2314151 2314783 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013614.1 protein_id gnl|my_center|LOCUS_21910 2316014 2314809 gene locus_tag LOCUS_21920 2316014 2314809 CDS product EAL domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029301722.1 protein_id gnl|my_center|LOCUS_21920 2316876 2316007 gene locus_tag LOCUS_21930 2316876 2316007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 2319876 2316895 gene locus_tag LOCUS_21940 2319876 2316895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 2320820 2320035 gene locus_tag LOCUS_21950 gene nagB 2320820 2320035 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052563.1 protein_id gnl|my_center|LOCUS_21950 2320977 2321384 gene locus_tag LOCUS_21960 2320977 2321384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 2322156 2321437 gene locus_tag LOCUS_21970 2322156 2321437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 2322539 2322153 gene locus_tag LOCUS_21980 2322539 2322153 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393829.1 protein_id gnl|my_center|LOCUS_21980 2322883 2322632 gene locus_tag LOCUS_21990 2322883 2322632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 2324679 2323150 gene locus_tag LOCUS_22000 2324679 2323150 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727675.1 protein_id gnl|my_center|LOCUS_22000 2324863 2325255 gene locus_tag LOCUS_22010 2324863 2325255 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487415.1 protein_id gnl|my_center|LOCUS_22010 2326106 2325483 gene locus_tag LOCUS_22020 2326106 2325483 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030760.1 protein_id gnl|my_center|LOCUS_22020 2326894 2326541 gene locus_tag LOCUS_22030 2326894 2326541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 2327239 2327556 gene locus_tag LOCUS_22040 2327239 2327556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 2327549 2328826 gene locus_tag LOCUS_22050 2327549 2328826 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967861.1 protein_id gnl|my_center|LOCUS_22050 2328831 2329154 gene locus_tag LOCUS_22060 2328831 2329154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 2329350 2329601 gene locus_tag LOCUS_22070 2329350 2329601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 2329960 2329799 gene locus_tag LOCUS_22080 2329960 2329799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 2329988 2331061 gene locus_tag LOCUS_22090 2329988 2331061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 2331490 2331164 gene locus_tag LOCUS_22100 2331490 2331164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 2332538 2331591 gene locus_tag LOCUS_22110 2332538 2331591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 2333218 2332538 gene locus_tag LOCUS_22120 2333218 2332538 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025775002.1 protein_id gnl|my_center|LOCUS_22120 2333406 2333215 gene locus_tag LOCUS_22130 2333406 2333215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 2334187 2333471 gene locus_tag LOCUS_22140 2334187 2333471 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107019778.1 protein_id gnl|my_center|LOCUS_22140 2335070 2334267 gene locus_tag LOCUS_22150 2335070 2334267 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528749.1 protein_id gnl|my_center|LOCUS_22150 2336218 2335211 gene locus_tag LOCUS_22160 2336218 2335211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 2336889 2336215 gene locus_tag LOCUS_22170 2336889 2336215 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222808.1 protein_id gnl|my_center|LOCUS_22170 2337097 2336879 gene locus_tag LOCUS_22180 2337097 2336879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 2337342 2338844 gene locus_tag LOCUS_22190 2337342 2338844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 2339076 2339315 gene locus_tag LOCUS_22200 2339076 2339315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 2339766 2339344 gene locus_tag LOCUS_22210 2339766 2339344 CDS product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897008.1 protein_id gnl|my_center|LOCUS_22210 2339942 2339763 gene locus_tag LOCUS_22220 2339942 2339763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 2340460 2341800 gene locus_tag LOCUS_22230 2340460 2341800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22230 2341755 2342354 gene locus_tag LOCUS_22240 2341755 2342354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22240 2342291 2343334 gene locus_tag LOCUS_22250 2342291 2343334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22250 2344486 2343488 gene locus_tag LOCUS_22260 2344486 2343488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 2345517 2344492 gene locus_tag LOCUS_22270 gene pdxA 2345517 2344492 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063965.1 protein_id gnl|my_center|LOCUS_22270 2346950 2345514 gene locus_tag LOCUS_22280 2346950 2345514 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063966.1 protein_id gnl|my_center|LOCUS_22280 2347996 2346953 gene locus_tag LOCUS_22290 2347996 2346953 CDS product 2-keto-3-deoxygluconate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040097.1 protein_id gnl|my_center|LOCUS_22290 2349174 2348215 gene locus_tag LOCUS_22300 2349174 2348215 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533155.1 protein_id gnl|my_center|LOCUS_22300 2350066 2349164 gene locus_tag LOCUS_22310 2350066 2349164 CDS product allophanate hydrolase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187690.1 protein_id gnl|my_center|LOCUS_22310 2351418 2350063 gene locus_tag LOCUS_22320 2351418 2350063 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551237.1 protein_id gnl|my_center|LOCUS_22320 2351660 2351421 gene locus_tag LOCUS_22330 2351660 2351421 CDS product acetyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084813.1 protein_id gnl|my_center|LOCUS_22330 2352437 2351685 gene locus_tag LOCUS_22340 2352437 2351685 CDS product LamB/YcsF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533151.1 protein_id gnl|my_center|LOCUS_22340 2352816 2352439 gene locus_tag LOCUS_22350 2352816 2352439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 2353573 2352845 gene locus_tag LOCUS_22360 2353573 2352845 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412971.1 protein_id gnl|my_center|LOCUS_22360 2354395 2353631 gene locus_tag LOCUS_22370 2354395 2353631 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764783.1 protein_id gnl|my_center|LOCUS_22370 2355797 2354388 gene locus_tag LOCUS_22380 2355797 2354388 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268749.1 protein_id gnl|my_center|LOCUS_22380 2356684 2355794 gene locus_tag LOCUS_22390 2356684 2355794 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554892.1 protein_id gnl|my_center|LOCUS_22390 2357766 2356735 gene locus_tag LOCUS_22400 2357766 2356735 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728867.1 protein_id gnl|my_center|LOCUS_22400 2358004 2359041 gene locus_tag LOCUS_22410 2358004 2359041 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728741.1 protein_id gnl|my_center|LOCUS_22410 2359251 2359802 gene locus_tag LOCUS_22420 2359251 2359802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 2359917 2360267 gene locus_tag LOCUS_22430 2359917 2360267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 2360764 2360375 gene locus_tag LOCUS_22440 2360764 2360375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 2361423 2361061 gene locus_tag LOCUS_22450 2361423 2361061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 2361383 2361667 gene locus_tag LOCUS_22460 2361383 2361667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 2361868 2361796 gene locus_tag LOCUS_t00250 2361868 2361796 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2363509 2361980 gene locus_tag LOCUS_22470 gene gltX 2363509 2361980 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775887.1 protein_id gnl|my_center|LOCUS_22470 2364395 2363502 gene locus_tag LOCUS_22480 2364395 2363502 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029852.1 protein_id gnl|my_center|LOCUS_22480 2364543 2365622 gene locus_tag LOCUS_22490 2364543 2365622 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727328.1 protein_id gnl|my_center|LOCUS_22490 2366415 2365708 gene locus_tag LOCUS_22500 2366415 2365708 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100427.1 protein_id gnl|my_center|LOCUS_22500 2367489 2366470 gene locus_tag LOCUS_22510 2367489 2366470 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976409.1 protein_id gnl|my_center|LOCUS_22510 2367569 2368171 gene locus_tag LOCUS_22520 2367569 2368171 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223996.1 protein_id gnl|my_center|LOCUS_22520 2368913 2368173 gene locus_tag LOCUS_22530 2368913 2368173 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775888.1 protein_id gnl|my_center|LOCUS_22530 2370051 2368939 gene locus_tag LOCUS_22540 2370051 2368939 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036086.1 protein_id gnl|my_center|LOCUS_22540 2371130 2370048 gene locus_tag LOCUS_22550 2371130 2370048 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030290.1 protein_id gnl|my_center|LOCUS_22550 2371231 2371482 gene locus_tag LOCUS_22560 2371231 2371482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 2372993 2371506 gene locus_tag LOCUS_22570 2372993 2371506 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803919.1 protein_id gnl|my_center|LOCUS_22570 2373217 2373750 gene locus_tag LOCUS_22580 2373217 2373750 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803918.1 protein_id gnl|my_center|LOCUS_22580 2375355 2373763 gene locus_tag LOCUS_22590 gene serA 2375355 2373763 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973481.1 protein_id gnl|my_center|LOCUS_22590 2375444 2375839 gene locus_tag LOCUS_22600 2375444 2375839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 2376192 2375836 gene locus_tag LOCUS_22610 2376192 2375836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 2376677 2376189 gene locus_tag LOCUS_22620 2376677 2376189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 2378024 2376726 gene locus_tag LOCUS_22630 2378024 2376726 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385749.1 protein_id gnl|my_center|LOCUS_22630 2379520 2378204 gene locus_tag LOCUS_22640 2379520 2378204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 2381184 2379517 gene locus_tag LOCUS_22650 2381184 2379517 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014996.1 protein_id gnl|my_center|LOCUS_22650 2381881 2381237 gene locus_tag LOCUS_22660 2381881 2381237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 2383000 2381972 gene locus_tag LOCUS_22670 gene ilvC 2383000 2381972 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775904.1 protein_id gnl|my_center|LOCUS_22670 2383554 2383045 gene locus_tag LOCUS_22680 gene ilvN 2383554 2383045 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003080760.1 protein_id gnl|my_center|LOCUS_22680 2385380 2383557 gene locus_tag LOCUS_22690 2385380 2383557 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775906.1 protein_id gnl|my_center|LOCUS_22690 2387117 2385423 gene locus_tag LOCUS_22700 gene ilvD 2387117 2385423 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229259.1 protein_id gnl|my_center|LOCUS_22700 2389421 2387145 gene locus_tag LOCUS_22710 2389421 2387145 CDS product bifunctional alpha,alpha-trehalose-phosphate synthase (UDP-forming)/trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775961.1 protein_id gnl|my_center|LOCUS_22710 2389582 2389770 gene locus_tag LOCUS_22720 2389582 2389770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 2389862 2390335 gene locus_tag LOCUS_22730 2389862 2390335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 2390370 2392169 gene locus_tag LOCUS_22740 2390370 2392169 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027999.1 protein_id gnl|my_center|LOCUS_22740 2392252 2392878 gene locus_tag LOCUS_22750 2392252 2392878 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093334.1 protein_id gnl|my_center|LOCUS_22750 2392882 2393562 gene locus_tag LOCUS_22760 2392882 2393562 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014785.1 protein_id gnl|my_center|LOCUS_22760 2393559 2394152 gene locus_tag LOCUS_22770 2393559 2394152 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889093.1 protein_id gnl|my_center|LOCUS_22770 2394227 2395222 gene locus_tag LOCUS_22780 2394227 2395222 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805214.1 protein_id gnl|my_center|LOCUS_22780 2395380 2395718 gene locus_tag LOCUS_22790 2395380 2395718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 2396669 2395782 gene locus_tag LOCUS_22800 2396669 2395782 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776451.1 protein_id gnl|my_center|LOCUS_22800 2397763 2396792 gene locus_tag LOCUS_22810 2397763 2396792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 2399046 2397760 gene locus_tag LOCUS_22820 2399046 2397760 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930007.1 protein_id gnl|my_center|LOCUS_22820 2400751 2399369 gene locus_tag LOCUS_22830 2400751 2399369 CDS product C4-dicarboxylate transporter DctA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973562.1 protein_id gnl|my_center|LOCUS_22830 2400908 2402545 gene locus_tag LOCUS_22840 2400908 2402545 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227865.1 protein_id gnl|my_center|LOCUS_22840 2402542 2403243 gene locus_tag LOCUS_22850 2402542 2403243 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030245.1 protein_id gnl|my_center|LOCUS_22850 2403423 2403348 gene locus_tag LOCUS_t00260 2403423 2403348 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2403420 2404358 gene locus_tag LOCUS_22860 2403420 2404358 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775973.1 protein_id gnl|my_center|LOCUS_22860 2405192 2404458 gene locus_tag LOCUS_22870 2405192 2404458 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013417.1 protein_id gnl|my_center|LOCUS_22870 2405239 2405685 gene locus_tag LOCUS_22880 gene rirA 2405239 2405685 CDS product iron-responsive transcriptional regulator RirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974535.1 protein_id gnl|my_center|LOCUS_22880 2405776 2406954 gene locus_tag LOCUS_22890 2405776 2406954 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971715.1 protein_id gnl|my_center|LOCUS_22890 2407006 2408520 gene locus_tag LOCUS_22900 2407006 2408520 CDS product CYTH and CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978319.1 protein_id gnl|my_center|LOCUS_22900 2410618 2408894 gene locus_tag LOCUS_22910 gene sulP 2410618 2408894 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163161279.1 protein_id gnl|my_center|LOCUS_22910 2411694 2410945 gene locus_tag LOCUS_22920 gene istB 2411694 2410945 CDS product IS21-like element ISFK1 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090937.1 protein_id gnl|my_center|LOCUS_22920 2413244 2411691 gene locus_tag LOCUS_22930 gene istA 2413244 2411691 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015262274.1 protein_id gnl|my_center|LOCUS_22930 2415098 2413638 gene locus_tag LOCUS_22940 2415098 2413638 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229411.1 protein_id gnl|my_center|LOCUS_22940 2415682 2415298 gene locus_tag LOCUS_tm00010 2415682 2415298 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 2416253 2415777 gene locus_tag LOCUS_22950 gene smpB 2416253 2415777 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975846.1 protein_id gnl|my_center|LOCUS_22950 2417248 2416334 gene locus_tag LOCUS_22960 gene ftsX 2417248 2416334 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776048.1 protein_id gnl|my_center|LOCUS_22960 2418420 2417245 gene locus_tag LOCUS_22970 2418420 2417245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 2418609 2419577 gene locus_tag LOCUS_22980 2418609 2419577 CDS product IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058916821.1 protein_id gnl|my_center|LOCUS_22980 2420703 2419591 gene locus_tag LOCUS_22990 gene prfB 2420703 2419591 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776050.1 protein_id gnl|my_center|LOCUS_22990 2420773 2422026 gene locus_tag LOCUS_23000 2420773 2422026 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814398.1 protein_id gnl|my_center|LOCUS_23000 2422056 2422589 gene locus_tag LOCUS_23010 2422056 2422589 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918102.1 protein_id gnl|my_center|LOCUS_23010 2422643 2423086 gene locus_tag LOCUS_23020 2422643 2423086 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466994.1 protein_id gnl|my_center|LOCUS_23020 2423088 2423744 gene locus_tag LOCUS_23030 2423088 2423744 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776661.1 protein_id gnl|my_center|LOCUS_23030 2424697 2423759 gene locus_tag LOCUS_23040 2424697 2423759 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726968.1 protein_id gnl|my_center|LOCUS_23040 2425086 2424736 gene locus_tag LOCUS_23050 2425086 2424736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 2425712 2425245 gene locus_tag LOCUS_23060 2425712 2425245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 2426194 2425709 gene locus_tag LOCUS_23070 2426194 2425709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 2426567 2426169 gene locus_tag LOCUS_23080 2426567 2426169 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776054.1 protein_id gnl|my_center|LOCUS_23080 2426788 2426612 gene locus_tag LOCUS_23090 2426788 2426612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 2426921 2427070 gene locus_tag LOCUS_23100 2426921 2427070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 2427067 2428527 gene locus_tag LOCUS_23110 2427067 2428527 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003903979.1 protein_id gnl|my_center|LOCUS_23110 2428596 2429084 gene locus_tag LOCUS_23120 2428596 2429084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 2429181 2429256 gene locus_tag LOCUS_t00270 2429181 2429256 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2429279 2429740 gene locus_tag LOCUS_23130 2429279 2429740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 2430066 2430482 gene locus_tag LOCUS_23140 2430066 2430482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 2430479 2431828 gene locus_tag LOCUS_23150 2430479 2431828 CDS product DUF3631 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230503.1 protein_id gnl|my_center|LOCUS_23150 2431825 2432067 gene locus_tag LOCUS_23160 2431825 2432067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 2432342 2432740 gene locus_tag LOCUS_23170 2432342 2432740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 2432756 2433616 gene locus_tag LOCUS_23180 2432756 2433616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 2434136 2434552 gene locus_tag LOCUS_23190 2434136 2434552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 2434545 2434916 gene locus_tag LOCUS_23200 2434545 2434916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 2434918 2435214 gene locus_tag LOCUS_23210 2434918 2435214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 2435207 2437981 gene locus_tag LOCUS_23220 2435207 2437981 CDS product phage tail tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389880.1 protein_id gnl|my_center|LOCUS_23220 2438055 2438270 gene locus_tag LOCUS_23230 2438055 2438270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 2438322 2438630 gene locus_tag LOCUS_23240 2438322 2438630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 2439059 2439394 gene locus_tag LOCUS_23250 2439059 2439394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 2440455 2439574 gene locus_tag LOCUS_23260 2440455 2439574 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776056.1 protein_id gnl|my_center|LOCUS_23260 2441388 2440603 gene locus_tag LOCUS_23270 2441388 2440603 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223166.1 protein_id gnl|my_center|LOCUS_23270 2441540 2442856 gene locus_tag LOCUS_23280 2441540 2442856 CDS product YjiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289401.1 protein_id gnl|my_center|LOCUS_23280 2442968 2443555 gene locus_tag LOCUS_23290 2442968 2443555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 2443615 2444148 gene locus_tag LOCUS_23300 2443615 2444148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 2444145 2445581 gene locus_tag LOCUS_23310 2444145 2445581 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030223.1 protein_id gnl|my_center|LOCUS_23310 2445867 2446211 gene locus_tag LOCUS_23320 2445867 2446211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 2447446 2446214 gene locus_tag LOCUS_23330 2447446 2446214 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776058.1 protein_id gnl|my_center|LOCUS_23330 2448127 2447522 gene locus_tag LOCUS_23340 gene soxG 2448127 2447522 CDS product sarcosine oxidase subunit gamma family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103144.1 protein_id gnl|my_center|LOCUS_23340 2450984 2448120 gene locus_tag LOCUS_23350 2450984 2448120 CDS product sarcosine oxidase subunit alpha family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202495.1 protein_id gnl|my_center|LOCUS_23350 2451259 2450981 gene locus_tag LOCUS_23360 2451259 2450981 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229308.1 protein_id gnl|my_center|LOCUS_23360 2452535 2451285 gene locus_tag LOCUS_23370 2452535 2451285 CDS product sarcosine oxidase subunit beta family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229309.1 protein_id gnl|my_center|LOCUS_23370 2452644 2453312 gene locus_tag LOCUS_23380 2452644 2453312 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229311.1 protein_id gnl|my_center|LOCUS_23380 2453496 2453834 gene locus_tag LOCUS_23390 2453496 2453834 CDS product bifunctional 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229731.1 protein_id gnl|my_center|LOCUS_23390 2453850 2455100 gene locus_tag LOCUS_23400 2453850 2455100 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229319.1 protein_id gnl|my_center|LOCUS_23400 2455108 2456241 gene locus_tag LOCUS_23410 2455108 2456241 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229312.1 protein_id gnl|my_center|LOCUS_23410 2457049 2456243 gene locus_tag LOCUS_23420 2457049 2456243 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229732.1 protein_id gnl|my_center|LOCUS_23420 2458006 2457134 gene locus_tag LOCUS_23430 gene purU 2458006 2457134 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974579.1 protein_id gnl|my_center|LOCUS_23430 2458109 2458912 gene locus_tag LOCUS_23440 2458109 2458912 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229732.1 protein_id gnl|my_center|LOCUS_23440 2459115 2461583 gene locus_tag LOCUS_23450 2459115 2461583 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229304.1 protein_id gnl|my_center|LOCUS_23450 2462443 2461619 gene locus_tag LOCUS_23460 2462443 2461619 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897426.1 protein_id gnl|my_center|LOCUS_23460 2463893 2462487 gene locus_tag LOCUS_23470 2463893 2462487 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089500.1 protein_id gnl|my_center|LOCUS_23470 2464077 2465009 gene locus_tag LOCUS_23480 2464077 2465009 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730983.1 protein_id gnl|my_center|LOCUS_23480 2465054 2465138 gene locus_tag LOCUS_t00280 2465054 2465138 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2465251 2465988 gene locus_tag LOCUS_23490 2465251 2465988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 2466907 2465993 gene locus_tag LOCUS_23500 2466907 2465993 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972246.1 protein_id gnl|my_center|LOCUS_23500 2467576 2466983 gene locus_tag LOCUS_23510 gene rdgB 2467576 2466983 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028655.1 protein_id gnl|my_center|LOCUS_23510 2468315 2467581 gene locus_tag LOCUS_23520 gene rph 2468315 2467581 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975906.1 protein_id gnl|my_center|LOCUS_23520 2469181 2468312 gene locus_tag LOCUS_23530 gene murI 2469181 2468312 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776024.1 protein_id gnl|my_center|LOCUS_23530 2469244 2470578 gene locus_tag LOCUS_23540 2469244 2470578 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229465.1 protein_id gnl|my_center|LOCUS_23540 2470941 2470654 gene locus_tag LOCUS_23550 2470941 2470654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 2472538 2470967 gene locus_tag LOCUS_23560 2472538 2470967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068786.1 protein_id gnl|my_center|LOCUS_23560 2473266 2472514 gene locus_tag LOCUS_23570 2473266 2472514 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582910.1 protein_id gnl|my_center|LOCUS_23570 2473433 2474326 gene locus_tag LOCUS_23580 2473433 2474326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 2474450 2475214 gene locus_tag LOCUS_23590 2474450 2475214 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876008.1 protein_id gnl|my_center|LOCUS_23590 2475284 2476084 gene locus_tag LOCUS_23600 2475284 2476084 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_134212093.1 protein_id gnl|my_center|LOCUS_23600 2476084 2476857 gene locus_tag LOCUS_23610 2476084 2476857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 2477120 2476824 gene locus_tag LOCUS_23620 2477120 2476824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 2477207 2478121 gene locus_tag LOCUS_23630 2477207 2478121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406325.1 protein_id gnl|my_center|LOCUS_23630 2479532 2478204 gene locus_tag LOCUS_23640 2479532 2478204 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776617.1 protein_id gnl|my_center|LOCUS_23640 2480463 2479558 gene locus_tag LOCUS_23650 2480463 2479558 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031159.1 protein_id gnl|my_center|LOCUS_23650 2481262 2480450 gene locus_tag LOCUS_23660 2481262 2480450 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270333.1 protein_id gnl|my_center|LOCUS_23660 2482356 2481265 gene locus_tag LOCUS_23670 2482356 2481265 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337572.1 protein_id gnl|my_center|LOCUS_23670 2484084 2482447 gene locus_tag LOCUS_23680 2484084 2482447 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930000.1 protein_id gnl|my_center|LOCUS_23680 2484224 2484727 gene locus_tag LOCUS_23690 2484224 2484727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23690 2484724 2485428 gene locus_tag LOCUS_23700 2484724 2485428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23700 2486501 2485425 gene locus_tag LOCUS_23710 2486501 2485425 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064197.1 protein_id gnl|my_center|LOCUS_23710 2486700 2487647 gene locus_tag LOCUS_23720 2486700 2487647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 2487727 2489229 gene locus_tag LOCUS_23730 2487727 2489229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 2489580 2489966 gene locus_tag LOCUS_23740 2489580 2489966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 2490817 2489963 gene locus_tag LOCUS_23750 2490817 2489963 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894754.1 protein_id gnl|my_center|LOCUS_23750 2492161 2490845 gene locus_tag LOCUS_23760 2492161 2490845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 2492407 2493159 gene locus_tag LOCUS_23770 2492407 2493159 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027779.1 protein_id gnl|my_center|LOCUS_23770 2493241 2494014 gene locus_tag LOCUS_23780 2493241 2494014 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014097.1 protein_id gnl|my_center|LOCUS_23780 2493995 2495320 gene locus_tag LOCUS_23790 gene nadA 2493995 2495320 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804025.1 protein_id gnl|my_center|LOCUS_23790 2495322 2496953 gene locus_tag LOCUS_23800 gene nadB 2495322 2496953 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804026.1 protein_id gnl|my_center|LOCUS_23800 2496947 2497807 gene locus_tag LOCUS_23810 gene nadC 2496947 2497807 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804027.1 protein_id gnl|my_center|LOCUS_23810 2497816 2498970 gene locus_tag LOCUS_23820 2497816 2498970 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804028.1 protein_id gnl|my_center|LOCUS_23820 2499682 2498978 gene locus_tag LOCUS_23830 gene nagL 2499682 2498978 CDS product mycothiol-dependent maleylpyruvate isomerase NagL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855155.1 protein_id gnl|my_center|LOCUS_23830 2499845 2499771 gene locus_tag LOCUS_t00290 2499845 2499771 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2500160 2500086 gene locus_tag LOCUS_t00300 2500160 2500086 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2503155 2500318 gene locus_tag LOCUS_23840 2503155 2500318 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929964.1 protein_id gnl|my_center|LOCUS_23840 2504438 2503329 gene locus_tag LOCUS_23850 2504438 2503329 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804763.1 protein_id gnl|my_center|LOCUS_23850 2504597 2505961 gene locus_tag LOCUS_23860 2504597 2505961 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973777.1 protein_id gnl|my_center|LOCUS_23860 2506091 2507185 gene locus_tag LOCUS_23870 gene adhP 2506091 2507185 CDS product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015397.1 protein_id gnl|my_center|LOCUS_23870 2507313 2508224 gene locus_tag LOCUS_23880 2507313 2508224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416809.1 protein_id gnl|my_center|LOCUS_23880 2509875 2508115 gene locus_tag LOCUS_23890 2509875 2508115 CDS product ATP-dependent DNA helicase UvrD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668762.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23890 2510816 2509827 gene locus_tag LOCUS_23900 gene nudC 2510816 2509827 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327228.1 protein_id gnl|my_center|LOCUS_23900 2510907 2512115 gene locus_tag LOCUS_23910 2510907 2512115 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067952.1 protein_id gnl|my_center|LOCUS_23910 2515408 2512010 gene locus_tag LOCUS_23920 2515408 2512010 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223039.1 protein_id gnl|my_center|LOCUS_23920 2518758 2515405 gene locus_tag LOCUS_23930 gene adnA 2518758 2515405 CDS product ATP-dependent DNA helicase AdnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003905015.1 protein_id gnl|my_center|LOCUS_23930 2518855 2519079 gene locus_tag LOCUS_23940 2518855 2519079 CDS product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221492514.1 protein_id gnl|my_center|LOCUS_23940 2519086 2519394 gene locus_tag LOCUS_23950 2519086 2519394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 2520238 2519510 gene locus_tag LOCUS_23960 2520238 2519510 CDS product ferritin-like fold-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223015.1 protein_id gnl|my_center|LOCUS_23960 2520315 2521916 gene locus_tag LOCUS_23970 2520315 2521916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 2522874 2522005 gene locus_tag LOCUS_23980 2522874 2522005 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804749.1 protein_id gnl|my_center|LOCUS_23980 2522954 2523988 gene locus_tag LOCUS_23990 2522954 2523988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 2524035 2525576 gene locus_tag LOCUS_24000 2524035 2525576 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930178.1 protein_id gnl|my_center|LOCUS_24000 2526267 2525713 gene locus_tag LOCUS_24010 2526267 2525713 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406290.1 protein_id gnl|my_center|LOCUS_24010 2526382 2527392 gene locus_tag LOCUS_24020 2526382 2527392 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_24020 2527398 2528384 gene locus_tag LOCUS_24030 2527398 2528384 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804230.1 protein_id gnl|my_center|LOCUS_24030 2528397 2528801 gene locus_tag LOCUS_24040 gene rbsD 2528397 2528801 CDS product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693672.1 protein_id gnl|my_center|LOCUS_24040 2528812 2530305 gene locus_tag LOCUS_24050 2528812 2530305 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978049.1 protein_id gnl|my_center|LOCUS_24050 2530302 2531354 gene locus_tag LOCUS_24060 2530302 2531354 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074641.1 protein_id gnl|my_center|LOCUS_24060 2531410 2532405 gene locus_tag LOCUS_24070 2531410 2532405 CDS product D-ribose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014235.1 protein_id gnl|my_center|LOCUS_24070 2532490 2533791 gene locus_tag LOCUS_24080 2532490 2533791 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030088.1 protein_id gnl|my_center|LOCUS_24080 2533778 2534341 gene locus_tag LOCUS_24090 2533778 2534341 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804746.1 protein_id gnl|my_center|LOCUS_24090 2534334 2535506 gene locus_tag LOCUS_24100 2534334 2535506 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286318.1 protein_id gnl|my_center|LOCUS_24100 2535671 2537209 gene locus_tag LOCUS_24110 2535671 2537209 CDS product succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224348.1 protein_id gnl|my_center|LOCUS_24110 2538070 2537186 gene locus_tag LOCUS_24120 gene ppk2 2538070 2537186 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013972.1 protein_id gnl|my_center|LOCUS_24120 2541739 2538083 gene locus_tag LOCUS_24130 2541739 2538083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 2542245 2541814 gene locus_tag LOCUS_24140 2542245 2541814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 2542945 2542493 gene locus_tag LOCUS_24150 2542945 2542493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 2542978 2543610 gene locus_tag LOCUS_24160 2542978 2543610 CDS product SAM-dependent O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911448.1 protein_id gnl|my_center|LOCUS_24160 2543888 2543697 gene locus_tag LOCUS_24170 2543888 2543697 CDS product DUF3117 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010551467.1 protein_id gnl|my_center|LOCUS_24170 2545144 2543957 gene locus_tag LOCUS_24180 2545144 2543957 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705134.1 protein_id gnl|my_center|LOCUS_24180 2546280 2545177 gene locus_tag LOCUS_24190 gene dapE 2546280 2545177 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030079.1 protein_id gnl|my_center|LOCUS_24190 2546298 2547275 gene locus_tag LOCUS_24200 gene dapD 2546298 2547275 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930176.1 protein_id gnl|my_center|LOCUS_24200 2547341 2549956 gene locus_tag LOCUS_24210 2547341 2549956 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259579.1 protein_id gnl|my_center|LOCUS_24210 2551334 2550000 gene locus_tag LOCUS_24220 2551334 2550000 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897085.1 protein_id gnl|my_center|LOCUS_24220 2552642 2551542 gene locus_tag LOCUS_24230 2552642 2551542 CDS product bifunctional succinyldiaminopimelate transaminase/glutamate-prephenate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030077.1 protein_id gnl|my_center|LOCUS_24230 2552972 2552649 gene locus_tag LOCUS_24240 2552972 2552649 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804733.1 protein_id gnl|my_center|LOCUS_24240 2554022 2553045 gene locus_tag LOCUS_24250 2554022 2553045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 2554164 2555027 gene locus_tag LOCUS_24260 2554164 2555027 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976536.1 protein_id gnl|my_center|LOCUS_24260 2555064 2556248 gene locus_tag LOCUS_24270 2555064 2556248 CDS product peptidase M75 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229934.1 protein_id gnl|my_center|LOCUS_24270 2556245 2557567 gene locus_tag LOCUS_24280 gene efeB 2556245 2557567 CDS product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073925.1 protein_id gnl|my_center|LOCUS_24280 2558123 2557689 gene locus_tag LOCUS_24290 2558123 2557689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 2560107 2558197 gene locus_tag LOCUS_24300 gene typA 2560107 2558197 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804730.1 protein_id gnl|my_center|LOCUS_24300 2562011 2560233 gene locus_tag LOCUS_24310 2562011 2560233 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113016.1 protein_id gnl|my_center|LOCUS_24310 2562103 2562666 gene locus_tag LOCUS_24320 2562103 2562666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 2563715 2562687 gene locus_tag LOCUS_24330 2563715 2562687 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229761.1 protein_id gnl|my_center|LOCUS_24330 2565253 2563715 gene locus_tag LOCUS_24340 2565253 2563715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 2567190 2565418 gene locus_tag LOCUS_24350 2567190 2565418 CDS product ABC transporter family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283994.1 protein_id gnl|my_center|LOCUS_24350 2569289 2567487 gene locus_tag LOCUS_24360 2569289 2567487 CDS product ABC transporter family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283994.1 protein_id gnl|my_center|LOCUS_24360 2571145 2569340 gene locus_tag LOCUS_24370 2571145 2569340 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467722.1 protein_id gnl|my_center|LOCUS_24370 2571208 2571813 gene locus_tag LOCUS_24380 2571208 2571813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 2572847 2571828 gene locus_tag LOCUS_24390 2572847 2571828 