COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..383222 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 512..1009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS complement(1078..1722) product Ktr system potassium transporter KtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222311.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 gene ktrC CDS complement(1740..2201) product thiol-disulfide oxidoreductase YkuV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245810.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 gene ykuV CDS complement(2198..3340) product N-acetyldiaminopimelate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301163.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS complement(3384..4091) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218680.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 gene dapD CDS complement(4154..4573) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623565.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS complement(4680..4919) product DUF1797 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218671.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS complement(5019..5249) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS complement(5295..6503) product EAL-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232391.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS complement(6601..7356) product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001987267.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 gene fadH CDS 7556..8350 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002026257.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS complement(8345..8677) product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245812.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 gene crcB CDS complement(8674..9060) product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245042.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS complement(9070..11157) product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423561.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS complement(11160..12671) product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658863.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 gene ppx CDS 12770..13210 product YkyB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232406.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS complement(13301..14878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS complement(14971..16083) product Ger(x)C family spore germination C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987075.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS complement(16080..17180) product GerAB/ArcD/ProY family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095034.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(17177..18640) product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802296.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS complement(18721..21603) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS complement(21596..21970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS complement(21970..25161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS complement(25161..26546) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168007557.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS complement(26539..27579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS complement(27582..29192) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS complement(29209..30114) product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967126.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 gene cheV CDS complement(30185..30823) product DUF1906 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204953390.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS 30969..31550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS complement(31547..32803) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012262.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS 32945..33130 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS 33287..33454 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS 33468..33707 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS 33820..34971 product aminotransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434569.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS complement(34983..35849) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245029.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS complement(35865..36632) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971313.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS complement(36647..37924) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023204.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS complement(37921..39168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS complement(39297..41276) product methyl-accepting chemotaxis protein McpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245443.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 gene mcpC CDS complement(41419..43134) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218638.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 gene ptsP CDS complement(43134..43397) product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154654.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS complement(43490..45502) product PTS glucose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473177.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 gene ptsG CDS complement(45747..46592) product ptsGHI operon transcription antiterminator GlcT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967114.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 gene glcT CDS 46787..47590 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594240.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS complement(47616..48647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS 48822..49583 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125180.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS complement(49597..49944) product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272628.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 gene mnhG CDS complement(49928..50203) product Na(+)/H(+) antiporter subunit F1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228814.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS complement(50200..50676) product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244015.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS complement(50682..52154) product Na+/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989978.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS complement(52147..52479) product Na(+)/H(+) antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220730.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS complement(52479..52901) product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003769105.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(52898..55282) product Na+/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228821.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS 55396..55563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS complement(55565..56857) product heme-based aerotactic transducer HemAT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245216.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 gene hemAT CDS complement(56939..57082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS complement(57153..57368) product DUF2922 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197593.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS complement(57382..57585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS complement(57643..57951) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357080.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS 58061..58663 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231196.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(58815..60074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS complement(60094..60336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS 60593..61117 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003160679.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS complement(61044..61238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218622.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS 61386..61718 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS 61807..61983 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS complement(61999..62688) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042743.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS complement(62806..63138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS complement(63267..64169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS complement(64301..64468) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS complement(64487..65209) product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232460.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 gene queE CDS complement(65209..65646) product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245665.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 gene queD CDS complement(65643..66308) product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711595.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 gene queC CDS 66569..67228 product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251240.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 gene phoU CDS 67324..68139 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS complement(68185..68322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS 68405..70018 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808965.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS complement(70038..70496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(70539..71534) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244712.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS complement(71607..71981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 72074..73048 product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232389.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS 73051..73722 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049879.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS 73706..75115 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494796.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS 75152..76006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS 76137..78224 product ATP-dependent protease ATP-binding subunit ClpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967104.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 gene clpE CDS complement(78237..78884) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711168.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS complement(78892..79923) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266746.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS complement(79920..80636) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187071.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS 81114..82535 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186282.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS complement(82567..83532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS 83878..85293 product DUF3149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669134.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS 85305..86039 product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082259.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS complement(86057..86593) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057305.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS complement(86606..87214) product methylthioribulose 1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244782.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(87211..87867) product 2-hydroxy-3-keto-5-methylthiopentenyl-1-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245748.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 gene mtnX CDS complement(87867..89087) product 2,3-diketo-5-methylthiopentyl-1-phosphate enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014181.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 gene mtnW CDS complement(89345..90517) product methionine-glutamine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244774.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 gene mtnE CDS 90618..91412 product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002204714.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS 91669..92838 product S-methyl-5-thioribose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244973.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 gene mtnK CDS 92849..93883 product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232498.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 gene mtnA CDS 93880..94998 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732065.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS 95010..96488 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002164630.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS 96485..97444 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049242.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS complement(97451..99187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS complement(99241..101424) product sporulation two-component system sensor histidine kinase KinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232504.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 gene kinE CDS complement(101565..102242) product lactate utilization protein LutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228309.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 gene lutC CDS complement(102242..103660) product lactate utilization iron-sulfur protein LutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228307.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 gene lutB CDS complement(103672..104388) product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869148.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS complement(104660..105370) product L-lactate utilization/bacilysin biosynthesis transcriptional regulator LutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968191.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 gene lutR CDS 105580..107349 product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811125.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS 107449..109179 product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462181.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS 109371..109913 product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880077.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS complement(110019..110162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS complement(110159..110314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001997002.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS complement(110311..110451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS 110536..110871 product DUF3905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726024.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS complement(111047..111862) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722710.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS complement(111875..112765) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257890.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS complement(112868..114136) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257891.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS complement(114191..114862) product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228210.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 gene pgmB CDS complement(114877..117219) product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096414.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS complement(117290..118306) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS 118480..120246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS 120322..121425 product sugar diacid recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898619.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS 121521..122933 product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398865.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 gene glcD CDS 122930..124276 product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209630.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS complement(124288..125148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS complement(125236..125739) product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949392.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS complement(125797..126582) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967096.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 note possible pseudo, frameshifted CDS complement(126832..128244) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809373.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS complement(128337..129593) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012262.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS 129731..130897 product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460037.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS complement(130906..131904) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245533.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS complement(131901..133556) product DUF6044 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245165.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS complement(133621..134361) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS complement(134358..135419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(135764..136333) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880118.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS 136505..137140 product FMN-dependent NADH-azoreductase AzoRB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243587.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 gene azoRB CDS complement(137449..138549) product ornithine racemase Orr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156226178.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 gene orr CDS complement(138546..139628) product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143093.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 repeat_region 139800..140375 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaattcctcataggtacgatacaaat CDS complement(140568..141440) product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391725.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS complement(141542..143248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS complement(143375..144790) product malate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338924.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS complement(144810..146222) product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230430.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 gene aspA CDS complement(146223..147233) product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722312.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 gene ansA CDS 147425..147757 product HTH-type transcriptional regulator AnsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399024.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 gene ansR CDS complement(147772..148530) product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872063.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS complement(148530..148703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS 148823..149512 product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943112.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS 149502..149804 product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807927.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS complement(149835..150719) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814724.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS complement(151204..151590) product endoribonuclease MazF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392535.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 gene mazF CDS complement(151590..151841) product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887061.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS complement(152153..152998) product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391719.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 tRNA complement(153146..153218) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS complement(153321..153953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS 154069..154605 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244444.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS complement(154626..155765) product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244787.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 gene metC CDS complement(155769..156872) product cystathionine gamma-synthase/O-acetylhomoserine thiolyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103897.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 gene metI CDS 157437..158003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS 158083..158241 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS complement(158212..158415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS complement(158426..158908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS 159033..159428 product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242893.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 gene mscL CDS 159587..160231 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS 160455..160745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS complement(160771..161286) product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665103.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS 161437..162129 product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084007.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS 162191..162703 product YjcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232861.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS 162708..163139 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543273.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS 163205..163882 product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233805.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS complement(163879..164004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS 164113..166236 product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245380.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS complement(166254..166508) product sporulation-specific transcription regulator SopVIF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232870.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 gene spoVIF CDS complement(166596..166724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS complement(166793..167035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS 167122..167442 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658787.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS complement(167463..167981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS complement(168430..168876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS complement(169013..170728) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(170855..171526) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS complement(172315..173172) product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018922.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS complement(173175..173381) product DUF1657 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215913.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS complement(173388..173744) product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575919.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 gene spoVAE CDS complement(173741..174757) product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938970.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 gene spoVAD CDS complement(174754..175236) product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095399.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 gene spoVAC CDS complement(175249..175704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(175763..175966) product DUF1657 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216166.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS complement(176050..176241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS complement(176258..176380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS complement(176452..176718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS 176874..177593 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS 177683..178354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS complement(178376..178708) product DUF1360 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899662.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS 178834..179166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS 179180..180454 product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398478.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS 180451..181392 product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229036.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS 181395..182531 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229035.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS complement(182515..182871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS complement(182969..183745) product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421886.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 gene fabI CDS complement(183836..185158) product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294561.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 gene mgtE CDS 185271..186434 product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654702.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS 186595..187701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS 187727..188113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS 188180..188917 product bis(5'-nucleosyl)-tetraphosphatase PrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872716.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 gene prpE CDS complement(188914..189792) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079106.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS complement(189805..190596) product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232918.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(190602..191240) product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081482.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS complement(191253..191609) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001180009.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS 191738..192328 product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232924.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS 192325..192933 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS 192990..193394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043381.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS 193384..194190 product protease adaptor protein SpxH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245184.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 gene spxH CDS complement(194617..196413) product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003393.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 gene pepF CDS complement(196451..197635) product competence protein CoiA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628317.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS 197860..198528 product adaptor protein MecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245194.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 gene mecA CDS 198586..200094 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799204.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS complement(200107..200517) product transcriptional regulator SpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720569.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 gene spxA CDS 200766..200957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559980.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS complement(201058..201996) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166346.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS complement(201993..203051) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854337.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS complement(203072..204082) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974106.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS complement(204082..205011) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534167.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS complement(205120..206772) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823441.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS 207059..207388 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS 207701..208690 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245134.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 gene trpS CDS complement(208721..209461) product YjbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966134.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS complement(209538..209744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS complement(209800..210522) product DUF2268 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232967.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS complement(210593..211834) product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412656.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 gene fabF CDS complement(211867..212799) product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100539.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 gene fabH CDS complement(212900..213856) product transcriptional regulator Med inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245494.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 gene med CDS complement(213944..214645) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028712.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS 214785..214964 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS complement(214990..217572) product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365401.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 gene clpB CDS complement(217658..217837) product YjzC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245356.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS complement(217927..218871) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868438.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 gene argF CDS complement(218868..221972) product carbamoyl phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232982.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS complement(221965..223032) product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232984.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS complement(223082..224239) product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200540.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS complement(224236..224994) product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232987.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 gene argB CDS complement(225006..226232) product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598387.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 gene argJ CDS complement(226247..227272) product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861219.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 gene argC CDS 227447..228130 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013859.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS complement(228149..228856) product YwiC-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779966.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS complement(228927..229682) product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233006.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS 229791..230597 product 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YitU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233007.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 gene yitU CDS 230686..230838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS 230840..231013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS complement(231038..231871) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364431.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS 231959..232822 product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245785.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS 232852..232977 product DUF3941 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120851.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS complement(233009..234661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS complement(234674..235639) product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964021.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS 235807..236298 product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233034.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS 236559..238406 product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245847.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS 238399..241788 product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271582.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 gene metH CDS complement(241813..242334) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229235.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 gene cobO CDS complement(242328..243077) product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521262.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 gene cobA CDS complement(243070..244095) product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258437.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 gene cobT CDS complement(244097..245599) product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437761.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS complement(245592..246950) product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943636.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS complement(246947..248026) product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828196.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS complement(248028..248795) product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871103.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 gene cobM CDS complement(248792..249493) product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914028.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 gene cobI CDS complement(249483..250694) product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649057.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(250660..251772) product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258428.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS complement(251775..252422) product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943629.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS complement(252423..253199) product precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896460.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 gene cobK CDS complement(253210..254037) product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028014.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS complement(254043..255563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS complement(255570..256349) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166908820.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS complement(256333..257055) product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058272.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 gene cbiQ CDS complement(257048..257314) product energy-coupling factor ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895390.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS complement(257311..258063) product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258436.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS complement(258060..258422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS complement(258831..259865) product maltose operon transcriptional repressor MalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219053.