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229761.1 protein_id gnl|my_center|LOCUS_24390 2574343 2572847 gene locus_tag LOCUS_24400 2574343 2572847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 2574306 2574464 gene locus_tag LOCUS_24410 2574306 2574464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 2576257 2574476 gene locus_tag LOCUS_24420 2576257 2574476 CDS product ABC transporter family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283994.1 protein_id gnl|my_center|LOCUS_24420 2578201 2576453 gene locus_tag LOCUS_24430 2578201 2576453 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014807.1 protein_id gnl|my_center|LOCUS_24430 2579145 2578198 gene locus_tag LOCUS_24440 2579145 2578198 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006284211.1 protein_id gnl|my_center|LOCUS_24440 2580064 2579135 gene locus_tag LOCUS_24450 2580064 2579135 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419701.1 protein_id gnl|my_center|LOCUS_24450 2581876 2580197 gene locus_tag LOCUS_24460 2581876 2580197 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014806.1 protein_id gnl|my_center|LOCUS_24460 2582144 2582923 gene locus_tag LOCUS_24470 2582144 2582923 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776540.1 protein_id gnl|my_center|LOCUS_24470 2585992 2583044 gene locus_tag LOCUS_24480 gene gcvP 2585992 2583044 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804854.1 protein_id gnl|my_center|LOCUS_24480 2586367 2585996 gene locus_tag LOCUS_24490 gene gcvH 2586367 2585996 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804853.1 protein_id gnl|my_center|LOCUS_24490 2587530 2586394 gene locus_tag LOCUS_24500 gene gcvT 2587530 2586394 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804852.1 protein_id gnl|my_center|LOCUS_24500 2587925 2588689 gene locus_tag LOCUS_24510 2587925 2588689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 2589533 2588679 gene locus_tag LOCUS_24520 2589533 2588679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 2590071 2589595 gene locus_tag LOCUS_24530 2590071 2589595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 2590552 2590058 gene locus_tag LOCUS_24540 2590552 2590058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 2593244 2590620 gene locus_tag LOCUS_24550 2593244 2590620 CDS product putative baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133736098.1 protein_id gnl|my_center|LOCUS_24550 2593708 2593241 gene locus_tag LOCUS_24560 2593708 2593241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 2594043 2593705 gene locus_tag LOCUS_24570 2594043 2593705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 2595560 2594040 gene locus_tag LOCUS_24580 2595560 2594040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 2596321 2595557 gene locus_tag LOCUS_24590 2596321 2595557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 2598057 2597551 gene locus_tag LOCUS_24600 2598057 2597551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 2599306 2598059 gene locus_tag LOCUS_24610 2599306 2598059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 2600028 2599339 gene locus_tag LOCUS_24620 2600028 2599339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 2600287 2600937 gene locus_tag LOCUS_24630 2600287 2600937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 2600934 2602130 gene locus_tag LOCUS_24640 2600934 2602130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 2602275 2603009 gene locus_tag LOCUS_24650 2602275 2603009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 2603006 2603866 gene locus_tag LOCUS_24660 2603006 2603866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 2603945 2604925 gene locus_tag LOCUS_24670 2603945 2604925 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626569.1 protein_id gnl|my_center|LOCUS_24670 2604922 2605773 gene locus_tag LOCUS_24680 2604922 2605773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 2605846 2606181 gene locus_tag LOCUS_24690 2605846 2606181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 2607965 2606301 gene locus_tag LOCUS_24700 2607965 2606301 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104457.1 protein_id gnl|my_center|LOCUS_24700 2608620 2608009 gene locus_tag LOCUS_24710 2608620 2608009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 2609335 2608622 gene locus_tag LOCUS_24720 2609335 2608622 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036734.1 protein_id gnl|my_center|LOCUS_24720 2609489 2611870 gene locus_tag LOCUS_24730 2609489 2611870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 2611926 2612621 gene locus_tag LOCUS_24740 2611926 2612621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 2612644 2613384 gene locus_tag LOCUS_24750 2612644 2613384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 2613533 2614996 gene locus_tag LOCUS_24760 2613533 2614996 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484182.1 protein_id gnl|my_center|LOCUS_24760 2616866 2615031 gene locus_tag LOCUS_24770 2616866 2615031 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226167.1 protein_id gnl|my_center|LOCUS_24770 2617035 2618891 gene locus_tag LOCUS_24780 2617035 2618891 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086110.1 protein_id gnl|my_center|LOCUS_24780 2618934 2619401 gene locus_tag LOCUS_24790 2618934 2619401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 2619404 2621530 gene locus_tag LOCUS_24800 2619404 2621530 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399322.1 protein_id gnl|my_center|LOCUS_24800 2621583 2623931 gene locus_tag LOCUS_24810 2621583 2623931 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533167.1 protein_id gnl|my_center|LOCUS_24810 2624019 2624828 gene locus_tag LOCUS_24820 2624019 2624828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 2626064 2624832 gene locus_tag LOCUS_24830 2626064 2624832 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762629.1 protein_id gnl|my_center|LOCUS_24830 2626311 2626090 gene locus_tag LOCUS_24840 2626311 2626090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 2627274 2626429 gene locus_tag LOCUS_24850 2627274 2626429 CDS product bacteriorhodopsin-like inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140202.1 protein_id gnl|my_center|LOCUS_24850 2627426 2628715 gene locus_tag LOCUS_24860 2627426 2628715 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015414.1 protein_id gnl|my_center|LOCUS_24860 2629143 2628727 gene locus_tag LOCUS_24870 2629143 2628727 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895802.1 protein_id gnl|my_center|LOCUS_24870 2629929 2629360 gene locus_tag LOCUS_24880 2629929 2629360 CDS product HhH-GPD-type base excision DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896556.1 protein_id gnl|my_center|LOCUS_24880 2630055 2631713 gene locus_tag LOCUS_24890 2630055 2631713 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014807.1 protein_id gnl|my_center|LOCUS_24890 2632665 2631733 gene locus_tag LOCUS_24900 2632665 2631733 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230615.1 protein_id gnl|my_center|LOCUS_24900 2633675 2632671 gene locus_tag LOCUS_24910 2633675 2632671 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230616.1 protein_id gnl|my_center|LOCUS_24910 2635424 2633763 gene locus_tag LOCUS_24920 2635424 2633763 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230617.1 protein_id gnl|my_center|LOCUS_24920 2636208 2635798 gene locus_tag LOCUS_24930 2636208 2635798 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804508.1 protein_id gnl|my_center|LOCUS_24930 2636708 2636247 gene locus_tag LOCUS_24940 2636708 2636247 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888560.1 protein_id gnl|my_center|LOCUS_24940 2636807 2637079 gene locus_tag LOCUS_24950 2636807 2637079 CDS product DUF2277 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089416.1 protein_id gnl|my_center|LOCUS_24950 2638045 2637371 gene locus_tag LOCUS_24960 2638045 2637371 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227434.1 protein_id gnl|my_center|LOCUS_24960 2638979 2638275 gene locus_tag LOCUS_24970 2638979 2638275 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224710.1 protein_id gnl|my_center|LOCUS_24970 2639752 2639075 gene locus_tag LOCUS_24980 2639752 2639075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 2640493 2640296 gene locus_tag LOCUS_24990 2640493 2640296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 2640386 2640625 gene locus_tag LOCUS_25000 2640386 2640625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 2640976 2640764 gene locus_tag LOCUS_25010 2640976 2640764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 2642423 2641350 gene locus_tag LOCUS_25020 gene ychF 2642423 2641350 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776292.1 protein_id gnl|my_center|LOCUS_25020 2642487 2643101 gene locus_tag LOCUS_25030 2642487 2643101 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613738.1 protein_id gnl|my_center|LOCUS_25030 2643248 2644480 gene locus_tag LOCUS_25040 2643248 2644480 CDS product lycopene cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257690.1 protein_id gnl|my_center|LOCUS_25040 2644477 2645442 gene locus_tag LOCUS_25050 2644477 2645442 CDS product Brp/Blh family beta-carotene 15,15'-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404936.1 protein_id gnl|my_center|LOCUS_25050 2645472 2646872 gene locus_tag LOCUS_25060 2645472 2646872 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004137617.1 protein_id gnl|my_center|LOCUS_25060 2647941 2646955 gene locus_tag LOCUS_25070 gene glpX 2647941 2646955 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742217.1 protein_id gnl|my_center|LOCUS_25070 2649551 2648082 gene locus_tag LOCUS_25080 2649551 2648082 CDS product GntP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104433.1 protein_id gnl|my_center|LOCUS_25080 2650562 2649642 gene locus_tag LOCUS_25090 2650562 2649642 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803721.1 protein_id gnl|my_center|LOCUS_25090 2652028 2650559 gene locus_tag LOCUS_25100 2652028 2650559 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803720.1 protein_id gnl|my_center|LOCUS_25100 2652826 2652122 gene locus_tag LOCUS_25110 2652826 2652122 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225805.1 protein_id gnl|my_center|LOCUS_25110 2652997 2654022 gene locus_tag LOCUS_25120 gene fbaA 2652997 2654022 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029142.1 protein_id gnl|my_center|LOCUS_25120 2654086 2654715 gene locus_tag LOCUS_25130 2654086 2654715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 2655789 2654749 gene locus_tag LOCUS_25140 2655789 2654749 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776295.1 protein_id gnl|my_center|LOCUS_25140 2655886 2657172 gene locus_tag LOCUS_25150 gene xseA 2655886 2657172 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776296.1 protein_id gnl|my_center|LOCUS_25150 2657183 2657431 gene locus_tag LOCUS_25160 2657183 2657431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 2657428 2658075 gene locus_tag LOCUS_25170 2657428 2658075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 2658142 2658780 gene locus_tag LOCUS_25180 2658142 2658780 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166331374.1 protein_id gnl|my_center|LOCUS_25180 2658855 2660279 gene locus_tag LOCUS_25190 2658855 2660279 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776300.1 protein_id gnl|my_center|LOCUS_25190 2661858 2660512 gene locus_tag LOCUS_25200 2661858 2660512 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973949.1 protein_id gnl|my_center|LOCUS_25200 2663183 2662062 gene locus_tag LOCUS_25210 2663183 2662062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 2663929 2663231 gene locus_tag LOCUS_25220 2663929 2663231 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167441465.1 protein_id gnl|my_center|LOCUS_25220 2664085 2664786 gene locus_tag LOCUS_25230 2664085 2664786 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029984.1 protein_id gnl|my_center|LOCUS_25230 2665066 2664824 gene locus_tag LOCUS_25240 2665066 2664824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 2665929 2665063 gene locus_tag LOCUS_25250 gene mca 2665929 2665063 CDS product mycothiol conjugate amidase Mca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059316.1 protein_id gnl|my_center|LOCUS_25250 2666018 2666458 gene locus_tag LOCUS_25260 2666018 2666458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 2666592 2667080 gene locus_tag LOCUS_25270 gene greA 2666592 2667080 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776308.1 protein_id gnl|my_center|LOCUS_25270 2668330 2667095 gene locus_tag LOCUS_25280 gene ilvA 2668330 2667095 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029975.1 protein_id gnl|my_center|LOCUS_25280 2669517 2668333 gene locus_tag LOCUS_25290 2669517 2668333 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891590.1 protein_id gnl|my_center|LOCUS_25290 2670679 2669594 gene locus_tag LOCUS_25300 2670679 2669594 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897935.1 protein_id gnl|my_center|LOCUS_25300 2671530 2670676 gene locus_tag LOCUS_25310 2671530 2670676 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897936.1 protein_id gnl|my_center|LOCUS_25310 2672327 2671527 gene locus_tag LOCUS_25320 2672327 2671527 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897937.1 protein_id gnl|my_center|LOCUS_25320 2673507 2672377 gene locus_tag LOCUS_25330 2673507 2672377 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731336.1 protein_id gnl|my_center|LOCUS_25330 2673689 2674897 gene locus_tag LOCUS_25340 2673689 2674897 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531089.1 protein_id gnl|my_center|LOCUS_25340 2675884 2674997 gene locus_tag LOCUS_25350 gene htpX 2675884 2674997 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583272.1 protein_id gnl|my_center|LOCUS_25350 2676463 2675897 gene locus_tag LOCUS_25360 2676463 2675897 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022624.1 protein_id gnl|my_center|LOCUS_25360 2676675 2677430 gene locus_tag LOCUS_25370 2676675 2677430 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229141.1 protein_id gnl|my_center|LOCUS_25370 2677427 2678161 gene locus_tag LOCUS_25380 2677427 2678161 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229140.1 protein_id gnl|my_center|LOCUS_25380 2679658 2678165 gene locus_tag LOCUS_25390 2679658 2678165 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222037.1 protein_id gnl|my_center|LOCUS_25390 2680968 2679655 gene locus_tag LOCUS_25400 2680968 2679655 CDS product D-arabinono-1,4-lactone oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030501.1 protein_id gnl|my_center|LOCUS_25400 2681532 2681020 gene locus_tag LOCUS_25410 2681532 2681020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 2681429 2683291 gene locus_tag LOCUS_25420 2681429 2683291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 2683311 2684237 gene locus_tag LOCUS_25430 2683311 2684237 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028926.1 protein_id gnl|my_center|LOCUS_25430 2684294 2684743 gene locus_tag LOCUS_25440 2684294 2684743 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819713.1 protein_id gnl|my_center|LOCUS_25440 2686335 2684740 gene locus_tag LOCUS_25450 2686335 2684740 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140102.1 protein_id gnl|my_center|LOCUS_25450 2688162 2686741 gene locus_tag LOCUS_25460 2688162 2686741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 2688513 2688437 gene locus_tag LOCUS_t00310 2688513 2688437 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2690080 2688566 gene locus_tag LOCUS_25470 2690080 2688566 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031431.1 protein_id gnl|my_center|LOCUS_25470 2691424 2690123 gene locus_tag LOCUS_25480 2691424 2690123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 2692041 2691511 gene locus_tag LOCUS_25490 2692041 2691511 CDS product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028762.1 protein_id gnl|my_center|LOCUS_25490 2692553 2692038 gene locus_tag LOCUS_25500 2692553 2692038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 2693901 2692621 gene locus_tag LOCUS_25510 gene eno 2693901 2692621 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229929.1 protein_id gnl|my_center|LOCUS_25510 2695242 2693989 gene locus_tag LOCUS_25520 gene hisS 2695242 2693989 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036976.1 protein_id gnl|my_center|LOCUS_25520 2696005 2695283 gene locus_tag LOCUS_25530 2696005 2695283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 2696217 2697536 gene locus_tag LOCUS_25540 gene nhaA 2696217 2697536 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081951.1 protein_id gnl|my_center|LOCUS_25540 2701226 2697603 gene locus_tag LOCUS_25550 gene mfd 2701226 2697603 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068204100.1 protein_id gnl|my_center|LOCUS_25550 2702024 2701521 gene locus_tag LOCUS_25560 gene pth 2702024 2701521 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405251.1 protein_id gnl|my_center|LOCUS_25560 2701974 2702225 gene locus_tag LOCUS_25570 2701974 2702225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 2702746 2702144 gene locus_tag LOCUS_25580 2702746 2702144 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092871.1 protein_id gnl|my_center|LOCUS_25580 2703960 2703016 gene locus_tag LOCUS_25590 2703960 2703016 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029030.1 protein_id gnl|my_center|LOCUS_25590 2704613 2703957 gene locus_tag LOCUS_25600 2704613 2703957 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027391.1 protein_id gnl|my_center|LOCUS_25600 2705755 2704607 gene locus_tag LOCUS_25610 gene dgoD 2705755 2704607 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230776.1 protein_id gnl|my_center|LOCUS_25610 2706662 2705760 gene locus_tag LOCUS_25620 2706662 2705760 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974653.1 protein_id gnl|my_center|LOCUS_25620 2707582 2706662 gene locus_tag LOCUS_25630 2707582 2706662 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085515.1 protein_id gnl|my_center|LOCUS_25630 2708920 2707676 gene locus_tag LOCUS_25640 2708920 2707676 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331252.1 protein_id gnl|my_center|LOCUS_25640 2709110 2709832 gene locus_tag LOCUS_25650 2709110 2709832 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027913.1 protein_id gnl|my_center|LOCUS_25650 2709850 2710566 gene locus_tag LOCUS_25660 2709850 2710566 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027913.1 protein_id gnl|my_center|LOCUS_25660 2711650 2710610 gene locus_tag LOCUS_25670 2711650 2710610 CDS product L-idonate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027915.1 protein_id gnl|my_center|LOCUS_25670 2712480 2711683 gene locus_tag LOCUS_25680 2712480 2711683 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729052.1 protein_id gnl|my_center|LOCUS_25680 2713884 2712484 gene locus_tag LOCUS_25690 2713884 2712484 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015481.1 protein_id gnl|my_center|LOCUS_25690 2714479 2713919 gene locus_tag LOCUS_25700 2714479 2713919 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977146.1 protein_id gnl|my_center|LOCUS_25700 2714693 2716150 gene locus_tag LOCUS_25710 gene gndA 2714693 2716150 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856232.1 protein_id gnl|my_center|LOCUS_25710 2716291 2716656 gene locus_tag LOCUS_25720 2716291 2716656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 2716792 2719251 gene locus_tag LOCUS_25730 2716792 2719251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 2719251 2721077 gene locus_tag LOCUS_25740 2719251 2721077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 2721074 2722132 gene locus_tag LOCUS_25750 2721074 2722132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 2722129 2723088 gene locus_tag LOCUS_25760 2722129 2723088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 2723085 2723570 gene locus_tag LOCUS_25770 2723085 2723570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 2723567 2724028 gene locus_tag LOCUS_25780 2723567 2724028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 2724025 2725356 gene locus_tag LOCUS_25790 2724025 2725356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 2726720 2725743 gene locus_tag LOCUS_25800 2726720 2725743 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975691.1 protein_id gnl|my_center|LOCUS_25800 2728235 2726721 gene locus_tag LOCUS_25810 gene glmU 2728235 2726721 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929929.1 protein_id gnl|my_center|LOCUS_25810 2728344 2728272 gene locus_tag LOCUS_t00320 2728344 2728272 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2728437 2728928 gene locus_tag LOCUS_25820 gene tamR 2728437 2728928 CDS product MarR family transcriptional regulator TamR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975680.1 protein_id gnl|my_center|LOCUS_25820 2730219 2729014 gene locus_tag LOCUS_25830 2730219 2729014 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222135.1 protein_id gnl|my_center|LOCUS_25830 2731440 2730388 gene locus_tag LOCUS_25840 2731440 2730388 CDS product alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170068.1 protein_id gnl|my_center|LOCUS_25840 2731832 2731686 gene locus_tag LOCUS_25850 2731832 2731686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 2731890 2733329 gene locus_tag LOCUS_25860 2731890 2733329 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974635.1 protein_id gnl|my_center|LOCUS_25860 2734392 2733685 gene locus_tag LOCUS_25870 2734392 2733685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 2734505 2735185 gene locus_tag LOCUS_25880 2734505 2735185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 2735511 2737004 gene locus_tag LOCUS_25890 gene istA 2735511 2737004 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100512979.1 protein_id gnl|my_center|LOCUS_25890 2737001 2737732 gene locus_tag LOCUS_25900 gene istB 2737001 2737732 CDS product IS21-like element ISBlo1 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012472066.1 protein_id gnl|my_center|LOCUS_25900 2738114 2739139 gene locus_tag LOCUS_25910 2738114 2739139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 2739233 2739538 gene locus_tag LOCUS_25920 2739233 2739538 CDS product thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775987.1 protein_id gnl|my_center|LOCUS_25920 2739928 2739761 gene locus_tag LOCUS_25930 2739928 2739761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 2740625 2739948 gene locus_tag LOCUS_25940 2740625 2739948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 2740936 2740658 gene locus_tag LOCUS_25950 2740936 2740658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 2741380 2741231 gene locus_tag LOCUS_25960 2741380 2741231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25960 2742612 2741389 gene locus_tag LOCUS_25970 2742612 2741389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 2743553 2742648 gene locus_tag LOCUS_25980 2743553 2742648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 2743595 2744689 gene locus_tag LOCUS_25990 2743595 2744689 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103575.1 protein_id gnl|my_center|LOCUS_25990 2745737 2744700 gene locus_tag LOCUS_26000 2745737 2744700 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183373870.1 protein_id gnl|my_center|LOCUS_26000 2747071 2745734 gene locus_tag LOCUS_26010 2747071 2745734 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226803.1 protein_id gnl|my_center|LOCUS_26010 2748637 2747198 gene locus_tag LOCUS_26020 2748637 2747198 CDS product GuaB1 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164279790.1 protein_id gnl|my_center|LOCUS_26020 2748904 2752533 gene locus_tag LOCUS_26030 2748904 2752533 CDS product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030150.1 protein_id gnl|my_center|LOCUS_26030 2752962 2752720 gene locus_tag LOCUS_26040 2752962 2752720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 2753669 2752959 gene locus_tag LOCUS_26050 2753669 2752959 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229712.1 protein_id gnl|my_center|LOCUS_26050 2753713 2755071 gene locus_tag LOCUS_26060 gene aroA 2753713 2755071 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973760.1 protein_id gnl|my_center|LOCUS_26060 2755072 2756145 gene locus_tag LOCUS_26070 gene rsgA 2755072 2756145 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775972.1 protein_id gnl|my_center|LOCUS_26070 2756168 2756605 gene locus_tag LOCUS_26080 2756168 2756605 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887982.1 protein_id gnl|my_center|LOCUS_26080 2756598 2758028 gene locus_tag LOCUS_26090 2756598 2758028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 2758067 2758546 gene locus_tag LOCUS_26100 gene bcp 2758067 2758546 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093079.1 protein_id gnl|my_center|LOCUS_26100 2759009 2758560 gene locus_tag LOCUS_26110 2759009 2758560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 2759194 2759442 gene locus_tag LOCUS_26120 2759194 2759442 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776066.1 protein_id gnl|my_center|LOCUS_26120 2761111 2759666 gene locus_tag LOCUS_26130 2761111 2759666 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973732.1 protein_id gnl|my_center|LOCUS_26130 2761237 2761701 gene locus_tag LOCUS_26140 2761237 2761701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 2761698 2763395 gene locus_tag LOCUS_26150 2761698 2763395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 2764221 2763376 gene locus_tag LOCUS_26160 2764221 2763376 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031738.1 protein_id gnl|my_center|LOCUS_26160 2765075 2764218 gene locus_tag LOCUS_26170 2765075 2764218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 2766013 2765072 gene locus_tag LOCUS_26180 2766013 2765072 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729371.1 protein_id gnl|my_center|LOCUS_26180 2767429 2766146 gene locus_tag LOCUS_26190 2767429 2766146 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776070.1 protein_id gnl|my_center|LOCUS_26190 2768073 2767432 gene locus_tag LOCUS_26200 2768073 2767432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 2768219 2768530 gene locus_tag LOCUS_26210 2768219 2768530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 2769231 2768557 gene locus_tag LOCUS_26220 2769231 2768557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 2769396 2769797 gene locus_tag LOCUS_26230 2769396 2769797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 2772695 2769894 gene locus_tag LOCUS_26240 gene secA 2772695 2769894 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776076.1 protein_id gnl|my_center|LOCUS_26240 2773537 2772821 gene locus_tag LOCUS_26250 gene raiA 2773537 2772821 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776077.1 protein_id gnl|my_center|LOCUS_26250 2774336 2773638 gene locus_tag LOCUS_26260 2774336 2773638 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066564913.1 protein_id gnl|my_center|LOCUS_26260 2776125 2774428 gene locus_tag LOCUS_26270 gene lpqB 2776125 2774428 CDS product MtrAB system accessory lipoprotein LpqB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416969.1 protein_id gnl|my_center|LOCUS_26270 2777659 2776118 gene locus_tag LOCUS_26280 gene mtrB 2777659 2776118 CDS product MtrAB system histidine kinase MtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776080.1 protein_id gnl|my_center|LOCUS_26280 2777604 2777807 gene locus_tag LOCUS_26290 2777604 2777807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 2778484 2777804 gene locus_tag LOCUS_26300 gene mtrA 2778484 2777804 CDS product two-component system response regulator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975799.1 protein_id gnl|my_center|LOCUS_26300 2778664 2779812 gene locus_tag LOCUS_26310 2778664 2779812 CDS product glycerophosphoryl diester phosphodiesterase membrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975797.1 protein_id gnl|my_center|LOCUS_26310 2779809 2780462 gene locus_tag LOCUS_26320 2779809 2780462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 2780459 2781754 gene locus_tag LOCUS_26330 2780459 2781754 CDS product DUF4350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223046.1 protein_id gnl|my_center|LOCUS_26330 2781751 2782728 gene locus_tag LOCUS_26340 2781751 2782728 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897409.1 protein_id gnl|my_center|LOCUS_26340 2782737 2784044 gene locus_tag LOCUS_26350 2782737 2784044 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223048.1 protein_id gnl|my_center|LOCUS_26350 2785040 2784045 gene locus_tag LOCUS_26360 2785040 2784045 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731132.1 protein_id gnl|my_center|LOCUS_26360 2785058 2785918 gene locus_tag LOCUS_26370 2785058 2785918 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040165421.1 protein_id gnl|my_center|LOCUS_26370 2786376 2786266 gene locus_tag LOCUS_r00040 2786376 2786266 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2789613 2786493 gene locus_tag LOCUS_r00050 2789613 2786493 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2791585 2790054 gene locus_tag LOCUS_r00060 2791585 2790054 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2794029 2792533 gene locus_tag LOCUS_26380 gene ahcY 2794029 2792533 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227086.1 protein_id gnl|my_center|LOCUS_26380 2794264 2794079 gene locus_tag LOCUS_26390 2794264 2794079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 2794442 2794801 gene locus_tag LOCUS_26400 2794442 2794801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 2794983 2795666 gene locus_tag LOCUS_26410 2794983 2795666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 2795952 2797505 gene locus_tag LOCUS_26420 2795952 2797505 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408080.1 protein_id gnl|my_center|LOCUS_26420 2798917 2797493 gene locus_tag LOCUS_26430 2798917 2797493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 2799051 2800304 gene locus_tag LOCUS_26440 2799051 2800304 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911099.1 protein_id gnl|my_center|LOCUS_26440 2800301 2800822 gene locus_tag LOCUS_26450 2800301 2800822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 2801469 2800771 gene locus_tag LOCUS_26460 2801469 2800771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26460 2802140 2801466 gene locus_tag LOCUS_26470 2802140 2801466 CDS product DUF2064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870668.1 protein_id gnl|my_center|LOCUS_26470 2802781 2802140 gene locus_tag LOCUS_26480 2802781 2802140 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029202.1 protein_id gnl|my_center|LOCUS_26480 2802909 2803700 gene locus_tag LOCUS_26490 2802909 2803700 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485328.1 protein_id gnl|my_center|LOCUS_26490 2803697 2804659 gene locus_tag LOCUS_26500 2803697 2804659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 2804694 2805392 gene locus_tag LOCUS_26510 2804694 2805392 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031779.1 protein_id gnl|my_center|LOCUS_26510 2806486 2805419 gene locus_tag LOCUS_26520 2806486 2805419 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029199.1 protein_id gnl|my_center|LOCUS_26520 2807421 2806483 gene locus_tag LOCUS_26530 2807421 2806483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 2807918 2808964 gene locus_tag LOCUS_26540 2807918 2808964 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804802.1 protein_id gnl|my_center|LOCUS_26540 2810641 2809184 gene locus_tag LOCUS_26550 2810641 2809184 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092091.1 protein_id gnl|my_center|LOCUS_26550 2810839 2811786 gene locus_tag LOCUS_26560 2810839 2811786 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400956.1 protein_id gnl|my_center|LOCUS_26560 2812247 2811783 gene locus_tag LOCUS_26570 2812247 2811783 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462739.1 protein_id gnl|my_center|LOCUS_26570 2812475 2812867 gene locus_tag LOCUS_26580 2812475 2812867 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268409.1 protein_id gnl|my_center|LOCUS_26580 2813557 2813201 gene locus_tag LOCUS_26590 2813557 2813201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 2815151 2813691 gene locus_tag LOCUS_26600 2815151 2813691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 2818413 2815141 gene locus_tag LOCUS_26610 2818413 2815141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 2818984 2818667 gene locus_tag LOCUS_26620 2818984 2818667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 2820193 2819183 gene locus_tag LOCUS_26630 gene galE 2820193 2819183 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975823.1 protein_id gnl|my_center|LOCUS_26630 2820535 2820374 gene locus_tag LOCUS_26640 2820535 2820374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 2820641 2821606 gene locus_tag LOCUS_26650 2820641 2821606 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055585491.1 protein_id gnl|my_center|LOCUS_26650 2823159 2821810 gene locus_tag LOCUS_26660 gene manA 2823159 2821810 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417054.1 protein_id gnl|my_center|LOCUS_26660 2823281 2824459 gene locus_tag LOCUS_26670 2823281 2824459 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228153.1 protein_id gnl|my_center|LOCUS_26670 2824579 2826042 gene locus_tag LOCUS_26680 2824579 2826042 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775793.1 protein_id gnl|my_center|LOCUS_26680 2826056 2826490 gene locus_tag LOCUS_26690 2826056 2826490 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226133.1 protein_id gnl|my_center|LOCUS_26690 2826574 2827830 gene locus_tag LOCUS_26700 2826574 2827830 CDS product O-antigen ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920287.1 protein_id gnl|my_center|LOCUS_26700 2827843 2829138 gene locus_tag LOCUS_26710 2827843 2829138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 2830009 2829215 gene locus_tag LOCUS_26720 2830009 2829215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 2830690 2830526 gene locus_tag LOCUS_26730 2830690 2830526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 2831195 2830743 gene locus_tag LOCUS_26740 2831195 2830743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 2832518 2831529 gene locus_tag LOCUS_26750 2832518 2831529 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407642.1 protein_id gnl|my_center|LOCUS_26750 2833552 2832521 gene locus_tag LOCUS_26760 gene gmd 2833552 2832521 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407639.1 protein_id gnl|my_center|LOCUS_26760 2834825 2833734 gene locus_tag LOCUS_26770 2834825 2833734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 2835673 2834903 gene locus_tag LOCUS_26780 2835673 2834903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 2837062 2835797 gene locus_tag LOCUS_26790 2837062 2835797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083474.1 protein_id gnl|my_center|LOCUS_26790 2838105 2837125 gene locus_tag LOCUS_26800 2838105 2837125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 2838179 2838916 gene locus_tag LOCUS_26810 2838179 2838916 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878191.1 protein_id gnl|my_center|LOCUS_26810 2838913 2839299 gene locus_tag LOCUS_26820 2838913 2839299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 2841370 2839331 gene locus_tag LOCUS_26830 2841370 2839331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002302719.1 protein_id gnl|my_center|LOCUS_26830 2842360 2841506 gene locus_tag LOCUS_26840 2842360 2841506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 2842446 2842664 gene locus_tag LOCUS_26850 2842446 2842664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 2842932 2844482 gene locus_tag LOCUS_26860 gene istA 2842932 2844482 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015262274.1 protein_id gnl|my_center|LOCUS_26860 2845438 2844659 gene locus_tag LOCUS_26870 gene istB 2845438 2844659 CDS product IS21-like element ISRsp2 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167668023.1 protein_id gnl|my_center|LOCUS_26870 2847018 2845438 gene locus_tag LOCUS_26880 gene istA 2847018 2845438 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015262274.1 protein_id gnl|my_center|LOCUS_26880 2847269 2847862 gene locus_tag LOCUS_26890 2847269 2847862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 2849024 2848371 gene locus_tag LOCUS_26900 2849024 2848371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 2848995 2849225 gene locus_tag LOCUS_26910 2848995 2849225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 2849611 2849865 gene locus_tag LOCUS_26920 2849611 2849865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 2852766 2850613 gene locus_tag LOCUS_26930 2852766 2850613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 2853365 2852898 gene locus_tag LOCUS_26940 2853365 2852898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 2853507 2854448 gene locus_tag LOCUS_26950 2853507 2854448 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112141.1 protein_id gnl|my_center|LOCUS_26950 2854452 2855669 gene locus_tag LOCUS_26960 2854452 2855669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 2856619 2855666 gene locus_tag LOCUS_26970 2856619 2855666 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229036.1 protein_id gnl|my_center|LOCUS_26970 2857586 2856600 gene locus_tag LOCUS_26980 2857586 2856600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 2857740 2858618 gene locus_tag LOCUS_26990 2857740 2858618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 2859605 2858625 gene locus_tag LOCUS_27000 2859605 2858625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 2860524 2859595 gene locus_tag LOCUS_27010 2860524 2859595 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937860.1 protein_id gnl|my_center|LOCUS_27010 2861638 2860517 gene locus_tag LOCUS_27020 2861638 2860517 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223217130.