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 gene malR CDS complement(259882..262209) product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989370.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS complement(262229..263743) product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042441161.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS complement(263840..264682) product maltosaccharide ABC transporter permease MalD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001022608.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 gene malD CDS complement(264684..265967) product maltosaccharide ABC transporter permease MalC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194988.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 gene malC CDS complement(266079..267371) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709916.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS 267646..269409 product alpha-glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910456.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS complement(269393..270241) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966961.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS 270365..271708 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233074.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS complement(271686..273131) product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_134752840.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 gene crtI CDS complement(273128..274210) product hydroxychlorobactene glucosyltransferase CruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933643.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 gene cruC CDS complement(274207..274872) product hydroxychlorobactene glucoside lauroyltransferase CruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932647.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 gene cruD CDS complement(274869..275597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS complement(275584..276435) product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642485.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS complement(276435..277859) product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102097.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 gene crtI CDS complement(277859..279379) product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334293.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS complement(279461..281320) product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333979.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 gene asnB CDS 281436..281957 product DUF2777 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616046.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS complement(281951..283897) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS complement(284014..284370) product YisL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244937.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS 284522..285712 product ornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616652.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 gene rocD CDS complement(285735..286598) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213071.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS 286785..286964 product aspartyl-phosphate phosphatase YisI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233086.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 gene yisI CDS complement(286970..288079) product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244185.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS complement(288151..289743) product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289110.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS 289885..290109 product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233096.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS 290113..290334 product spore germination protein GerPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001111188.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 gene gerPA CDS 290347..290559 product spore germination protein GerPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233090.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 gene gerPB CDS 290633..291217 product spore germination protein GerPC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070767.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 gene gerPC CDS 291214..291411 product spore germination protein GerPD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233093.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 gene gerPD CDS 291408..291806 product spore germination protein GerPE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886467.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS 291781..292002 product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233096.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS complement(291999..292277) product HNH nuclease-like protein HlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245113.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 gene hlpB CDS complement(292290..295649) product exonuclease subunit SbcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245201.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 gene sbcC CDS complement(295649..296809) product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233099.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS complement(296811..300440) product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572274.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 gene addA CDS complement(300445..303909) product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244988.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 gene addB CDS complement(303926..304528) product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347516.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS complement(304594..305112) product competence protein ComK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444443.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS complement(305314..306348) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS 306800..307408 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400779.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS complement(307486..308772) product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787342.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 gene aceA CDS complement(308990..310237) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233297.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS 310382..310972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS 311051..313426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS complement(313439..314233) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856990.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS complement(314199..315173) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811777.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS complement(315191..316177) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439336.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS complement(316283..317833) product fatty acid--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055172.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS complement(317971..318213) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS complement(318465..319127) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS complement(319139..320974) product cyclic nucleotide-binding/CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014260.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS complement(321030..322679) product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228221.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS complement(322706..323008) product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546253.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS complement(322995..323198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS complement(323388..324122) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784668.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS 324276..324407 product protein YhfH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886464.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 gene yhfH CDS complement(324436..326145) product oligo-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415207.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 gene malL CDS complement(326164..326991) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888075.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS complement(327003..328298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS complement(328368..329675) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888077.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS complement(329714..330733) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103715.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS complement(330869..333178) product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245424.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS complement(333253..333822) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963381.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS complement(333924..335342) product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001228080.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 gene hemY CDS complement(335339..336286) product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244736.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 gene hemH CDS complement(336294..337334) product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000252605.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 gene hemE CDS 337525..338031 product heme-degrading oxygenase HmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244748.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 gene hmoB CDS complement(338047..338415) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092318.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS 338512..339687 product N-acetyl amino acid acetylase SndC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245681.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 gene sndC CDS complement(339698..340882) product ABC transporter permease EcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089155.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 gene ecsB CDS complement(340875..341618) product ABC transporter ATP-binding protein EcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292603.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 gene ecsA CDS 342025..342444 product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016840.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS complement(342484..343317) product peptidylprolyl isomerase PrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245079.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 gene prsA CDS 343396..343575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS complement(343611..343790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172690.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS 343928..344269 product YhaI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966921.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS complement(344249..344860) product HTH-type transcriptional regulator Hpr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834924.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS 344984..345166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS complement(345212..345733) product tryptophan transporter TrpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233236.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 gene trpP CDS complement(345832..346908) product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233234.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 gene serC CDS complement(347011..347178) product sporulation YhaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449223.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS 347300..347485 product YhzD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000539551.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS complement(347505..348995) product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924633.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS complement(349074..349934) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640427.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS complement(350006..350350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS complement(350413..351522) product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195186.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS complement(351563..351856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS 351954..352103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS 352178..353059 product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242549.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS 353173..354285 product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818931.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 gene ugpC CDS complement(354315..354557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510476.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS 354782..354982 product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113545.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS complement(355020..355754) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623610.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS complement(355774..356382) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281501.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS complement(356462..357244) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732840.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS complement(357346..358611) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869172.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS complement(358889..359677) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002035802.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 gene thiD CDS complement(359682..360698) product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065417.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 gene thiF CDS complement(360695..361465) product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931981.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 gene thiG CDS complement(361467..361670) product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084514.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 gene thiS CDS complement(361654..362775) product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333314.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 gene thiO CDS complement(362763..363377) product thiazole tautomerase TenI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787188.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 gene tenI CDS complement(363379..364173) product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273253.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS complement(364170..365612) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485331.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS complement(365625..366209) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033477.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS complement(366190..366885) product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144491.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 gene tenA CDS 367213..368397 product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS complement(368684..369190) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS complement(369319..370983) product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044735.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS complement(371176..372783) product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437649.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS complement(372789..373232) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132361.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS 373368..374786 product stage V sporulation protein SpoVR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233364.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 gene spoVR CDS 374875..375840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS 375837..376769 product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937986.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS complement(376774..377232) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283897.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS 377333..377581 product YhdB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233373.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS complement(377610..378317) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051345837.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS complement(378390..380129) product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244986.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 gene pgcA CDS complement(380238..380663) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245462.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS 380797..381225 product disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000532263.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS 381222..381686 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738459.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS complement(381711..382103) product YhcU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233401.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS 382208..383119 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448370.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 sequence02 source 1..300763 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(127..1005) product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230220.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS complement(1080..1508) product transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143076.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 gene mntR CDS complement(1578..2603) product spore photoproduct lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009879610.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 gene splB CDS complement(2719..3330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS complement(3414..3731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS complement(4500..6458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS complement(6619..7455) product octanoyltransferase LipM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398586.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 gene lipM CDS 7582..7953 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108653.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS complement(7984..9438) product aminomethyl-transferring glycine dehydrogenase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795698.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 gene gcvPB CDS complement(9431..10777) product aminomethyl-transferring glycine dehydrogenase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903240.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 gene gcvPA CDS complement(10795..11889) product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631769.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 gene gcvT CDS 12308..13951 product SNF2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100021.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS 13938..14708 product YqhG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183964.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS complement(14723..14911) product YqzE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230176.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS complement(14938..15444) product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836631.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 gene aroK CDS complement(15459..15875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS complement(15847..16269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS complement(16266..16574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS complement(16558..16995) product competence type IV pilus minor pilin ComGD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813141.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 gene comGD CDS complement(16988..17284) product competence type IV pilus major pilin ComGC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732258.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 gene comGC CDS complement(17299..18330) product competence type IV pilus assembly protein ComGB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110378.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 gene comGB CDS complement(18314..19384) product competence protein ComGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399124.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 gene comGA CDS complement(19493..19864) product transcriptional regulator MgsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230147.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 gene mgsR CDS 20054..20752 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434132.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS 20822..21064 product DUF2626 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440716.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS complement(21093..22163) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181859.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS complement(22313..22945) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967732.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS 23078..23263 product DUF2759 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524853.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS complement(23290..24159) product M14 family metallocarboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886566.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS complement(24284..26146) product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399146.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS complement(26413..27378) product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391701.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 gene glcK CDS complement(27386..27595) product YqgQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253699.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS complement(27706..29151) product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811050.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS 29273..30124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS complement(30095..31624) product rhomboid protease YqgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230128.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 gene yqgP CDS complement(31684..31869) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS complement(31946..32896) product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715345.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS complement(33054..33626) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642751.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS complement(33681..33830) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003153056.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 gene rpmG CDS complement(33911..36298) product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000679311.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS 36443..36760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS 36757..37173 product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003734026.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS complement(37203..37862) product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251234.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 gene phoU CDS complement(37921..38733) product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226686.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 gene pstB CDS complement(38760..39641) product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450297.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 gene pstA CDS complement(39644..40594) product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204619.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 gene pstC CDS complement(40670..41641) product phosphate ABC transporter substrate-binding protein PhoX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871265.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 gene phoX CDS complement(41757..43910) product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039006.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS complement(43972..45186) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871370.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS complement(45278..45886) product superoxide dismutase SodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398583.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 gene sodA tRNA complement(46054..46127) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS 46260..47030 product DUF1189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230089.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS complement(47043..48785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS 48949..49260 product LysM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230087.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS 49340..50434 product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886567.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 gene ispG CDS complement(50457..50795) product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886568.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS 50926..51501 product nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246215.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS complement(51504..51929) product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398578.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 gene zur CDS complement(51936..52769) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613815.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS complement(52784..53539) product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059649.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS complement(53598..54473) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435958.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS 54558..54812 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS complement(54836..55723) product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967756.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS complement(55737..57017) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121678890.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS 57175..57636 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS 57705..58652 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706669.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 gene ispH CDS complement(58662..59780) product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036241.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS complement(59777..60481) product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006551.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS complement(60572..60934) product cytochrome c-550 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230068.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 gene cccA CDS complement(61044..61580) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS complement(61655..62773) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764065.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 gene rpoD CDS complement(62766..64577) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230066.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 gene dnaG CDS complement(64883..65689) product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230064.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS complement(65702..66301) product transcriptional regulator CcpN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003237058.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 gene ccpN CDS complement(66423..67184) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230055.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 gene recO CDS complement(67204..67347) product YqzL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230053.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS complement(67447..68355) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080241.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 gene era CDS complement(68422..68811) product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027339.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS complement(68815..69282) product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054684.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 gene ybeY CDS complement(69339..70301) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840501.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS complement(70305..71492) product sporulation protein YqfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792478.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 gene yqfD CDS complement(71504..71788) product sporulation protein YqfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732266.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 gene yqfC CDS complement(71842..72171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS complement(72182..73171) product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230026.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 gene floA CDS complement(73168..73830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS complement(73922..74365) product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230022.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS complement(74380..74553) product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003152957.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 gene rpsU CDS complement(74654..76006) product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230017.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 gene mtaB CDS complement(76017..76766) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190154.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS complement(76781..77719) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398884.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 gene prmA CDS complement(77743..78864) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230010.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 gene dnaJ CDS complement(78996..80813) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398786.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 gene dnaK CDS complement(80827..81411) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392710.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 gene grpE CDS complement(81478..82512) product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246126.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 gene hrcA CDS complement(82590..83732) product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249433.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 gene hemW CDS complement(83780..85606) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229999.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 gene lepA CDS complement(85701..86006) product YqxA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399162.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS complement(86016..87182) product spore autolysin SpoIIP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229993.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 gene spoIIP CDS complement(87251..88354) product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662627.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 gene gpr CDS 88547..88813 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274011.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 gene rpsT CDS 88871..89551 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392343.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS complement(89560..90519) product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279906.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 gene holA CDS 90780..90914 product YqzM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229983.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS complement(90963..93068) product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009879844.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS complement(93028..93219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS complement(93216..93683) product ComE operon protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439774.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS complement(93729..94316) product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000989944.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS 94394..95224 product late competence protein ComER inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020554.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 gene comER CDS complement(95286..96026) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105572.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS complement(96023..96379) product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229971.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 gene rsfS CDS complement(96376..96951) product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399059.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 gene yqeK CDS complement(96941..97507) product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398676.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS complement(97518..97811) product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955224.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 gene yhbY CDS complement(97805..98632) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812076.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 gene aroE CDS complement(98653..99756) product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229966.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 gene yqeH CDS complement(99762..100274) product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765314.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS 100561..100701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS complement(100710..101507) product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255000.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS 101632..102171 product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963995.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 gene pssA CDS 102289..103089 product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244739.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 gene motA CDS 103073..103828 product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232473.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 gene motB CDS complement(103856..105184) product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383526.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS 105337..105726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS complement(105732..107228) product site-specific DNA recombinase SpoIVCA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886573.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 gene spoIVCA CDS complement(107420..107584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS complement(107568..107924) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS complement(107911..108258) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS complement(108227..108883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS complement(108883..109236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS complement(109236..109640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS complement(109640..109777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS complement(109771..110052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS complement(110052..110528) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS complement(110680..112419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS complement(112425..113024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS complement(113591..113782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS complement(113844..114062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS complement(114067..114225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS complement(114504..114725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS complement(114927..115220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS complement(115375..115710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS complement(115827..116009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS complement(116006..116191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS complement(116184..116606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS complement(116724..119021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS complement(119031..119249) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS complement(119391..119522) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS complement(119540..119797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS complement(119819..120049) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS complement(120068..120292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS 120453..120809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS 120802..121497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS 121594..122091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS 122088..122519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS complement(122555..123322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS complement(123510..123887) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05540 note possible pseudo, internal stop codon, frameshifted CDS complement(124001..124633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05550 note possible pseudo, internal stop codon, frameshifted repeat_region 124698..126708 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaattcctcataggtacgatacaaac CDS complement(126890..127639) product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545251.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 gene cas6 CDS complement(127654..127917) product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817554.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 gene cas2 CDS complement(127928..128935) product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817555.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 gene cas1b CDS complement(128938..129447) product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460582.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 gene cas4 CDS complement(129435..131906) product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582994.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS complement(131953..132687) product type I-B CRISPR-associated protein Cas5b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582995.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 gene cas5b CDS complement(132703..133638) product type I-B CRISPR-associated protein Cas7/Csh2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582996.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 gene cas7b CDS complement(133663..135624) product type I-B CRISPR-associated protein Cas8b/Csh1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181363066.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 gene cas8b CDS 135937..136560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05640 repeat_region 136599..138604 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaattcctcataggtacgatacaaac CDS complement(138977..139207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS complement(139271..140404) product bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201906.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS complement(140406..141329) product O-acetylserine dependent cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103859.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS complement(141374..142072) product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967881.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 gene mtnN CDS complement(142091..142729) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000536320.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS 142866..143069 product YrzA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010984.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS complement(143074..143664) product YrrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246156.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS complement(143661..145409) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398903.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS complement(145457..145933) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399078.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 gene greA CDS complement(146025..146660) product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225916.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 gene udk CDS complement(146662..147915) product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229802.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS complement(147932..148861) product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742806.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS complement(148863..149510) product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389102.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS complement(149620..150702) product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229799.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 gene mltG CDS complement(150865..152040) product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599321.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS complement(152220..152513) product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246199.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS complement(152519..152941) product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229795.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 gene ruvX CDS complement(152946..153212) product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225903.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS complement(153296..155929) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811825.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 gene alaS CDS complement(156239..157297) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967889.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS complement(157387..157521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS complement(157538..157729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225893.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS complement(157832..160180) product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528070.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS complement(160198..160854) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066409.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS complement(160917..162014) product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038010.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 gene mnmA CDS complement(162029..163174) product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439881.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS complement(163190..163606) product cysteine metabolism transcriptional regulator CymR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225879.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 gene cymR CDS complement(163680..164963) product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812943.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS complement(164973..165782) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659648.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS complement(165862..168921) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033498.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS complement(169067..169831) product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967893.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS complement(170188..171966) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840895.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 gene aspS CDS complement(171978..173249) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003161280.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 gene hisS CDS complement(173584..174843) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723525.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS 174976..175149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242605.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS complement(175185..175625) product D-tyrosyl-tRNA(Tyr) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266954.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS complement(175640..177838) product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229747.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 gene relA CDS complement(177942..178454) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229745.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS complement(178420..180780) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941257.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 gene recJ CDS complement(180834..181727) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409725.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS complement(181811..184057) product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245970.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 gene secDF CDS complement(184153..184425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS 184517..186040 product stage V sporulation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398529.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 gene spoVB CDS complement(186041..186688) product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454832.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS 186779..187153 product TIGR04086 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229729.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS complement(187179..187442) product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398708.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 gene yajC CDS complement(187457..188596) product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125362.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 gene tgt CDS complement(188617..189648) product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229723.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 gene queA CDS complement(189673..189879) product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138162.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS complement(189876..190874) product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344449.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 gene ruvB CDS complement(190891..191487) product Holliday junction DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000464511.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 gene ruvA CDS complement(191595..192041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS complement(192109..192846) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398802.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS complement(192931..193626) product spore germination protein SgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245996.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 gene sgpA CDS complement(193704..194444) product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437535.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 gene nadE CDS complement(194520..195425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS complement(195561..196664) product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025295.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 gene nadA CDS complement(196677..197507) product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092231.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 gene nadC CDS complement(197504..199036) product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138531.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 gene nadB CDS 199126..200265 product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973777.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS 200262..200795 product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812275.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS complement(200808..201671) product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621730.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 gene pheA CDS complement(201686..202126) product transcriptional regulator ThrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222630.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 gene thrR CDS complement(202149..203435) product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246161.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 gene obgE CDS complement(203468..204010) product sporulation initiation phosphotransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037006.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS complement(204103..204393) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944958.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 gene rpmA CDS complement(204407..204742) product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973720.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS complement(204753..205061) product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000270907.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 gene rplU CDS complement(205199..206062) product stage IV sporulation intramembrane metalloprotease SpoIVFB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398649.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 gene spoIVFB CDS complement(206055..206783) product stage IV sporulation protein SpoIVFA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797463.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 gene spoIVFA CDS complement(206870..207676) product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398624.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 gene minD CDS complement(207679..208362) product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391517.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 gene minC CDS complement(208409..208933) product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398811.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 gene mreD CDS complement(208930..209790) product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135499.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 gene mreC CDS complement(209810..210832) product cell shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229650.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 gene mreB CDS complement(210917..211591) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246034.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 gene radC CDS complement(211621..212190) product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226275.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS complement(212302..213081) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS complement(213187..213627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS complement(213641..214267) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(214264..214845) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS complement(214829..215797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS complement(215810..216577) product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886586.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS complement(216558..217007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS complement(217084..218295) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393061.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS complement(218301..219335) product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393062.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS complement(219346..221007) product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393063.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS complement(221004..222242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS complement(222256..223002) product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459933.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(222999..224228) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS 224317..224907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS 224891..225460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS 225473..227110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS complement(227120..227968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS complement(227987..231409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS complement(231468..232772) product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582053.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 gene folC CDS complement(232836..235460) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398606.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 gene valS CDS 235861..236052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222590.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS complement(236037..236951) product spore coat protein YsxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367002.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 gene ysxE CDS complement(236964..237854) product stage VI sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179738.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 gene spoVID CDS complement(238055..238465) product antitoxin YezG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997349.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS complement(238468..239988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS complement(240214..241503) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398699.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 gene hemL CDS complement(241503..242477) product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087065.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 gene hemB CDS complement(242479..243228) product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992336.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 gene hemD CDS complement(243229..244155) product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226407.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 gene hemC CDS complement(244177..244992) product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222575.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS complement(245005..246339) product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547860.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 gene hemA CDS 246516..246989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS complement(247030..247611) product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229621.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 gene yihA CDS complement(247608..249932) product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097310.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 gene lon CDS complement(250046..251704) product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398923.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 gene lonB CDS complement(251812..253074) product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472289.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 gene clpX CDS complement(253270..254556) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229611.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 gene tig CDS complement(254658..255578) product DNA damage checkpoint antagonist DdcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229609.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 gene ddcA CDS complement(255662..256246) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229606.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 gene leuD CDS complement(256258..257673) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229604.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 gene leuC CDS complement(257685..258794) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399139.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 gene leuB CDS complement(258813..260357) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967929.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS complement(260344..261369) product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222549.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 gene ilvC CDS complement(261387..261908) product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399096.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 gene ilvN CDS complement(261902..263620) product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398643.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 gene ilvB CDS complement(263957..264859) product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005489.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 gene ilvE tRNA complement(265415..265489) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS complement(265570..266082) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229585.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS complement(266079..266690) product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932644.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS complement(266687..267454) product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261764.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS complement(267548..268594) product spore germination protein GerM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229578.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 gene gerM CDS complement(268685..269482) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774002.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 gene racE CDS complement(269592..269801) product spore germination transcription factor GerE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003184172.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 gene gerE CDS complement(269888..270337) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822741.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS complement(270425..271186) product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229569.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 gene sdhB CDS complement(271183..272943) product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229567.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 gene sdhA CDS complement(272967..273575) product succinate dehydrogenase cytochrome B558 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222512.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 gene sdhC CDS 273861..274292 product YslB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042224.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS complement(274303..276084) product excinuclease ABC subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544275.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 gene uvrC CDS complement(276077..277477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS complement(277525..278448) product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706367.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS complement(278467..279213) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS complement(279288..280010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS complement(280007..281449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS complement(281446..282294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS complement(282353..283297) product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403393.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS complement(283379..284587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS complement(284712..285026) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222500.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 gene trxA CDS complement(285173..286150) product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101963.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 gene etfA CDS complement(286167..286940) product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029028.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 gene etfB CDS complement(286956..287723) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911295.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS complement(287763..288344) product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742222.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS complement(288441..290117) product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181877.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS complement(290311..290718) product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003237674.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS complement(290730..293075) product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893750.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS complement(293095..294804) product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867515.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 gene polX CDS complement(294854..295393) product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229537.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS complement(295386..295679) product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082701.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 gene zapA CDS complement(295784..296338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS complement(296325..296555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS complement(296621..299743) product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185141306.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS complement(299740..300189) product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721623.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS 300311..300685 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07230 sequence03 source 1..258559 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(70..207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS complement(372..1748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS complement(2066..2626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07260 note possible pseudo, internal stop codon CDS complement(2639..3505) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211231800.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 note possible pseudo, internal stop codon, frameshifted CDS complement(3996..4286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07280 note possible pseudo, internal stop codon CDS complement(4371..5141) product DUF817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399435.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS complement(5157..5372) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231396.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS complement(5383..5862) product DUF2975 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399412.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS complement(6097..6561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963451.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS complement(6778..7029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS complement(7184..7555) product iron chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989448.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS 7716..8690 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267092.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS 8687..9073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS complement(9105..10106) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS complement(10244..10636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS complement(10666..11127) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS complement(11198..11977) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619789.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS 12149..12721 product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811907.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS complement(12769..13476) product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687920.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS complement(13697..14563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS complement(14578..14907) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813646.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS complement(15126..15503) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800772.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS complement(15555..16679) product conserved virulence factor C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398677.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS complement(16815..17243) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS complement(17391..17789) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400455.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 note possible pseudo, frameshifted CDS complement(17999..20122) product Piwi domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880937.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS complement(20186..20701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS complement(21021..21164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS complement(21262..22014) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS complement(22123..22941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS complement(23068..24102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS complement(24099..26045) product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858944.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS complement(26075..26443) product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075358.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS complement(26490..27833) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775027.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS complement(27964..28104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS complement(28120..28980) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263073.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS complement(29049..29495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS complement(29690..31180) product malate:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069158.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS complement(31442..32095) product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578704.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS 32254..32628 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS complement(32792..33796) product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895264.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS complement(33893..35131) product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209536.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS complement(35242..36699) product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886399.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 gene putP CDS complement(36785..37699) product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436772.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS complement(37721..39268) product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243454.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 gene pruA CDS complement(39367..40569) product proline utilization transcriptional regulator PutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234651.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 gene putR CDS complement(40651..41604) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008843.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS complement(41605..42651) product guanosine ABC transporter permease NupP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243735.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 gene nupP CDS complement(42648..44177) product guanosine ABC transporter ATP-binding protein NupO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228830.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 gene nupO CDS complement(44302..45393) product guanosine ABC transporter substrate-binding protein NupN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228831.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 gene nupN CDS complement(45501..46226) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114176.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS complement(46429..48669) product DNA translocase SpoIIIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245350.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 gene spoIIIE CDS complement(48734..48958) product YlzJ-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605024.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS complement(48955..49668) product translocation-enhancing protein TepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245712.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 gene tepA CDS complement(49779..51440) product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823087.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS complement(51543..52412) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000564763.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 gene dapA CDS complement(52425..53651) product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692470.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 gene dapG CDS complement(53674..54723) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414849.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 gene asd CDS complement(54829..55422) product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049484.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 gene dpaB CDS complement(55419..56321) product dipicolinic acid synthetase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954735.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 gene dpaA CDS complement(56436..56672) product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231890.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS complement(56731..57972) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592994.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS complement(57965..58927) product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244721.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS complement(59048..61156) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231897.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 gene pnp CDS complement(61266..61535) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220957.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 gene rpsO CDS complement(61618..62589) product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766706.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 gene ribF CDS complement(62599..63495) product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399352.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 gene truB CDS complement(63543..63902) product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776437.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 gene rbfA CDS complement(63917..64195) product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220950.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS complement(64192..66378) product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036343.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 gene infB CDS complement(66397..66696) product YlxQ family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220946.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS complement(66686..66970) product glucose-induced regulator RulR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967250.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 gene rulR CDS complement(66972..68075) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231912.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 gene nusA CDS complement(68103..68573) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231915.