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27020 2861887 2862747 gene locus_tag LOCUS_27030 gene wbbL 2861887 2862747 CDS product N-acetylglucosaminyl-diphospho-decaprenol L-rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417100.1 protein_id gnl|my_center|LOCUS_27030 2863623 2862760 gene locus_tag LOCUS_27040 gene rfbA 2863623 2862760 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364387.1 protein_id gnl|my_center|LOCUS_27040 2864238 2863627 gene locus_tag LOCUS_27050 2864238 2863627 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229701.1 protein_id gnl|my_center|LOCUS_27050 2865818 2864271 gene locus_tag LOCUS_27060 2865818 2864271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 2866069 2865815 gene locus_tag LOCUS_27070 2866069 2865815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 2866092 2867207 gene locus_tag LOCUS_27080 gene rfbB 2866092 2867207 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222917.1 protein_id gnl|my_center|LOCUS_27080 2867283 2868134 gene locus_tag LOCUS_27090 gene rfbD 2867283 2868134 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222918.1 protein_id gnl|my_center|LOCUS_27090 2868131 2869273 gene locus_tag LOCUS_27100 2868131 2869273 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222922.1 protein_id gnl|my_center|LOCUS_27100 2869317 2869766 gene locus_tag LOCUS_27110 2869317 2869766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 2869847 2870743 gene locus_tag LOCUS_27120 2869847 2870743 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028071.1 protein_id gnl|my_center|LOCUS_27120 2870927 2871085 gene locus_tag LOCUS_27130 2870927 2871085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 2872478 2871114 gene locus_tag LOCUS_27140 2872478 2871114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 2873032 2872475 gene locus_tag LOCUS_27150 gene purE 2873032 2872475 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975752.1 protein_id gnl|my_center|LOCUS_27150 2874165 2873029 gene locus_tag LOCUS_27160 2874165 2873029 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776123.1 protein_id gnl|my_center|LOCUS_27160 2874294 2874866 gene locus_tag LOCUS_27170 2874294 2874866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 2875526 2874936 gene locus_tag LOCUS_27180 2875526 2874936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 2876398 2875550 gene locus_tag LOCUS_27190 2876398 2875550 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727931.1 protein_id gnl|my_center|LOCUS_27190 2876549 2878207 gene locus_tag LOCUS_27200 2876549 2878207 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029952.1 protein_id gnl|my_center|LOCUS_27200 2878214 2878492 gene locus_tag LOCUS_27210 2878214 2878492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 2879826 2878792 gene locus_tag LOCUS_27220 2879826 2878792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 2881220 2879826 gene locus_tag LOCUS_27230 2881220 2879826 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224902.1 protein_id gnl|my_center|LOCUS_27230 2881944 2881213 gene locus_tag LOCUS_27240 2881944 2881213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 2883282 2881954 gene locus_tag LOCUS_27250 2883282 2881954 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805055.1 protein_id gnl|my_center|LOCUS_27250 2883346 2884014 gene locus_tag LOCUS_27260 2883346 2884014 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776131.1 protein_id gnl|my_center|LOCUS_27260 2884135 2885922 gene locus_tag LOCUS_27270 2884135 2885922 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776132.1 protein_id gnl|my_center|LOCUS_27270 2887550 2886114 gene locus_tag LOCUS_27280 2887550 2886114 CDS product NAD(P)H-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929978.1 protein_id gnl|my_center|LOCUS_27280 2887714 2888547 gene locus_tag LOCUS_27290 2887714 2888547 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776134.1 protein_id gnl|my_center|LOCUS_27290 2888544 2890784 gene locus_tag LOCUS_27300 2888544 2890784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 2891212 2890937 gene locus_tag LOCUS_27310 2891212 2890937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 2891667 2891209 gene locus_tag LOCUS_27320 2891667 2891209 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817398.1 protein_id gnl|my_center|LOCUS_27320 2892807 2891686 gene locus_tag LOCUS_27330 2892807 2891686 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974072.1 protein_id gnl|my_center|LOCUS_27330 2893263 2893976 gene locus_tag LOCUS_27340 2893263 2893976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 2895609 2894305 gene locus_tag LOCUS_27350 2895609 2894305 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872150.1 protein_id gnl|my_center|LOCUS_27350 2896028 2895612 gene locus_tag LOCUS_27360 2896028 2895612 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877157.1 protein_id gnl|my_center|LOCUS_27360 2897323 2896025 gene locus_tag LOCUS_27370 2897323 2896025 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776141.1 protein_id gnl|my_center|LOCUS_27370 2898591 2897320 gene locus_tag LOCUS_27380 2898591 2897320 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776142.1 protein_id gnl|my_center|LOCUS_27380 2900129 2898588 gene locus_tag LOCUS_27390 2900129 2898588 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776143.1 protein_id gnl|my_center|LOCUS_27390 2901363 2900263 gene locus_tag LOCUS_27400 2901363 2900263 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776144.1 protein_id gnl|my_center|LOCUS_27400 2902653 2901532 gene locus_tag LOCUS_27410 2902653 2901532 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776146.1 protein_id gnl|my_center|LOCUS_27410 2902743 2903897 gene locus_tag LOCUS_27420 2902743 2903897 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742121.1 protein_id gnl|my_center|LOCUS_27420 2904013 2904432 gene locus_tag LOCUS_27430 gene sdhC 2904013 2904432 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776147.1 protein_id gnl|my_center|LOCUS_27430 2904444 2904896 gene locus_tag LOCUS_27440 gene sdhD 2904444 2904896 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776148.1 protein_id gnl|my_center|LOCUS_27440 2904914 2906731 gene locus_tag LOCUS_27450 gene sdhA 2904914 2906731 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222763.1 protein_id gnl|my_center|LOCUS_27450 2906731 2907489 gene locus_tag LOCUS_27460 2906731 2907489 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776150.1 protein_id gnl|my_center|LOCUS_27460 2907759 2908820 gene locus_tag LOCUS_27470 2907759 2908820 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067971.1 protein_id gnl|my_center|LOCUS_27470 2908830 2909669 gene locus_tag LOCUS_27480 2908830 2909669 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776151.1 protein_id gnl|my_center|LOCUS_27480 2909693 2910697 gene locus_tag LOCUS_27490 gene trpS 2909693 2910697 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124091865.1 protein_id gnl|my_center|LOCUS_27490 2910874 2911608 gene locus_tag LOCUS_27500 2910874 2911608 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030303.1 protein_id gnl|my_center|LOCUS_27500 2912620 2911709 gene locus_tag LOCUS_27510 2912620 2911709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 2914478 2912964 gene locus_tag LOCUS_27520 gene glpK 2914478 2912964 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776956.1 protein_id gnl|my_center|LOCUS_27520 2915300 2914539 gene locus_tag LOCUS_27530 2915300 2914539 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776957.1 protein_id gnl|my_center|LOCUS_27530 2917185 2915482 gene locus_tag LOCUS_27540 2917185 2915482 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529476.1 protein_id gnl|my_center|LOCUS_27540 2917301 2918290 gene locus_tag LOCUS_27550 2917301 2918290 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618838.1 protein_id gnl|my_center|LOCUS_27550 2918752 2919768 gene locus_tag LOCUS_27560 gene ribD 2918752 2919768 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803669.1 protein_id gnl|my_center|LOCUS_27560 2919777 2920409 gene locus_tag LOCUS_27570 2919777 2920409 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894458.1 protein_id gnl|my_center|LOCUS_27570 2920406 2921668 gene locus_tag LOCUS_27580 2920406 2921668 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977384.1 protein_id gnl|my_center|LOCUS_27580 2921665 2922135 gene locus_tag LOCUS_27590 gene ribH 2921665 2922135 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803672.1 protein_id gnl|my_center|LOCUS_27590 2922321 2923676 gene locus_tag LOCUS_27600 2922321 2923676 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626527.1 protein_id gnl|my_center|LOCUS_27600 2924313 2923891 gene locus_tag LOCUS_27610 2924313 2923891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27610 2924687 2924319 gene locus_tag LOCUS_27620 2924687 2924319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 2924792 2926864 gene locus_tag LOCUS_27630 2924792 2926864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 2927748 2926912 gene locus_tag LOCUS_27640 2927748 2926912 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228482.1 protein_id gnl|my_center|LOCUS_27640 2928575 2927745 gene locus_tag LOCUS_27650 2928575 2927745 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228483.1 protein_id gnl|my_center|LOCUS_27650 2929498 2928572 gene locus_tag LOCUS_27660 2929498 2928572 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228484.1 protein_id gnl|my_center|LOCUS_27660 2929759 2931591 gene locus_tag LOCUS_27670 2929759 2931591 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028846.1 protein_id gnl|my_center|LOCUS_27670 2934741 2931625 gene locus_tag LOCUS_27680 2934741 2931625 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085775.1 protein_id gnl|my_center|LOCUS_27680 2936796 2934946 gene locus_tag LOCUS_27690 2936796 2934946 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973998.1 protein_id gnl|my_center|LOCUS_27690 2936954 2938396 gene locus_tag LOCUS_27700 2936954 2938396 CDS product short-chain fatty acyl-CoA regulator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027490.1 protein_id gnl|my_center|LOCUS_27700 2939568 2938585 gene locus_tag LOCUS_27710 2939568 2938585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148043383.1 protein_id gnl|my_center|LOCUS_27710 2940507 2939875 gene locus_tag LOCUS_27720 2940507 2939875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 2940600 2942345 gene locus_tag LOCUS_27730 2940600 2942345 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400819.1 protein_id gnl|my_center|LOCUS_27730 2942239 2943234 gene locus_tag LOCUS_27740 2942239 2943234 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079494.1 protein_id gnl|my_center|LOCUS_27740 2943243 2944268 gene locus_tag LOCUS_27750 2943243 2944268 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079496.1 protein_id gnl|my_center|LOCUS_27750 2944457 2945830 gene locus_tag LOCUS_27760 2944457 2945830 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777115.1 protein_id gnl|my_center|LOCUS_27760 2945827 2946873 gene locus_tag LOCUS_27770 2945827 2946873 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777114.1 protein_id gnl|my_center|LOCUS_27770 2947183 2947518 gene locus_tag LOCUS_27780 2947183 2947518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 2947976 2947674 gene locus_tag LOCUS_27790 2947976 2947674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 2948455 2948177 gene locus_tag LOCUS_27800 2948455 2948177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 2949920 2948694 gene locus_tag LOCUS_27810 2949920 2948694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 2950664 2950053 gene locus_tag LOCUS_27820 2950664 2950053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 2951455 2950664 gene locus_tag LOCUS_27830 2951455 2950664 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896585.1 protein_id gnl|my_center|LOCUS_27830 2952714 2951530 gene locus_tag LOCUS_27840 2952714 2951530 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226452.1 protein_id gnl|my_center|LOCUS_27840 2953717 2952911 gene locus_tag LOCUS_27850 2953717 2952911 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930212.1 protein_id gnl|my_center|LOCUS_27850 2955576 2954086 gene locus_tag LOCUS_27860 2955576 2954086 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776710.1 protein_id gnl|my_center|LOCUS_27860 2955800 2956513 gene locus_tag LOCUS_27870 2955800 2956513 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730148.1 protein_id gnl|my_center|LOCUS_27870 2956774 2958120 gene locus_tag LOCUS_27880 2956774 2958120 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228261.1 protein_id gnl|my_center|LOCUS_27880 2958196 2958909 gene locus_tag LOCUS_27890 2958196 2958909 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224884.1 protein_id gnl|my_center|LOCUS_27890 2959135 2960049 gene locus_tag LOCUS_27900 2959135 2960049 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014872.1 protein_id gnl|my_center|LOCUS_27900 2960378 2960734 gene locus_tag LOCUS_27910 2960378 2960734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27910 2960945 2962426 gene locus_tag LOCUS_27920 2960945 2962426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 2962411 2963097 gene locus_tag LOCUS_27930 2962411 2963097 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224884.1 protein_id gnl|my_center|LOCUS_27930 2963098 2964048 gene locus_tag LOCUS_27940 gene hpaI 2963098 2964048 CDS product 2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144460629.1 protein_id gnl|my_center|LOCUS_27940 2964045 2965586 gene locus_tag LOCUS_27950 gene hpaE 2964045 2965586 CDS product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889479.1 protein_id gnl|my_center|LOCUS_27950 2965766 2966836 gene locus_tag LOCUS_27960 gene hpaD 2965766 2966836 CDS product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528545.1 protein_id gnl|my_center|LOCUS_27960 2967722 2966991 gene locus_tag LOCUS_27970 2967722 2966991 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030245.1 protein_id gnl|my_center|LOCUS_27970 2968969 2967719 gene locus_tag LOCUS_27980 2968969 2967719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 2969144 2970124 gene locus_tag LOCUS_27990 2969144 2970124 CDS product tripartite tricarboxylate transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204250323.1 protein_id gnl|my_center|LOCUS_27990 2970121 2970813 gene locus_tag LOCUS_28000 2970121 2970813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 2970801 2972336 gene locus_tag LOCUS_28010 gene tctA 2970801 2972336 CDS product tripartite tricarboxylate transporter permease TctA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015409.1 protein_id gnl|my_center|LOCUS_28010 2973249 2972512 gene locus_tag LOCUS_28020 2973249 2972512 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971721.1 protein_id gnl|my_center|LOCUS_28020 2973845 2973246 gene locus_tag LOCUS_28030 2973845 2973246 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804252.1 protein_id gnl|my_center|LOCUS_28030 2975596 2973866 gene locus_tag LOCUS_28040 2975596 2973866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 2976634 2975651 gene locus_tag LOCUS_28050 2976634 2975651 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230695.1 protein_id gnl|my_center|LOCUS_28050 2978175 2976769 gene locus_tag LOCUS_28060 2978175 2976769 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729823.1 protein_id gnl|my_center|LOCUS_28060 2978491 2978733 gene locus_tag LOCUS_28070 2978491 2978733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28070 2978755 2979015 gene locus_tag LOCUS_28080 2978755 2979015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28080 2979059 2979934 gene locus_tag LOCUS_28090 2979059 2979934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 2980042 2980692 gene locus_tag LOCUS_28100 2980042 2980692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 2980731 2981000 gene locus_tag LOCUS_28110 2980731 2981000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 2981859 2980960 gene locus_tag LOCUS_28120 2981859 2980960 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223267.1 protein_id gnl|my_center|LOCUS_28120 2981904 2982395 gene locus_tag LOCUS_28130 2981904 2982395 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742221.1 protein_id gnl|my_center|LOCUS_28130 2983711 2982431 gene locus_tag LOCUS_28140 2983711 2982431 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257843.1 protein_id gnl|my_center|LOCUS_28140 2984724 2983708 gene locus_tag LOCUS_28150 2984724 2983708 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257842.1 protein_id gnl|my_center|LOCUS_28150 2985803 2984721 gene locus_tag LOCUS_28160 gene pdhA 2985803 2984721 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257841.1 protein_id gnl|my_center|LOCUS_28160 2985936 2986547 gene locus_tag LOCUS_28170 2985936 2986547 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008023.1 protein_id gnl|my_center|LOCUS_28170 2986723 2987115 gene locus_tag LOCUS_28180 2986723 2987115 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223930.1 protein_id gnl|my_center|LOCUS_28180 2987415 2987125 gene locus_tag LOCUS_28190 2987415 2987125 CDS product DUF4287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225328.1 protein_id gnl|my_center|LOCUS_28190 2988092 2987367 gene locus_tag LOCUS_28200 2988092 2987367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 2988464 2989930 gene locus_tag LOCUS_28210 2988464 2989930 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092091.1 protein_id gnl|my_center|LOCUS_28210 2990326 2991372 gene locus_tag LOCUS_28220 2990326 2991372 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804802.1 protein_id gnl|my_center|LOCUS_28220 2991777 2991703 gene locus_tag LOCUS_t00330 2991777 2991703 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2992459 2991824 gene locus_tag LOCUS_28230 2992459 2991824 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027253.1 protein_id gnl|my_center|LOCUS_28230 2994060 2992525 gene locus_tag LOCUS_28240 2994060 2992525 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975395.1 protein_id gnl|my_center|LOCUS_28240 2995233 2994082 gene locus_tag LOCUS_28250 2995233 2994082 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776597.1 protein_id gnl|my_center|LOCUS_28250 2995342 2995647 gene locus_tag LOCUS_28260 2995342 2995647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 2995631 2996869 gene locus_tag LOCUS_28270 2995631 2996869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 2996973 2997428 gene locus_tag LOCUS_28280 2996973 2997428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 2998158 2997502 gene locus_tag LOCUS_28290 2998158 2997502 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976672.1 protein_id gnl|my_center|LOCUS_28290 2999657 2998155 gene locus_tag LOCUS_28300 2999657 2998155 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803947.1 protein_id gnl|my_center|LOCUS_28300 3000458 2999841 gene locus_tag LOCUS_28310 gene tmk 3000458 2999841 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051604.1 protein_id gnl|my_center|LOCUS_28310 3003469 3000455 gene locus_tag LOCUS_28320 gene topA 3003469 3000455 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899617.1 protein_id gnl|my_center|LOCUS_28320 3003530 3003901 gene locus_tag LOCUS_28330 3003530 3003901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 3004274 3003921 gene locus_tag LOCUS_28340 3004274 3003921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 3004591 3004274 gene locus_tag LOCUS_28350 3004591 3004274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 3004820 3004614 gene locus_tag LOCUS_28360 3004820 3004614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 3004966 3005613 gene locus_tag LOCUS_28370 3004966 3005613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 3006662 3005610 gene locus_tag LOCUS_28380 3006662 3005610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 3007793 3006663 gene locus_tag LOCUS_28390 3007793 3006663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 3008239 3010215 gene locus_tag LOCUS_28400 gene acs 3008239 3010215 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975373.1 protein_id gnl|my_center|LOCUS_28400 3010747 3010277 gene locus_tag LOCUS_28410 3010747 3010277 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975361.1 protein_id gnl|my_center|LOCUS_28410 3010923 3010750 gene locus_tag LOCUS_28420 3010923 3010750 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776605.1 protein_id gnl|my_center|LOCUS_28420 3010953 3013547 gene locus_tag LOCUS_28430 3010953 3013547 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930028.1 protein_id gnl|my_center|LOCUS_28430 3013544 3014602 gene locus_tag LOCUS_28440 3013544 3014602 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731114.1 protein_id gnl|my_center|LOCUS_28440 3014702 3015178 gene locus_tag LOCUS_28450 3014702 3015178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 3015459 3017795 gene locus_tag LOCUS_28460 3015459 3017795 CDS product DUF1906 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029885.1 protein_id gnl|my_center|LOCUS_28460 3018703 3017891 gene locus_tag LOCUS_28470 3018703 3017891 CDS product ExeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899491.1 protein_id gnl|my_center|LOCUS_28470 3020226 3018700 gene locus_tag LOCUS_28480 3020226 3018700 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144956692.1 protein_id gnl|my_center|LOCUS_28480 3020639 3020956 gene locus_tag LOCUS_28490 3020639 3020956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 3021239 3021595 gene locus_tag LOCUS_28500 3021239 3021595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 3021582 3022199 gene locus_tag LOCUS_28510 3021582 3022199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029884.1 protein_id gnl|my_center|LOCUS_28510 3022302 3022376 gene locus_tag LOCUS_t00340 3022302 3022376 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3022318 3023964 gene locus_tag LOCUS_28520 3022318 3023964 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723717.1 protein_id gnl|my_center|LOCUS_28520 3025307 3024204 gene locus_tag LOCUS_28530 3025307 3024204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 3025671 3026162 gene locus_tag LOCUS_28540 3025671 3026162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 3027139 3026360 gene locus_tag LOCUS_28550 3027139 3026360 CDS product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051905.1 protein_id gnl|my_center|LOCUS_28550 3028450 3027416 gene locus_tag LOCUS_28560 3028450 3027416 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225826.1 protein_id gnl|my_center|LOCUS_28560 3029961 3028447 gene locus_tag LOCUS_28570 3029961 3028447 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225825.1 protein_id gnl|my_center|LOCUS_28570 3030171 3031217 gene locus_tag LOCUS_28580 3030171 3031217 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225827.1 protein_id gnl|my_center|LOCUS_28580 3031284 3032483 gene locus_tag LOCUS_28590 3031284 3032483 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031011.1 protein_id gnl|my_center|LOCUS_28590 3032492 3033493 gene locus_tag LOCUS_28600 3032492 3033493 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805157.1 protein_id gnl|my_center|LOCUS_28600 3034950 3033754 gene locus_tag LOCUS_28610 3034950 3033754 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868921.1 protein_id gnl|my_center|LOCUS_28610 3036174 3035167 gene locus_tag LOCUS_28620 3036174 3035167 CDS product IS1595-like element ISSod11 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071113.1 protein_id gnl|my_center|LOCUS_28620 3036423 3038585 gene locus_tag LOCUS_28630 3036423 3038585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 3038621 3039601 gene locus_tag LOCUS_28640 3038621 3039601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 3041265 3039874 gene locus_tag LOCUS_28650 3041265 3039874 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715488.1 protein_id gnl|my_center|LOCUS_28650 3042134 3041268 gene locus_tag LOCUS_28660 3042134 3041268 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028849.1 protein_id gnl|my_center|LOCUS_28660 3042871 3042137 gene locus_tag LOCUS_28670 3042871 3042137 CDS product EboA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028850.1 protein_id gnl|my_center|LOCUS_28670 3043796 3042918 gene locus_tag LOCUS_28680 3043796 3042918 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028852.1 protein_id gnl|my_center|LOCUS_28680 3044659 3044012 gene locus_tag LOCUS_28690 3044659 3044012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 3046534 3044711 gene locus_tag LOCUS_28700 3046534 3044711 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227785.1 protein_id gnl|my_center|LOCUS_28700 3046673 3047734 gene locus_tag LOCUS_28710 3046673 3047734 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532940.1 protein_id gnl|my_center|LOCUS_28710 3047811 3048842 gene locus_tag LOCUS_28720 3047811 3048842 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228804.1 protein_id gnl|my_center|LOCUS_28720 3049015 3050295 gene locus_tag LOCUS_28730 3049015 3050295 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776530.1 protein_id gnl|my_center|LOCUS_28730 3050301 3051278 gene locus_tag LOCUS_28740 3050301 3051278 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776529.1 protein_id gnl|my_center|LOCUS_28740 3051275 3052099 gene locus_tag LOCUS_28750 3051275 3052099 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776528.1 protein_id gnl|my_center|LOCUS_28750 3052096 3053637 gene locus_tag LOCUS_28760 3052096 3053637 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030127.1 protein_id gnl|my_center|LOCUS_28760 3053163 3053071 gene locus_tag LOCUS_t00350 3053163 3053071 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 3053634 3054893 gene locus_tag LOCUS_28770 3053634 3054893 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031767.1 protein_id gnl|my_center|LOCUS_28770 3054890 3055804 gene locus_tag LOCUS_28780 3054890 3055804 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031768.1 protein_id gnl|my_center|LOCUS_28780 3055797 3056762 gene locus_tag LOCUS_28790 gene murQ 3055797 3056762 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029570.1 protein_id gnl|my_center|LOCUS_28790 3056752 3057633 gene locus_tag LOCUS_28800 3056752 3057633 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093946417.1 protein_id gnl|my_center|LOCUS_28800 3057680 3058465 gene locus_tag LOCUS_28810 3057680 3058465 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027539.1 protein_id gnl|my_center|LOCUS_28810 3058462 3059649 gene locus_tag LOCUS_28820 gene nagA 3058462 3059649 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817047.1 protein_id gnl|my_center|LOCUS_28820 3060162 3059737 gene locus_tag LOCUS_28830 3060162 3059737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 3060688 3060170 gene locus_tag LOCUS_28840 3060688 3060170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 3060935 3061588 gene locus_tag LOCUS_28850 3060935 3061588 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973988.1 protein_id gnl|my_center|LOCUS_28850 3061616 3063316 gene locus_tag LOCUS_28860 gene hutU 3061616 3063316 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223168.1 protein_id gnl|my_center|LOCUS_28860 3063313 3064575 gene locus_tag LOCUS_28870 3063313 3064575 CDS product allantoate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223169.1 protein_id gnl|my_center|LOCUS_28870 3064572 3065990 gene locus_tag LOCUS_28880 3064572 3065990 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223170.1 protein_id gnl|my_center|LOCUS_28880 3065987 3067159 gene locus_tag LOCUS_28890 gene hutI 3065987 3067159 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223171.1 protein_id gnl|my_center|LOCUS_28890 3067690 3067436 gene locus_tag LOCUS_28900 3067690 3067436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 3069484 3067769 gene locus_tag LOCUS_28910 3069484 3067769 CDS product DUF4012 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053633.1 protein_id gnl|my_center|LOCUS_28910 3069743 3071011 gene locus_tag LOCUS_28920 3069743 3071011 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461043.1 protein_id gnl|my_center|LOCUS_28920 3071015 3071956 gene locus_tag LOCUS_28930 3071015 3071956 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039035.1 protein_id gnl|my_center|LOCUS_28930 3071961 3073307 gene locus_tag LOCUS_28940 3071961 3073307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 3073304 3074557 gene locus_tag LOCUS_28950 3073304 3074557 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107242.1 protein_id gnl|my_center|LOCUS_28950 3074547 3076580 gene locus_tag LOCUS_28960 3074547 3076580 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776627.1 protein_id gnl|my_center|LOCUS_28960 3077209 3076577 gene locus_tag LOCUS_28970 3077209 3076577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 3079598 3077199 gene locus_tag LOCUS_28980 3079598 3077199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 3079832 3081019 gene locus_tag LOCUS_28990 3079832 3081019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 3082536 3081028 gene locus_tag LOCUS_29000 3082536 3081028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 3083693 3082548 gene locus_tag LOCUS_29010 gene wecB 3083693 3082548 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942885.1 protein_id gnl|my_center|LOCUS_29010 3084802 3083690 gene locus_tag LOCUS_29020 3084802 3083690 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963418.1 protein_id gnl|my_center|LOCUS_29020 3085854 3084799 gene locus_tag LOCUS_29030 3085854 3084799 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963420.1 protein_id gnl|my_center|LOCUS_29030 3087115 3085847 gene locus_tag LOCUS_29040 3087115 3085847 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776619.1 protein_id gnl|my_center|LOCUS_29040 3087756 3087112 gene locus_tag LOCUS_29050 3087756 3087112 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013601.1 protein_id gnl|my_center|LOCUS_29050 3088376 3087753 gene locus_tag LOCUS_29060 3088376 3087753 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256836.1 protein_id gnl|my_center|LOCUS_29060 3089506 3088373 gene locus_tag LOCUS_29070 3089506 3088373 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013588.1 protein_id gnl|my_center|LOCUS_29070 3091344 3089503 gene locus_tag LOCUS_29080 3091344 3089503 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066564050.1 protein_id gnl|my_center|LOCUS_29080 3092267 3091335 gene locus_tag LOCUS_29090 3092267 3091335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013586.1 protein_id gnl|my_center|LOCUS_29090 3092983 3092438 gene locus_tag LOCUS_29100 3092983 3092438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 3094862 3093039 gene locus_tag LOCUS_29110 3094862 3093039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 3096546 3095218 gene locus_tag LOCUS_29120 3096546 3095218 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730947.1 protein_id gnl|my_center|LOCUS_29120 3097282 3096752 gene locus_tag LOCUS_29130 3097282 3096752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 3099538 3097745 gene locus_tag LOCUS_29140 3099538 3097745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 3100586 3099585 gene locus_tag LOCUS_29150 3100586 3099585 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407642.1 protein_id gnl|my_center|LOCUS_29150 3101653 3100583 gene locus_tag LOCUS_29160 gene gmd 3101653 3100583 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407639.1 protein_id gnl|my_center|LOCUS_29160 3101998 3103434 gene locus_tag LOCUS_29170 3101998 3103434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 3103481 3104461 gene locus_tag LOCUS_29180 3103481 3104461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 3104766 3106802 gene locus_tag LOCUS_29190 3104766 3106802 CDS product SGNH hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235624217.1 protein_id gnl|my_center|LOCUS_29190 3106799 3107188 gene locus_tag LOCUS_29200 3106799 3107188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 3107217 3107651 gene locus_tag LOCUS_29210 3107217 3107651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085100849.1 protein_id gnl|my_center|LOCUS_29210 3107651 3108469 gene locus_tag LOCUS_29220 3107651 3108469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29220 3108587 3110140 gene locus_tag LOCUS_29230 gene istA 3108587 3110140 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015262274.1 protein_id gnl|my_center|LOCUS_29230 3110137 3110886 gene locus_tag LOCUS_29240 gene istB 3110137 3110886 CDS product IS21-like element ISFK1 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090937.1 protein_id gnl|my_center|LOCUS_29240 3111318 3112094 gene locus_tag LOCUS_29250 3111318 3112094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 3113113 3112127 gene locus_tag LOCUS_29260 3113113 3112127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 3114030 3113218 gene locus_tag LOCUS_29270 3114030 3113218 CDS product alpha-1,2-fucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058149.1 protein_id gnl|my_center|LOCUS_29270 3115151 3114063 gene locus_tag LOCUS_29280 3115151 3114063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 3116347 3115148 gene locus_tag LOCUS_29290 3116347 3115148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 3117499 3116351 gene locus_tag LOCUS_29300 3117499 3116351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 3118818 3117496 gene locus_tag LOCUS_29310 3118818 3117496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 3119784 3118921 gene locus_tag LOCUS_29320 3119784 3118921 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203012.1 protein_id gnl|my_center|LOCUS_29320 3120812 3119781 gene locus_tag LOCUS_29330 3120812 3119781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 3122070 3120901 gene locus_tag LOCUS_29340 3122070 3120901 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027080.1 protein_id gnl|my_center|LOCUS_29340 3122877 3122071 gene locus_tag LOCUS_29350 3122877 3122071 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920874.1 protein_id gnl|my_center|LOCUS_29350 3124073 3123147 gene locus_tag LOCUS_29360 3124073 3123147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 3125566 3124073 gene locus_tag LOCUS_29370 3125566 3124073 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803920.1 protein_id gnl|my_center|LOCUS_29370 3127128 3125869 gene locus_tag LOCUS_29380 3127128 3125869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 3127309 3127396 gene locus_tag LOCUS_t00360 3127309 3127396 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3127508 3127978 gene locus_tag LOCUS_29390 3127508 3127978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 3128877 3128038 gene locus_tag LOCUS_29400 3128877 3128038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 3130287 3129316 gene locus_tag LOCUS_29410 3130287 3129316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 3130853 3130290 gene locus_tag LOCUS_29420 3130853 3130290 CDS product low molecular weight phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013585.1 protein_id gnl|my_center|LOCUS_29420 3130995 3131207 gene locus_tag LOCUS_29430 3130995 3131207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 3132562 3131138 gene locus_tag LOCUS_29440 3132562 3131138 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013584.1 protein_id gnl|my_center|LOCUS_29440 3132954 3133196 gene locus_tag LOCUS_29450 3132954 3133196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 3133230 3134012 gene locus_tag LOCUS_29460 3133230 3134012 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251231.1 protein_id gnl|my_center|LOCUS_29460 3134009 3134299 gene locus_tag LOCUS_29470 3134009 3134299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 3134296 3135792 gene locus_tag LOCUS_29480 3134296 3135792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 3135785 3136477 gene locus_tag LOCUS_29490 3135785 3136477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 3136849 3136538 gene locus_tag LOCUS_29500 3136849 3136538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 3138618 3136873 gene locus_tag LOCUS_29510 3138618 3136873 CDS product DUF4012 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053633.1 protein_id gnl|my_center|LOCUS_29510 3138692 3139351 gene locus_tag LOCUS_29520 3138692 3139351 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776120.1 protein_id gnl|my_center|LOCUS_29520 3139348 3140451 gene locus_tag LOCUS_29530 3139348 3140451 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776119.1 protein_id gnl|my_center|LOCUS_29530 3140451 3141437 gene locus_tag LOCUS_29540 3140451 3141437 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776118.1 protein_id gnl|my_center|LOCUS_29540 3141489 3142787 gene locus_tag LOCUS_29550 3141489 3142787 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776106.1 protein_id gnl|my_center|LOCUS_29550 3143925 3142828 gene locus_tag LOCUS_29560 3143925 3142828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 3146130 3145306 gene locus_tag LOCUS_29570 3146130 3145306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 3148053 3147001 gene locus_tag LOCUS_29580 3148053 3147001 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115615.1 protein_id gnl|my_center|LOCUS_29580 3150254 3148230 gene locus_tag LOCUS_29590 3150254 3148230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 3152473 3150638 gene locus_tag LOCUS_29600 3152473 3150638 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066564050.1 protein_id gnl|my_center|LOCUS_29600 3153266 3152727 gene locus_tag LOCUS_29610 3153266 3152727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 3153678 3154721 gene locus_tag LOCUS_29620 3153678 3154721 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967713.1 protein_id gnl|my_center|LOCUS_29620 3154909 3154625 gene locus_tag LOCUS_29630 3154909 3154625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 3155918 3154959 gene locus_tag LOCUS_29640 3155918 3154959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 3155851 3156687 gene locus_tag LOCUS_29650 3155851 3156687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 3156706 3157089 gene locus_tag LOCUS_29660 3156706 3157089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 3158076 3157249 gene locus_tag LOCUS_29670 3158076 3157249 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730918.1 protein_id gnl|my_center|LOCUS_29670 3159307 3158186 gene locus_tag LOCUS_29680 3159307 3158186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 3160469 3159513 gene locus_tag LOCUS_29690 3160469 3159513 CDS product FRG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804176.1 protein_id gnl|my_center|LOCUS_29690 3160806 3162263 gene locus_tag LOCUS_29700 3160806 3162263 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092091.1 protein_id gnl|my_center|LOCUS_29700 3162430 3163206 gene locus_tag LOCUS_29710 3162430 3163206 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728425.1 protein_id gnl|my_center|LOCUS_29710 3164138 3163338 gene locus_tag LOCUS_29720 3164138 3163338 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224211.1 protein_id gnl|my_center|LOCUS_29720 3165632 3164142 gene locus_tag LOCUS_29730 3165632 3164142 CDS product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392249.1 protein_id gnl|my_center|LOCUS_29730 3166620 3165931 gene locus_tag LOCUS_29740 3166620 3165931 CDS product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093809.1 protein_id gnl|my_center|LOCUS_29740 3167129 3166653 gene locus_tag LOCUS_29750 3167129 3166653 CDS product DUF1772 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115305.1 protein_id gnl|my_center|LOCUS_29750 3167970 3167218 gene locus_tag LOCUS_29760 gene fabG 3167970 3167218 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869844.1 protein_id gnl|my_center|LOCUS_29760 3168959 3167967 gene locus_tag LOCUS_29770 3168959 3167967 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258268.1 protein_id gnl|my_center|LOCUS_29770 3169220 3168963 gene locus_tag LOCUS_29780 3169220 3168963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 3169441 3171012 gene locus_tag LOCUS_29790 3169441 3171012 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028809.1 protein_id gnl|my_center|LOCUS_29790 3171009 3172571 gene locus_tag LOCUS_29800 3171009 3172571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 3172568 3173911 gene locus_tag LOCUS_29810 3172568 3173911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 3174051 3174845 gene locus_tag LOCUS_29820 3174051 3174845 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226532.1 protein_id gnl|my_center|LOCUS_29820 3174853 3176088 gene locus_tag LOCUS_29830 3174853 3176088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 3179425 3176042 gene locus_tag LOCUS_29840 3179425 3176042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 3180000 3179473 gene locus_tag LOCUS_29850 3180000 3179473 CDS product DUF1772 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028680.1 protein_id gnl|my_center|LOCUS_29850 3180177 3181034 gene locus_tag LOCUS_29860 3180177 3181034 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485415.1 protein_id gnl|my_center|LOCUS_29860 3181165 3182430 gene locus_tag LOCUS_29870 3181165 3182430 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583069.1 protein_id gnl|my_center|LOCUS_29870 3182427 3183650 gene locus_tag LOCUS_29880 gene fabF 3182427 3183650 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227920.1 protein_id gnl|my_center|LOCUS_29880 3183674 3184525 gene locus_tag LOCUS_29890 3183674 3184525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 3184522 3186036 gene locus_tag LOCUS_29900 3184522 3186036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 3186038 3186373 gene locus_tag LOCUS_29910 3186038 3186373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 3186370 3187407 gene locus_tag LOCUS_29920 gene trpD 3186370 3187407 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411387.1 protein_id gnl|my_center|LOCUS_29920 3187394 3188290 gene locus_tag LOCUS_29930 gene trpA 3187394 3188290 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921372.1 protein_id gnl|my_center|LOCUS_29930 3188306 3188680 gene locus_tag LOCUS_29940 3188306 3188680 CDS product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084901.1 protein_id gnl|my_center|LOCUS_29940 3188694 3189839 gene locus_tag LOCUS_29950 3188694 3189839 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973142.1 protein_id gnl|my_center|LOCUS_29950 3189836 3190612 gene locus_tag LOCUS_29960 3189836 3190612 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058105.1 protein_id gnl|my_center|LOCUS_29960 3190609 3191337 gene locus_tag LOCUS_29970 3190609 3191337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 3191334 3192074 gene locus_tag LOCUS_29980 3191334 3192074 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080912.1 protein_id gnl|my_center|LOCUS_29980 3192153 3192785 gene locus_tag LOCUS_29990 3192153 3192785 CDS product AmiS/UreI family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730476.1 protein_id gnl|my_center|LOCUS_29990 3192795 3193085 gene locus_tag LOCUS_30000 3192795 3193085 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809492.1 protein_id gnl|my_center|LOCUS_30000 3193114 3194370 gene locus_tag LOCUS_30010 3193114 3194370 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729771.1 protein_id gnl|my_center|LOCUS_30010 3195068 3194433 gene locus_tag LOCUS_30020 3195068 3194433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 3195649 3195065 gene locus_tag LOCUS_30030 3195649 3195065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 3195996 3195646 gene locus_tag LOCUS_30040 3195996 3195646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 3196184 3195993 gene locus_tag LOCUS_30050 3196184 3195993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 3196606 3196181 gene locus_tag LOCUS_30060 3196606 3196181 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074067.1 protein_id gnl|my_center|LOCUS_30060 3197079 3196750 gene locus_tag LOCUS_30070 3197079 3196750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 3197725 3197072 gene locus_tag LOCUS_30080 3197725 3197072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 3198297 3197722 gene locus_tag LOCUS_30090 3198297 3197722 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230856.1 protein_id gnl|my_center|LOCUS_30090 3198418 3198591 gene locus_tag LOCUS_30100 3198418 3198591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 3199453 3198581 gene locus_tag LOCUS_30110 3199453 3198581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 3199690 3200376 gene locus_tag LOCUS_30120 3199690 3200376 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111761.1 protein_id gnl|my_center|LOCUS_30120 3200507 3200806 gene locus_tag LOCUS_30130 3200507 3200806 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089378.1 protein_id gnl|my_center|LOCUS_30130 3201584 3200949 gene locus_tag LOCUS_30140 3201584 3200949 CDS product nucleoside/nucleotide kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230842.1 protein_id gnl|my_center|LOCUS_30140 3202045 3201740 gene locus_tag LOCUS_30150 3202045 3201740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 3202391 3202008 gene locus_tag LOCUS_30160 3202391 3202008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 3203873 3202419 gene locus_tag LOCUS_30170 3203873 3202419 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013584.1 protein_id gnl|my_center|LOCUS_30170 3204038 3204757 gene locus_tag LOCUS_30180 3204038 3204757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 3204984 3205304 gene locus_tag LOCUS_30190 3204984 3205304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 3206393 3205323 gene locus_tag LOCUS_30200 3206393 3205323 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510611.1 protein_id gnl|my_center|LOCUS_30200 3207178 3206588 gene locus_tag LOCUS_30210 3207178 3206588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 3207326 3207784 gene locus_tag LOCUS_30220 3207326 3207784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 3208607 3208158 gene locus_tag LOCUS_30230 3208607 3208158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 3208768 3210357 gene locus_tag LOCUS_30240 gene istA 3208768 3210357 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015262274.1 protein_id gnl|my_center|LOCUS_30240 3210357 3211124 gene locus_tag LOCUS_30250 gene istB 3210357 3211124 CDS product IS21-like element ISRsp2 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167668023.1 protein_id gnl|my_center|LOCUS_30250 3211768 3211178 gene locus_tag LOCUS_30260 3211768 3211178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 3212110 3211847 gene locus_tag LOCUS_30270 3212110 3211847 CDS product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776162.1 protein_id gnl|my_center|LOCUS_30270 3216709 3212243 gene locus_tag LOCUS_30280 3216709 3212243 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776163.1 protein_id gnl|my_center|LOCUS_30280 3217460 3216711 gene locus_tag LOCUS_30290 3217460 3216711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776164.1 protein_id gnl|my_center|LOCUS_30290 3219061 3217457 gene locus_tag LOCUS_30300 3219061 3217457 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776165.1 protein_id gnl|my_center|LOCUS_30300 3220383 3219058 gene locus_tag LOCUS_30310 3220383 3219058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 3221264 3220380 gene locus_tag LOCUS_30320 3221264 3220380 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776167.1 protein_id gnl|my_center|LOCUS_30320 3222568 3221261 gene locus_tag LOCUS_30330 3222568 3221261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 3224880 3222565 gene locus_tag LOCUS_30340 3224880 3222565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30340 3226184 3224877 gene locus_tag LOCUS_30350 3226184 3224877 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776170.1 protein_id gnl|my_center|LOCUS_30350 3227155 3226181 gene locus_tag LOCUS_30360 3227155 3226181 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929980.1 protein_id gnl|my_center|LOCUS_30360 3233174 3227181 gene locus_tag LOCUS_30370 3233174 3227181 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193495474.1 protein_id gnl|my_center|LOCUS_30370 3235987 3233471 gene locus_tag LOCUS_30380 3235987 3233471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 3236674 3236021 gene locus_tag LOCUS_30390 3236674 3236021 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862544.1 protein_id gnl|my_center|LOCUS_30390 3236585 3236770 gene locus_tag LOCUS_30400 3236585 3236770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 3237587 3236967 gene locus_tag LOCUS_30410 3237587 3236967 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775779.1 protein_id gnl|my_center|LOCUS_30410 3238825 3237587 gene locus_tag LOCUS_30420 3238825 3237587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 3240042 3238822 gene locus_tag LOCUS_30430 3240042 3238822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 3241341 3240235 gene locus_tag LOCUS_30440 3241341 3240235 CDS product Rv2578c family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776854.1 protein_id gnl|my_center|LOCUS_30440 3242156 3241395 gene locus_tag LOCUS_30450 3242156 3241395 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895777.1 protein_id gnl|my_center|LOCUS_30450 3243269 3242271 gene locus_tag LOCUS_30460 3243269 3242271 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895776.1 protein_id gnl|my_center|LOCUS_30460 3244852 3243422 gene locus_tag LOCUS_30470 3244852 3243422 CDS product malate:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804910.1 protein_id gnl|my_center|LOCUS_30470 3246195 3244960 gene locus_tag LOCUS_30480 3246195 3244960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 3246632 3246225 gene locus_tag LOCUS_30490 3246632 3246225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 3246966 3246634 gene locus_tag LOCUS_30500 3246966 3246634 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257824.1 protein_id gnl|my_center|LOCUS_30500 3248906 3246951 gene locus_tag LOCUS_30510 3248906 3246951 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257823.1 protein_id gnl|my_center|LOCUS_30510 3249528 3249076 gene locus_tag LOCUS_30520 3249528 3249076 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120329.1 protein_id gnl|my_center|LOCUS_30520 3249642 3250430 gene locus_tag LOCUS_30530 3249642 3250430 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089391.1 protein_id gnl|my_center|LOCUS_30530 3250793 3250443 gene locus_tag LOCUS_30540 3250793 3250443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 3250692 3250970 gene locus_tag LOCUS_30550 3250692 3250970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 3252262 3251093 gene locus_tag LOCUS_30560 3252262 3251093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 3253914 3252262 gene locus_tag LOCUS_30570 3253914 3252262 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930043.1 protein_id gnl|my_center|LOCUS_30570 3256424 3253911 gene locus_tag LOCUS_30580 3256424 3253911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 3257690 3256626 gene locus_tag LOCUS_30590 3257690 3256626 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230597.1 protein_id gnl|my_center|LOCUS_30590 3259207 3257930 gene locus_tag LOCUS_30600 3259207 3257930 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975324.1 protein_id gnl|my_center|LOCUS_30600 3259997 3259398 gene locus_tag LOCUS_30610 gene recR 3259997 3259398 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 protein_id gnl|my_center|LOCUS_30610 3262514 3260001 gene locus_tag LOCUS_30620 3262514 3260001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 3267116 3262695 gene locus_tag LOCUS_30630 3267116 3262695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 3267490 3268116 gene locus_tag LOCUS_30640 3267490 3268116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 3268215 3268766 gene locus_tag LOCUS_30650 3268215 3268766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 3268791 3270113 gene locus_tag LOCUS_30660 3268791 3270113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 3270110 3270616 gene locus_tag LOCUS_30670 3270110 3270616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 3270748 3271116 gene locus_tag LOCUS_30680 3270748 3271116 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976576.1 protein_id gnl|my_center|LOCUS_30680 3271564 3271118 gene locus_tag LOCUS_30690 3271564 3271118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 3272961 3271660 gene locus_tag LOCUS_30700 3272961 3271660 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402097.1 protein_id gnl|my_center|LOCUS_30700 3275183 3272958 gene locus_tag LOCUS_30710 gene pta 3275183 3272958 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727187.1 protein_id gnl|my_center|LOCUS_30710 3277190 3275688 gene locus_tag LOCUS_30720 3277190 3275688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 3279741 3277270 gene locus_tag LOCUS_30730 3279741 3277270 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776228.1 protein_id gnl|my_center|LOCUS_30730 3280069 3280599 gene locus_tag LOCUS_30740 3280069 3280599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 3280637 3280724 gene locus_tag LOCUS_t00370 3280637 3280724 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3281470 3282516 gene locus_tag LOCUS_30750 3281470 3282516 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804802.1 protein_id gnl|my_center|LOCUS_30750 3283216 3282803 gene locus_tag LOCUS_30760 3283216 3282803 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721792.1 protein_id gnl|my_center|LOCUS_30760 3283666 3283316 gene locus_tag LOCUS_30770 3283666 3283316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 3284739 3283663 gene locus_tag LOCUS_30780 3284739 3283663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 3285065 3284748 gene locus_tag LOCUS_30790 3285065 3284748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 3285376 3285062 gene locus_tag LOCUS_30800 3285376 3285062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 3286116 3285379 gene locus_tag LOCUS_30810 3286116 3285379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 3288266 3286125 gene locus_tag LOCUS_30820 3288266 3286125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 3288625 3288266 gene locus_tag LOCUS_30830 3288625 3288266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 3289006 3288686 gene locus_tag LOCUS_30840 3289006 3288686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 3289363 3289019 gene locus_tag LOCUS_30850 3289363 3289019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 3289579 3290604 gene locus_tag LOCUS_30860 3289579 3290604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 3290594 3290887 gene locus_tag LOCUS_30870 3290594 3290887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 3290884 3292200 gene locus_tag LOCUS_30880 3290884 3292200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 3292201 3293097 gene locus_tag LOCUS_30890 3292201 3293097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 3293127 3297026 gene locus_tag LOCUS_30900 3293127 3297026 CDS product type VII secretion protein EccC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030426.1 protein_id gnl|my_center|LOCUS_30900 3297023 3297607 gene locus_tag LOCUS_30910 3297023 3297607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 3297697 3298365 gene locus_tag LOCUS_30920 3297697 3298365 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230676.1 protein_id gnl|my_center|LOCUS_30920 3299515 3298454 gene locus_tag LOCUS_30930 3299515 3298454 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230238.1 protein_id gnl|my_center|LOCUS_30930 3300468 3299515 gene locus_tag LOCUS_30940 3300468 3299515 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728089.1 protein_id gnl|my_center|LOCUS_30940 3301168 3300455 gene locus_tag LOCUS_30950 gene modA 3301168 3300455 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728090.1 protein_id gnl|my_center|LOCUS_30950 3301611 3301207 gene locus_tag LOCUS_30960 3301611 3301207 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467790.1 protein_id gnl|my_center|LOCUS_30960 3301747 3302958 gene locus_tag LOCUS_30970 gene moeZ 3301747 3302958 CDS product adenylyltransferase/sulfurtransferase MoeZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223024.1 protein_id gnl|my_center|LOCUS_30970 3302962 3304386 gene locus_tag LOCUS_30980 3302962 3304386 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113181.1 protein_id gnl|my_center|LOCUS_30980 3304383 3304895 gene locus_tag LOCUS_30990 gene moaC 3304383 3304895 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028813.1 protein_id gnl|my_center|LOCUS_30990 3305117 3305752 gene locus_tag LOCUS_31000 3305117 3305752 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014193.1 protein_id gnl|my_center|LOCUS_31000 3305749 3306024 gene locus_tag LOCUS_31010 3305749 3306024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_31010 3306024 3306263 gene locus_tag LOCUS_31020 3306024 3306263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 3306564 3307370 gene locus_tag LOCUS_31030 3306564 3307370 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803832.1 protein_id gnl|my_center|LOCUS_31030 3307367 3308743 gene locus_tag LOCUS_31040 3307367 3308743 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803833.1 protein_id gnl|my_center|LOCUS_31040 3308736 3309902 gene locus_tag LOCUS_31050 gene thiO 3308736 3309902 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861894.1 protein_id gnl|my_center|LOCUS_31050 3309895 3310119 gene locus_tag LOCUS_31060 gene thiS 3309895 3310119 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005357774.1 protein_id gnl|my_center|LOCUS_31060 3310122 3310922 gene locus_tag LOCUS_31070 3310122 3310922 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857587.1 protein_id gnl|my_center|LOCUS_31070 3310919 3312079 gene locus_tag LOCUS_31080 gene moeZ 3310919 3312079 CDS product adenylyltransferase/sulfurtransferase MoeZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223024.1 protein_id gnl|my_center|LOCUS_31080 3312076 3312735 gene locus_tag LOCUS_31090 3312076 3312735 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898105.1 protein_id gnl|my_center|LOCUS_31090 3312741 3313541 gene locus_tag LOCUS_31100 3312741 3313541 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731491.1 protein_id gnl|my_center|LOCUS_31100 3313969 3313538 gene locus_tag LOCUS_31110 3313969 3313538 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013473.1 protein_id gnl|my_center|LOCUS_31110 3314484 3313969 gene locus_tag LOCUS_31120 3314484 3313969 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804487.1 protein_id gnl|my_center|LOCUS_31120 3314782 3316107 gene locus_tag LOCUS_31130 3314782 3316107 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014188.1 protein_id gnl|my_center|LOCUS_31130 3318339 3316342 gene locus_tag LOCUS_31140 3318339 3316342 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898626.1 protein_id gnl|my_center|LOCUS_31140 3318819 3318457 gene locus_tag LOCUS_31150 3318819 3318457 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813393.1 protein_id gnl|my_center|LOCUS_31150 3319799 3319041 gene locus_tag LOCUS_31160 gene narI 3319799 3319041 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775894.1 protein_id gnl|my_center|LOCUS_31160 3320515 3319796 gene locus_tag LOCUS_31170 gene narJ 3320515 3319796 CDS product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014185.1 protein_id gnl|my_center|LOCUS_31170 3322355 3320652 gene locus_tag LOCUS_31180 gene narH 3322355 3320652 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730341.1 protein_id gnl|my_center|LOCUS_31180 3326105 3322356 gene locus_tag LOCUS_31190 3326105 3322356 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972444.1 protein_id gnl|my_center|LOCUS_31190 3326882 3326181 gene locus_tag LOCUS_31200 3326882 3326181 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929996.1 protein_id gnl|my_center|LOCUS_31200 3327168 3326941 gene locus_tag LOCUS_31210 3327168 3326941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 3328758 3327235 gene locus_tag LOCUS_31220 gene paaP 3328758 3327235 CDS product aminopeptidase PaaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101464.1 protein_id gnl|my_center|LOCUS_31220 3329616 3328918 gene locus_tag LOCUS_31230 3329616 3328918 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776430.1 protein_id gnl|my_center|LOCUS_31230 3330976 3329609 gene locus_tag LOCUS_31240 3330976 3329609 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776429.1 protein_id gnl|my_center|LOCUS_31240 3331273 3331818 gene locus_tag LOCUS_31250 3331273 3331818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 3331931 3332464 gene locus_tag LOCUS_31260 3331931 3332464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 3332642 3333262 gene locus_tag LOCUS_31270 3332642 3333262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 3334050 3333259 gene locus_tag LOCUS_31280 3334050 3333259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 3334805 3334092 gene locus_tag LOCUS_31290 3334805 3334092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 3336442 3335075 gene locus_tag LOCUS_31300 3336442 3335075 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084531.1 protein_id gnl|my_center|LOCUS_31300 3336933 3336505 gene locus_tag LOCUS_31310 3336933 3336505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 3338461 3337082 gene locus_tag LOCUS_31320 3338461 3337082 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839765.1 protein_id gnl|my_center|LOCUS_31320 3340148 3338811 gene locus_tag LOCUS_31330 3340148 3338811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 3340260 3341264 gene locus_tag LOCUS_31340 3340260 3341264 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776829.1 protein_id gnl|my_center|LOCUS_31340 3341412 3342257 gene locus_tag LOCUS_31350 3341412 3342257 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707196.1 protein_id gnl|my_center|LOCUS_31350 3343344 3342382 gene locus_tag LOCUS_31360 3343344 3342382 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029030.1 protein_id gnl|my_center|LOCUS_31360 3344006 3343341 gene locus_tag LOCUS_31370 3344006 3343341 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803802.1 protein_id gnl|my_center|LOCUS_31370 3345037 3344003 gene locus_tag LOCUS_31380 3345037 3344003 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804351.1 protein_id gnl|my_center|LOCUS_31380 3345135 3346679 gene locus_tag LOCUS_31390 3345135 3346679 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311047.1 protein_id gnl|my_center|LOCUS_31390 3348051 3346819 gene locus_tag LOCUS_31400 3348051 3346819 CDS product D-galactonate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971515.1 protein_id gnl|my_center|LOCUS_31400 3349532 3348048 gene locus_tag LOCUS_31410 gene uxaC 3349532 3348048 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975776.1 protein_id gnl|my_center|LOCUS_31410 3349778 3350788 gene locus_tag LOCUS_31420 3349778 3350788 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226270.1 protein_id gnl|my_center|LOCUS_31420 3350862 3352088 gene locus_tag LOCUS_31430 3350862 3352088 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876235.1 protein_id gnl|my_center|LOCUS_31430 3352092 3353219 gene locus_tag LOCUS_31440 3352092 3353219 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230681.1 protein_id gnl|my_center|LOCUS_31440 3353216 3354148 gene locus_tag LOCUS_31450 3353216 3354148 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230680.1 protein_id gnl|my_center|LOCUS_31450 3354148 3355089 gene locus_tag LOCUS_31460 3354148 3355089 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230679.1 protein_id gnl|my_center|LOCUS_31460 3355079 3356629 gene locus_tag LOCUS_31470 3355079 3356629 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037467968.1 protein_id gnl|my_center|LOCUS_31470 3357988 3356738 gene locus_tag LOCUS_31480 3357988 3356738 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226269.1 protein_id gnl|my_center|LOCUS_31480 3358119 3359309 gene locus_tag LOCUS_31490 gene xylA 3358119 3359309 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730977.1 protein_id gnl|my_center|LOCUS_31490 3360082 3359384 gene locus_tag LOCUS_31500 3360082 3359384 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730508.1 protein_id gnl|my_center|LOCUS_31500 3362577 3360079 gene locus_tag LOCUS_31510 3362577 3360079 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030507.1 protein_id gnl|my_center|LOCUS_31510 3363189 3362581 gene locus_tag LOCUS_31520 gene kdpC 3363189 3362581 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919467.1 protein_id gnl|my_center|LOCUS_31520 3365394 3363232 gene locus_tag LOCUS_31530 gene kdpB 3365394 3363232 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029187.1 protein_id gnl|my_center|LOCUS_31530 3367073 3365400 gene locus_tag LOCUS_31540 gene kdpA 3367073 3365400 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730504.1 protein_id gnl|my_center|LOCUS_31540 3369129 3367702 gene locus_tag LOCUS_31550 3369129 3367702 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229411.1 protein_id gnl|my_center|LOCUS_31550 3369420 3370736 gene locus_tag LOCUS_31560 3369420 3370736 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974785.1 protein_id gnl|my_center|LOCUS_31560 3370837 3371730 gene locus_tag LOCUS_31570 3370837 3371730 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804385.1 protein_id gnl|my_center|LOCUS_31570 3372739 3371762 gene locus_tag LOCUS_31580 3372739 3371762 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259109.1 protein_id gnl|my_center|LOCUS_31580 3372856 3373206 gene locus_tag LOCUS_31590 3372856 3373206 CDS product CHY zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127269.1 protein_id gnl|my_center|LOCUS_31590 3373646 3373269 gene locus_tag LOCUS_31600 gene crcB 3373646 3373269 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079419.1 protein_id gnl|my_center|LOCUS_31600 3374086 3373643 gene locus_tag LOCUS_31610 3374086 3373643 CDS product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296550.1 protein_id gnl|my_center|LOCUS_31610 3374707 3374198 gene locus_tag LOCUS_31620 3374707 3374198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 3375230 3374859 gene locus_tag LOCUS_31630 3375230 3374859 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112737.1 protein_id gnl|my_center|LOCUS_31630 3375316 3376434 gene locus_tag LOCUS_31640 gene arsB 3375316 3376434 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174265970.1 protein_id gnl|my_center|LOCUS_31640 3376431 3376841 gene locus_tag LOCUS_31650 3376431 3376841 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031220.1 protein_id gnl|my_center|LOCUS_31650 3376844 3377515 gene locus_tag LOCUS_31660 3376844 3377515 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014416.1 protein_id gnl|my_center|LOCUS_31660 3377528 3378847 gene locus_tag LOCUS_31670 3377528 3378847 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259423.1 protein_id gnl|my_center|LOCUS_31670 3379370 3379092 gene locus_tag LOCUS_31680 3379370 3379092 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878317.1 protein_id gnl|my_center|LOCUS_31680 3379674 3379372 gene locus_tag LOCUS_31690 3379674 3379372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 3381368 3379671 gene locus_tag LOCUS_31700 3381368 3379671 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161799.1 protein_id gnl|my_center|LOCUS_31700 3381629 3383728 gene locus_tag LOCUS_31710 3381629 3383728 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777103.1 protein_id gnl|my_center|LOCUS_31710 3385927 3383753 gene locus_tag LOCUS_31720 3385927 3383753 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225368.1 protein_id gnl|my_center|LOCUS_31720 3386229 3386005 gene locus_tag LOCUS_31730 3386229 3386005 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225366.1 protein_id gnl|my_center|LOCUS_31730 3386320 3386634 gene locus_tag LOCUS_31740 3386320 3386634 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401147.1 protein_id gnl|my_center|LOCUS_31740 3386740 3387393 gene locus_tag LOCUS_31750 3386740 3387393 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029248.1 protein_id gnl|my_center|LOCUS_31750 3388314 3387454 gene locus_tag LOCUS_31760 3388314 3387454 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015511.1 protein_id gnl|my_center|LOCUS_31760 3388535 3389590 gene locus_tag LOCUS_31770 3388535 3389590 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978698.1 protein_id gnl|my_center|LOCUS_31770 3389642 3390493 gene locus_tag LOCUS_31780 3389642 3390493 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899121.1 protein_id gnl|my_center|LOCUS_31780 3390678 3391190 gene locus_tag LOCUS_31790 3390678 3391190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 3391280 3392188 gene locus_tag LOCUS_31800 3391280 3392188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389652.