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 gene rimP CDS complement(68722..73014) product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245843.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS complement(73120..74814) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814310.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 gene proS CDS complement(74844..76100) product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090228.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 gene rseP CDS complement(76116..77261) product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245155.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 gene dxr CDS complement(77277..78044) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813583.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 gene cdsA CDS complement(78051..78815) product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231925.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS complement(78909..79460) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531501.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 gene frr CDS complement(79462..80184) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042668.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 gene pyrH CDS complement(80247..81128) product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018578.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 gene tsf CDS complement(81258..81965) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220918.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 gene rpsB CDS complement(82105..82548) product swarming motility protein SwrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967248.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 gene swrB CDS complement(82559..82816) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS complement(82859..83590) product RNA polymerase sigma-28 factor SigD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220911.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 gene sigD CDS complement(83623..83937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS complement(83937..84437) product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244852.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 gene cheD CDS complement(84430..85065) product CheY-P phosphatase CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231935.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 gene cheC CDS complement(85073..85504) product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939190.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS complement(85530..87536) product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245734.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 gene cheA CDS complement(87551..88612) product protein-glutamate O-methylesterase CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245823.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 gene cheB CDS complement(88625..89494) product flagellum location/number ATPase FlhG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886507.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 gene flhG CDS complement(89491..90591) product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231945.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 gene flhF CDS complement(90588..92624) product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231947.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 gene flhA CDS complement(92655..93737) product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231949.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 gene flhB CDS complement(93739..94509) product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245510.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 gene fliR CDS complement(94515..94784) product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220888.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 gene fliQ CDS complement(94800..95465) product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245692.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 gene fliP CDS complement(95458..96084) product flagella biosynthesis regulatory protein FliZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231958.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 gene fliZ CDS complement(96097..96456) product chemotaxis protein CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244957.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 gene cheY CDS complement(96476..97627) product flagellar motor switch phosphatase FliY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231962.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 gene fliY CDS complement(97617..98615) product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220879.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 gene fliM CDS complement(98647..99075) product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231964.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 gene fliL CDS complement(99062..99289) product swarming motility protein SwrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231966.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 gene swrD CDS complement(99331..100719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS complement(100797..101159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS complement(101173..101640) product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231970.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 gene flgD CDS complement(101652..102896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS complement(102911..103519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS complement(103526..103969) product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231977.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 gene fliJ CDS complement(103977..105290) product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244825.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 gene fliI CDS complement(105287..106057) product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967242.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 gene fliH CDS complement(106050..107069) product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231981.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 gene fliG CDS complement(107083..108669) product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886506.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 gene fliF CDS complement(108699..108992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS complement(109004..109441) product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245521.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 gene flgC CDS complement(109445..109825) product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245656.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 gene flgB CDS complement(109968..110747) product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220850.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 gene codY CDS complement(110760..112142) product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245556.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 gene hslU CDS complement(112156..112698) product ATP-dependent protease proteolytic subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000526272.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 gene hslV CDS complement(112713..113615) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101227.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 gene xerC CDS complement(113676..114974) product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244725.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 gene trmFO CDS complement(115020..117089) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245599.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 gene topA CDS complement(117194..118081) product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818032.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 gene dprA CDS complement(118143..119045) product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115178.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 gene sucD CDS complement(119065..120225) product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020785.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 gene sucC CDS complement(120344..120610) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS complement(120607..121773) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS complement(121775..122545) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174721.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 gene rnhB CDS complement(122612..123457) product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967235.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 gene ylqF CDS complement(123481..124032) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711857.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 gene lepB CDS complement(124105..124449) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220825.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 gene rplS CDS complement(124575..125312) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686892.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 gene trmD CDS complement(125309..125824) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170268.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 gene rimM CDS complement(125830..126213) product YlqD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008948139.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS complement(126262..126489) product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728421.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS complement(126493..126765) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220815.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 gene rpsP CDS complement(126861..128201) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863461.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 gene ffh CDS complement(128214..128546) product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891062.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS complement(128618..129616) product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007650.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 gene ftsY CDS complement(129623..133183) product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232028.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 gene smc CDS complement(133243..133959) product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146875.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 gene rncS CDS complement(134029..134265) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154310.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 gene acpP CDS complement(134324..135061) product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232035.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 gene fabG CDS complement(135064..136005) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516948.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 gene fabD CDS complement(136017..137006) product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684110.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 gene plsX CDS complement(137003..137587) product transcription factor FapR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232044.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 gene fapR CDS complement(137663..139711) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006884.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 gene recG CDS complement(139704..140591) product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232049.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 gene sdaAA CDS complement(140616..141278) product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232050.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 gene sdaAB CDS complement(141365..143023) product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027130.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS complement(143041..143403) product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232054.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS 143624..143809 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638622.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 gene rpmB CDS complement(143840..144004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS complement(143994..144632) product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245470.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS complement(144663..145319) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589966.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 gene rpe CDS complement(145322..146203) product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113932.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 gene rsgA CDS complement(146215..148140) product serine/threonine protein kinase PrkC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232062.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 gene prkC CDS complement(148147..148896) product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648703.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS complement(148947..149996) product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232066.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 gene rlmN CDS complement(149993..151339) product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249680.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 gene rsmB CDS complement(151332..152276) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598811.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 gene fmt CDS complement(152273..152746) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279468.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 gene def CDS complement(152764..155178) product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666732.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 gene priA CDS complement(155175..156377) product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911762.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 gene coaBC CDS complement(156446..156655) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933970.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 gene rpoZ CDS complement(156657..157277) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232083.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 gene gmk CDS complement(157302..158180) product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967215.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS complement(158283..160952) product calcium-translocating P-type ATPase, SERCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104785.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 161054..162766 product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863284.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS 162870..163487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS complement(163521..164135) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711449.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 gene pyrE CDS complement(164135..164848) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083510.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 gene pyrF CDS complement(164820..165758) product dihydroorotate oxidase B catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081049.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 gene pyrD CDS complement(165755..166519) product dihydroorotate oxidase B electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983358.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 gene pyrK CDS complement(166516..169707) product carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232113.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 gene carB CDS complement(169700..170794) product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828679.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS complement(170791..172077) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108375.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 gene pyrC CDS complement(172043..172966) product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018849.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 gene pyrB CDS complement(173109..174401) product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435928.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 gene uraA CDS complement(174520..175056) product bifunctional pyrimidine operon transcriptional regulator/uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232127.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 gene pyrR CDS complement(175420..176331) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005836.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS complement(176306..176794) product lipoprotein signal peptidase LspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642185.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 gene lspA CDS complement(176870..179626) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455930.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 gene ileS2 CDS complement(179932..180435) product septum site-determining protein DivIVA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221468.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 gene divIVA CDS complement(180499..181272) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002164454.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS complement(181272..181544) product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221463.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS complement(181547..181969) product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244791.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 gene sepF CDS complement(181969..182652) product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218005.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS complement(182657..183460) product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209009.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 gene pgeF CDS complement(183530..183772) product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232153.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS complement(183888..184667) product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967190.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 gene sigG CDS complement(184733..185452) product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976948.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 gene sigE CDS complement(185500..186393) product sigma-E processing peptidase SpoIIGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000261975.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 gene spoIIGA CDS complement(186524..187642) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232167.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 gene ftsZ CDS complement(187669..188949) product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087551.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 gene ftsA CDS complement(189030..189389) product small basic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238683.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS complement(189395..190108) product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967184.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS complement(190123..190827) product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245024.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS complement(190799..191581) product cell division protein DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232178.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 gene divIB CDS complement(191713..192621) product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232182.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 gene murB CDS complement(192662..193753) product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181833.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 gene murG CDS complement(193809..194909) product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244810.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 gene spoVE CDS complement(194942..196276) product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860120.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 gene murD CDS complement(196276..197250) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232192.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 gene mraY CDS complement(197274..198785) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766313.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 gene murE CDS complement(198806..200722) product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245048.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS complement(200787..202892) product penicillin-binding protein 2B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968930.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 gene pbpB CDS complement(202971..203333) product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723754.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 gene ftsL CDS complement(203351..204283) product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481788.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 gene rsmH CDS complement(204432..206042) product bacillithiol biosynthesis cysteine-adding enzyme BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403059.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 gene bshC CDS complement(206062..206457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS complement(206454..207347) product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782397.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 gene panE CDS complement(207416..207862) product RsfA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246467.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS complement(207923..208675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS complement(208778..208951) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154457.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 gene rpmF CDS complement(209015..209530) product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872145.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS 209672..210877 product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187910.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS complement(210869..211882) product SepM family pheromone-processing serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476281.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS complement(211879..212655) product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662590.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS 212755..213960 product sporulation integral membrane protein YlbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273100.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 gene ylbJ CDS complement(213957..214454) product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245283.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 gene coaD CDS complement(214457..215026) product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266978.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 gene rsmD CDS complement(215289..216617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS 216762..217151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616010.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS complement(217222..217488) product YlbG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967171.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS complement(217511..217960) product regulatory iron-sulfur-containing complex subunit RicF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221370.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 gene ricF CDS complement(218032..218394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS complement(218436..218678) product YlbE-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232231.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS complement(218690..219019) product YlbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232233.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS complement(219085..220095) product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245434.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS complement(220198..220614) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199022.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS 220746..221105 product YugN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160950.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS complement(221112..221372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS 221398..222477 product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944296.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 gene ytvI CDS complement(222502..222966) product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830117.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS complement(222988..223854) product cytochrome c oxidase assembly factor CtaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244967.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 gene ctaG CDS complement(223941..224273) product cytochrome c oxidase subunit IVB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985698.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 gene ctaF CDS complement(224278..224898) product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557860.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 gene ctaE CDS complement(224898..226766) product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011371630.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 gene ctaD CDS complement(226796..227860) product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232248.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 gene coxB CDS complement(227948..228853) product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232250.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 gene cyoE CDS 229233..230180 product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188730.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 gene ctaA CDS complement(230205..233645) product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164087.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 gene pyc CDS complement(233710..234903) product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967159.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 gene ftsW CDS complement(234987..235277) product YlaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135694.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS 235418..235912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289792.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS complement(235936..237267) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358083.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS 237386..237961 product YhcN/YlaJ family sporulation lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854053.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS complement(237981..238436) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024581.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS 238530..238730 product YlaI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232271.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS complement(238760..239041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258151.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS complement(239038..239340) product YlaH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232274.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS complement(239353..241188) product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000914762.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 gene typA CDS complement(241495..241980) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS complement(242223..242846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS complement(242981..243361) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS complement(243545..243787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS 243871..244053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS complement(244054..244836) product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232297.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 gene suhB CDS complement(244887..245075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250168.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS complement(245155..245424) product UPF0223 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456560.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS complement(245456..246415) product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925404.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 gene fabK CDS 246603..248069 product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084882.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 gene speA CDS complement(248194..248415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS complement(248440..248733) product DUF3055 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462038.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS 248861..249241 product DUF1885 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163307.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS complement(249229..249465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS complement(249545..250957) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232309.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 gene lpdA CDS complement(250962..252245) product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863430.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 gene pdhC CDS complement(252295..253272) product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068166.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 gene pdhB CDS complement(253276..254382) product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222294.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 gene pdhA CDS 254765..255319 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245474.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 gene def CDS complement(255349..256125) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998273.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS 256554..256769 product RNA polymerase subunit omega 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222303.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 gene rnpZA CDS 256766..258433 product ribonuclease J1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670368.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 gene rnjA sequence04 source 1..194453 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 21..97 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 tRNA 119..195 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 tRNA 203..278 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA 291..365 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 tRNA 373..449 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA 464..556 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 tRNA 584..659 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 tRNA 666..741 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 tRNA 761..831 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 tRNA 836..911 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 tRNA 924..998 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 tRNA 1002..1093 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 tRNA 1106..1178 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS complement(1369..2349) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013485.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS 2615..4549 product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100880.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 gene glgB CDS 4497..5669 product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057619.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 gene glgC CDS 5657..6679 product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398841.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 gene glgD CDS 6676..8130 product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110443.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 gene glgA CDS 8117..10504 product glycogen phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494109.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 gene glgP CDS complement(10545..11276) product yteA family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229046.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS complement(11362..12297) product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425766.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS 12455..13810 product isochorismate synthase MenF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398674.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS 13807..15549 product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059249.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 gene menD CDS 15546..16373 product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869224.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 gene menH CDS 16363..17181 product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963873.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 gene menB CDS 17239..18669 product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449576.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS complement(18690..19718) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017662.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 gene cydB CDS complement(19708..21057) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286188.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 gene cydA CDS complement(21235..21390) product DUF1540 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046095.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS 21567..21857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS 21854..22306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS complement(22320..23357) product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003729560.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS complement(23311..23802) product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989907.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS complement(23814..26093) product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722279.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS complement(26496..27533) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229071.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS complement(27548..28900) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399130.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS complement(28972..29925) product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126148.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS complement(30020..31201) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757677.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS complement(31280..31504) product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229076.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 gene yidD CDS 31635..32108 product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219361.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS 32230..32667 product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229083.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS 32778..33086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435818.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS 33150..33623 product antimutator 8-oxo-(dGTP/GTP)ase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276386.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 gene mutTA CDS complement(33654..34460) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229090.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS complement(34447..35217) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009050.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS complement(35227..36204) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733143.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS complement(36304..36546) product DUF2584 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727325.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS 36781..37860 product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661226.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS complement(37958..38683) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941936.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS complement(38683..39174) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS complement(39414..40382) product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941934.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS complement(40432..41409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS complement(41527..43113) product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108804.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 gene pckA CDS 43518..44723 product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229102.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 gene metK CDS 44787..46676 product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930749.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 gene asnB CDS complement(46667..47794) product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261645.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS complement(47808..48326) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868582.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS complement(48402..48932) product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640212.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS 49015..49833 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000267421.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS 49808..50878 product tetraprenyl-beta-curcumene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102461.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS 50921..51484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS complement(51526..52098) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764471.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS complement(52098..53048) product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968016.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS 53173..53436 product YtzC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229117.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS 53447..53587 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS complement(53624..54328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS complement(54733..54924) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS 55391..57808 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246072.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 gene leuS CDS 57870..58166 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398993.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS complement(58202..59467) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229222.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS 59568..61193 product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284028.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS complement(61208..61468) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS 61575..62297 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234947.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS complement(62336..62557) product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003152337.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS 62731..64128 product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274265.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 gene pepV CDS 64215..65366 product major facilitator superfamily domain-containing protein 6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242781.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS 65399..65929 product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433233.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 gene thpR CDS 65952..66329 product CidA/LrgA family holin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878488.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS 66326..66997 product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227015.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS 67033..67989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229241.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS complement(68003..68944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS 69018..71138 product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921725.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 gene pulA CDS 71220..71996 product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001986674.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS complement(71988..72257) product YtzH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122235.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS 72330..72980 product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239380.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 gene trmB CDS 73060..73899 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246020.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS complement(73925..74221) product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118540.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS 74328..75395 product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031503.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS 75408..75923 product DUF84 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869966.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS 75932..76258 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009915789.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS 76251..77054 product DUF1444 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967991.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS 77054..77659 product DUF4479 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229269.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS 77731..79863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS 79935..81044 product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658370.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS 81205..82506 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219468.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 gene murC CDS complement(82518..82847) product bacillithiol system redox-active protein YtxJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073516751.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 gene ytxJ CDS complement(82834..83163) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS complement(83176..83568) product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229276.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS 83699..84814 product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654739.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS complement(84839..86986) product cell division FtsA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214035.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS 87146..88228 product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223454.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS 88385..89386 product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103304.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 gene ccpA CDS complement(89476..90648) product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092826.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 gene acuC CDS complement(90645..91289) product acetoin utilization AcuB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634568.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS complement(91309..91941) product acetoin utilization protein acetyltransferase AcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581400.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 gene acuA CDS 92106..93827 product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862049.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 gene acsA CDS complement(93853..96639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS 97056..98315 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512096.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 gene tyrS CDS complement(98352..98954) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135311.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 gene rpsD CDS 99327..101183 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229309.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS complement(101211..101696) product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494335.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS complement(101710..102498) product histidinol-phosphatase HisJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229318.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 gene hisJ CDS 102662..104353 product septation ring formation regulator EzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377302.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 gene ezrA CDS complement(104375..105703) product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099177.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 gene brnQ CDS 105881..107032 product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638965.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS 107029..108222 product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229326.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 gene thiI CDS 108282..108473 product small acid-soluble spore protein, SasP family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284598.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 gene sasP CDS 108607..110181 product acyl--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817748.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS 110408..111178 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256973.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS 111191..113101 product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256972.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS 113102..113986 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391255.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS 113990..115060 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256970.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS 115117..116316 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256969.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS 116378..117166 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256968.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS 117166..118296 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256967.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS complement(118318..119121) product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399091.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS 119248..119886 product DUF2953 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002164419.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS 119898..120326 product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398631.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 gene ytfJ CDS 120404..120910 product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024529.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 gene tpx CDS 120998..121972 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181883.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS 122130..123323 product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223511.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS complement(123526..123840) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417218.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS 123987..125195 product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358518.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 gene argG CDS 125192..126568 product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246018.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 gene argH CDS complement(126581..127033) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066673.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS 127139..127267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS 127360..128121 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002024902.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS complement(128139..129230) product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994047.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 gene pepQ CDS 129340..130017 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868943.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS 130091..131401 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201572.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS complement(131417..131716) product YtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144777.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS 131816..132763 product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545136.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS complement(132772..133272) product sporulation membrane protein YtrI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229408.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 gene ytrI CDS complement(133269..133607) product sporulation membrane protein YtrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229410.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 gene ytrH CDS 133721..136942 product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673716.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 gene dnaE CDS 137031..138284 product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229415.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 gene maeB CDS 138271..138873 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204441.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS 138943..139815 product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223544.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 gene accD CDS 139800..140777 product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229417.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 gene accA CDS 140967..141926 product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229420.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 gene pfkA CDS 141975..143735 product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398560.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 gene pyk CDS 143781..144173 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS complement(144197..145315) product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081388.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 gene ytvI CDS 145403..145858 product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625507.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS 146120..147238 product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398810.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 gene citZ CDS 147309..148583 product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229433.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 gene icd CDS 148607..149545 product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229437.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 gene mdh CDS 149605..150069 product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000914178.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS 150160..150876 product two-component system response regulator PhoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065226.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 gene phoP CDS 150869..152632 product sensory box histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032106.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 gene phoR CDS 152827..155454 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412819.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 gene polA CDS 155471..156292 product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114480.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 gene mutM CDS 156360..156983 product sporulation membrane protein YtaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281740.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 gene ytaF CDS 156995..157597 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219305.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 gene coaE CDS 157705..158733 product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229459.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS 158974..159348 product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223584.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 gene speD CDS 159423..159815 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS 159878..160348 product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223586.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 gene nrdR CDS 160382..161779 product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415049.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS 161790..162722 product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400104.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 gene dnaI CDS 162785..163639 product putative sporulation protein YtxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229471.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene ytxC CDS 163935..165866 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786086.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 gene thrS CDS 166080..166676 product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886591.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 gene infC CDS 166696..166896 product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222418.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 gene rpmI CDS 166915..167274 product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222420.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 gene rplT CDS 167335..167823 product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365050.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS 167879..168964 product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163568.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS 169108..170418 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530183.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS 170525..171439 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969762.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS 171436..172242 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311851.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS 172244..174505 product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019639497.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS 174498..175676 product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016043.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS 175673..176659 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706835.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 gene galE CDS 176663..178174 product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227402.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 gene galT CDS 178191..180134 product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575935.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS 180157..181176 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836854.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS 181230..182282 product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930954.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS complement(182319..182528) product small acid-soluble spore protein SspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009509.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 gene sspI CDS 182612..183136 product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291873.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 gene msrA CDS 183133..183885 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003158483.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS 184227..185261 product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388219.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 gene pheS CDS 185278..187692 product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498183.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 gene pheT CDS 187841..188338 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS 188457..189350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS 189369..189524 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS 189531..191789 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041810227.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS 191811..192482 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573662.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS 193083..193421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS 193622..194005 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11870 sequence05 source 1..171471 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 566..2188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS 2185..3429 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS complement(3452..4519) product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951379.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS 5170..5382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS complement(5689..7128) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS 7293..12206 product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947955.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS 12387..14798 product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599479.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 gene pcrA CDS 14791..17298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS 17273..18952 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207706.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS 18965..19486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS 19551..21227 product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870224.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS 21253..21537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS 21790..22848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS 22915..24288 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS 24397..24606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS 24738..25112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS 25093..25386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS complement(25421..27625) product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391529.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 gene katG CDS complement(27857..27988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS 28198..29019 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243397.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS complement(29047..29607) product maltose acetyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002026426.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS 29746..30888 product TIGR04053 family radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046900.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS complement(30885..31130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS 31257..32849 product spore germination protein GerKA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246515.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 gene gerKA CDS 32839..34041 product spore germination protein GerKC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246578.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 gene gerKC CDS 34057..35163 product spore germination protein GerKB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234509.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 gene gerKB CDS complement(35173..36003) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604155.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS complement(36088..36792) product polysaccharide deacetylase family sporulation protein PdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000945995.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 gene pdaB CDS 36904..37782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS 37775..37915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS 38017..39507 product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463798.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS 39607..40329 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229185.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS complement(40354..40635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS complement(40655..41071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS 41369..42742 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822542.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS 42748..43419 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565469.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS 43431..43979 product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852222.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS 44028..44333 product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349636.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS 44348..46729 product copper-exporting P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242925.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 gene copA CDS 46765..46968 product copper chaperone CopZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076661.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 gene copZ CDS complement(47284..47805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS complement(48242..50269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS 50396..50800 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS complement(50822..52282) product C-3',4' desaturase CrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056087.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 gene crtD CDS 52372..53775 product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922487.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS 53949..55388 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716439.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS 55448..56440 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497489.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS complement(56414..56878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS 56993..57379 product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231531.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS 57481..58842 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393525.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS complement(58875..59774) product glutamate biosynthesis transcriptional regulator GltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399246.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 gene gltC CDS 59894..64438 product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967365.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 gene gltB CDS 64475..65935 product glutamate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231462.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 gene gltD CDS 66002..66361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS 66488..68155 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967560.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 gene ilvD CDS 68240..68566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS complement(68587..69780) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258522.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS complement(69767..70924) product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869162.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS 71334..72635 product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093009.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 gene gabT CDS 72635..74077 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246263.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS 74092..75471 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948160.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS 75561..77186 product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399307.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS 77183..78658 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169153932.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS 78671..79819 product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763350.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS 79918..80730 product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459802.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS 80743..81792 product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391607.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS 81785..83080 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054936956.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS 83077..83364 product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811676.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS 83370..83570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS 83735..84766 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS 84782..85654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS 85670..86212 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS 86302..86469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS 86485..87033 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS 88096..89361 product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030529.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS 89694..89933 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS 90068..90265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS 90366..91199 product 5'-3' exonuclease ExnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230763.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 gene exnP CDS complement(91266..92507) product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006634.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 gene proA CDS complement(92529..93647) product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744710.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 gene proB CDS complement(93958..94557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS 94714..95616 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233262.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS 95606..96835 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244912.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS complement(96861..97331) product PCYCGC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761026.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS 97450..99372 product FapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392342.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS 99489..101465 product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259232.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS 101582..101968 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878176.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS 101965..103494 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185142.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS 103472..105142 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040466.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS complement(105174..105809) product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398522.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS 105932..106858 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948290.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS 106938..108101 product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937396.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 gene trpB CDS complement(108257..108853) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680830.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS 108839..109045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS complement(108950..110320) product YjiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986374.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS 110673..111641 product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248640.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS complement(111658..112968) product serine/threonine exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244819.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 gene steT CDS 113270..114175 product manganese ABC transporter substrate-binding protein/adhesin MntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229060.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 gene mntA CDS 114178..114918 product manganese ABC transporter ATP-binding protein MntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398644.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 gene mntB CDS 114926..115825 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS 115822..116691 product manganese ABC transporter permease MntD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229067.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 gene mntD CDS complement(116701..116829) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS 116956..118197 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930645.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS 118194..118757 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS 118857..119486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS 119623..120282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS 120266..121417 product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226779.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS 121484..121837 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS 121907..123550 product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087552.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 gene cdr CDS 123562..123858 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661705.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS 123951..125141 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269239.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS complement(125154..126497) product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001204707.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS 126659..127558 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378082.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS 127634..129316 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987082.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS 129395..130381 product sugar-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583991.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS 130378..131817 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS 131795..133027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS 133208..134290 product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054936757.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 gene xylF CDS 134307..135860 product xylose ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393517.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS 135864..137033 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208974840.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 gene gguB CDS 137351..138556 product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228602.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS 138683..139669 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228603.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS 139679..140965 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256820.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS 140946..141722 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002937291.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS 141736..142443 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173391.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS 142507..143622 product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398737.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 gene menC CDS 143627..144139 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460219.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS 144219..144464 product DUF1450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941962.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS 144517..144951 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS complement(144987..145325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS 145515..146384 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS complement(146413..146949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS complement(147011..147673) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245627.