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31800 3393788 3392217 gene locus_tag LOCUS_31810 3393788 3392217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776311.1 protein_id gnl|my_center|LOCUS_31810 3394606 3393770 gene locus_tag LOCUS_31820 3394606 3393770 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814760.1 protein_id gnl|my_center|LOCUS_31820 3394770 3396272 gene locus_tag LOCUS_31830 3394770 3396272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 3396614 3397768 gene locus_tag LOCUS_31840 3396614 3397768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 3398512 3397775 gene locus_tag LOCUS_31850 3398512 3397775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 3398833 3399600 gene locus_tag LOCUS_31860 3398833 3399600 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230559.1 protein_id gnl|my_center|LOCUS_31860 3399658 3400086 gene locus_tag LOCUS_31870 3399658 3400086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 3400275 3401237 gene locus_tag LOCUS_31880 3400275 3401237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 3401238 3402833 gene locus_tag LOCUS_31890 3401238 3402833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 3402830 3403510 gene locus_tag LOCUS_31900 3402830 3403510 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481692.1 protein_id gnl|my_center|LOCUS_31900 3403507 3404862 gene locus_tag LOCUS_31910 3403507 3404862 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230190.1 protein_id gnl|my_center|LOCUS_31910 3405906 3404929 gene locus_tag LOCUS_31920 gene nrdF 3405906 3404929 CDS product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070938867.1 protein_id gnl|my_center|LOCUS_31920 3408064 3405944 gene locus_tag LOCUS_31930 gene nrdE 3408064 3405944 CDS product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876938.1 protein_id gnl|my_center|LOCUS_31930 3408480 3408076 gene locus_tag LOCUS_31940 gene nrdI 3408480 3408076 CDS product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776482.1 protein_id gnl|my_center|LOCUS_31940 3408744 3408511 gene locus_tag LOCUS_31950 3408744 3408511 CDS product redoxin NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893665.1 protein_id gnl|my_center|LOCUS_31950 3410400 3409162 gene locus_tag LOCUS_31960 gene gguB 3410400 3409162 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776910.1 protein_id gnl|my_center|LOCUS_31960 3411960 3410431 gene locus_tag LOCUS_31970 gene gguA 3411960 3410431 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976401.1 protein_id gnl|my_center|LOCUS_31970 3413185 3412064 gene locus_tag LOCUS_31980 gene chvE 3413185 3412064 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226248.1 protein_id gnl|my_center|LOCUS_31980 3413624 3413253 gene locus_tag LOCUS_31990 3413624 3413253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31990 3414770 3413676 gene locus_tag LOCUS_32000 3414770 3413676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32000 3415480 3414770 gene locus_tag LOCUS_32010 3415480 3414770 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893113.1 protein_id gnl|my_center|LOCUS_32010 3416316 3415477 gene locus_tag LOCUS_32020 3416316 3415477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32020 3417185 3416313 gene locus_tag LOCUS_32030 3417185 3416313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32030 3418450 3417431 gene locus_tag LOCUS_32040 3418450 3417431 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226239.1 protein_id gnl|my_center|LOCUS_32040 3419812 3418658 gene locus_tag LOCUS_32050 3419812 3418658 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730426.1 protein_id gnl|my_center|LOCUS_32050 3421214 3419850 gene locus_tag LOCUS_32060 3421214 3419850 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084259.1 protein_id gnl|my_center|LOCUS_32060 3421494 3422165 gene locus_tag LOCUS_32070 3421494 3422165 CDS product DUF3105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028218.1 protein_id gnl|my_center|LOCUS_32070 3422171 3422845 gene locus_tag LOCUS_32080 3422171 3422845 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229546.1 protein_id gnl|my_center|LOCUS_32080 3424873 3423029 gene locus_tag LOCUS_32090 3424873 3423029 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977687.1 protein_id gnl|my_center|LOCUS_32090 3425981 3425013 gene locus_tag LOCUS_32100 3425981 3425013 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258586.1 protein_id gnl|my_center|LOCUS_32100 3427111 3425978 gene locus_tag LOCUS_32110 3427111 3425978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 3428586 3427267 gene locus_tag LOCUS_32120 3428586 3427267 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528261.1 protein_id gnl|my_center|LOCUS_32120 3428884 3429906 gene locus_tag LOCUS_32130 3428884 3429906 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_32130 3430424 3430041 gene locus_tag LOCUS_32140 gene rplL 3430424 3430041 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403353.1 protein_id gnl|my_center|LOCUS_32140 3431009 3430494 gene locus_tag LOCUS_32150 gene rplJ 3431009 3430494 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974311.1 protein_id gnl|my_center|LOCUS_32150 3431393 3433090 gene locus_tag LOCUS_32160 3431393 3433090 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978239.1 protein_id gnl|my_center|LOCUS_32160 3433126 3433539 gene locus_tag LOCUS_32170 3433126 3433539 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973682.1 protein_id gnl|my_center|LOCUS_32170 3435057 3433552 gene locus_tag LOCUS_32180 3435057 3433552 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876236.1 protein_id gnl|my_center|LOCUS_32180 3435887 3435054 gene locus_tag LOCUS_32190 3435887 3435054 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863629.1 protein_id gnl|my_center|LOCUS_32190 3435984 3437465 gene locus_tag LOCUS_32200 3435984 3437465 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029960.1 protein_id gnl|my_center|LOCUS_32200 3437490 3438161 gene locus_tag LOCUS_32210 3437490 3438161 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974037.1 protein_id gnl|my_center|LOCUS_32210 3439092 3438292 gene locus_tag LOCUS_32220 3439092 3438292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 3439617 3440276 gene locus_tag LOCUS_32230 3439617 3440276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 3440314 3441288 gene locus_tag LOCUS_32240 3440314 3441288 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204065824.1 protein_id gnl|my_center|LOCUS_32240 3441909 3441304 gene locus_tag LOCUS_32250 3441909 3441304 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002320930.1 protein_id gnl|my_center|LOCUS_32250 3442577 3441906 gene locus_tag LOCUS_32260 3442577 3441906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 3443711 3442980 gene locus_tag LOCUS_32270 3443711 3442980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 3444709 3443708 gene locus_tag LOCUS_32280 3444709 3443708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 3445293 3444706 gene locus_tag LOCUS_32290 3445293 3444706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 3445974 3445336 gene locus_tag LOCUS_32300 3445974 3445336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 3446359 3447768 gene locus_tag LOCUS_32310 3446359 3447768 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967081.1 protein_id gnl|my_center|LOCUS_32310 3448269 3447784 gene locus_tag LOCUS_32320 3448269 3447784 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894176.1 protein_id gnl|my_center|LOCUS_32320 3448807 3448322 gene locus_tag LOCUS_32330 3448807 3448322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 3449575 3448889 gene locus_tag LOCUS_32340 3449575 3448889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 3451505 3449829 gene locus_tag LOCUS_32350 gene aceB 3451505 3449829 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223537.1 protein_id gnl|my_center|LOCUS_32350 3451659 3453146 gene locus_tag LOCUS_32360 3451659 3453146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 3454125 3453280 gene locus_tag LOCUS_32370 3454125 3453280 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093147.1 protein_id gnl|my_center|LOCUS_32370 3455051 3454122 gene locus_tag LOCUS_32380 3455051 3454122 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230918.1 protein_id gnl|my_center|LOCUS_32380 3456643 3455051 gene locus_tag LOCUS_32390 3456643 3455051 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929955.1 protein_id gnl|my_center|LOCUS_32390 3456978 3457796 gene locus_tag LOCUS_32400 3456978 3457796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 3457811 3459430 gene locus_tag LOCUS_32410 3457811 3459430 CDS product dipeptide/oligopeptide/nickel ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385805.1 protein_id gnl|my_center|LOCUS_32410 3460118 3459420 gene locus_tag LOCUS_32420 3460118 3459420 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210025486.1 protein_id gnl|my_center|LOCUS_32420 3460376 3461809 gene locus_tag LOCUS_32430 3460376 3461809 CDS product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223105.1 protein_id gnl|my_center|LOCUS_32430 3462675 3461986 gene locus_tag LOCUS_32440 gene rplA 3462675 3461986 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974314.1 protein_id gnl|my_center|LOCUS_32440 3463199 3462768 gene locus_tag LOCUS_32450 gene rplK 3463199 3462768 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892734.1 protein_id gnl|my_center|LOCUS_32450 3464245 3463289 gene locus_tag LOCUS_32460 gene nusG 3464245 3463289 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029791.1 protein_id gnl|my_center|LOCUS_32460 3464594 3464325 gene locus_tag LOCUS_32470 3464594 3464325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 3464709 3464636 gene locus_tag LOCUS_t00380 3464709 3464636 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 3464899 3466101 gene locus_tag LOCUS_32480 3464899 3466101 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029790.1 protein_id gnl|my_center|LOCUS_32480 3466398 3467606 gene locus_tag LOCUS_32490 3466398 3467606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 3467603 3467833 gene locus_tag LOCUS_32500 3467603 3467833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 3468507 3467830 gene locus_tag LOCUS_32510 3468507 3467830 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222701.1 protein_id gnl|my_center|LOCUS_32510 3469766 3468504 gene locus_tag LOCUS_32520 3469766 3468504 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974180.1 protein_id gnl|my_center|LOCUS_32520 3469895 3471364 gene locus_tag LOCUS_32530 3469895 3471364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 3471377 3471667 gene locus_tag LOCUS_32540 3471377 3471667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 3471684 3472328 gene locus_tag LOCUS_32550 3471684 3472328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 3473410 3472454 gene locus_tag LOCUS_32560 3473410 3472454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 3474608 3473472 gene locus_tag LOCUS_32570 3474608 3473472 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222386.1 protein_id gnl|my_center|LOCUS_32570 3475027 3474605 gene locus_tag LOCUS_32580 3475027 3474605 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776155.1 protein_id gnl|my_center|LOCUS_32580 3475470 3475024 gene locus_tag LOCUS_32590 3475470 3475024 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029784.1 protein_id gnl|my_center|LOCUS_32590 3475552 3476061 gene locus_tag LOCUS_32600 3475552 3476061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 3476160 3476807 gene locus_tag LOCUS_32610 3476160 3476807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 3476878 3477579 gene locus_tag LOCUS_32620 3476878 3477579 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742086.1 protein_id gnl|my_center|LOCUS_32620 3478538 3477603 gene locus_tag LOCUS_32630 3478538 3477603 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227640.1 protein_id gnl|my_center|LOCUS_32630 3478593 3479510 gene locus_tag LOCUS_32640 3478593 3479510 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230607.1 protein_id gnl|my_center|LOCUS_32640 3479952 3479605 gene locus_tag LOCUS_32650 3479952 3479605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 3482584 3479963 gene locus_tag LOCUS_32660 3482584 3479963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 3482504 3482761 gene locus_tag LOCUS_32670 3482504 3482761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 3482990 3483277 gene locus_tag LOCUS_32680 3482990 3483277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 3483717 3483319 gene locus_tag LOCUS_32690 3483717 3483319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 3483601 3484617 gene locus_tag LOCUS_32700 3483601 3484617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_32700 3484840 3485196 gene locus_tag LOCUS_32710 3484840 3485196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 3485874 3486680 gene locus_tag LOCUS_32720 3485874 3486680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 3487325 3487543 gene locus_tag LOCUS_32730 3487325 3487543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230646.1 protein_id gnl|my_center|LOCUS_32730 3487878 3489551 gene locus_tag LOCUS_32740 3487878 3489551 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003465068.1 protein_id gnl|my_center|LOCUS_32740 3489545 3490462 gene locus_tag LOCUS_32750 3489545 3490462 CDS product TniB family NTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003465065.1 protein_id gnl|my_center|LOCUS_32750 3490564 3491658 gene locus_tag LOCUS_32760 3490564 3491658 CDS product TniQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087245.1 protein_id gnl|my_center|LOCUS_32760 3491748 3492389 gene locus_tag LOCUS_32770 3491748 3492389 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074921927.1 protein_id gnl|my_center|LOCUS_32770 3492832 3493386 gene locus_tag LOCUS_32780 3492832 3493386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 3493804 3493577 gene locus_tag LOCUS_32790 3493804 3493577 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978728.1 protein_id gnl|my_center|LOCUS_32790 3494280 3493804 gene locus_tag LOCUS_32800 3494280 3493804 CDS product DUF2975 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026883.1 protein_id gnl|my_center|LOCUS_32800 3495504 3496328 gene locus_tag LOCUS_32810 3495504 3496328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32810 3496338 3496568 gene locus_tag LOCUS_32820 3496338 3496568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32820 3496702 3498291 gene locus_tag LOCUS_32830 gene istA 3496702 3498291 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015262274.1 protein_id gnl|my_center|LOCUS_32830 3498291 3499058 gene locus_tag LOCUS_32840 gene istB 3498291 3499058 CDS product IS21-like element ISRsp2 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167668023.1 protein_id gnl|my_center|LOCUS_32840 3499167 3499706 gene locus_tag LOCUS_32850 3499167 3499706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 3499819 3500409 gene locus_tag LOCUS_32860 3499819 3500409 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147567.1 protein_id gnl|my_center|LOCUS_32860 3503955 3500413 gene locus_tag LOCUS_32870 3503955 3500413 CDS product DUF4020 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106004657.1 protein_id gnl|my_center|LOCUS_32870 3504316 3504849 gene locus_tag LOCUS_32880 3504316 3504849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 3504969 3505400 gene locus_tag LOCUS_32890 3504969 3505400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 3505489 3506109 gene locus_tag LOCUS_32900 3505489 3506109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 3507119 3506163 gene locus_tag LOCUS_32910 3507119 3506163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 3510581 3507330 gene locus_tag LOCUS_32920 3510581 3507330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 3512202 3511276 gene locus_tag LOCUS_32930 3512202 3511276 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776299.1 protein_id gnl|my_center|LOCUS_32930 3512565 3512263 gene locus_tag LOCUS_32940 3512565 3512263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 3513676 3512588 gene locus_tag LOCUS_32950 3513676 3512588 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970685.1 protein_id gnl|my_center|LOCUS_32950 3513880 3514896 gene locus_tag LOCUS_32960 3513880 3514896 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727630.1 protein_id gnl|my_center|LOCUS_32960 3515076 3516116 gene locus_tag LOCUS_32970 3515076 3516116 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974550.1 protein_id gnl|my_center|LOCUS_32970 3516113 3516889 gene locus_tag LOCUS_32980 3516113 3516889 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892760.1 protein_id gnl|my_center|LOCUS_32980 3517967 3516954 gene locus_tag LOCUS_32990 3517967 3516954 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227740.1 protein_id gnl|my_center|LOCUS_32990 3518320 3519888 gene locus_tag LOCUS_33000 3518320 3519888 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049744721.1 protein_id gnl|my_center|LOCUS_33000 3519888 3520538 gene locus_tag LOCUS_33010 3519888 3520538 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776120.1 protein_id gnl|my_center|LOCUS_33010 3520535 3521950 gene locus_tag LOCUS_33020 3520535 3521950 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089037.1 protein_id gnl|my_center|LOCUS_33020 3521957 3523843 gene locus_tag LOCUS_33030 gene asnB 3521957 3523843 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089038.1 protein_id gnl|my_center|LOCUS_33030 3523840 3524529 gene locus_tag LOCUS_33040 3523840 3524529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 3524531 3525886 gene locus_tag LOCUS_33050 3524531 3525886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 3525883 3526782 gene locus_tag LOCUS_33060 3525883 3526782 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061716.1 protein_id gnl|my_center|LOCUS_33060 3526794 3527636 gene locus_tag LOCUS_33070 3526794 3527636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 3531063 3527647 gene locus_tag LOCUS_33080 3531063 3527647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 3531842 3531141 gene locus_tag LOCUS_33090 3531842 3531141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 3532031 3533482 gene locus_tag LOCUS_33100 3532031 3533482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 3534765 3533551 gene locus_tag LOCUS_33110 3534765 3533551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 3535934 3534762 gene locus_tag LOCUS_33120 3535934 3534762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 3537534 3536086 gene locus_tag LOCUS_33130 3537534 3536086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 3539120 3537531 gene locus_tag LOCUS_33140 3539120 3537531 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730933.1 protein_id gnl|my_center|LOCUS_33140 3540337 3539120 gene locus_tag LOCUS_33150 3540337 3539120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 3541491 3540334 gene locus_tag LOCUS_33160 3541491 3540334 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461032.1 protein_id gnl|my_center|LOCUS_33160 3542132 3541488 gene locus_tag LOCUS_33170 3542132 3541488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 3543273 3542125 gene locus_tag LOCUS_33180 3543273 3542125 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807055.1 protein_id gnl|my_center|LOCUS_33180 3544319 3543273 gene locus_tag LOCUS_33190 3544319 3543273 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257504.1 protein_id gnl|my_center|LOCUS_33190 3545416 3544316 gene locus_tag LOCUS_33200 3545416 3544316 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061730.1 protein_id gnl|my_center|LOCUS_33200 3546036 3547568 gene locus_tag LOCUS_33210 3546036 3547568 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049744721.1 protein_id gnl|my_center|LOCUS_33210 3547634 3548830 gene locus_tag LOCUS_33220 3547634 3548830 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929836.1 protein_id gnl|my_center|LOCUS_33220 3548827 3553881 gene locus_tag LOCUS_33230 3548827 3553881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 3553962 3555068 gene locus_tag LOCUS_33240 3553962 3555068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 3555065 3556456 gene locus_tag LOCUS_33250 3555065 3556456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803941.1 protein_id gnl|my_center|LOCUS_33250 3556453 3557898 gene locus_tag LOCUS_33260 3556453 3557898 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803942.1 protein_id gnl|my_center|LOCUS_33260 3558568 3557906 gene locus_tag LOCUS_33270 3558568 3557906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 3559392 3558565 gene locus_tag LOCUS_33280 3559392 3558565 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803937.1 protein_id gnl|my_center|LOCUS_33280 3559724 3560953 gene locus_tag LOCUS_33290 3559724 3560953 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144955419.1 protein_id gnl|my_center|LOCUS_33290 3561936 3560989 gene locus_tag LOCUS_33300 3561936 3560989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 3562033 3563100 gene locus_tag LOCUS_33310 3562033 3563100 CDS product GDP-mannose--glycolipid 4-beta-D-mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037588.1 protein_id gnl|my_center|LOCUS_33310 3563087 3564073 gene locus_tag LOCUS_33320 3563087 3564073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 3564635 3564114 gene locus_tag LOCUS_33330 3564635 3564114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 3564818 3565948 gene locus_tag LOCUS_33340 3564818 3565948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 3565945 3567174 gene locus_tag LOCUS_33350 3565945 3567174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 3567171 3568694 gene locus_tag LOCUS_33360 3567171 3568694 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803944.1 protein_id gnl|my_center|LOCUS_33360 3571261 3568766 gene locus_tag LOCUS_33370 3571261 3568766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 3571617 3572129 gene locus_tag LOCUS_33380 3571617 3572129 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930108.1 protein_id gnl|my_center|LOCUS_33380 3573120 3572164 gene locus_tag LOCUS_33390 gene pip 3573120 3572164 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974918.1 protein_id gnl|my_center|LOCUS_33390 3573807 3573130 gene locus_tag LOCUS_33400 3573807 3573130 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975444.1 protein_id gnl|my_center|LOCUS_33400 3575087 3573804 gene locus_tag LOCUS_33410 3575087 3573804 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228285.1 protein_id gnl|my_center|LOCUS_33410 3575952 3575098 gene locus_tag LOCUS_33420 3575952 3575098 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228270.1 protein_id gnl|my_center|LOCUS_33420 3576908 3575949 gene locus_tag LOCUS_33430 3576908 3575949 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228283.1 protein_id gnl|my_center|LOCUS_33430 3578494 3577067 gene locus_tag LOCUS_33440 3578494 3577067 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229411.1 protein_id gnl|my_center|LOCUS_33440 3580880 3578784 gene locus_tag LOCUS_33450 3580880 3578784 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776348.1 protein_id gnl|my_center|LOCUS_33450 3581764 3581165 gene locus_tag LOCUS_33460 3581764 3581165 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930078.1 protein_id gnl|my_center|LOCUS_33460 3583788 3581767 gene locus_tag LOCUS_33470 gene recQ 3583788 3581767 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224869.1 protein_id gnl|my_center|LOCUS_33470 3584871 3583798 gene locus_tag LOCUS_33480 3584871 3583798 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194788.1 protein_id gnl|my_center|LOCUS_33480 3585617 3584979 gene locus_tag LOCUS_33490 3585617 3584979 CDS product copper resistance protein CopC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228316.1 protein_id gnl|my_center|LOCUS_33490 3586350 3585625 gene locus_tag LOCUS_33500 3586350 3585625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 3587117 3586491 gene locus_tag LOCUS_33510 3587117 3586491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 3589028 3587160 gene locus_tag LOCUS_33520 3589028 3587160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 3590162 3589203 gene locus_tag LOCUS_33530 gene pip 3590162 3589203 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087175.1 protein_id gnl|my_center|LOCUS_33530 3590285 3591409 gene locus_tag LOCUS_33540 3590285 3591409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 3591446 3592648 gene locus_tag LOCUS_33550 3591446 3592648 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776964.1 protein_id gnl|my_center|LOCUS_33550 3592791 3593384 gene locus_tag LOCUS_33560 3592791 3593384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 3593793 3593404 gene locus_tag LOCUS_33570 3593793 3593404 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404903.1 protein_id gnl|my_center|LOCUS_33570 3594035 3593790 gene locus_tag LOCUS_33580 3594035 3593790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 3595113 3594334 gene locus_tag LOCUS_33590 3595113 3594334 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162687994.1 protein_id gnl|my_center|LOCUS_33590 3596281 3595151 gene locus_tag LOCUS_33600 gene paaK 3596281 3595151 CDS product phenylacetate-CoA oxygenase/reductase subunit PaaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965787.1 protein_id gnl|my_center|LOCUS_33600 3596823 3596284 gene locus_tag LOCUS_33610 gene paaJ 3596823 3596284 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085678.1 protein_id gnl|my_center|LOCUS_33610 3597644 3596817 gene locus_tag LOCUS_33620 gene paaC 3597644 3596817 CDS product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329397.1 protein_id gnl|my_center|LOCUS_33620 3597946 3597641 gene locus_tag LOCUS_33630 gene paaB 3597946 3597641 CDS product 1,2-phenylacetyl-CoA epoxidase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551024.1 protein_id gnl|my_center|LOCUS_33630 3598944 3597943 gene locus_tag LOCUS_33640 gene paaA 3598944 3597943 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031683.1 protein_id gnl|my_center|LOCUS_33640 3599109 3599564 gene locus_tag LOCUS_33650 gene paaI 3599109 3599564 CDS product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223461.1 protein_id gnl|my_center|LOCUS_33650 3599583 3600902 gene locus_tag LOCUS_33660 gene paaF 3599583 3600902 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223460.1 protein_id gnl|my_center|LOCUS_33660 3600940 3601542 gene locus_tag LOCUS_33670 3600940 3601542 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223459.1 protein_id gnl|my_center|LOCUS_33670 3601847 3601737 gene locus_tag LOCUS_r00070 3601847 3601737 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3605100 3601980 gene locus_tag LOCUS_r00080 3605100 3601980 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3607072 3605541 gene locus_tag LOCUS_r00090 3607072 3605541 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3608290 3608865 gene locus_tag LOCUS_33680 3608290 3608865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 3608905 3610152 gene locus_tag LOCUS_33690 3608905 3610152 CDS product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967206.1 protein_id gnl|my_center|LOCUS_33690 3610469 3610158 gene locus_tag LOCUS_33700 3610469 3610158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 3611575 3610466 gene locus_tag LOCUS_33710 3611575 3610466 CDS product M4 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275113.1 protein_id gnl|my_center|LOCUS_33710 3611730 3612710 gene locus_tag LOCUS_33720 3611730 3612710 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023149.1 protein_id gnl|my_center|LOCUS_33720 3612753 3613064 gene locus_tag LOCUS_33730 3612753 3613064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 3613100 3614392 gene locus_tag LOCUS_33740 3613100 3614392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 3614995 3614459 gene locus_tag LOCUS_33750 3614995 3614459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 3617285 3615231 gene locus_tag LOCUS_33760 gene paaZ 3617285 3615231 CDS product phenylacetic acid degradation bifunctional protein PaaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223462.1 protein_id gnl|my_center|LOCUS_33760 3618228 3617338 gene locus_tag LOCUS_33770 3618228 3617338 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729557.1 protein_id gnl|my_center|LOCUS_33770 3619412 3618228 gene locus_tag LOCUS_33780 3619412 3618228 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113327.1 protein_id gnl|my_center|LOCUS_33780 3619633 3620358 gene locus_tag LOCUS_33790 3619633 3620358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 3621550 3620300 gene locus_tag LOCUS_33800 3621550 3620300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101496.1 protein_id gnl|my_center|LOCUS_33800 3622827 3621583 gene locus_tag LOCUS_33810 3622827 3621583 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224419.1 protein_id gnl|my_center|LOCUS_33810 3623909 3622824 gene locus_tag LOCUS_33820 3623909 3622824 CDS product DUF2891 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027115.1 protein_id gnl|my_center|LOCUS_33820 3626307 3624061 gene locus_tag LOCUS_33830 3626307 3624061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 3627638 3626583 gene locus_tag LOCUS_33840 gene zigA 3627638 3626583 CDS product zinc metallochaperone GTPase ZigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165446171.1 protein_id gnl|my_center|LOCUS_33840 3628001 3629254 gene locus_tag LOCUS_33850 3628001 3629254 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029543.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33850 3629233 3629442 gene locus_tag LOCUS_33860 3629233 3629442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 3629626 3630615 gene locus_tag LOCUS_33870 3629626 3630615 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886781.1 protein_id gnl|my_center|LOCUS_33870 3631441 3630656 gene locus_tag LOCUS_33880 3631441 3630656 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157773333.1 protein_id gnl|my_center|LOCUS_33880 3631532 3633115 gene locus_tag LOCUS_33890 gene hutH 3631532 3633115 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727479.1 protein_id gnl|my_center|LOCUS_33890 3633761 3634849 gene locus_tag LOCUS_33900 3633761 3634849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 3635358 3634864 gene locus_tag LOCUS_33910 3635358 3634864 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084746.1 protein_id gnl|my_center|LOCUS_33910 3635381 3635701 gene locus_tag LOCUS_33920 3635381 3635701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 3636587 3635940 gene locus_tag LOCUS_33930 3636587 3635940 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230676.1 protein_id gnl|my_center|LOCUS_33930 3637085 3636639 gene locus_tag LOCUS_33940 3637085 3636639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 3637233 3638735 gene locus_tag LOCUS_33950 3637233 3638735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 3642218 3638985 gene locus_tag LOCUS_33960 3642218 3638985 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224450.1 protein_id gnl|my_center|LOCUS_33960 3643739 3642279 gene locus_tag LOCUS_33970 3643739 3642279 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095878.1 protein_id gnl|my_center|LOCUS_33970 3643803 3644429 gene locus_tag LOCUS_33980 3643803 3644429 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367926.1 protein_id gnl|my_center|LOCUS_33980 3644456 3644929 gene locus_tag LOCUS_33990 3644456 3644929 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229196.1 protein_id gnl|my_center|LOCUS_33990 3646103 3644934 gene locus_tag LOCUS_34000 3646103 3644934 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038499.1 protein_id gnl|my_center|LOCUS_34000 3646184 3646993 gene locus_tag LOCUS_34010 3646184 3646993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 3647105 3647956 gene locus_tag LOCUS_34020 3647105 3647956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 3647953 3648576 gene locus_tag LOCUS_34030 3647953 3648576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 3648935 3648669 gene locus_tag LOCUS_34040 3648935 3648669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 3648991 3649440 gene locus_tag LOCUS_34050 3648991 3649440 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225292.1 protein_id gnl|my_center|LOCUS_34050 3649487 3651637 gene locus_tag LOCUS_34060 3649487 3651637 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742167.1 protein_id gnl|my_center|LOCUS_34060 3652888 3651761 gene locus_tag LOCUS_34070 3652888 3651761 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027605.1 protein_id gnl|my_center|LOCUS_34070 3653051 3653311 gene locus_tag LOCUS_34080 3653051 3653311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 3654681 3653578 gene locus_tag LOCUS_34090 gene purM 3654681 3653578 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804525.1 protein_id gnl|my_center|LOCUS_34090 3656267 3654678 gene locus_tag LOCUS_34100 gene purF 3656267 3654678 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804524.1 protein_id gnl|my_center|LOCUS_34100 3656618 3656280 gene locus_tag LOCUS_34110 3656618 3656280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 3656721 3657629 gene locus_tag LOCUS_34120 gene rbsK 3656721 3657629 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267464.1 protein_id gnl|my_center|LOCUS_34120 3662363 3657786 gene locus_tag LOCUS_34130 3662363 3657786 CDS product lamin tail domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053545967.1 protein_id gnl|my_center|LOCUS_34130 3663051 3662728 gene locus_tag LOCUS_34140 3663051 3662728 CDS product sterol carrier family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284386.1 protein_id gnl|my_center|LOCUS_34140 3664574 3663105 gene locus_tag LOCUS_34150 3664574 3663105 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013450.1 protein_id gnl|my_center|LOCUS_34150 3665541 3664729 gene locus_tag LOCUS_34160 3665541 3664729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 3666323 3665538 gene locus_tag LOCUS_34170 3666323 3665538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 3666476 3667369 gene locus_tag LOCUS_34180 3666476 3667369 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272027.1 protein_id gnl|my_center|LOCUS_34180 3667366 3668298 gene locus_tag LOCUS_34190 3667366 3668298 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943549.1 protein_id gnl|my_center|LOCUS_34190 3668295 3669263 gene locus_tag LOCUS_34200 3668295 3669263 CDS product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727634.1 protein_id gnl|my_center|LOCUS_34200 3669310 3670548 gene locus_tag LOCUS_34210 3669310 3670548 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402920.1 protein_id gnl|my_center|LOCUS_34210 3672053 3670581 gene locus_tag LOCUS_34220 3672053 3670581 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234939726.1 protein_id gnl|my_center|LOCUS_34220 3674034 3672154 gene locus_tag LOCUS_34230 gene iolD 3674034 3672154 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729994.1 protein_id gnl|my_center|LOCUS_34230 3674909 3674067 gene locus_tag LOCUS_34240 gene iolB 3674909 3674067 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640197.1 protein_id gnl|my_center|LOCUS_34240 3675820 3675002 gene locus_tag LOCUS_34250 3675820 3675002 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728079.1 protein_id gnl|my_center|LOCUS_34250 3676875 3675865 gene locus_tag LOCUS_34260 gene iolG 3676875 3675865 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855225.1 protein_id gnl|my_center|LOCUS_34260 3677996 3676929 gene locus_tag LOCUS_34270 3677996 3676929 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972671.1 protein_id gnl|my_center|LOCUS_34270 3678889 3678002 gene locus_tag LOCUS_34280 3678889 3678002 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729986.1 protein_id gnl|my_center|LOCUS_34280 3680138 3678942 gene locus_tag LOCUS_34290 3680138 3678942 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031359.1 protein_id gnl|my_center|LOCUS_34290 3681445 3680429 gene locus_tag LOCUS_34300 3681445 3680429 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223782.1 protein_id gnl|my_center|LOCUS_34300 3681668 3682663 gene locus_tag LOCUS_34310 3681668 3682663 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729990.1 protein_id gnl|my_center|LOCUS_34310 3682726 3683805 gene locus_tag LOCUS_34320 3682726 3683805 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972668.1 protein_id gnl|my_center|LOCUS_34320 3683802 3684719 gene locus_tag LOCUS_34330 3683802 3684719 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223778.1 protein_id gnl|my_center|LOCUS_34330 3685056 3684853 gene locus_tag LOCUS_34340 3685056 3684853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 3685122 3686378 gene locus_tag LOCUS_34350 gene purD 3685122 3686378 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029417.1 protein_id gnl|my_center|LOCUS_34350 3688014 3686509 gene locus_tag LOCUS_34360 3688014 3686509 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728196.1 protein_id gnl|my_center|LOCUS_34360 3689243 3688011 gene locus_tag LOCUS_34370 3689243 3688011 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728197.1 protein_id gnl|my_center|LOCUS_34370 3690649 3689282 gene locus_tag LOCUS_34380 3690649 3689282 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728198.1 protein_id gnl|my_center|LOCUS_34380 3690773 3691474 gene locus_tag LOCUS_34390 3690773 3691474 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893548.1 protein_id gnl|my_center|LOCUS_34390 3691489 3692439 gene locus_tag LOCUS_34400 3691489 3692439 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776330.1 protein_id gnl|my_center|LOCUS_34400 3692494 3692871 gene locus_tag LOCUS_34410 3692494 3692871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 3694474 3692930 gene locus_tag LOCUS_34420 3694474 3692930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 3695425 3694721 gene locus_tag LOCUS_34430 3695425 3694721 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228115.1 protein_id gnl|my_center|LOCUS_34430 3695592 3696446 gene locus_tag LOCUS_34440 3695592 3696446 CDS product tryptophan 2,3-dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035685.1 protein_id gnl|my_center|LOCUS_34440 3696443 3697309 gene locus_tag LOCUS_34450 3696443 3697309 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228210.1 protein_id gnl|my_center|LOCUS_34450 3697306 3698592 gene locus_tag LOCUS_34460 3697306 3698592 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228178.1 protein_id gnl|my_center|LOCUS_34460 3698672 3698905 gene locus_tag LOCUS_34470 gene purS 3698672 3698905 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776336.1 protein_id gnl|my_center|LOCUS_34470 3698905 3699600 gene locus_tag LOCUS_34480 gene purQ 3698905 3699600 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974894.1 protein_id gnl|my_center|LOCUS_34480 3699757 3700170 gene locus_tag LOCUS_34490 3699757 3700170 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027487.1 protein_id gnl|my_center|LOCUS_34490 3701697 3700174 gene locus_tag LOCUS_34500 3701697 3700174 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726682.1 protein_id gnl|my_center|LOCUS_34500 3702229 3701699 gene locus_tag LOCUS_34510 3702229 3701699 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726681.1 protein_id gnl|my_center|LOCUS_34510 3703212 3702226 gene locus_tag LOCUS_34520 3703212 3702226 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807281.1 protein_id gnl|my_center|LOCUS_34520 3704538 3703357 gene locus_tag LOCUS_34530 3704538 3703357 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113327.1 protein_id gnl|my_center|LOCUS_34530 3705311 3704535 gene locus_tag LOCUS_34540 gene fabG 3705311 3704535 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027734.1 protein_id gnl|my_center|LOCUS_34540 3706567 3705359 gene locus_tag LOCUS_34550 3706567 3705359 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259394.1 protein_id gnl|my_center|LOCUS_34550 3707004 3706564 gene locus_tag LOCUS_34560 3707004 3706564 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256620.1 protein_id gnl|my_center|LOCUS_34560 3708085 3706997 gene locus_tag LOCUS_34570 3708085 3706997 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226683.1 protein_id gnl|my_center|LOCUS_34570 3708355 3709278 gene locus_tag LOCUS_34580 3708355 3709278 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038349.1 protein_id gnl|my_center|LOCUS_34580 3709392 3710558 gene locus_tag LOCUS_34590 3709392 3710558 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728358.1 protein_id gnl|my_center|LOCUS_34590 3710568 3711548 gene locus_tag LOCUS_34600 3710568 3711548 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086618.1 protein_id gnl|my_center|LOCUS_34600 3711552 3712004 gene locus_tag LOCUS_34610 gene htdZ 3711552 3712004 CDS product 3-hydroxyacyl-thioester dehydratase HtdZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400912.1 protein_id gnl|my_center|LOCUS_34610 3713612 3712122 gene locus_tag LOCUS_34620 3713612 3712122 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027994.1 protein_id gnl|my_center|LOCUS_34620 3714744 3713881 gene locus_tag LOCUS_34630 3714744 3713881 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729048.1 protein_id gnl|my_center|LOCUS_34630 3716525 3714864 gene locus_tag LOCUS_34640 3716525 3714864 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013615.1 protein_id gnl|my_center|LOCUS_34640 3717052 3716522 gene locus_tag LOCUS_34650 3717052 3716522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 3717307 3718788 gene locus_tag LOCUS_34660 3717307 3718788 CDS product integrase core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013842.1 protein_id gnl|my_center|LOCUS_34660 3719534 3719037 gene locus_tag LOCUS_34670 3719534 3719037 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013395.1 protein_id gnl|my_center|LOCUS_34670 3719664 3720125 gene locus_tag LOCUS_34680 3719664 3720125 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804014.1 protein_id gnl|my_center|LOCUS_34680 3720385 3721887 gene locus_tag LOCUS_34690 3720385 3721887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 3722944 3722093 gene locus_tag LOCUS_34700 3722944 3722093 CDS product phosphonatase-like hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084718.1 protein_id gnl|my_center|LOCUS_34700 3724143 3722941 gene locus_tag LOCUS_34710 3724143 3722941 CDS product TIGR03364 family FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813122.1 protein_id gnl|my_center|LOCUS_34710 3725828 3724140 gene locus_tag LOCUS_34720 gene phnE 3725828 3724140 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727091.1 protein_id gnl|my_center|LOCUS_34720 3726739 3725825 gene locus_tag LOCUS_34730 gene phnC 3726739 3725825 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727093.1 protein_id gnl|my_center|LOCUS_34730 3727686 3726727 gene locus_tag LOCUS_34740 3727686 3726727 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892069.1 protein_id gnl|my_center|LOCUS_34740 3727913 3728743 gene locus_tag LOCUS_34750 3727913 3728743 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027387.1 protein_id gnl|my_center|LOCUS_34750 3729586 3728843 gene locus_tag LOCUS_34760 3729586 3728843 CDS product phosphonatase-like hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084718.1 protein_id gnl|my_center|LOCUS_34760 3729739 3731328 gene locus_tag LOCUS_34770 3729739 3731328 CDS product 4-coumarate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728294.1 protein_id gnl|my_center|LOCUS_34770 3731828 3731463 gene locus_tag LOCUS_34780 3731828 3731463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 3732065 3732640 gene locus_tag LOCUS_34790 3732065 3732640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 3732842 3735148 gene locus_tag LOCUS_34800 gene purL 3732842 3735148 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974893.1 protein_id gnl|my_center|LOCUS_34800 3735936 3735310 gene locus_tag LOCUS_34810 3735936 3735310 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031179.1 protein_id gnl|my_center|LOCUS_34810 3736098 3737705 gene locus_tag LOCUS_34820 3736098 3737705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 3737702 3738475 gene locus_tag LOCUS_34830 3737702 3738475 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027733.1 protein_id gnl|my_center|LOCUS_34830 3738503 3739738 gene locus_tag LOCUS_34840 3738503 3739738 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229261.1 protein_id gnl|my_center|LOCUS_34840 3739738 3740838 gene locus_tag LOCUS_34850 3739738 3740838 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027920.1 protein_id gnl|my_center|LOCUS_34850 3740928 3742316 gene locus_tag LOCUS_34860 3740928 3742316 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931161.1 protein_id gnl|my_center|LOCUS_34860 3743473 3742520 gene locus_tag LOCUS_34870 3743473 3742520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 3744429 3743506 gene locus_tag LOCUS_34880 3744429 3743506 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027013.1 protein_id gnl|my_center|LOCUS_34880 3744767 3744426 gene locus_tag LOCUS_34890 3744767 3744426 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976797.1 protein_id gnl|my_center|LOCUS_34890 3745772 3744804 gene locus_tag LOCUS_34900 3745772 3744804 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226734.1 protein_id gnl|my_center|LOCUS_34900 3746488 3745871 gene locus_tag LOCUS_34910 3746488 3745871 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191148287.1 protein_id gnl|my_center|LOCUS_34910 3747905 3746619 gene locus_tag LOCUS_34920 3747905 3746619 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975310.1 protein_id gnl|my_center|LOCUS_34920 3748393 3747908 gene locus_tag LOCUS_34930 3748393 3747908 CDS product DUF3151 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975291.1 protein_id gnl|my_center|LOCUS_34930 3748877 3748503 gene locus_tag LOCUS_34940 3748877 3748503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 3749539 3748907 gene locus_tag LOCUS_34950 3749539 3748907 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041323891.1 protein_id gnl|my_center|LOCUS_34950 3749681 3750910 gene locus_tag LOCUS_34960 3749681 3750910 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285682.1 protein_id gnl|my_center|LOCUS_34960 3750937 3751605 gene locus_tag LOCUS_34970 gene mntR 3750937 3751605 CDS product manganese-binding transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414136.1 protein_id gnl|my_center|LOCUS_34970 3751634 3752434 gene locus_tag LOCUS_34980 3751634 3752434 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893817.1 protein_id gnl|my_center|LOCUS_34980 3753564 3752437 gene locus_tag LOCUS_34990 3753564 3752437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 3754112 3753564 gene locus_tag LOCUS_35000 gene pyrE 3754112 3753564 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029143.1 protein_id gnl|my_center|LOCUS_35000 3754272 3754150 gene locus_tag LOCUS_35010 3754272 3754150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 3754407 3755327 gene locus_tag LOCUS_35020 3754407 3755327 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230607.1 protein_id gnl|my_center|LOCUS_35020 3756626 3755352 gene locus_tag LOCUS_35030 3756626 3755352 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140281.1 protein_id gnl|my_center|LOCUS_35030 3757438 3756623 gene locus_tag LOCUS_35040 3757438 3756623 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339543.1 protein_id gnl|my_center|LOCUS_35040 3758646 3757603 gene locus_tag LOCUS_35050 3758646 3757603 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723135.1 protein_id gnl|my_center|LOCUS_35050 3760303 3758810 gene locus_tag LOCUS_35060 3760303 3758810 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893815.1 protein_id gnl|my_center|LOCUS_35060 3761746 3760418 gene locus_tag LOCUS_35070 3761746 3760418 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893816.1 protein_id gnl|my_center|LOCUS_35070 3762972 3761821 gene locus_tag LOCUS_35080 3762972 3761821 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383812.1 protein_id gnl|my_center|LOCUS_35080 3763790 3763032 gene locus_tag LOCUS_35090 3763790 3763032 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256332.1 protein_id gnl|my_center|LOCUS_35090 3764626 3763808 gene locus_tag LOCUS_35100 3764626 3763808 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240183.1 protein_id gnl|my_center|LOCUS_35100 3765513 3764623 gene locus_tag LOCUS_35110 3765513 3764623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 3766543 3765527 gene locus_tag LOCUS_35120 3766543 3765527 CDS product TIGR03842 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111352.1 protein_id gnl|my_center|LOCUS_35120 3767993 3766560 gene locus_tag LOCUS_35130 gene hydA 3767993 3766560 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895004.1 protein_id gnl|my_center|LOCUS_35130 3768850 3767990 gene locus_tag LOCUS_35140 3768850 3767990 CDS product apolipoprotein acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296600.1 protein_id gnl|my_center|LOCUS_35140 3769002 3770369 gene locus_tag LOCUS_35150 3769002 3770369 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728155.1 protein_id gnl|my_center|LOCUS_35150 3770543 3771538 gene locus_tag LOCUS_35160 3770543 3771538 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729925.1 protein_id gnl|my_center|LOCUS_35160 3771568 3772587 gene locus_tag LOCUS_35170 3771568 3772587 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510662.1 protein_id gnl|my_center|LOCUS_35170 3772578 3773387 gene locus_tag LOCUS_35180 3772578 3773387 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729922.1 protein_id gnl|my_center|LOCUS_35180 3773384 3774370 gene locus_tag LOCUS_35190 gene cofD 3773384 3774370 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222933.1 protein_id gnl|my_center|LOCUS_35190 3775079 3774453 gene locus_tag LOCUS_35200 gene cofC 3775079 3774453 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223625.1 protein_id gnl|my_center|LOCUS_35200 3775668 3775177 gene locus_tag LOCUS_35210 3775668 3775177 CDS product DUF2087 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091313124.1 protein_id gnl|my_center|LOCUS_35210 3775950 3775687 gene locus_tag LOCUS_35220 3775950 3775687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 3776293 3776709 gene locus_tag LOCUS_35230 3776293 3776709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 3777513 3776713 gene locus_tag LOCUS_35240 3777513 3776713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 3778517 3777516 gene locus_tag LOCUS_35250 3778517 3777516 CDS product TIGR03557 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258687.1 protein_id gnl|my_center|LOCUS_35250 3778609 3779445 gene locus_tag LOCUS_35260 3778609 3779445 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078040.1 protein_id gnl|my_center|LOCUS_35260 3779454 3780044 gene locus_tag LOCUS_35270 3779454 3780044 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346204.1 protein_id gnl|my_center|LOCUS_35270 3780775 3780059 gene locus_tag LOCUS_35280 3780775 3780059 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199325.1 protein_id gnl|my_center|LOCUS_35280 3780917 3782104 gene locus_tag LOCUS_35290 gene lhgO 3780917 3782104 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222145.1 protein_id gnl|my_center|LOCUS_35290 3783036 3782116 gene locus_tag LOCUS_35300 3783036 3782116 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993877.1 protein_id gnl|my_center|LOCUS_35300 3783057 3783950 gene locus_tag LOCUS_35310 3783057 3783950 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066517.1 protein_id gnl|my_center|LOCUS_35310 3784068 3788747 gene locus_tag LOCUS_35320 3784068 3788747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 3788820 3789731 gene locus_tag LOCUS_35330 gene mmsB 3788820 3789731 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112425.1 protein_id gnl|my_center|LOCUS_35330 3790603 3789740 gene locus_tag LOCUS_35340 3790603 3789740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 3790697 3791593 gene locus_tag LOCUS_35350 3790697 3791593 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727032.1 protein_id gnl|my_center|LOCUS_35350 3791632 3792669 gene locus_tag LOCUS_35360 3791632 3792669 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049743398.1 protein_id gnl|my_center|LOCUS_35360 3792687 3793613 gene locus_tag LOCUS_35370 3792687 3793613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 3793617 3795644 gene locus_tag LOCUS_35380 gene acs 3793617 3795644 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230537.1 protein_id gnl|my_center|LOCUS_35380 3796017 3795637 gene locus_tag LOCUS_35390 3796017 3795637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 3796280 3797428 gene locus_tag LOCUS_35400 3796280 3797428 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535007.1 protein_id gnl|my_center|LOCUS_35400 3797431 3798777 gene locus_tag LOCUS_35410 3797431 3798777 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166233908.1 protein_id gnl|my_center|LOCUS_35410 3799228 3798791 gene locus_tag LOCUS_35420 3799228 3798791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 3800411 3799509 gene locus_tag LOCUS_35430 3800411 3799509 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727063.1 protein_id gnl|my_center|LOCUS_35430 3800571 3801989 gene locus_tag LOCUS_35440 3800571 3801989 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030556.1 protein_id gnl|my_center|LOCUS_35440 3803401 3803072 gene locus_tag LOCUS_35450 3803401 3803072 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776001.1 protein_id gnl|my_center|LOCUS_35450 3803598 3803413 gene locus_tag LOCUS_35460 3803598 3803413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 3806204 3803886 gene locus_tag LOCUS_35470 3806204 3803886 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776000.1 protein_id gnl|my_center|LOCUS_35470 3807198 3806269 gene locus_tag LOCUS_35480 3807198 3806269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225367.1 protein_id gnl|my_center|LOCUS_35480 3807407 3807195 gene locus_tag LOCUS_35490 3807407 3807195 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775998.1 protein_id gnl|my_center|LOCUS_35490 3807555 3808994 gene locus_tag LOCUS_35500 3807555 3808994 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063688.1 protein_id gnl|my_center|LOCUS_35500 3809332 3809802 gene locus_tag LOCUS_35510 3809332 3809802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 3809783 3810109 gene locus_tag LOCUS_35520 3809783 3810109 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776996.1 protein_id gnl|my_center|LOCUS_35520 3810212 3810436 gene locus_tag LOCUS_35530 3810212 3810436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 3810912 3810349 gene locus_tag LOCUS_35540 3810912 3810349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 3811062 3811550 gene locus_tag LOCUS_35550 3811062 3811550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 3811674 3811919 gene locus_tag LOCUS_35560 3811674 3811919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 3812769 3812014 gene locus_tag LOCUS_35570 3812769 3812014 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113309.1 protein_id gnl|my_center|LOCUS_35570 3814167 3812779 gene locus_tag LOCUS_35580 3814167 3812779 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948160.1 protein_id gnl|my_center|LOCUS_35580 3814421 3815821 gene locus_tag LOCUS_35590 3814421 3815821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 3815830 3816480 gene locus_tag LOCUS_35600 3815830 3816480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 3816555 3817925 gene locus_tag LOCUS_35610 3816555 3817925 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975443.1 protein_id gnl|my_center|LOCUS_35610 3817922 3818629 gene locus_tag LOCUS_35620 3817922 3818629 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230966.1 protein_id gnl|my_center|LOCUS_35620 3818731 3819615 gene locus_tag LOCUS_35630 3818731 3819615 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223991.1 protein_id gnl|my_center|LOCUS_35630 3819612 3820724 gene locus_tag LOCUS_35640 3819612 3820724 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230150.1 protein_id gnl|my_center|LOCUS_35640 3820800 3821684 gene locus_tag LOCUS_35650 3820800 3821684 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230149.1 protein_id gnl|my_center|LOCUS_35650 3821681 3822790 gene locus_tag LOCUS_35660 3821681 3822790 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086674640.1 protein_id gnl|my_center|LOCUS_35660 3822967 3822858 gene locus_tag LOCUS_r00100 3822967 3822858 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3823238 3823128 gene locus_tag LOCUS_r00110 3823238 3823128 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3826491 3823371 gene locus_tag LOCUS_r00120 3826491 3823371 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3828463 3826932 gene locus_tag LOCUS_r00130 3828463 3826932 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3829414 3830484 gene locus_tag LOCUS_35670 3829414 3830484 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027566.1 protein_id gnl|my_center|LOCUS_35670 3830481 3832169 gene locus_tag LOCUS_35680 3830481 3832169 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188700193.1 protein_id gnl|my_center|LOCUS_35680 3832274 3832879 gene locus_tag LOCUS_35690 3832274 3832879 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382970.1 protein_id gnl|my_center|LOCUS_35690 3833356 3832886 gene locus_tag LOCUS_35700 3833356 3832886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 3834455 3833406 gene locus_tag LOCUS_35710 3834455 3833406 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225577.1 protein_id gnl|my_center|LOCUS_35710 3836694 3834508 gene locus_tag LOCUS_35720 gene clpB 3836694 3834508 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975278.1 protein_id gnl|my_center|LOCUS_35720 3836843 3840199 gene locus_tag LOCUS_35730 3836843 3840199 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111768112.1 protein_id gnl|my_center|LOCUS_35730 3840668 3840252 gene locus_tag LOCUS_35740 3840668 3840252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 3840844 3842238 gene locus_tag LOCUS_35750 3840844 3842238 CDS product IS1380-like element ISCgl4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015202.1 protein_id gnl|my_center|LOCUS_35750 3842515 3842721 gene locus_tag LOCUS_35760 3842515 3842721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 3842869 3843465 gene locus_tag LOCUS_35770 3842869 3843465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 3843986 3843744 gene locus_tag LOCUS_35780 3843986 3843744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 3844823 3844074 gene locus_tag LOCUS_35790 gene istB 3844823 3844074 CDS product IS21-like element ISFK1 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090937.1 protein_id gnl|my_center|LOCUS_35790 3846373 3844820 gene locus_tag LOCUS_35800 gene istA 3846373 3844820 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015262274.1 protein_id gnl|my_center|LOCUS_35800 3846778 3846572 gene locus_tag LOCUS_35810 3846778 3846572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 3847405 3847902 gene locus_tag LOCUS_35820 3847405 3847902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 3848262 3847891 gene locus_tag LOCUS_35830 3848262 3847891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 3848371 3848706 gene locus_tag LOCUS_35840 3848371 3848706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 3848703 3849686 gene locus_tag LOCUS_35850 3848703 3849686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 3849683 3851536 gene locus_tag LOCUS_35860 3849683 3851536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 3851895 3851811 gene locus_tag LOCUS_t00390 3851895 3851811 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3852108 3852833 gene locus_tag LOCUS_35870 3852108 3852833 CDS product DUF3662 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068566.1 protein_id gnl|my_center|LOCUS_35870 3852830 3853408 gene locus_tag LOCUS_35880 3852830 3853408 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776669.1 protein_id gnl|my_center|LOCUS_35880 3853414 3854640 gene locus_tag LOCUS_35890 3853414 3854640 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776670.1 protein_id gnl|my_center|LOCUS_35890 3854696 3856027 gene locus_tag LOCUS_35900 3854696 3856027 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776671.1 protein_id gnl|my_center|LOCUS_35900 3856027 3857478 gene locus_tag LOCUS_35910 3856027 3857478 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776672.1 protein_id gnl|my_center|LOCUS_35910 3857475 3859178 gene locus_tag LOCUS_35920 3857475 3859178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 3859246 3860943 gene locus_tag LOCUS_35930 gene pknB 3859246 3860943 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112820.1 protein_id gnl|my_center|LOCUS_35930 3861615 3860977 gene locus_tag LOCUS_35940 3861615 3860977 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811402.1 protein_id gnl|my_center|LOCUS_35940 3861773 3861615 gene locus_tag LOCUS_35950 3861773 3861615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 3862529 3861783 gene locus_tag LOCUS_35960 3862529 3861783 CDS product class E sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776677.1 protein_id gnl|my_center|LOCUS_35960 3862635 3862949 gene locus_tag LOCUS_35970 3862635 3862949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 3863763 3863062 gene locus_tag LOCUS_35980 3863763 3863062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 3864468 3863929 gene locus_tag LOCUS_35990 3864468 3863929 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975078.1 protein_id gnl|my_center|LOCUS_35990 3864580 3865107 gene locus_tag LOCUS_36000 3864580 3865107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 3865336 3865263 gene locus_tag LOCUS_t00400 3865336 3865263 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3865440 3865366 gene locus_tag LOCUS_t00410 3865440 3865366 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 3865941 3865537 gene locus_tag LOCUS_36010 3865941 3865537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 3868531 3865934 gene locus_tag LOCUS_36020 gene gyrA 3868531 3865934 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326690.1 protein_id gnl|my_center|LOCUS_36020 3870359 3868521 gene locus_tag LOCUS_36030 gene gyrB 3870359 3868521 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803673.1 protein_id gnl|my_center|LOCUS_36030 3871140 3870619 gene locus_tag LOCUS_36040 3871140 3870619 CDS product DciA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221959.1 protein_id gnl|my_center|LOCUS_36040 3872347 3871133 gene locus_tag LOCUS_36050 gene recF 3872347 3871133 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221958.1 protein_id gnl|my_center|LOCUS_36050 3873241 3872354 gene locus_tag LOCUS_36060 gene gnd 3873241 3872354 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221957.1 protein_id gnl|my_center|LOCUS_36060 3874415 3873267 gene locus_tag LOCUS_36070 gene dnaN 3874415 3873267 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803666.1 protein_id gnl|my_center|LOCUS_36070 3876209 3874791 gene locus_tag LOCUS_36080 3876209 3874791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 3876548 3876685 gene locus_tag LOCUS_36090 gene rpmH 3876548 3876685 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975051.1 protein_id gnl|my_center|LOCUS_36090 3877085 3877396 gene locus_tag LOCUS_36100 3877085 3877396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 3877405 3878379 gene locus_tag LOCUS_36110 gene yidC 3877405 3878379 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777156.1 protein_id gnl|my_center|LOCUS_36110 3878394 3878993 gene locus_tag LOCUS_36120 3878394 3878993 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777155.1 protein_id gnl|my_center|LOCUS_36120 3879176 3879631 gene locus_tag LOCUS_36130 3879176 3879631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 3879676 3880614 gene locus_tag LOCUS_36140 gene parA 3879676 3880614 CDS product chromosome partitioning ATPase ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731642.1 protein_id gnl|my_center|LOCUS_36140 3880614 3881576 gene locus_tag LOCUS_36150 3880614 3881576 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231063.1 protein_id gnl|my_center|LOCUS_36150 3882540 3882854 gene locus_tag LOCUS_36160 3882540 3882854 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089378.1 protein_id gnl|my_center|LOCUS_36160 3884479 3883487 gene locus_tag LOCUS_36170 3884479 3883487 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231062.1 protein_id gnl|my_center|LOCUS_36170 3885840 3884521 gene locus_tag LOCUS_36180 3885840 3884521 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231061.1 protein_id gnl|my_center|LOCUS_36180 3886286 3885963 gene locus_tag LOCUS_36190 gene trxA 3886286 3885963 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975042.1 protein_id gnl|my_center|LOCUS_36190 3887271 3886297 gene locus_tag LOCUS_36200 gene trxB 3887271 3886297 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975041.1 protein_id gnl|my_center|LOCUS_36200 3889059 3887428 gene locus_tag LOCUS_36210 3889059 3887428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 3891259 3889052 gene locus_tag LOCUS_36220 3891259 3889052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 3891409 3892842 gene locus_tag LOCUS_36230 3891409 3892842 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930081.1 protein_id gnl|my_center|LOCUS_36230 3893122 3893769 gene locus_tag LOCUS_36240 3893122 3893769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 3893773 3894285 gene locus_tag LOCUS_36250 3893773 3894285 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898320.1 protein_id gnl|my_center|LOCUS_36250 3894351 3894614 gene locus_tag LOCUS_36260 gene rpsR 3894351 3894614 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004105399.1 protein_id gnl|my_center|LOCUS_36260 3894626 3895075 gene locus_tag LOCUS_36270 gene rplI 3894626 3895075 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975023.1 protein_id gnl|my_center|LOCUS_36270 3895489 3896862 gene locus_tag LOCUS_36280 gene dnaB 3895489 3896862 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975021.1 protein_id gnl|my_center|LOCUS_36280 3897008 3898147 gene locus_tag LOCUS_36290 3897008 3898147 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404932.1 protein_id gnl|my_center|LOCUS_36290 3898248 3898877 gene locus_tag LOCUS_36300 3898248 3898877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 3898874 3899125 gene locus_tag LOCUS_36310 3898874 3899125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 3900607 3899225 gene locus_tag LOCUS_36320 gene purB 3900607 3899225 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776538.1 protein_id gnl|my_center|LOCUS_36320 3901047 3900604 gene locus_tag LOCUS_36330 3901047 3900604 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975011.1 protein_id gnl|my_center|LOCUS_36330 3901257 3901541 gene locus_tag LOCUS_36340 3901257 3901541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 3901538 3903010 gene locus_tag LOCUS_36350 3901538 3903010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 3903386 3902994 gene locus_tag LOCUS_36360 3903386 3902994 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975010.1 protein_id gnl|my_center|LOCUS_36360 3903473 3904579 gene locus_tag LOCUS_36370 gene hisC 3903473 3904579 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029330.1 protein_id gnl|my_center|LOCUS_36370 3904584 3905729 gene locus_tag LOCUS_36380 gene pdhA 3904584 3905729 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112796.1 protein_id gnl|my_center|LOCUS_36380 3905729 3906772 gene locus_tag LOCUS_36390 3905729 3906772 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326663.1 protein_id gnl|my_center|LOCUS_36390 3906814 3908169 gene locus_tag LOCUS_36400 3906814 3908169 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029246.1 protein_id gnl|my_center|LOCUS_36400 3908251 3909954 gene locus_tag LOCUS_36410 3908251 3909954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776875.1 protein_id gnl|my_center|LOCUS_36410 3910034 3911071 gene locus_tag LOCUS_36420 3910034 3911071 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391451.1 protein_id gnl|my_center|LOCUS_36420 3911079 3911870 gene locus_tag LOCUS_36430 3911079 3911870 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399558.1 protein_id gnl|my_center|LOCUS_36430 3911872 3912756 gene locus_tag LOCUS_36440 3911872 3912756 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111894.1 protein_id gnl|my_center|LOCUS_36440 3912756 3913562 gene locus_tag LOCUS_36450 gene troC 3912756 3913562 CDS product transition metal ABC transporter permease subunit TroC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677722.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36450 3913541 3913960 gene locus_tag LOCUS_36460 3913541 3913960 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007449657.1 protein_id gnl|my_center|LOCUS_36460 3914113 3916983 gene locus_tag LOCUS_36470 3914113 3916983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 3917161 3917397 gene locus_tag LOCUS_36480 gene rpmB 3917161 3917397 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731012.1 protein_id gnl|my_center|LOCUS_36480 3917397 3917564 gene locus_tag LOCUS_36490 gene rpmG 3917397 3917564 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226831.1 protein_id gnl|my_center|LOCUS_36490 3917567 3917872 gene locus_tag LOCUS_36500 gene rpsN 3917567 3917872 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897467.1 protein_id gnl|my_center|LOCUS_36500 3918254 3918541 gene locus_tag LOCUS_36510 3918254 3918541 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003950507.1 protein_id gnl|my_center|LOCUS_36510 3918681 3920654 gene locus_tag LOCUS_36520 3918681 3920654 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878112.1 protein_id gnl|my_center|LOCUS_36520 3922187 3920721 gene locus_tag LOCUS_36530 3922187 3920721 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092091.1 protein_id gnl|my_center|LOCUS_36530 3923534 3922545 gene locus_tag LOCUS_36540 3923534 3922545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 3923653 3924360 gene locus_tag LOCUS_36550 3923653 3924360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 3924453 3925778 gene locus_tag LOCUS_36560 3924453 3925778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 3926396 3925842 gene locus_tag LOCUS_36570 3926396 3925842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 3926838 3926428 gene locus_tag LOCUS_36580 3926838 3926428 CDS product DUF4383 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466936.1 protein_id gnl|my_center|LOCUS_36580 3927050 3928315 gene locus_tag LOCUS_36590 3927050 3928315 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112974.1 protein_id gnl|my_center|LOCUS_36590 3928611 3928345 gene locus_tag LOCUS_36600 3928611 3928345 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225295.1 protein_id gnl|my_center|LOCUS_36600 3928671 3928856 gene locus_tag LOCUS_36610 3928671 3928856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 3929033 3930355 gene locus_tag LOCUS_36620 3929033 3930355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 3931835 3930453 gene locus_tag LOCUS_36630 3931835 3930453 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729530.1 protein_id gnl|my_center|LOCUS_36630 3933071 3931875 gene locus_tag LOCUS_36640 3933071 3931875 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731461.1 protein_id gnl|my_center|LOCUS_36640 3934643 3933135 gene locus_tag LOCUS_36650 3934643 3933135 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227765.1 protein_id gnl|my_center|LOCUS_36650 3935794 3934640 gene locus_tag LOCUS_36660 gene gabT 3935794 3934640 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112244.1 protein_id gnl|my_center|LOCUS_36660 3935732 3936100 gene locus_tag LOCUS_36670 3935732 3936100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 3936129 3937643 gene locus_tag LOCUS_36680 3936129 3937643 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892001.1 protein_id gnl|my_center|LOCUS_36680 3938848 3937646 gene locus_tag LOCUS_36690 3938848 3937646 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226683.1 protein_id gnl|my_center|LOCUS_36690 3939905 3939054 gene locus_tag LOCUS_36700 3939905 3939054 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096618.1 protein_id gnl|my_center|LOCUS_36700 3940162 3941316 gene locus_tag LOCUS_36710 3940162 3941316 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063775.1 protein_id gnl|my_center|LOCUS_36710 3941316 3941621 gene locus_tag LOCUS_36720 3941316 3941621 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909006.1 protein_id gnl|my_center|LOCUS_36720 3941618 3942991 gene locus_tag LOCUS_36730 3941618 3942991 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056543.1 protein_id gnl|my_center|LOCUS_36730 3943093 3943614 gene locus_tag LOCUS_36740 3943093 3943614 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111272.1 protein_id gnl|my_center|LOCUS_36740 3944009 3943617 gene locus_tag LOCUS_36750 3944009 3943617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 3944030 3944653 gene locus_tag LOCUS_36760 3944030 3944653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 3944640 3945092 gene locus_tag LOCUS_36770 3944640 3945092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 3945185 3945835 gene locus_tag LOCUS_36780 3945185 3945835 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530118.1 protein_id gnl|my_center|LOCUS_36780 3948308 3946314 gene locus_tag LOCUS_36790 3948308 3946314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 3949378 3948305 gene locus_tag LOCUS_36800 3949378 3948305 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104311.1 protein_id gnl|my_center|LOCUS_36800 3951435 3949378 gene locus_tag LOCUS_36810 3951435 3949378 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_079184950.1 protein_id gnl|my_center|LOCUS_36810 3952195 3951437 gene locus_tag LOCUS_36820 3952195 3951437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 3952303 3952728 gene locus_tag LOCUS_36830 3952303 3952728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 3953820 3955232 gene locus_tag LOCUS_36840 3953820 3955232 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144956692.1 protein_id gnl|my_center|LOCUS_36840 3955229 3956041 gene locus_tag LOCUS_36850 3955229 3956041 CDS product ExeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899491.1 protein_id gnl|my_center|LOCUS_36850 3956685 3956341 gene locus_tag LOCUS_36860 3956685 3956341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 3957642 3956734 gene locus_tag LOCUS_36870 3957642 3956734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 3957821 3957639 gene locus_tag LOCUS_36880 3957821 3957639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 3958210 3958485 gene locus_tag LOCUS_36890 3958210 3958485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 3959183 3961798 gene locus_tag LOCUS_36900 3959183 3961798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 3962366 3961839 gene locus_tag LOCUS_36910 3962366 3961839 CDS product mismatch-specific DNA-glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966411.1 protein_id gnl|my_center|LOCUS_36910 3962935 3962552 gene locus_tag LOCUS_36920 3962935 3962552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 3963352 3963699 gene locus_tag LOCUS_36930 3963352 3963699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 3963923 3964498 gene locus_tag LOCUS_36940 3963923 3964498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 3964508 3964981 gene locus_tag LOCUS_36950 3964508 3964981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 3967238 3965421 gene locus_tag LOCUS_36960 3967238 3965421 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023602.1 protein_id gnl|my_center|LOCUS_36960 3968475 3968113 gene locus_tag LOCUS_36970 3968475 3968113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36970 3968748 3969359 gene locus_tag LOCUS_36980 3968748 3969359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 3969430 3969936 gene locus_tag LOCUS_36990 3969430 3969936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 3970216 3970695 gene locus_tag LOCUS_37000 3970216 3970695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37000 3970748 3972805 gene locus_tag LOCUS_37010 3970748 3972805 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028768.1 protein_id gnl|my_center|LOCUS_37010 3973046 3974014 gene locus_tag LOCUS_37020 3973046 3974014 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463764.1 protein_id gnl|my_center|LOCUS_37020 3974201 3976150 gene locus_tag LOCUS_37030 3974201 3976150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 3976150 3977571 gene locus_tag LOCUS_37040 3976150 3977571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 3977552 3980503 gene locus_tag LOCUS_37050 3977552 3980503 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114402.1 protein_id gnl|my_center|LOCUS_37050 3980825 3980752 gene locus_tag LOCUS_t00420 3980825 3980752 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3980897 3981493 gene locus_tag LOCUS_37060 gene dcd 3980897 3981493 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975261.1 protein_id gnl|my_center|LOCUS_37060 3981685 3982209 gene locus_tag LOCUS_37070 3981685 3982209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966118.1 protein_id gnl|my_center|LOCUS_37070 3983122 3982322 gene locus_tag LOCUS_37080 3983122 3982322 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529940.1 protein_id gnl|my_center|LOCUS_37080 3984635 3983316 gene locus_tag LOCUS_37090 3984635 3983316 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015250.1 protein_id gnl|my_center|LOCUS_37090 3985577 3984753 gene locus_tag LOCUS_37100 3985577 3984753 CDS product RIO kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223947.1 protein_id gnl|my_center|LOCUS_37100 3986999 3985773 gene locus_tag LOCUS_37110 gene chrA 3986999 3985773 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972738.1 protein_id gnl|my_center|LOCUS_37110 3987255 3989129 gene locus_tag LOCUS_37120 gene dnaK 3987255 3989129 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051640.1 protein_id gnl|my_center|LOCUS_37120 3989138 3989809 gene locus_tag LOCUS_37130 3989138 3989809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 3989802 3990809 gene locus_tag LOCUS_37140 3989802 3990809 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804832.1 protein_id gnl|my_center|LOCUS_37140 3990812 3991228 gene locus_tag LOCUS_37150 3990812 3991228 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804833.1 protein_id gnl|my_center|LOCUS_37150 3991283 3992449 gene locus_tag LOCUS_37160 3991283 3992449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 