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS complement(147685..148542) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS 148672..149166 product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219440.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 gene bsaA CDS 149271..150362 product spore coat kinase CotI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886600.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 gene cotI CDS 150359..151654 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229035.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS complement(151664..152884) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365630.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS 153059..154813 product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862474.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS 154810..156564 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229520.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS complement(156594..157526) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129615.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS 157863..158804 product endonuclease I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888238.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS 158871..160259 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000537911.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS 160414..161727 product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056043.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 gene amt CDS 161741..162769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS 162773..163492 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS 163580..163885 product Zn(II)-responsive metalloregulatory transcriptional repressor CzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231284.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 gene czrA CDS 163897..165960 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485759.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS 166079..167998 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS 168097..169428 product nitrous oxide reductase family maturation protein NosD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113112.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS 169412..169861 product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259401.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS 169858..170667 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808202.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS 170660..171361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13400 sequence06 source 1..170853 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(134..691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS complement(834..1118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS complement(1565..2848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS complement(2992..3204) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS complement(3636..4919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS complement(4921..6021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS complement(6043..8010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS complement(8019..9281) product UDP-N-acetyl-D-mannosamine dehydrogenase VpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000482531.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 gene vpsB CDS complement(9304..9984) product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060578.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS complement(10001..10882) product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757774.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 gene galU CDS complement(10977..11804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS complement(12201..12965) product tyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110492.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS complement(13100..13801) product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207182.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS complement(13791..14531) product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393128.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS complement(14841..15239) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016716590.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS complement(15379..15609) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS complement(15676..16104) product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221796.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 gene fabZ CDS complement(16187..16399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS complement(16412..17236) product flagellar hook-basal body complex protein FlhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244381.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 gene flhP CDS complement(17247..18035) product flagellar hook-basal body complex protein FlhO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244097.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 gene flhO CDS complement(18124..19128) product cell shape-determining protein Mbl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227776.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 gene mbl CDS complement(19209..19472) product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544012.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 gene spoIIID CDS complement(19695..20471) product stage II sporulation protein spoIIQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227751.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 gene spoIIQ CDS complement(20546..21532) product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243408.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 gene spoIID CDS complement(21631..22929) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411265.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 gene murA CDS complement(22961..23656) product YwmB family TATA-box binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244344.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS complement(23739..23969) product DUF1146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227691.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS complement(24026..25528) product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078186264.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 gene nuoN CDS complement(25533..27044) product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998901.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS complement(27044..28900) product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568473.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 gene nuoL CDS complement(28959..29270) product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100078.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 gene nuoK CDS complement(29267..29776) product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012801.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS complement(29773..30192) product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677191.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 gene nuoI CDS complement(30215..31219) product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573431.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 gene nuoH CDS complement(31216..32316) product NADH-quinone oxidoreductase subunit NuoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621434.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 gene nuoD CDS complement(32321..33046) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13760 note possible pseudo, frameshifted assembly_gap 33073..33169 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(33618..34130) product NADH-quinone oxidoreductase subunit NuoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236331.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 gene nuoB CDS complement(34121..34486) product NADH-quinone oxidoreductase subunit NuoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179273.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 gene nuoA CDS complement(34642..35046) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227688.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS complement(35071..36492) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227686.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 gene atpD CDS complement(36521..37381) product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244388.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 gene atpG CDS complement(37452..38966) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027518.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 gene atpA CDS complement(38991..39527) product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243176.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS complement(39524..40033) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244051.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 gene atpF CDS complement(40205..40417) product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732517.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 gene atpE CDS complement(40468..41178) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732518.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 gene atpB CDS complement(41185..41496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS complement(41559..41786) product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171223.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS complement(41938..43089) product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140128.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 gene wecB CDS complement(43100..43729) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517539.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 gene upp CDS complement(43831..45066) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227669.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 gene glyA CDS complement(45139..45717) product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136366.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS complement(45731..46174) product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221910.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 gene rpiB CDS complement(46263..47552) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410209.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS complement(47570..48004) product low molecular weight protein arginine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832373.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS complement(48109..48654) product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227661.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS complement(48716..49813) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557353.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS complement(49927..50559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS complement(50650..51501) product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267061.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 gene prmC CDS complement(51491..52567) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227645.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 gene prfA CDS complement(52624..53244) product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243018.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS complement(53329..53529) product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151132.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 gene rpmE CDS complement(53640..54926) product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221939.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 gene rho CDS complement(55095..56057) product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442336.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 gene glpX CDS complement(56084..57370) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227628.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS complement(57428..58075) product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667670.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 gene fsa CDS complement(58158..59018) product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131850.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS complement(59223..59582) product sporulation initiation phosphotransferase Spo0F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227621.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 gene spo0F CDS 59757..60275 product DUF2529 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912402.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS complement(60303..61898) product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170460.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 gene pyrG CDS complement(62056..62604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS complement(62727..65981) product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224369.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS complement(66002..66625) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238599.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS complement(66636..67775) product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 gene acdA CDS complement(67772..68923) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074554312.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS complement(68937..69782) product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538874.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS complement(69797..70978) product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047982.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS complement(71145..73223) product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086758.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS 73371..74549 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000465731.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 gene cls CDS complement(74592..76262) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227570.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 gene argS CDS complement(76259..76687) product DUF1934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414867.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS complement(76787..77155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529135.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS complement(77265..78137) product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209826.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 gene speB CDS complement(78150..78977) product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424696.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 gene speE CDS 79153..81204 product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372988.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS complement(81344..81856) product YwhD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244446.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS complement(81868..82536) product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372445.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS 82668..82856 product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147171.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS complement(82867..83379) product YwgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227524.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS complement(83392..84690) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243873.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS complement(84839..85063) product DUF1450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222050.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS 85209..85880 product RsfA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868349.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS complement(85908..86732) product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071943.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS complement(86732..87715) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243393.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 gene pta CDS 87912..88475 product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161533195.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS 88543..89289 product heme-dependent peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287585.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS 89411..89833 product cell wall hydrolase CwlJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538169.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 gene cwlJ CDS 89854..90297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS complement(90324..90686) product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227446.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS complement(90698..90934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS 91034..92650 product oligo-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415176.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 gene malL CDS complement(92668..93663) product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993980.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS complement(93660..93866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS complement(93841..94515) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432519.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS complement(94574..95956) product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287157.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 gene glyS CDS complement(96303..97832) product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243077.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 gene ahpF CDS complement(97847..98410) product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924422.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 gene ahpC CDS complement(98892..99707) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242519.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS complement(99771..100967) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521091.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS complement(101129..102304) product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599321.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS complement(102497..102892) product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086294.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS complement(102918..103088) product DUF1427 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417708.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS complement(103104..103769) product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933101.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 gene deoC CDS complement(103824..105038) product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456066.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS complement(105216..106157) product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409781.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS complement(106286..107245) product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439483.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS 107355..108578 product sporulation transcriptional activator AdeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886604.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 gene adeR CDS 108699..109829 product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243280.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 gene ald CDS complement(109913..110635) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774590.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS complement(110632..111285) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705158.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS complement(111352..112149) product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222181.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS 112417..114675 product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195485.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 gene pflB CDS 114725..115453 product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238477.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 gene pflA CDS complement(115462..116127) product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228210.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 gene pgmB CDS complement(116120..116842) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963914.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS complement(116855..117334) product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710860.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 gene ybaK CDS complement(117414..120017) product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000260509.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 gene adhE CDS complement(120191..120418) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS complement(120500..121792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS 121933..123447 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199987.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS 123447..124913 product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534525.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS 124923..126023 product endospore germination permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166522.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS 126020..127114 product spore germination protein GerSC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252201.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 gene gerSC CDS 127186..128241 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014601365.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS 128243..129040 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721372.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS 129037..129816 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721373.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS 129813..130886 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721374.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS 131065..132555 product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246610.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS complement(132575..133138) product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243164.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 gene rlmH CDS complement(133138..133293) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS complement(133348..134556) product serine protease HtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969578.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 gene htrC CDS complement(134669..135457) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242676.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS complement(135463..136248) product WalRK two-component regulatory system regulator WalI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244037.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 gene walI CDS complement(136235..137563) product two-component system activity regulator YycH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061593.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 gene yycH CDS complement(137569..139383) product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755373.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 gene walK CDS complement(139388..140092) product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722907.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 gene yycF tRNA complement(140192..140265) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 tRNA complement(140292..140367) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS complement(140464..141750) product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243325.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 gene purA CDS complement(141867..143231) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226923.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 gene dnaB CDS complement(143309..143758) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864235.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 gene rplI CDS complement(143755..145728) product cyclic-di-AMP phosphodiesterase GdpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242517.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 gene gdpP CDS complement(145750..146679) product YybS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814840.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS complement(146741..146977) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219224.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 gene rpsR CDS complement(147010..147501) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981966.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 gene ssb CDS complement(147528..147815) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244064.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 gene rpsF CDS complement(147920..149020) product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524657.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 gene ychF CDS complement(149041..149235) product DUF951 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226838.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS complement(149259..150134) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382909.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS 150315..150905 product spore protease YyaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020723.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 gene yyaC CDS complement(150894..151601) product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236030.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS complement(151619..152482) product stage 0 sporulation protein Spo0J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226832.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 gene spo0J CDS complement(152475..153236) product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 gene soj CDS complement(153338..154189) product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799016.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 gene noc CDS complement(154225..154938) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019628.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 gene rsmG CDS complement(154952..156841) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226825.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 gene mnmG CDS complement(156853..158238) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244507.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 gene mnmE CDS complement(158408..159025) product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111516.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS complement(159022..159789) product YidC family membrane integrase SpoIIIJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886648.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 gene spoIIIJ CDS complement(159853..160191) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726621.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 gene rnpA CDS complement(160255..160389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS 160459..160695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS 160862..162205 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242674.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 gene dnaA CDS 162363..163499 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212886.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 gene dnaN CDS 163599..163811 product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821364.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 gene yaaA CDS 163827..164942 product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243515.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 gene recF CDS 164997..166919 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435982.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 gene gyrB CDS 166992..169445 product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282864.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 gene gyrA CDS 169491..170576 product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966912.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 sequence07 source 1..151781 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(258..1145) product nucleotidyltransferase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243727.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS 1266..1628 product YgzB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025058.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS complement(1652..2089) product peroxide-responsive transcriptional repressor PerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223285.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 gene perR CDS complement(2280..2741) product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633710.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 gene bcp CDS complement(2752..3150) product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964343.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS complement(3193..3978) product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965773.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS complement(3983..4774) product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521519.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS complement(4767..5762) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843645.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS 5896..7191 product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233535.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS 7455..11924 product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932983.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS 12064..13137 product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765787.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS complement(13167..14057) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583225.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS complement(14074..15078) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583224.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS complement(15144..16748) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583223.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS complement(16796..17764) product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583525.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS complement(17739..18752) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583524.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS complement(18943..19473) product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506628.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS complement(19573..19722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS 19825..20049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233542.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS complement(20062..21144) product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171397.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 gene mutY CDS 21207..22184 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244136.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS 22266..22433 product small, acid-soluble spore protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223241.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS 22435..22599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS complement(22626..22946) product YfhH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244592.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS complement(23000..24646) product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071701.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS 24804..25472 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405485.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS complement(25479..26282) product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268502.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 gene recX CDS 26348..27256 product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684382.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS 27296..28423 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698326.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS 28673..29230 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000914737.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS 29324..29452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS 29521..29709 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS complement(29768..31459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS 31893..32906 product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198321.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 gene adhP CDS complement(32932..33669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS complement(33744..33932) product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257467.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS complement(34001..34618) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257162.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS complement(34694..35800) product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896133.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS complement(35790..36116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS 36255..38933 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS complement(38961..40403) product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164930.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS 40684..43821 product DUF3427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986599.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS complement(43798..44202) product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948377.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS complement(44287..45645) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615206.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 gene rlmD CDS complement(45657..46523) product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233646.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS complement(46580..47359) product delta-lactam-biosynthetic de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681209.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 gene pdaA CDS complement(47448..48974) product class I fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413503.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 gene fumA CDS complement(49063..49257) product SE1561 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223132.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS 49370..50494 product radical SAM/CxCxxxxC motif protein YfkAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156007.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 gene yfkAB CDS complement(50530..51306) product YfkD famly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233657.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS complement(51407..52456) product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000482137.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 gene cax CDS 52597..53769 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966795.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS 53835..53981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS complement(54188..55030) product YihY family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242564.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS complement(55042..55305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS complement(55319..55789) product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250917.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS 55856..56065 product DUF1128 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243712.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS complement(56060..57037) product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461739.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS 57219..57926 product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232103.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS 57940..58986 product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232101.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 gene cysP CDS 59031..60107 product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029491.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 gene sat CDS 60107..60694 product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380502.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 gene cysC CDS 60704..61477 product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521268.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 gene cobA CDS 61481..62188 product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644360.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS 62193..62693 product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283347.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS complement(62706..63446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS 63551..63829 product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966115.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS complement(64007..66010) product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044821.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 gene feoB CDS complement(66007..66237) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS complement(66335..67051) product arginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054639.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS 67230..69671 product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948003.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS complement(69799..70488) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232944.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS 70714..71163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS 71330..73456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS complement(73756..75237) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS complement(75354..76421) product nitric oxide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243309.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 gene nosA CDS 76642..76989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS complement(77009..78160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS complement(78153..78638) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459411.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS complement(78754..79398) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582946.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS 79572..80624 product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460935.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS 80602..81282 product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460936.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS complement(81300..82157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS complement(82209..83420) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676841.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS complement(83609..84979) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233892.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 gene rlmD CDS complement(85044..85970) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233894.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS complement(86072..86860) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229890.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS complement(86876..87508) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198408415.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS complement(87489..88508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS complement(88575..89984) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123146.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS complement(90001..90525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS complement(90538..91737) product type II sulfide:quinone oxidoreductase Sqr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033018.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 gene sqr CDS 91916..92581 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461203.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS 92571..93932 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715835.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS 94027..94509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS 94510..95142 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS complement(95180..95869) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS complement(95936..97444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS complement(97513..97683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS 97644..99374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS 99396..100268 product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073167205.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS 100331..101251 product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877335.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 gene pstC CDS 101256..102167 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994147.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 gene pstA CDS complement(102183..102482) product cytochrome aa3 quinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721632.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 gene qoxD CDS complement(102483..103088) product cytochrome aa3 quinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729317.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 gene qoxC CDS complement(103078..105054) product cytochrome aa3 quinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762372.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 gene qoxB CDS complement(105044..106024) product cytochrome aa3 quinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176167.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS complement(106402..107751) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028370.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS 107892..108479 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS complement(108520..109953) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219444.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 gene gatB CDS complement(109965..111422) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242878.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 gene gatA CDS complement(111435..111725) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086999.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 gene gatC CDS 111991..113697 product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245362.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 gene ade CDS 113766..114329 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS complement(114412..114717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS complement(114744..114971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS complement(115046..115225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS complement(115452..116282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16350 note possible pseudo, frameshifted CDS complement(116321..116608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16360 note possible pseudo, frameshifted CDS complement(117033..117404) product DUF393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634870.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS complement(118841..120013) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS complement(120035..121180) product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528974.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS complement(121267..121422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS 121569..122045 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722820.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS 122168..123703 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS complement(124158..125381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS complement(125490..126233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS complement(126353..127900) product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000259550.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 gene pruA CDS complement(127986..129035) product CamS family sex pheromone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242795.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS complement(129123..131132) product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031450.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 gene ligA CDS complement(131147..133312) product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002163769.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 gene pcrA CDS complement(133355..134050) product heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272088.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS complement(134112..134429) product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219429.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS complement(134440..135462) product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233927.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS complement(135498..137243) product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233929.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS 137326..137589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS complement(137707..138987) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101936.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 gene purD CDS complement(139003..140538) product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745439.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 gene purH CDS complement(140516..141118) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244322.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 gene purN CDS complement(141115..142152) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242485.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 gene purM CDS complement(142115..143542) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233947.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 gene purF CDS complement(143518..145740) product phosphoribosylformylglycinamidine synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055546.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 gene purL CDS complement(145724..146410) product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666779.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 gene purQ CDS complement(146407..146661) product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219409.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 gene purS CDS complement(146649..147371) product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170544.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 gene purC CDS complement(147438..148733) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233955.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 gene purB CDS complement(148730..149869) product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196812.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 gene purK CDS complement(149862..150350) product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244134.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 gene purE CDS complement(150615..150770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS 150709..151098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16670 rRNA complement(151231..151340) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 sequence08 source 1..127671 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 372..908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16680 note possible pseudo, frameshifted CDS 890..1432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16690 note possible pseudo, frameshifted CDS 1422..2624 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948943.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS 2624..3850 product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522781.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS 3843..5039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS 5067..6176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS 6357..6776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139849141.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS 6789..7277 product YpuI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064519.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS 7337..8113 product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075741.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS 8266..9297 product D-alanyl-D-alanine carboxypeptidase DacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230505.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 gene dacB CDS 9290..9883 product spore maturation protein SpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247811.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 gene spmA CDS 9883..10416 product spore maturation protein SpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230509.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 gene spmB CDS 10497..11234 product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398815.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 gene rluB CDS 11328..11849 product thiol-disulfide oxidoreductase ResA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230513.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 gene resA CDS 11862..13478 product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910536.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 gene resB CDS 13490..14665 product cytochrome c biogenesis protein ResC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250084.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 gene resC CDS 14757..15473 product DNA-binding response regulator ResD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426862.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 gene resD CDS 15470..17233 product sensor histidine kinase ResE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230520.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 gene resE CDS 17611..18453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS 18480..18800 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS 18872..19828 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243040.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS 19794..20834 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968147.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS 20831..22288 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886611.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS 22285..23217 product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392613.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 gene cbiB CDS 23192..24247 product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545158.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS 24244..24795 product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215857.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 gene cobU CDS 24780..25523 product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964693.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 gene cobS CDS 25481..26077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS 26029..26457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS 26470..27057 product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781294.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS 27054..27524 product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460553.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS 27517..28218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391734.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS 28442..29254 product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582599.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS complement(29283..30857) product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398713.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 gene serA CDS complement(31032..31529) product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875902.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS complement(31649..31897) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151993.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS 32098..33120 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167004.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS 33113..34555 product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230528.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS 34552..35142 product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025780.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS 35135..35653 product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254346.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS 35714..36154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS 36200..36574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS 36576..37337 product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637791.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS 37420..38340 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142718.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS 38422..39009 product genetic competence negative regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235392.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS complement(39037..39723) product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228885.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS 39780..39944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS 39907..41172 product NAD-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886557.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 gene gudB CDS 41223..42224 product YpdA family putative bacillithiol disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168520.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS 42305..42973 product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398591.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 gene bioD CDS 42970..44313 product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398913.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 gene bioA CDS complement(44325..45671) product germination protein YpeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943704.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 gene ypeB CDS complement(45684..46541) product spore cortex-lytic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398523.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 gene sleB CDS complement(46658..47332) product glutamic-type intramembrane protease PrsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230542.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 gene prsW CDS 47471..48130 product cyclic di-GMP receptor DgrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230551.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 gene dgrA CDS 48183..48362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS 48438..49115 product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361252.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 gene cmk CDS 49115..49696 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392843.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS 49845..50984 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230556.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 gene rpsA CDS 50986..52050 product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251056.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS 52299..52898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399232.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS 52895..53791 product YIEGIA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141596.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS 53788..53970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979059.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS 54061..55371 product ribosome-associated GTPase EngA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125893.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 gene engA CDS 55384..56403 product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161763.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 gene gpsA CDS 56578..56781 product DUF2768 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288997.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS 56797..57519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713407.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS 57644..59122 product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230572.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 gene spoIVA CDS 59382..59654 product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043860.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS 59774..60328 product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151482.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 gene folE CDS 60339..60566 product trp RNA-binding attenuation protein MtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230576.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 gene mtrB CDS 60627..61277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS 61302..62015 product 2-heptaprenyl-1,4-naphthoquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187674.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 gene menG CDS 62027..62989 product heptaprenyl diphosphate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776077.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 gene hepT CDS 63102..63548 product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415883.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 gene ndk CDS 63647..64417 product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230589.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 gene cheR CDS 64526..65695 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398727.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 gene aroC CDS 65698..66834 product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000526827.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 gene aroB CDS 66794..67174 product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967606.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 gene aroH CDS 67350..68855 product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246124.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 gene trpE CDS 68848..69858 product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245959.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 gene trpD CDS 69851..70612 product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886553.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 gene trpC CDS 70609..71238 product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398742.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS 71238..72431 product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230605.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 gene trpB CDS 72431..73270 product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230608.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 gene trpA CDS 73212..74327 product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399129.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 gene hisC CDS 74309..75412 product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230615.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS 75427..76713 product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664618.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 gene aroA CDS 76803..78056 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168671.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS 78089..78613 product ReoY family proteolytic degradation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399171.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS 78718..79152 product YpiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871320.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS 79282..79791 product menaquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290423.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 gene qcrA CDS 79795..80469 product menaquinol-cytochrome c reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932700.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 gene qcrB CDS 80495..81262 product menaquinol-cytochrome c reductase cytochrome b/c subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000554608.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 gene qcrC CDS 81321..81890 product DUF1405 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886552.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS 81957..82730 product sporulation protein YpjB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831595.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 gene ypjB CDS complement(82753..83613) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202121.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS 83732..84064 product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398996.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS 84061..84855 product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661724.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 gene dapB CDS 84869..85276 product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684755.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 gene mgsA CDS 85282..85977 product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000015666.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 gene bshB1 CDS 85974..87104 product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768305.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 gene bshA CDS 87104..88297 product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439304.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS 88267..89247 product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192045.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS 89472..90308 product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000851103.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 gene panB CDS 90305..91153 product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706997.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 gene panC CDS 91166..91549 product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225586.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 gene panD CDS 91603..94248 product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044941.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 gene dinG CDS 94301..95041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS 95225..95395 product YpmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358352.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS 95408..95890 product DUF5590 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758739.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS 95887..97074 product aspartate transaminase AspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761551.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 gene aspB CDS 97189..98481 product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398777.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 gene asnS CDS 98549..99220 product DNA replication protein DnaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000728542.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 gene dnaD CDS 99234..99884 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933025.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 gene nth CDS 99885..100376 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967579.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS complement(100405..103023) product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398589.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS complement(103039..103638) product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155598.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 gene recU CDS complement(103736..103876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS 104019..104222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS complement(104248..104415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS complement(104477..104689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS 104843..105181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS complement(105204..105626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS 106022..107665 product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233382.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 gene glpD CDS complement(107669..107818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS complement(107892..108317) product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393982.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS complement(108390..108650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231211.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS complement(108663..109637) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS complement(109690..110775) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722298.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS complement(110847..112079) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007344.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS 112197..112628 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS 112625..113746 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071679105.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS complement(113833..115119) product globin-coupled sensor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003471527.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS 115316..117613 product DUF4084 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065525186.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS 117734..118594 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964109.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS 118530..119462 product iron-hydroxamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732576.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS 119486..120499 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823047.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS 120496..121506 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613083.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS 121571..122740 product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077285.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 gene bioF CDS 122737..123417 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001004171.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS 123410..124177 product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608924.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 gene bioC CDS complement(124170..124943) product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965890.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 gene speD CDS 125169..125495 product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277353.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS 125488..127500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18120 sequence09 source 1..120700 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(119..253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS 318..992 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160042.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS complement(1006..1560) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062063.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS complement(1562..3067) product multidrug efflux MFS transporter Bmr3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246377.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 gene bmr3 CDS complement(3160..4068) product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398721.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 gene metA CDS 4210..4644 product bacilliredoxin BrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230794.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 gene brxA CDS 4685..5461 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637459.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS 5497..5628 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS 5825..7045 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814826.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS complement(7067..7432) product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583024.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS 7526..7708 product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000492443.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS 7771..8535 product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390125.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 gene tatC CDS 8702..9772 product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460190.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS 9775..11496 product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012502532.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS 11508..12284 product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811165.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 gene cybH CDS 12265..12750 product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880396.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS 12747..13166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS 13159..13509 product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462320.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 gene hypA CDS 13514..14185 product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940974.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 gene hypB CDS 14158..16437 product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393666.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 gene hypF CDS 16428..16655 product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810715.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS 16636..17745 product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393664.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 gene hypD CDS 17749..18741 product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810719.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 gene hypE CDS 18835..19629 product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948554.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 gene thyA CDS 19643..20131 product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637205.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 gene dfrA CDS 20250..21518 product threonine ammonia-lyase IlvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230803.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 gene ilvA CDS 21616..21867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS 22010..22852 product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003266758.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS 22866..23438 product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833331.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS 23504..24253 product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365717.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS 24257..24817 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS complement(24848..26212) product RsmF rRNA methyltransferase first C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287145.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS complement(26212..26793) product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231560.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 gene plsY CDS 26931..27335 product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151390.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS 27464..29431 product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231552.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 gene parE CDS 29436..31832 product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231550.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 gene parC CDS 31901..32287 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS 32444..33847 product PTS system trehalose-specific EIIBC component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233682.