3994037 3992493 gene locus_tag LOCUS_37170 3994037 3992493 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727782.1 protein_id gnl|my_center|LOCUS_37170 3994975 3994055 gene locus_tag LOCUS_37180 3994975 3994055 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727781.1 protein_id gnl|my_center|LOCUS_37180 3997002 3994972 gene locus_tag LOCUS_37190 3997002 3994972 CDS product primary-amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085810.1 protein_id gnl|my_center|LOCUS_37190 3998415 3997108 gene locus_tag LOCUS_37200 3998415 3997108 CDS product glycosyltransferase family 87 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326026.1 protein_id gnl|my_center|LOCUS_37200 3998381 3998605 gene locus_tag LOCUS_37210 3998381 3998605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 3999123 3998551 gene locus_tag LOCUS_37220 3999123 3998551 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776019.1 protein_id gnl|my_center|LOCUS_37220 3999313 3999128 gene locus_tag LOCUS_37230 3999313 3999128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 4000677 3999283 gene locus_tag LOCUS_37240 4000677 3999283 CDS product IS1380-like element ISCgl4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015202.1 protein_id gnl|my_center|LOCUS_37240 4000863 4001090 gene locus_tag LOCUS_37250 4000863 4001090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 4002044 4003660 gene locus_tag LOCUS_37260 4002044 4003660 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113373.1 protein_id gnl|my_center|LOCUS_37260 4003905 4003723 gene locus_tag LOCUS_37270 4003905 4003723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 4004682 4003936 gene locus_tag LOCUS_37280 4004682 4003936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 4004815 4006365 gene locus_tag LOCUS_37290 gene istA 4004815 4006365 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015262274.1 protein_id gnl|my_center|LOCUS_37290 4006362 4007111 gene locus_tag LOCUS_37300 gene istB 4006362 4007111 CDS product IS21-like element ISFK1 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090937.1 protein_id gnl|my_center|LOCUS_37300 4007481 4007221 gene locus_tag LOCUS_37310 4007481 4007221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 4007565 4008119 gene locus_tag LOCUS_37320 4007565 4008119 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892919.1 protein_id gnl|my_center|LOCUS_37320 4008175 4009410 gene locus_tag LOCUS_37330 4008175 4009410 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104410.1 protein_id gnl|my_center|LOCUS_37330 4009458 4010456 gene locus_tag LOCUS_37340 4009458 4010456 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270038.1 protein_id gnl|my_center|LOCUS_37340 4010861 4010463 gene locus_tag LOCUS_37350 4010861 4010463 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031756.1 protein_id gnl|my_center|LOCUS_37350 4012286 4010886 gene locus_tag LOCUS_37360 4012286 4010886 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728383.1 protein_id gnl|my_center|LOCUS_37360 4012406 4013680 gene locus_tag LOCUS_37370 4012406 4013680 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229620.1 protein_id gnl|my_center|LOCUS_37370 4013730 4016663 gene locus_tag LOCUS_37380 4013730 4016663 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228786.1 protein_id gnl|my_center|LOCUS_37380 4016660 4018135 gene locus_tag LOCUS_37390 4016660 4018135 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031393.1 protein_id gnl|my_center|LOCUS_37390 4018176 4018871 gene locus_tag LOCUS_37400 4018176 4018871 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229616.1 protein_id gnl|my_center|LOCUS_37400 4018952 4020139 gene locus_tag LOCUS_37410 4018952 4020139 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728381.1 protein_id gnl|my_center|LOCUS_37410 4020136 4021347 gene locus_tag LOCUS_37420 4020136 4021347 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893854.1 protein_id gnl|my_center|LOCUS_37420 4021344 4022552 gene locus_tag LOCUS_37430 4021344 4022552 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728380.1 protein_id gnl|my_center|LOCUS_37430 4022549 4023520 gene locus_tag LOCUS_37440 4022549 4023520 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229613.1 protein_id gnl|my_center|LOCUS_37440 4024249 4023521 gene locus_tag LOCUS_37450 4024249 4023521 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877404.1 protein_id gnl|my_center|LOCUS_37450 4024416 4025303 gene locus_tag LOCUS_37460 gene ehuB 4024416 4025303 CDS product ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729149.1 protein_id gnl|my_center|LOCUS_37460 4025393 4026091 gene locus_tag LOCUS_37470 gene ehuC 4025393 4026091 CDS product ectoine/hydroxyectoine ABC transporter permease subunit EhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729150.1 protein_id gnl|my_center|LOCUS_37470 4026088 4026747 gene locus_tag LOCUS_37480 gene ehuD 4026088 4026747 CDS product ectoine/hydroxyectoine ABC transporter permease subunit EhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729151.1 protein_id gnl|my_center|LOCUS_37480 4026731 4027546 gene locus_tag LOCUS_37490 gene ehuA 4026731 4027546 CDS product ectoine/hydroxyectoine ABC transporter ATP-binding protein EhuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895001.1 protein_id gnl|my_center|LOCUS_37490 4028310 4027543 gene locus_tag LOCUS_37500 4028310 4027543 CDS product Asp/Glu/hydantoin racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893856.1 protein_id gnl|my_center|LOCUS_37500 4028424 4028930 gene locus_tag LOCUS_37510 4028424 4028930 CDS product DUF3830 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893859.1 protein_id gnl|my_center|LOCUS_37510 4029554 4028934 gene locus_tag LOCUS_37520 4029554 4028934 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894347.1 protein_id gnl|my_center|LOCUS_37520 4029952 4029641 gene locus_tag LOCUS_37530 4029952 4029641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775780.1 protein_id gnl|my_center|LOCUS_37530 4030744 4030034 gene locus_tag LOCUS_37540 4030744 4030034 CDS product EI24 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028326.1 protein_id gnl|my_center|LOCUS_37540 4030965 4031609 gene locus_tag LOCUS_37550 4030965 4031609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 4033111 4031612 gene locus_tag LOCUS_37560 4033111 4031612 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060486261.1 protein_id gnl|my_center|LOCUS_37560 4034124 4033189 gene locus_tag LOCUS_37570 4034124 4033189 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328117.1 protein_id gnl|my_center|LOCUS_37570 4034212 4035102 gene locus_tag LOCUS_37580 4034212 4035102 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228552.1 protein_id gnl|my_center|LOCUS_37580 4037579 4035078 gene locus_tag LOCUS_37590 4037579 4035078 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462788.1 protein_id gnl|my_center|LOCUS_37590 4037726 4038565 gene locus_tag LOCUS_37600 4037726 4038565 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405636.1 protein_id gnl|my_center|LOCUS_37600 4040274 4038607 gene locus_tag LOCUS_37610 4040274 4038607 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188488774.1 protein_id gnl|my_center|LOCUS_37610 4041572 4040340 gene locus_tag LOCUS_37620 4041572 4040340 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776991.1 protein_id gnl|my_center|LOCUS_37620 4043712 4041610 gene locus_tag LOCUS_37630 4043712 4041610 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224500.1 protein_id gnl|my_center|LOCUS_37630 4044528 4043824 gene locus_tag LOCUS_37640 4044528 4043824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 4044695 4045132 gene locus_tag LOCUS_37650 4044695 4045132 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013845.1 protein_id gnl|my_center|LOCUS_37650 4046059 4045166 gene locus_tag LOCUS_37660 4046059 4045166 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768450.1 protein_id gnl|my_center|LOCUS_37660 4047295 4046081 gene locus_tag LOCUS_37670 4047295 4046081 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104714.1 protein_id gnl|my_center|LOCUS_37670 4048722 4047292 gene locus_tag LOCUS_37680 4048722 4047292 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877503.1 protein_id gnl|my_center|LOCUS_37680 4049409 4048744 gene locus_tag LOCUS_37690 4049409 4048744 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769429.1 protein_id gnl|my_center|LOCUS_37690 4050181 4049402 gene locus_tag LOCUS_37700 4050181 4049402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 4051817 4050387 gene locus_tag LOCUS_37710 4051817 4050387 CDS product DUF2079 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929884.1 protein_id gnl|my_center|LOCUS_37710 4052099 4052839 gene locus_tag LOCUS_37720 4052099 4052839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 4052766 4053623 gene locus_tag LOCUS_37730 4052766 4053623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 4053853 4054023 gene locus_tag LOCUS_37740 4053853 4054023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37740 4054604 4054035 gene locus_tag LOCUS_37750 4054604 4054035 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391513.1 protein_id gnl|my_center|LOCUS_37750 4054995 4054627 gene locus_tag LOCUS_37760 4054995 4054627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 4055760 4057151 gene locus_tag LOCUS_37770 4055760 4057151 CDS product IS1380-like element ISCgl4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015202.1 protein_id gnl|my_center|LOCUS_37770 4058340 4057288 gene locus_tag LOCUS_37780 4058340 4057288 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804802.1 protein_id gnl|my_center|LOCUS_37780 4059372 4058563 gene locus_tag LOCUS_37790 4059372 4058563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 4059914 4059534 gene locus_tag LOCUS_37800 4059914 4059534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 4060114 4060644 gene locus_tag LOCUS_37810 4060114 4060644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030585.1 protein_id gnl|my_center|LOCUS_37810 4060641 4061018 gene locus_tag LOCUS_37820 4060641 4061018 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228235.1 protein_id gnl|my_center|LOCUS_37820 4061118 4062089 gene locus_tag LOCUS_37830 4061118 4062089 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399225.1 protein_id gnl|my_center|LOCUS_37830 4062928 4062107 gene locus_tag LOCUS_37840 4062928 4062107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 4063022 4063624 gene locus_tag LOCUS_37850 gene hxlB 4063022 4063624 CDS product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065105.1 protein_id gnl|my_center|LOCUS_37850 4063677 4064300 gene locus_tag LOCUS_37860 4063677 4064300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 4065160 4064492 gene locus_tag LOCUS_37870 4065160 4064492 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027441.1 protein_id gnl|my_center|LOCUS_37870 4065282 4066217 gene locus_tag LOCUS_37880 4065282 4066217 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674948.1 protein_id gnl|my_center|LOCUS_37880 4066912 4066214 gene locus_tag LOCUS_37890 gene nucS 4066912 4066214 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775934.1 protein_id gnl|my_center|LOCUS_37890 4067313 4066933 gene locus_tag LOCUS_37900 4067313 4066933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 4067781 4067539 gene locus_tag LOCUS_37910 4067781 4067539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 4069124 4067901 gene locus_tag LOCUS_37920 4069124 4067901 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217437.1 protein_id gnl|my_center|LOCUS_37920 4069292 4070332 gene locus_tag LOCUS_37930 4069292 4070332 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729221.1 protein_id gnl|my_center|LOCUS_37930 4070574 4072151 gene locus_tag LOCUS_37940 4070574 4072151 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729220.1 protein_id gnl|my_center|LOCUS_37940 4072148 4073308 gene locus_tag LOCUS_37950 4072148 4073308 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405115.1 protein_id gnl|my_center|LOCUS_37950 4074876 4073515 gene locus_tag LOCUS_37960 4074876 4073515 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803932.1 protein_id gnl|my_center|LOCUS_37960 4074918 4075430 gene locus_tag LOCUS_37970 4074918 4075430 CDS product DUF664 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224874.1 protein_id gnl|my_center|LOCUS_37970 4075631 4075320 gene locus_tag LOCUS_37980 4075631 4075320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 4075566 4077530 gene locus_tag LOCUS_37990 4075566 4077530 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726765.1 protein_id gnl|my_center|LOCUS_37990 4077604 4078512 gene locus_tag LOCUS_38000 4077604 4078512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 4078567 4078971 gene locus_tag LOCUS_38010 4078567 4078971 CDS product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084102.1 protein_id gnl|my_center|LOCUS_38010 4079285 4078968 gene locus_tag LOCUS_38020 4079285 4078968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 4079719 4079288 gene locus_tag LOCUS_38030 4079719 4079288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 4080881 4079766 gene locus_tag LOCUS_38040 4080881 4079766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 4082115 4081168 gene locus_tag LOCUS_38050 4082115 4081168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 4082272 4082748 gene locus_tag LOCUS_38060 4082272 4082748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060 4083801 4082773 gene locus_tag LOCUS_38070 4083801 4082773 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729196.1 protein_id gnl|my_center|LOCUS_38070 4084671 4083859 gene locus_tag LOCUS_38080 4084671 4083859 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226344.1 protein_id gnl|my_center|LOCUS_38080 4084816 4086189 gene locus_tag LOCUS_38090 4084816 4086189 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896979.1 protein_id gnl|my_center|LOCUS_38090 4086304 4087299 gene locus_tag LOCUS_38100 4086304 4087299 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222784.1 protein_id gnl|my_center|LOCUS_38100 4087296 4088171 gene locus_tag LOCUS_38110 4087296 4088171 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896977.1 protein_id gnl|my_center|LOCUS_38110 4088228 4089031 gene locus_tag LOCUS_38120 4088228 4089031 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226344.1 protein_id gnl|my_center|LOCUS_38120 4089028 4089747 gene locus_tag LOCUS_38130 4089028 4089747 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727842.1 protein_id gnl|my_center|LOCUS_38130 4089731 4091251 gene locus_tag LOCUS_38140 4089731 4091251 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013396.1 protein_id gnl|my_center|LOCUS_38140 4091284 4092687 gene locus_tag LOCUS_38150 gene xylB 4091284 4092687 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222654.1 protein_id gnl|my_center|LOCUS_38150 4093800 4092802 gene locus_tag LOCUS_38160 4093800 4092802 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325683.1 protein_id gnl|my_center|LOCUS_38160 4094731 4093994 gene locus_tag LOCUS_38170 4094731 4093994 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775799.1 protein_id gnl|my_center|LOCUS_38170 4095023 4094814 gene locus_tag LOCUS_38180 4095023 4094814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 4097305 4095023 gene locus_tag LOCUS_38190 4097305 4095023 CDS product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084321.1 protein_id gnl|my_center|LOCUS_38190 4097442 4098827 gene locus_tag LOCUS_38200 4097442 4098827 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729870.1 protein_id gnl|my_center|LOCUS_38200 4099984 4098926 gene locus_tag LOCUS_38210 4099984 4098926 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972097.1 protein_id gnl|my_center|LOCUS_38210 4100873 4099989 gene locus_tag LOCUS_38220 4100873 4099989 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031770.1 protein_id gnl|my_center|LOCUS_38220 4102217 4100907 gene locus_tag LOCUS_38230 4102217 4100907 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226490.1 protein_id gnl|my_center|LOCUS_38230 4102360 4104213 gene locus_tag LOCUS_38240 4102360 4104213 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226492.1 protein_id gnl|my_center|LOCUS_38240 4104215 4105243 gene locus_tag LOCUS_38250 4104215 4105243 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226493.1 protein_id gnl|my_center|LOCUS_38250 4105240 4106151 gene locus_tag LOCUS_38260 4105240 4106151 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226494.1 protein_id gnl|my_center|LOCUS_38260 4106151 4107788 gene locus_tag LOCUS_38270 4106151 4107788 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226495.1 protein_id gnl|my_center|LOCUS_38270 4107785 4108720 gene locus_tag LOCUS_38280 4107785 4108720 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863161.1 protein_id gnl|my_center|LOCUS_38280 4108717 4109790 gene locus_tag LOCUS_38290 4108717 4109790 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776031.1 protein_id gnl|my_center|LOCUS_38290 4110960 4109866 gene locus_tag LOCUS_38300 gene ykfB 4110960 4109866 CDS product L-Ala-D/L-Glu epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244980.1 protein_id gnl|my_center|LOCUS_38300 4111537 4110962 gene locus_tag LOCUS_38310 4111537 4110962 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228061.1 protein_id gnl|my_center|LOCUS_38310 4113087 4111714 gene locus_tag LOCUS_38320 4113087 4111714 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727309.1 protein_id gnl|my_center|LOCUS_38320 4113160 4114269 gene locus_tag LOCUS_38330 gene hemE 4113160 4114269 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224512.1 protein_id gnl|my_center|LOCUS_38330 4114437 4115921 gene locus_tag LOCUS_38340 gene hemG 4114437 4115921 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776652.1 protein_id gnl|my_center|LOCUS_38340 4116031 4116408 gene locus_tag LOCUS_38350 4116031 4116408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 4116549 4116965 gene locus_tag LOCUS_38360 4116549 4116965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 4116955 4117251 gene locus_tag LOCUS_38370 4116955 4117251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38370 4117331 4118083 gene locus_tag LOCUS_38380 4117331 4118083 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972879.1 protein_id gnl|my_center|LOCUS_38380 4118083 4119177 gene locus_tag LOCUS_38390 4118083 4119177 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776654.1 protein_id gnl|my_center|LOCUS_38390 4119174 4120127 gene locus_tag LOCUS_38400 gene hemC 4119174 4120127 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975518.1 protein_id gnl|my_center|LOCUS_38400 4120124 4120903 gene locus_tag LOCUS_38410 4120124 4120903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_38410 4122718 4121057 gene locus_tag LOCUS_38420 4122718 4121057 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945404.1 protein_id gnl|my_center|LOCUS_38420 4123325 4122780 gene locus_tag LOCUS_38430 4123325 4122780 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223869.1 protein_id gnl|my_center|LOCUS_38430 4124221 4123406 gene locus_tag LOCUS_38440 4124221 4123406 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326902.1 protein_id gnl|my_center|LOCUS_38440 4126008 4124506 gene locus_tag LOCUS_38450 4126008 4124506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 4126477 4127904 gene locus_tag LOCUS_38460 4126477 4127904 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229411.1 protein_id gnl|my_center|LOCUS_38460 4128426 4128055 gene locus_tag LOCUS_38470 4128426 4128055 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224711.1 protein_id gnl|my_center|LOCUS_38470 4128639 4129493 gene locus_tag LOCUS_38480 gene hemB 4128639 4129493 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776657.1 protein_id gnl|my_center|LOCUS_38480 4129490 4130806 gene locus_tag LOCUS_38490 gene hemL 4129490 4130806 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222429.1 protein_id gnl|my_center|LOCUS_38490 4130950 4131303 gene locus_tag LOCUS_38500 4130950 4131303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 4131772 4131380 gene locus_tag LOCUS_38510 4131772 4131380 CDS product DUF1304 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015615.1 protein_id gnl|my_center|LOCUS_38510 4133177 4131825 gene locus_tag LOCUS_38520 4133177 4131825 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081235.1 protein_id gnl|my_center|LOCUS_38520 4134525 4133266 gene locus_tag LOCUS_38530 4134525 4133266 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922632.1 protein_id gnl|my_center|LOCUS_38530 4135760 4134522 gene locus_tag LOCUS_38540 4135760 4134522 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112637.1 protein_id gnl|my_center|LOCUS_38540 4136482 4135757 gene locus_tag LOCUS_38550 4136482 4135757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 4137266 4136511 gene locus_tag LOCUS_38560 4137266 4136511 CDS product DUF5058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426729.1 protein_id gnl|my_center|LOCUS_38560 4137372 4138331 gene locus_tag LOCUS_38570 4137372 4138331 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125308321.1 protein_id gnl|my_center|LOCUS_38570 4139775 4138348 gene locus_tag LOCUS_38580 4139775 4138348 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256492.1 protein_id gnl|my_center|LOCUS_38580 4140783 4139947 gene locus_tag LOCUS_38590 4140783 4139947 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804277.1 protein_id gnl|my_center|LOCUS_38590 4141688 4140786 gene locus_tag LOCUS_38600 4141688 4140786 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229683.1 protein_id gnl|my_center|LOCUS_38600 4142992 4141766 gene locus_tag LOCUS_38610 4142992 4141766 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977776.1 protein_id gnl|my_center|LOCUS_38610 4143939 4143043 gene locus_tag LOCUS_38620 4143939 4143043 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015551.1 protein_id gnl|my_center|LOCUS_38620 4143992 4144531 gene locus_tag LOCUS_38630 4143992 4144531 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411119.1 protein_id gnl|my_center|LOCUS_38630 4144652 4145689 gene locus_tag LOCUS_38640 4144652 4145689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 4145708 4146130 gene locus_tag LOCUS_38650 4145708 4146130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 4146819 4146181 gene locus_tag LOCUS_38660 4146819 4146181 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080357.1 protein_id gnl|my_center|LOCUS_38660 4146904 4148442 gene locus_tag LOCUS_38670 4146904 4148442 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804819.1 protein_id gnl|my_center|LOCUS_38670 4148490 4149620 gene locus_tag LOCUS_38680 4148490 4149620 CDS product bifunctional 2-methylcitrate synthase/citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804817.1 protein_id gnl|my_center|LOCUS_38680 4149858 4150418 gene locus_tag LOCUS_38690 4149858 4150418 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074286.1 protein_id gnl|my_center|LOCUS_38690 4150961 4150431 gene locus_tag LOCUS_38700 4150961 4150431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 4152594 4151023 gene locus_tag LOCUS_38710 4152594 4151023 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223948.1 protein_id gnl|my_center|LOCUS_38710 4152711 4154624 gene locus_tag LOCUS_38720 4152711 4154624 CDS product choice-of-anchor I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385247.1 protein_id gnl|my_center|LOCUS_38720 4155769 4154735 gene locus_tag LOCUS_38730 4155769 4154735 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014191.1 protein_id gnl|my_center|LOCUS_38730 4157184 4155766 gene locus_tag LOCUS_38740 4157184 4155766 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014192.1 protein_id gnl|my_center|LOCUS_38740 4158338 4157424 gene locus_tag LOCUS_38750 4158338 4157424 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775749.1 protein_id gnl|my_center|LOCUS_38750 4158555 4162073 gene locus_tag LOCUS_38760 4158555 4162073 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197702416.1 protein_id gnl|my_center|LOCUS_38760 4162253 4163275 gene locus_tag LOCUS_38770 4162253 4163275 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775776.1 protein_id gnl|my_center|LOCUS_38770 4163272 4166052 gene locus_tag LOCUS_38780 4163272 4166052 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775775.1 protein_id gnl|my_center|LOCUS_38780 4166096 4167067 gene locus_tag LOCUS_38790 4166096 4167067 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775774.1 protein_id gnl|my_center|LOCUS_38790 4167453 4167073 gene locus_tag LOCUS_38800 4167453 4167073 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222929.1 protein_id gnl|my_center|LOCUS_38800 4167577 4167996 gene locus_tag LOCUS_38810 4167577 4167996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 4168006 4168767 gene locus_tag LOCUS_38820 4168006 4168767 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227890.1 protein_id gnl|my_center|LOCUS_38820 4169254 4168817 gene locus_tag LOCUS_38830 4169254 4168817 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727656.1 protein_id gnl|my_center|LOCUS_38830 4169475 4170335 gene locus_tag LOCUS_38840 4169475 4170335 CDS product arginine deiminase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089035.1 protein_id gnl|my_center|LOCUS_38840 4170376 4171659 gene locus_tag LOCUS_38850 gene rocD 4170376 4171659 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727654.1 protein_id gnl|my_center|LOCUS_38850 4172707 4171739 gene locus_tag LOCUS_38860 4172707 4171739 CDS product IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058916821.1 protein_id gnl|my_center|LOCUS_38860 4172823 4173785 gene locus_tag LOCUS_38870 4172823 4173785 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972087.1 protein_id gnl|my_center|LOCUS_38870 4173823 4174029 gene locus_tag LOCUS_38880 4173823 4174029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 4174026 4174397 gene locus_tag LOCUS_38890 4174026 4174397 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727560.1 protein_id gnl|my_center|LOCUS_38890 4175826 4174483 gene locus_tag LOCUS_38900 4175826 4174483 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908688.1 protein_id gnl|my_center|LOCUS_38900 4176555 4175839 gene locus_tag LOCUS_38910 4176555 4175839 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727054.1 protein_id gnl|my_center|LOCUS_38910 4178106 4176670 gene locus_tag LOCUS_38920 4178106 4176670 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030832.1 protein_id gnl|my_center|LOCUS_38920 4178272 4179006 gene locus_tag LOCUS_38930 4178272 4179006 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230868.1 protein_id gnl|my_center|LOCUS_38930 4179126 4179386 gene locus_tag LOCUS_38940 4179126 4179386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 4179621 4180472 gene locus_tag LOCUS_38950 4179621 4180472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 4181435 4180509 gene locus_tag LOCUS_38960 4181435 4180509 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030286.1 protein_id gnl|my_center|LOCUS_38960 4182369 4181464 gene locus_tag LOCUS_38970 4182369 4181464 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066836.1 protein_id gnl|my_center|LOCUS_38970 4183279 4182380 gene locus_tag LOCUS_38980 4183279 4182380 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186540.1 protein_id gnl|my_center|LOCUS_38980 4183463 4184950 gene locus_tag LOCUS_38990 4183463 4184950 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230541.1 protein_id gnl|my_center|LOCUS_38990 4185764 4184997 gene locus_tag LOCUS_39000 4185764 4184997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39000 4186482 4185787 gene locus_tag LOCUS_39010 4186482 4185787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 4186687 4188396 gene locus_tag LOCUS_39020 4186687 4188396 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228668.1 protein_id gnl|my_center|LOCUS_39020 4188773 4188477 gene locus_tag LOCUS_39030 4188773 4188477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 4189056 4188847 gene locus_tag LOCUS_39040 4189056 4188847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 4189772 4189155 gene locus_tag LOCUS_39050 4189772 4189155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39050 4192220 4189881 gene locus_tag LOCUS_39060 4192220 4189881 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856231.1 protein_id gnl|my_center|LOCUS_39060 4192439 4193983 gene locus_tag LOCUS_39070 4192439 4193983 CDS product T2SS-translocated chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193152.1 protein_id gnl|my_center|LOCUS_39070 4195352 4193988 gene locus_tag LOCUS_39080 4195352 4193988 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974638.1 protein_id gnl|my_center|LOCUS_39080 4195819 4195349 gene locus_tag LOCUS_39090 4195819 4195349 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225436.1 protein_id gnl|my_center|LOCUS_39090 4195892 4196767 gene locus_tag LOCUS_39100 4195892 4196767 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436568.1 protein_id gnl|my_center|LOCUS_39100 4196847 4197896 gene locus_tag LOCUS_39110 4196847 4197896 CDS product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327718.1 protein_id gnl|my_center|LOCUS_39110 4197977 4198285 gene locus_tag LOCUS_39120 4197977 4198285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 4198606 4198304 gene locus_tag LOCUS_39130 4198606 4198304 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031863.1 protein_id gnl|my_center|LOCUS_39130 4198642 4199646 gene locus_tag LOCUS_39140 4198642 4199646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39140 4199643 4200566 gene locus_tag LOCUS_39150 4199643 4200566 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973051.1 protein_id gnl|my_center|LOCUS_39150 4200722 4201405 gene locus_tag LOCUS_39160 4200722 4201405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 4203016 4201601 gene locus_tag LOCUS_39170 4203016 4201601 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896540.1 protein_id gnl|my_center|LOCUS_39170 4203109 4203957 gene locus_tag LOCUS_39180 4203109 4203957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39180 4204311 4203976 gene locus_tag LOCUS_39190 4204311 4203976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 4204496 4204308 gene locus_tag LOCUS_39200 4204496 4204308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 4204426 4205250 gene locus_tag LOCUS_39210 4204426 4205250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 4205384 4206076 gene locus_tag LOCUS_39220 4205384 4206076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39220 4207805 4206249 gene locus_tag LOCUS_39230 gene pgm 4207805 4206249 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728182.1 protein_id gnl|my_center|LOCUS_39230 4207901 4208845 gene locus_tag LOCUS_39240 gene pheA 4207901 4208845 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804316.1 protein_id gnl|my_center|LOCUS_39240 4208845 4209423 gene locus_tag LOCUS_39250 4208845 4209423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 4210538 4209549 gene locus_tag LOCUS_39260 4210538 4209549 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804319.1 protein_id gnl|my_center|LOCUS_39260 4210589 4211872 gene locus_tag LOCUS_39270 gene serS 4210589 4211872 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831496.1 protein_id gnl|my_center|LOCUS_39270 4211869 4212678 gene locus_tag LOCUS_39280 4211869 4212678 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804321.1 protein_id gnl|my_center|LOCUS_39280 4212770 4212855 gene locus_tag LOCUS_t00430 4212770 4212855 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4212914 4214212 gene locus_tag LOCUS_39290 4212914 4214212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 4214273 4214364 gene locus_tag LOCUS_t00440 4214273 4214364 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4216348 4214609 gene locus_tag LOCUS_39300 4216348 4214609 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031437.1 protein_id gnl|my_center|LOCUS_39300 4218087 4217677 gene locus_tag LOCUS_39310 4218087 4217677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 4218700 4218392 gene locus_tag LOCUS_39320 4218700 4218392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 4219497 4221086 gene locus_tag LOCUS_39330 gene istA 4219497 4221086 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015262274.1 protein_id gnl|my_center|LOCUS_39330 4221086 4221853 gene locus_tag LOCUS_39340 gene istB 4221086 4221853 CDS product IS21-like element ISRsp2 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167668023.1 protein_id gnl|my_center|LOCUS_39340 4222171 4223217 gene locus_tag LOCUS_39350 4222171 4223217 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225050.1 protein_id gnl|my_center|LOCUS_39350 4223210 4223680 gene locus_tag LOCUS_39360 4223210 4223680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 4223677 4224180 gene locus_tag LOCUS_39370 4223677 4224180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 4224345 4224866 gene locus_tag LOCUS_39380 4224345 4224866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 4226056 4225214 gene locus_tag LOCUS_39390 4226056 4225214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142083.1 protein_id gnl|my_center|LOCUS_39390 4226370 4226053 gene locus_tag LOCUS_39400 4226370 4226053 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404784.1 protein_id gnl|my_center|LOCUS_39400 4228802 4226373 gene locus_tag LOCUS_39410 4228802 4226373 CDS product DUF2309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257648.1 protein_id gnl|my_center|LOCUS_39410 4230343 4228799 gene locus_tag LOCUS_39420 4230343 4228799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 4230450 4230734 gene locus_tag LOCUS_39430 4230450 4230734 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225051.1 protein_id gnl|my_center|LOCUS_39430 4231071 4231238 gene locus_tag LOCUS_39440 4231071 4231238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 4231527 4231354 gene locus_tag LOCUS_39450 4231527 4231354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39450 4231918 4231760 gene locus_tag LOCUS_39460 4231918 4231760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 4232149 4233480 gene locus_tag LOCUS_39470 4232149 4233480 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930000.1 protein_id gnl|my_center|LOCUS_39470 4233746 4234369 gene locus_tag LOCUS_39480 4233746 4234369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 4234776 4234405 gene locus_tag LOCUS_39490 4234776 4234405 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742210.1 protein_id gnl|my_center|LOCUS_39490 4235069 4236034 gene locus_tag LOCUS_39500 gene iolC 4235069 4236034 CDS product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729991.1 protein_id gnl|my_center|LOCUS_39500 4236031 4236912 gene locus_tag LOCUS_39510 4236031 4236912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857137.1 protein_id gnl|my_center|LOCUS_39510 4236954 4238465 gene locus_tag LOCUS_39520 4236954 4238465 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013433.1 protein_id gnl|my_center|LOCUS_39520 4238478 4239386 gene locus_tag LOCUS_39530 gene iolB 4238478 4239386 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862468.1 protein_id gnl|my_center|LOCUS_39530 4239420 4241339 gene locus_tag LOCUS_39540 gene iolD 4239420 4241339 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013434.1 protein_id gnl|my_center|LOCUS_39540 4241342 4242268 gene locus_tag LOCUS_39550 4241342 4242268 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013435.1 protein_id gnl|my_center|LOCUS_39550 4242314 4243324 gene locus_tag LOCUS_39560 4242314 4243324 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013436.1 protein_id gnl|my_center|LOCUS_39560 4243356 4244234 gene locus_tag LOCUS_39570 4243356 4244234 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013437.1 protein_id gnl|my_center|LOCUS_39570 4244356 4244544 gene locus_tag LOCUS_39580 4244356 4244544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_39580 4245556 4244777 gene locus_tag LOCUS_39590 4245556 4244777 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148770277.1 protein_id gnl|my_center|LOCUS_39590 4246566 4245553 gene locus_tag LOCUS_39600 4246566 4245553 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013444.1 protein_id gnl|my_center|LOCUS_39600 4247405 4246659 gene locus_tag LOCUS_39610 4247405 4246659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 4248376 4247402 gene locus_tag LOCUS_39620 4248376 4247402 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123535.1 protein_id gnl|my_center|LOCUS_39620 4249695 4248376 gene locus_tag LOCUS_39630 4249695 4248376 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730110.1 protein_id gnl|my_center|LOCUS_39630 4249835 4251151 gene locus_tag LOCUS_39640 4249835 4251151 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257411.1 protein_id gnl|my_center|LOCUS_39640 4251199 4251642 gene locus_tag LOCUS_39650 4251199 4251642 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062763.1 protein_id gnl|my_center|LOCUS_39650 4252629 4251652 gene locus_tag LOCUS_39660 4252629 4251652 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229017.1 protein_id gnl|my_center|LOCUS_39660 4252924 4253973 gene locus_tag LOCUS_39670 4252924 4253973 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530992.1 protein_id gnl|my_center|LOCUS_39670 4254117 4255211 gene locus_tag LOCUS_39680 4254117 4255211 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311331.1 protein_id gnl|my_center|LOCUS_39680 4255208 4255978 gene locus_tag LOCUS_39690 4255208 4255978 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970128.1 protein_id gnl|my_center|LOCUS_39690 4256003 4256188 gene locus_tag LOCUS_39700 4256003 4256188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39700 4256196 4257047 gene locus_tag LOCUS_39710 4256196 4257047 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223780.1 protein_id gnl|my_center|LOCUS_39710 4257044 4258084 gene locus_tag LOCUS_39720 4257044 4258084 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223779.1 protein_id gnl|my_center|LOCUS_39720 4258081 4258884 gene locus_tag LOCUS_39730 4258081 4258884 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223778.1 protein_id gnl|my_center|LOCUS_39730 4260306 4258921 gene locus_tag LOCUS_39740 4260306 4258921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 4261443 4260676 gene locus_tag LOCUS_39750 gene iolR 4261443 4260676 CDS product GntR family transcriptional regulator IolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857140.1 protein_id gnl|my_center|LOCUS_39750 4261544 4262566 gene locus_tag LOCUS_39760 4261544 4262566 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013439.1 protein_id gnl|my_center|LOCUS_39760 4262771 4263532 gene locus_tag LOCUS_39770 4262771 4263532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39770 4263596 4264228 gene locus_tag LOCUS_39780 4263596 4264228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39780 4266181 4264622 gene locus_tag LOCUS_39790 4266181 4264622 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899145.1 protein_id gnl|my_center|LOCUS_39790 4266975 4266241 gene locus_tag LOCUS_39800 4266975 4266241 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225375.1 protein_id gnl|my_center|LOCUS_39800 4268945 4267089 gene locus_tag LOCUS_39810 4268945 4267089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_39810 4269963 4269049 gene locus_tag LOCUS_39820 4269963 4269049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39820 4270162 4270235 gene locus_tag LOCUS_t00450 4270162 4270235 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4270951 4270511 gene locus_tag LOCUS_39830 4270951 4270511 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742106.1 protein_id gnl|my_center|LOCUS_39830 4272061 4271378 gene locus_tag LOCUS_39840 4272061 4271378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39840 4273262 4272630 gene locus_tag LOCUS_39850 gene upp 4273262 4272630 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974921.1 protein_id gnl|my_center|LOCUS_39850 4273321 4273794 gene locus_tag LOCUS_39860 gene tadA 4273321 4273794 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974924.1 protein_id gnl|my_center|LOCUS_39860 4274740 4273778 gene locus_tag LOCUS_39870 4274740 4273778 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028720.1 protein_id gnl|my_center|LOCUS_39870 4274800 4275648 gene locus_tag LOCUS_39880 gene proC 4274800 4275648 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222401.1 protein_id gnl|my_center|LOCUS_39880 4277443 4275833 gene locus_tag LOCUS_39890 4277443 4275833 CDS product chromosome partitioning protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803976.1 protein_id gnl|my_center|LOCUS_39890 4278208 4277537 gene locus_tag LOCUS_39900 4278208 4277537 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776430.1 protein_id gnl|my_center|LOCUS_39900 4279643 4278201 gene locus_tag LOCUS_39910 4279643 4278201 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776429.1 protein_id gnl|my_center|LOCUS_39910 4279718 4280164 gene locus_tag LOCUS_39920 4279718 4280164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39920 4280244 4280438 gene locus_tag LOCUS_39930 4280244 4280438 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222402.1 protein_id gnl|my_center|LOCUS_39930 4280712 4280981 gene locus_tag LOCUS_39940 4280712 4280981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39940 4280978 4281277 gene locus_tag LOCUS_39950 4280978 4281277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39950 4282649 4281336 gene locus_tag LOCUS_39960 gene aspS 4282649 4281336 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868079.1 protein_id gnl|my_center|LOCUS_39960 4282753 4283373 gene locus_tag LOCUS_39970 4282753 4283373 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222430.1 protein_id gnl|my_center|LOCUS_39970 4283373 4283969 gene locus_tag LOCUS_39980 4283373 4283969 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776421.1 protein_id gnl|my_center|LOCUS_39980 4283972 4284733 gene locus_tag LOCUS_39990 4283972 4284733 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222432.1 protein_id gnl|my_center|LOCUS_39990 4284708 4286402 gene locus_tag LOCUS_40000 4284708 4286402 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776419.1 protein_id gnl|my_center|LOCUS_40000 4286412 4287404 gene locus_tag LOCUS_40010 gene ccsB 4286412 4287404 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776418.1 protein_id gnl|my_center|LOCUS_40010 4288567 4287587 gene locus_tag LOCUS_40020 4288567 4287587 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402923.1 protein_id gnl|my_center|LOCUS_40020 4288862 4288602 gene locus_tag LOCUS_40030 4288862 4288602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40030 4289231 4288872 gene locus_tag LOCUS_40040 4289231 4288872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 4290370 4289282 gene locus_tag LOCUS_40050 4290370 4289282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40050 4290690 4290367 gene locus_tag LOCUS_40060 4290690 4290367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40060 4290949 4292118 gene locus_tag LOCUS_40070 gene menE 4290949 4292118 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742122.1 protein_id gnl|my_center|LOCUS_40070 4292200 4293216 gene locus_tag LOCUS_40080 4292200 4293216 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776415.1 protein_id gnl|my_center|LOCUS_40080 4293762 4293328 gene locus_tag LOCUS_40090 4293762 4293328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40090 4293847 4294248 gene locus_tag LOCUS_40100 4293847 4294248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40100 4294254 4296233 gene locus_tag LOCUS_40110 4294254 4296233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 4297624 4296251 gene locus_tag LOCUS_40120 4297624 4296251 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224238.1 protein_id gnl|my_center|LOCUS_40120 4298172 4297636 gene locus_tag LOCUS_40130 4298172 4297636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_40130 4298483 4298956 gene locus_tag LOCUS_40140 4298483 4298956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40140 4298946 4299425 gene locus_tag LOCUS_40150 4298946 4299425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40150 4299513 4299893 gene locus_tag LOCUS_40160 4299513 4299893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 4299886 4300182 gene locus_tag LOCUS_40170 4299886 4300182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40170 4300186 4301175 gene locus_tag LOCUS_40180 4300186 4301175 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785727.1 protein_id gnl|my_center|LOCUS_40180 4301172 4302683 gene locus_tag LOCUS_40190 4301172 4302683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40190 4304057 4302825 gene locus_tag LOCUS_40200 4304057 4302825 CDS product chorismate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929999.1 protein_id gnl|my_center|LOCUS_40200 4304167 4304865 gene locus_tag LOCUS_40210 4304167 4304865 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974389.1 protein_id gnl|my_center|LOCUS_40210 4304897 4305967 gene locus_tag LOCUS_40220 4304897 4305967 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776173.1 protein_id gnl|my_center|LOCUS_40220 4305978 4307357 gene locus_tag LOCUS_40230 4305978 4307357 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221998.1 protein_id gnl|my_center|LOCUS_40230 4308107 4307619 gene locus_tag LOCUS_40240 4308107 4307619 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974333.1 protein_id gnl|my_center|LOCUS_40240 4309162 4308146 gene locus_tag LOCUS_40250 4309162 4308146 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_40250 4309317 4309399 gene locus_tag LOCUS_t00460 4309317 4309399 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 4309492 4310316 gene locus_tag LOCUS_40260 4309492 4310316 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224474.1 protein_id gnl|my_center|LOCUS_40260 4310544 4310302 gene locus_tag LOCUS_40270 4310544 4310302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40270 4310487 4311752 gene locus_tag LOCUS_40280 4310487 4311752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40280 4312646 4311846 gene locus_tag LOCUS_40290 4312646 4311846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 4314506 4312830 gene locus_tag LOCUS_40300 4314506 4312830 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804840.1 protein_id gnl|my_center|LOCUS_40300 4314678 4315904 gene locus_tag LOCUS_40310 4314678 4315904 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804843.1 protein_id gnl|my_center|LOCUS_40310 4316018 4317640 gene locus_tag LOCUS_40320 4316018 4317640 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804842.1 protein_id gnl|my_center|LOCUS_40320 4317642 4318565 gene locus_tag LOCUS_40330 4317642 4318565 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804841.1 protein_id gnl|my_center|LOCUS_40330 4319775 4318570 gene locus_tag LOCUS_40340 4319775 4318570 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729999.1 protein_id gnl|my_center|LOCUS_40340 4319993 4320065 gene locus_tag LOCUS_t00470 4319993 4320065 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4320098 4320172 gene locus_tag LOCUS_t00480 4320098 4320172 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4321259 4320510 gene locus_tag LOCUS_40350 gene istB 4321259 4320510 CDS product IS21-like element ISFK1 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090937.1 protein_id gnl|my_center|LOCUS_40350 4321759 4321256 gene locus_tag LOCUS_40360 4321759 4321256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40360 4322627 4321860 gene locus_tag LOCUS_40370 gene istB 4322627 4321860 CDS product IS21-like element ISRsp2 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167668023.1 protein_id gnl|my_center|LOCUS_40370 4324216 4322627 gene locus_tag LOCUS_40380 gene istA 4324216 4322627 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015262274.1 protein_id gnl|my_center|LOCUS_40380 4324627 4324337 gene locus_tag LOCUS_40390 4324627 4324337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40390 4326012 4324630 gene locus_tag LOCUS_40400 4326012 4324630 CDS product Mu transposase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790712.1 protein_id gnl|my_center|LOCUS_40400 4326535 4326020 gene locus_tag LOCUS_40410 4326535 4326020 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776577.1 protein_id gnl|my_center|LOCUS_40410 4326880 4327197 gene locus_tag LOCUS_40420 4326880 4327197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40420 4328139 4327459 gene locus_tag LOCUS_40430 4328139 4327459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40430 4329502 4328879 gene locus_tag LOCUS_40440 4329502 4328879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40440 4329824 4329486 gene locus_tag LOCUS_40450 4329824 4329486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40450 4330400 4329834 gene locus_tag LOCUS_40460 4330400 4329834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40460 4331491 4331171 gene locus_tag LOCUS_40470 4331491 4331171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 4332855 4331461 gene locus_tag LOCUS_40480 4332855 4331461 CDS product IS1380-like element ISCgl4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015202.1 protein_id gnl|my_center|LOCUS_40480 4333870 4332971 gene locus_tag LOCUS_40490 4333870 4332971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40490 4333982 4335475 gene locus_tag LOCUS_40500 gene istA 4333982 4335475 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100512979.1 protein_id gnl|my_center|LOCUS_40500 4335472 4336203 gene locus_tag LOCUS_40510 gene istB 4335472 4336203 CDS product IS21-like element ISBlo1 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012472066.1 protein_id gnl|my_center|LOCUS_40510 4337584 4336610 gene locus_tag LOCUS_40520 4337584 4336610 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273465.1 protein_id gnl|my_center|LOCUS_40520 4338950 4339714 gene locus_tag LOCUS_40530 4338950 4339714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530 4339878 4340312 gene locus_tag LOCUS_40540 4339878 4340312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085100849.1 protein_id gnl|my_center|LOCUS_40540 4340312 4341319 gene locus_tag LOCUS_40550 4340312 4341319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40550 4341379 4341807 gene locus_tag LOCUS_40560 4341379 4341807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40560 4342354 4343589 gene locus_tag LOCUS_40570 4342354 4343589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 4344464 4343619 gene locus_tag LOCUS_40580 4344464 4343619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40580 4345147 4344500 gene locus_tag LOCUS_40590 4345147 4344500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 4347085 4345511 gene locus_tag LOCUS_40600 4347085 4345511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40600 4347919 4347281 gene locus_tag LOCUS_40610 4347919 4347281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40610 4348181 4348020 gene locus_tag LOCUS_40620 4348181 4348020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40620 4348650 4348207 gene locus_tag LOCUS_40630 4348650 4348207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 4348948 4349586 gene locus_tag LOCUS_40640 4348948 4349586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40640 4349586 4349999 gene locus_tag LOCUS_40650 4349586 4349999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40650 4351019 4352248 gene locus_tag LOCUS_40660 4351019 4352248 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728185.1 protein_id gnl|my_center|LOCUS_40660 4352874 4352275 gene locus_tag LOCUS_40670 4352874 4352275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40670 4352943 4353188 gene locus_tag LOCUS_40680 4352943 4353188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40680 4353713 4353483 gene locus_tag LOCUS_40690 4353713 4353483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40690 4355130 4353772 gene locus_tag LOCUS_40700 4355130 4353772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 4355868 4355194 gene locus_tag LOCUS_40710 4355868 4355194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40710 4356353 4356697 gene locus_tag LOCUS_40720 4356353 4356697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40720 4356709 4357029 gene locus_tag LOCUS_40730 4356709 4357029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40730 4357066 4357425 gene locus_tag LOCUS_40740 4357066 4357425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40740 4357425 4359749 gene locus_tag LOCUS_40750 4357425 4359749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40750 4359742 4360224 gene locus_tag LOCUS_40760 4359742 4360224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40760 4360289 4360753 gene locus_tag LOCUS_40770 4360289 4360753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40770 4362707 4361178 gene locus_tag LOCUS_40780 4362707 4361178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40780 4363225 4362710 gene locus_tag LOCUS_40790 4363225 4362710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40790 4363995 4365845 gene locus_tag LOCUS_40800 4363995 4365845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014659.1 protein_id gnl|my_center|LOCUS_40800 4366836 4367228 gene locus_tag LOCUS_40810 4366836 4367228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085100849.1 protein_id gnl|my_center|LOCUS_40810 4367228 4368235 gene locus_tag LOCUS_40820 4367228 4368235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40820 4369103 4368381 gene locus_tag LOCUS_40830 4369103 4368381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40830 4369396 4370976 gene locus_tag LOCUS_40840 gene istA 4369396 4370976 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015262274.1 protein_id gnl|my_center|LOCUS_40840 4370976 4371755 gene locus_tag LOCUS_40850 gene istB 4370976 4371755 CDS product IS21-like element ISRsp2 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167668023.1 protein_id gnl|my_center|LOCUS_40850 4373025 4371850 gene locus_tag LOCUS_40860 4373025 4371850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40860 4373374 4373159 gene locus_tag LOCUS_40870 4373374 4373159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40870 4373462 4374202 gene locus_tag LOCUS_40880 4373462 4374202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40880 4374202 4375353 gene locus_tag LOCUS_40890 4374202 4375353 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110336.1 protein_id gnl|my_center|LOCUS_40890 4375514 4375440 gene locus_tag LOCUS_t00490 4375514 4375440 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 4375652 4375578 gene locus_tag LOCUS_t00500 4375652 4375578 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 4375789 4375716 gene locus_tag LOCUS_t00510 4375789 4375716 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 4376034 4377434 gene locus_tag LOCUS_40900 4376034 4377434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40900 4377427 4378797 gene locus_tag LOCUS_40910 4377427 4378797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40910 4379355 4378864 gene locus_tag LOCUS_40920 4379355 4378864 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731048.1 protein_id gnl|my_center|LOCUS_40920 4379401 4380405 gene locus_tag LOCUS_40930 4379401 4380405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40930 4380424 4380987 gene locus_tag LOCUS_40940 gene hpt 4380424 4380987 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007452004.1 protein_id gnl|my_center|LOCUS_40940 4381071 4383083 gene locus_tag LOCUS_40950 gene ftsH 4381071 4383083 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867756.1 protein_id gnl|my_center|LOCUS_40950 4383092 4383661 gene locus_tag LOCUS_40960 gene folE 4383092 4383661 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336701.1 protein_id gnl|my_center|LOCUS_40960 4383658 4384494 gene locus_tag LOCUS_40970 gene folP 4383658 4384494 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467816.1 protein_id gnl|my_center|LOCUS_40970 4384509 4384871 gene locus_tag LOCUS_40980 gene folB 4384509 4384871 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230465.1 protein_id gnl|my_center|LOCUS_40980 4384868 4385389 gene locus_tag LOCUS_40990 gene folK 4384868 4385389 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975432.1 protein_id gnl|my_center|LOCUS_40990 4385386 4385883 gene locus_tag LOCUS_41000 4385386 4385883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41000 4385867 4386415 gene locus_tag LOCUS_41010 4385867 4386415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41010 4386412 4388088 gene locus_tag LOCUS_41020 4386412 4388088 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804900.1 protein_id gnl|my_center|LOCUS_41020 4388102 4388896 gene locus_tag LOCUS_41030 4388102 4388896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41030 4388893 4389774 gene locus_tag LOCUS_41040 gene panC 4388893 4389774 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731036.1 protein_id gnl|my_center|LOCUS_41040 4389884 4391392 gene locus_tag LOCUS_41050 gene lysS 4389884 4391392 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230454.1 protein_id gnl|my_center|LOCUS_41050 4391400 4391555 gene locus_tag LOCUS_41060 4391400 4391555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41060 4391573 4391752 gene locus_tag LOCUS_41070 4391573 4391752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41070 4391759 4393222 gene locus_tag LOCUS_41080 gene cls 4391759 4393222 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804433.1 protein_id gnl|my_center|LOCUS_41080 4394666 4393230 gene locus_tag LOCUS_41090 4394666 4393230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41090 4394877 4397402 gene locus_tag LOCUS_41100 4394877 4397402 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975461.1 protein_id gnl|my_center|LOCUS_41100 4397535 4398086 gene locus_tag LOCUS_41110 4397535 4398086 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804919.1 protein_id gnl|my_center|LOCUS_41110 4398215 4402966 gene locus_tag LOCUS_41120 4398215 4402966 CDS product ExeM/NucH family extracellular endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390206.1 protein_id gnl|my_center|LOCUS_41120 4403102 4403743 gene locus_tag LOCUS_41130 4403102 4403743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 4403827 4404264 gene locus_tag LOCUS_41140 4403827 4404264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41140 4405625 4404261 gene locus_tag LOCUS_41150 gene radA 4405625 4404261 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028928.1 protein_id gnl|my_center|LOCUS_41150 4406421 4405636 gene locus_tag LOCUS_41160 4406421 4405636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41160 4406508 4406597 gene locus_tag LOCUS_t00520 4406508 4406597 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4406971 4407594 gene locus_tag LOCUS_41170 4406971 4407594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41170 4407612 4407893 gene locus_tag LOCUS_41180 4407612 4407893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41180 4408092 4408553 gene locus_tag LOCUS_41190 4408092 4408553 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525102.1 protein_id gnl|my_center|LOCUS_41190 4409341 4408604 gene locus_tag LOCUS_41200 4409341 4408604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41200 4409558 4409767 gene locus_tag LOCUS_41210 4409558 4409767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41210 4412023 4409654 gene locus_tag LOCUS_41220 4412023 4409654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41220 4413147 4412077 gene locus_tag LOCUS_41230 4413147 4412077 CDS product heparan-alpha-glucosaminide N-acetyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775829.1 protein_id gnl|my_center|LOCUS_41230 4413272 4413916 gene locus_tag LOCUS_41240 4413272 4413916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41240 4413963 4416497 gene locus_tag LOCUS_41250 4413963 4416497 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179552221.1 protein_id gnl|my_center|LOCUS_41250 4418107 4416494 gene locus_tag LOCUS_41260 4418107 4416494 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031132.1 protein_id gnl|my_center|LOCUS_41260 4418560 4420164 gene locus_tag LOCUS_41270 4418560 4420164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41270 4420387 4421433 gene locus_tag LOCUS_41280 4420387 4421433 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804802.1 protein_id gnl|my_center|LOCUS_41280 4422723 4421656 gene locus_tag LOCUS_41290 4422723 4421656 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730979.1 protein_id gnl|my_center|LOCUS_41290 4422843 4423109 gene locus_tag LOCUS_41300 4422843 4423109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41300 4424305 4423001 gene locus_tag LOCUS_41310 4424305 4423001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704211.1 protein_id gnl|my_center|LOCUS_41310 4424381 4424728 gene locus_tag LOCUS_41320 4424381 4424728 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921237.1 protein_id gnl|my_center|LOCUS_41320 4424721 4425320 gene locus_tag LOCUS_41330 4424721 4425320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41330 4425444 4425938 gene locus_tag LOCUS_41340 4425444 4425938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41340 4427212 4425983 gene locus_tag LOCUS_41350 4427212 4425983 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777064.1 protein_id gnl|my_center|LOCUS_41350 4427739 4427212 gene locus_tag LOCUS_41360 4427739 4427212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41360 4428401 4427736 gene locus_tag LOCUS_41370 4428401 4427736 CDS product copper resistance protein CopC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776436.1 protein_id gnl|my_center|LOCUS_41370 4429266 4428652 gene locus_tag LOCUS_41380 4429266 4428652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41380 4429360 4430127 gene locus_tag LOCUS_41390 4429360 4430127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41390 4430188 4430541 gene locus_tag LOCUS_41400 4430188 4430541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41400 4430579 4430962 gene locus_tag LOCUS_41410 4430579 4430962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41410 4431214 4431567 gene locus_tag LOCUS_41420 4431214 4431567 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101229.1 protein_id gnl|my_center|LOCUS_41420 4431718 4434108 gene locus_tag LOCUS_41430 gene otsB 4431718 4434108 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085421.1 protein_id gnl|my_center|LOCUS_41430 4434133 4434723 gene locus_tag LOCUS_41440 4434133 4434723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41440 4435644 4434727 gene locus_tag LOCUS_41450 gene mmsB 4435644 4434727 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088663.1 protein_id gnl|my_center|LOCUS_41450 4436746 4435658 gene locus_tag LOCUS_41460 4436746 4435658 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730435.1 protein_id gnl|my_center|LOCUS_41460 4437882 4436743 gene locus_tag LOCUS_41470 4437882 4436743 CDS product isobutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084251.1 protein_id gnl|my_center|LOCUS_41470 4439384 4437885 gene locus_tag LOCUS_41480 4439384 4437885 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109992.1 protein_id gnl|my_center|LOCUS_41480 4439544 4440323 gene locus_tag LOCUS_41490 4439544 4440323 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223550.1 protein_id gnl|my_center|LOCUS_41490 4440356 4441327 gene locus_tag LOCUS_41500 4440356 4441327 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899889.1 protein_id gnl|my_center|LOCUS_41500 4442094 4441405 gene locus_tag LOCUS_41510 4442094 4441405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41510 4442343 4443197 gene locus_tag LOCUS_41520 4442343 4443197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41520 4443302 4444588 gene locus_tag LOCUS_41530 4443302 4444588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41530 4444674 4445108 gene locus_tag LOCUS_41540 4444674 4445108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41540 4445105 4445410 gene locus_tag LOCUS_41550 4445105 4445410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41550 4448188 4445420 gene locus_tag LOCUS_41560 4448188 4445420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41560 4448506 4449126 gene locus_tag LOCUS_41570 4448506 4449126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41570 4449129 4449809 gene locus_tag LOCUS_41580 4449129 4449809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41580 4449818 4451101 gene locus_tag LOCUS_41590 4449818 4451101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41590 4451098 4451610 gene locus_tag LOCUS_41600 4451098 4451610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41600 >Feature sequence2 614 21 gene locus_tag LOCUS_41610 gene cas6e 614 21 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227610.1 protein_id gnl|my_center|LOCUS_41610 1303 611 gene locus_tag LOCUS_41620 1303 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41620 2412 1288 gene locus_tag LOCUS_41630 gene cas7e 2412 1288 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387931.1 protein_id gnl|my_center|LOCUS_41630 2917 2414 gene locus_tag LOCUS_41640 2917 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41640 4618 2921 gene locus_tag LOCUS_41650 4618 2921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41650 6624 4633 gene locus_tag LOCUS_41660 6624 4633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41660 7990 7664 gene locus_tag LOCUS_41670 7990 7664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41670 9198 8095 gene locus_tag LOCUS_41680 9198 8095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41680 9738 9343 gene locus_tag LOCUS_41690 9738 9343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41690 9820 10242 gene locus_tag LOCUS_41700 9820 10242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41700 10552 10244 gene locus_tag LOCUS_41710 10552 10244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41710 11022 10768 gene locus_tag LOCUS_41720 11022 10768 CDS product redoxin NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041322946.1 protein_id gnl|my_center|LOCUS_41720 11176 11394 gene locus_tag LOCUS_41730 11176 11394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41730 11655 11281 gene locus_tag LOCUS_41740 11655 11281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41740 12449 11652 gene locus_tag LOCUS_41750 12449 11652 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228058.1 protein_id gnl|my_center|LOCUS_41750 13069 12650 gene locus_tag LOCUS_41760 13069 12650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 14377 13436 gene locus_tag LOCUS_41770 14377 13436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41770 15153 14719 gene locus_tag LOCUS_41780 15153 14719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41780 15311 15168 gene locus_tag LOCUS_41790 15311 15168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41790 16563 15682 gene locus_tag LOCUS_41800 16563 15682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41800 17736 16801 gene locus_tag LOCUS_41810 17736 16801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41810 19601 18159 gene locus_tag LOCUS_41820 19601 18159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41820 19856 20245 gene locus_tag LOCUS_41830 19856 20245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41830 20723 20358 gene locus_tag LOCUS_41840 20723 20358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41840 21536 20886 gene locus_tag LOCUS_41850 21536 20886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41850 22019 21777 gene locus_tag LOCUS_41860 22019 21777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41860 22848 22219 gene locus_tag LOCUS_41870 22848 22219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41870 23524 24348 gene locus_tag LOCUS_41880 23524 24348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41880 27244 25262 gene locus_tag LOCUS_41890 27244 25262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41890 27596 27366 gene locus_tag LOCUS_41900 27596 27366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41900 27927 27664 gene locus_tag LOCUS_41910 27927 27664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41910 28583 28281 gene locus_tag LOCUS_41920 28583 28281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41920 28925 30121 gene locus_tag LOCUS_41930 28925 30121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41930 30124 30456 gene locus_tag LOCUS_41940 30124 30456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41940 30468 31190 gene locus_tag LOCUS_41950 30468 31190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41950 31190 32626 gene locus_tag LOCUS_41960 31190 32626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41960 32619 34334 gene locus_tag LOCUS_41970 32619 34334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41970 34331 35866 gene locus_tag LOCUS_41980 34331 35866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41980 35874 36947 gene locus_tag LOCUS_41990 35874 36947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41990 36947 38701 gene locus_tag LOCUS_42000 36947 38701 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068079.1 protein_id gnl|my_center|LOCUS_42000 38694 39206 gene locus_tag LOCUS_42010 38694 39206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42010 39687 39517 gene locus_tag LOCUS_42020 39687 39517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42020 39960 40364 gene locus_tag LOCUS_42030 39960 40364 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113894.1 protein_id gnl|my_center|LOCUS_42030 40364 40957 gene locus_tag LOCUS_42040 40364 40957 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067248.1 protein_id gnl|my_center|LOCUS_42040 42111 41587 gene locus_tag LOCUS_42050 42111 41587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42050 42221 42697 gene locus_tag LOCUS_42060 42221 42697 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326320.1 protein_id gnl|my_center|LOCUS_42060 43095 42862 gene locus_tag LOCUS_42070 43095 42862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42070 43677 43216 gene locus_tag LOCUS_42080 43677 43216 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014064.1 protein_id gnl|my_center|LOCUS_42080 44216 43824 gene locus_tag LOCUS_42090 44216 43824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42090 45028 44519 gene locus_tag LOCUS_42100 45028 44519 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902879.1 protein_id gnl|my_center|LOCUS_42100 45193 45744 gene locus_tag LOCUS_42110 45193 45744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42110 45953 46330 gene locus_tag LOCUS_42120 45953 46330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 46587 47291 gene locus_tag LOCUS_42130 46587 47291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42130 47527 48711 gene locus_tag LOCUS_42140 47527 48711 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230945.1 protein_id gnl|my_center|LOCUS_42140 49144 48743 gene locus_tag LOCUS_42150 49144 48743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112674.1 protein_id gnl|my_center|LOCUS_42150 50173 49604 gene locus_tag LOCUS_42160 50173 49604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42160 51128 50358 gene locus_tag LOCUS_42170 51128 50358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42170 51645 51911 gene locus_tag LOCUS_42180 51645 51911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42180 55881 51988 gene locus_tag LOCUS_42190 55881 51988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42190 56177 56560 gene locus_tag LOCUS_42200 56177 56560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42200 57743 56697 gene locus_tag LOCUS_42210 57743 56697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42210 58781 58389 gene locus_tag LOCUS_42220 58781 58389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42220 58671 59060 gene locus_tag LOCUS_42230 58671 59060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42230 59190 59912 gene locus_tag LOCUS_42240 59190 59912 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227392.1 protein_id gnl|my_center|LOCUS_42240 60636 61193 gene locus_tag LOCUS_42250 60636 61193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42250 61644 62630 gene locus_tag LOCUS_42260 61644 62630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42260 63285 62758 gene locus_tag LOCUS_42270 63285 62758 CDS product DUF1643 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263212.1 protein_id gnl|my_center|LOCUS_42270 66060 63532 gene locus_tag LOCUS_42280 66060 63532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42280 67464 66457 gene locus_tag LOCUS_42290 67464 66457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42290 67898 67464 gene locus_tag LOCUS_42300 67898 67464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085100849.1 protein_id gnl|my_center|LOCUS_42300 68429 68100 gene locus_tag LOCUS_42310 68429 68100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42310 68486 69745 gene locus_tag LOCUS_42320 68486 69745 CDS product IS256-like element IS1553 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419623.1 protein_id gnl|my_center|LOCUS_42320 70516 69746 gene locus_tag LOCUS_42330 70516 69746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42330 70998 70600 gene locus_tag LOCUS_42340 70998 70600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42340 72744 71413 gene locus_tag LOCUS_42350 72744 71413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42350 73487 72873 gene locus_tag LOCUS_42360 73487 72873 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074921927.1 protein_id gnl|my_center|LOCUS_42360 73905 74168 gene locus_tag LOCUS_42370 73905 74168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42370 74228 74719 gene locus_tag LOCUS_42380 74228 74719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42380 75006 77961 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gggaacacccccgcctacgcggggaaggg 78297 77980 gene locus_tag LOCUS_42390 78297 77980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42390 <79223 78302 gene locus_tag LOCUS_42400 <79223 78302 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011229111.1:type I-E CRISPR-associated endonuclease Cas1e