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 gene treP CDS 33849..35513 product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244272.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 gene treC CDS 35541..36263 product trehalose operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405408.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 gene treR CDS complement(36426..36575) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003719608.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 gene rpmG CDS complement(36624..37472) product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943180.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 gene speE CDS 37715..38533 product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893037.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS 38627..39526 product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245802.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 gene purU CDS 39682..40056 product replication termination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220337.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 gene rtp CDS 40118..40381 product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456206.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS 40511..41398 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886530.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS 41409..43313 product nitric oxide reductase activation protein NorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399326.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS 43616..45049 product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356603.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS 45260..45454 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS complement(45682..46095) product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282829.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS 46232..48313 product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304230.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS complement(48364..49239) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS complement(49300..50394) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036621.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS complement(50505..51362) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034812.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS complement(51451..52344) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538553.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS complement(52385..53317) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948814.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS 53440..54321 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403856.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS complement(54394..54810) product thioredoxin-dependent arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398596.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS complement(54826..56124) product arsenic transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243030.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS complement(56142..56474) product metal-responsive transcriptional regulator AseR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243257.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 gene aseR CDS complement(56684..56827) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS 57275..58195 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044939.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS complement(58209..58805) product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201899.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 tRNA complement(58879..58971) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS complement(59022..59981) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754999.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS complement(59984..60616) product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949003.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS complement(60616..61596) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001206500.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS complement(61589..62500) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989559.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS complement(62500..63291) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931622.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS complement(63393..64754) product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231737.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 gene glnA CDS complement(65026..65226) product cold-shock protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193054.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 gene cspD CDS complement(65416..65976) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947316.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS complement(66060..68525) product DUF3656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140940.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS complement(68625..70532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS complement(70507..71406) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385582.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS complement(71393..71788) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548044.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS complement(71900..72565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS complement(72669..72878) product DUF6501 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231245.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS complement(72894..73097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS complement(73212..74420) product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 gene ilvA CDS complement(74588..75484) product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227725.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS complement(75499..75705) product YuzF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220677.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS 75876..77129 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000937253.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS complement(77154..78569) product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356603.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS 78727..80067 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231218.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS complement(80448..81347) product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535550.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 gene rarD CDS complement(81369..82247) product manganese transporter MneS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233995.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 gene mneS CDS 82474..83784 product Na+/H+ antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994836.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS 84024..84293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS complement(84296..85099) product LD-carboxypeptidase LdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399387.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 gene ldcB CDS complement(85161..85865) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231176.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 gene deoD CDS complement(85973..86335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS 86417..86542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231174.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS complement(86644..86967) product shape determination protein YodL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399431.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 gene yodL CDS complement(87107..87877) product sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486596.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS complement(87975..88148) product YozD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231166.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS complement(88381..88575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS complement(88657..89646) product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398967.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 gene bioB CDS complement(89758..91194) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461659.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS complement(91340..92278) product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932389.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS 92600..92887 product HesB/YadR/YfhF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231562.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS complement(92906..93325) product YbgC/FadM family acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231566.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS complement(93451..93678) product small acid-soluble spore protein Tlp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231568.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 gene tlp CDS complement(93810..93953) product acid-soluble spore protein SspN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000527987.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 gene sspN CDS complement(93988..94122) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS complement(94200..94715) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS complement(94769..94909) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS complement(94966..95238) product YpbS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451819.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS complement(95231..98857) product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182166.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS complement(98932..99438) product alkylpyrone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398552.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 gene bpsB CDS complement(99435..100499) product type III polyketide synthase BpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230750.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 gene bpsA CDS 100761..101216 product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082082.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS 101482..101631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS 101653..102126 product ba3-type cytochrome C oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173203.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 gene cbaB CDS 102123..103772 product b(o/a)3-type cytochrome-c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903627.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS complement(103798..105312) product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215086.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 gene ypwA CDS complement(105367..107295) product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493712.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS complement(107395..108546) product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521234.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS complement(108553..110268) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS complement(110806..111102) product cell division regulator GpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225629.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 gene gpsB CDS complement(111227..111460) product spore coat protein CotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886551.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 gene cotD CDS 111833..113200 product globin-coupled sensor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003471527.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS 113224..113553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS 113531..113923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS 113920..114213 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS complement(114236..115372) product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025547.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS complement(115470..116231) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003269647.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS complement(116318..116971) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086979.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 gene thiE CDS complement(116972..117763) product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092692.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 gene thiM CDS 118103..119392 product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098308124.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 gene hcp CDS complement(119422..119949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS complement(119946..120572) product phosphoserine phosphatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858827.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 sequence10 source 1..100279 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(120..800) product two-component system response regulator DegU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219701.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 gene degU CDS complement(797..1960) product two-component sensor histidine kinase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227983.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 gene degS CDS 2157..2795 product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926669.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS 2889..3911 product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048656281.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS complement(3943..4995) product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722780.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS 5221..5439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS 5436..6782 product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393198.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS complement(6801..7547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS complement(7559..9001) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS complement(9266..11488) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS 11616..11741 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS 11843..13672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS complement(13701..15473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS complement(15545..22057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS complement(22104..26393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS complement(26545..32610) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS complement(32885..33715) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS complement(33798..34010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS complement(33959..34282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS complement(34276..35790) product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS complement(35792..36364) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114586.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS complement(36935..37438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185130035.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS complement(37666..38169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185130035.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS complement(38842..41781) product S-layer homology domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107329.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS 42158..43123 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS complement(43147..44739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19700 CDS complement(44846..48286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19710 CDS 48524..50854 product accessory Sec system translocase SecA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935165.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 gene secA2 CDS 50877..51743 product accessory Sec system S-layer assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016716591.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS complement(51914..52360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS 52554..52967 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS complement(53266..53505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS 53874..54281 product YwpF-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227794.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS complement(54286..54792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS complement(54774..55697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS complement(55758..57104) product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966541.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS complement(57154..57582) product DUF1284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061260.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS complement(57623..58105) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS complement(58194..60290) product HAMP domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966949.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS complement(60397..61479) product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181502.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 gene csaB CDS complement(61476..63335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS complement(63341..64873) product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034592.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS complement(64870..65604) product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101055.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS 65745..66302 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS complement(66325..68568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS 68780..69499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS complement(69520..70641) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246276.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS 70768..71625 product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281259.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS 71622..72614 product scyllo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228926.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 gene iolU CDS 72714..73763 product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931304.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS complement(73772..74191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS 74333..75988 product SWIM zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227806.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS 75985..78684 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227803.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS complement(78804..81860) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS complement(81938..82909) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987061.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 gene galE CDS complement(83006..84307) product UDP-glucose 6-dehydrogenase UglF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243223.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 gene uglF CDS 84449..85039 product plasmid pRiA4b ORF-3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021922.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS 85303..85740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS complement(85835..87478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS complement(87544..88155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS complement(88152..89222) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143072.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS complement(89661..90581) product transcription antiterminator LytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227949.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 gene lytR CDS complement(91225..92064) product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664667.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 gene rfbD CDS complement(92061..93074) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989656.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 gene rfbB CDS complement(93074..93634) product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721499.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 gene rfbC CDS complement(93653..94540) product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721498.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 gene rfbA CDS complement(94559..95716) product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039851544.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS complement(95735..96847) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808446.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS complement(96920..97252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS complement(97403..97966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS complement(98066..99298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20150 sequence11 source 1..77876 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(85..315) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS complement(370..1407) product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964934.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS complement(1404..2054) product MtnX-like HAD-IB family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964933.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS complement(2090..3211) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844369.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS complement(3293..4282) product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257655.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS complement(4398..4757) product DUF2294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246482.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS 5058..5975 product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379732.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS complement(6025..6162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS complement(6159..6314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS 6505..6792 product MerR family transcriptional regulator TnrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232541.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 gene tnrA CDS 6840..7118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS 7147..7893 product YidC family membrane integrase SpoIIIJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727738.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 gene spoIIIJ CDS 7940..10084 product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766756.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 gene topB CDS complement(10097..10465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS 10607..11524 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229237.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 gene cysK CDS 11572..12849 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772433.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS 12846..14126 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411954.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS 14133..14846 product EF-P-5 aminopentanone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244676.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 gene efpI CDS 14912..15160 product DUF3243 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114454.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS 15341..16132 product DUF3388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000574107.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS 16151..17002 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137484.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS 17032..17610 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244753.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 gene pgsA CDS 17633..18865 product competence/damage-inducible protein CinA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990712.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 gene cinA CDS 18973..20010 product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245789.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 gene recA CDS 20221..21777 product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221010.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 gene rny CDS 21877..22671 product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221095.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS 22798..23058 product stage V sporulation protein SpoVS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154135.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 gene spoVS CDS 23164..24087 product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000688057.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS 24289..26025 product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625424.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS 26028..26894 product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190154.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS 27014..28594 product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244831.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 gene miaB CDS 28596..29027 product RicAFT regulatory complex protein RicA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870461.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS 29186..29722 product outer spore coat protein CotE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231833.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 gene cotE CDS 29798..32362 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244841.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 gene mutS CDS 32376..34202 product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245099.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 gene mutL CDS 34319..35254 product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504940.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 gene miaA CDS 35290..35514 product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813896.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 gene hfq CDS 35630..36559 product stage V sporulation protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438185.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 gene spoVK CDS 36689..38248 product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281991.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS 38261..39403 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134747.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS 39415..40515 product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813988.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS 40478..42085 product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980180.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS 42097..42942 product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538874.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS 42939..44111 product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228126.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS complement(44147..44755) product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219999.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS 44902..46149 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048525537.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 gene hflX CDS 46163..47431 product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460292.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS 47533..47937 product transcriptional repressor GlnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238341.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 gene glnR CDS 47991..49325 product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231737.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 gene glnA CDS complement(49365..49982) product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238209.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 gene lexA CDS 50130..50432 product cell division suppressor protein YneA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231598.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 gene yneA CDS 50448..51143 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991464.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS 51153..51380 product DUF896 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231595.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS 51525..53528 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245397.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 gene tkt CDS 53648..53860 product YneF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221221.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS 53974..54678 product cytochrome c-type biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001152681.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 gene ccdA CDS 54705..55064 product chemotaxis protein CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081049.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 gene cheY CDS 55086..55553 product CcdC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231582.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS complement(55568..56005) product DUF2621 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889384.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS complement(56084..56227) product small acid-soluble spore protein P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221237.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS 56333..56593 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146294.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS complement(56611..56760) product small acid-soluble spore protein O inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000518056.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 gene sspO CDS 56931..59639 product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245728.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 gene acnA CDS complement(59664..59795) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS 59861..60331 product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009925810.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS complement(60326..61222) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181584.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS complement(61283..61966) product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230767.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS 62086..62736 product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875548.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS 62733..62921 product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399003.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS complement(62955..63233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS complement(63345..63545) product cold-shock protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230776.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 gene cspD CDS 63794..64042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS 64162..64566 product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243483.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS 64563..65114 product glycerol uptake operon antiterminator GlpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394287.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 gene glpP CDS 65249..66733 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759995.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 gene glpK CDS 66991..67743 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957279.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS 67740..68663 product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640844.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 gene pfkB CDS 68660..70516 product PTS fructose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232350.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS 70642..71082 product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041153.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS complement(71156..72466) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012262.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS 72655..73464 product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245334.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS complement(73487..75160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS complement(75250..76353) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194336.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS 76526..77026 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701365.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS 77092..77568 product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000266027.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 gene rraA CDS 77610..77762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21010 sequence12 source 1..73966 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 305..1489 product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599321.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS 1662..2504 product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844766.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS 2582..3913 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879430.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS 3949..4578 product comF operon protein ComFC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227991.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 gene comFC CDS 4661..10201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS 10198..10485 product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870093.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS 10545..10958 product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080180.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 gene fliS CDS 10972..12108 product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272513.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS 12190..12627 product YaaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656987.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS 12639..13046 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227995.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS 13112..13369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS 13384..13836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS 13851..15392 product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228001.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 gene flgK CDS 15404..16276 product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228004.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 gene flgL CDS 16291..16845 product DUF6470 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243053.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS 16859..17296 product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228007.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 gene fliW CDS 17309..17551 product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219727.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 gene csrA CDS 17548..17733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS 17875..18732 product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987021.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS 19306..19665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS 19676..21226 product flagellar hook-associated protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242960.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS 21245..21646 product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243747.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 gene fliS CDS 21646..21996 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS 22006..22395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS complement(22430..23512) product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156271991.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS 23686..24234 product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722643.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 gene raiA CDS 24297..24878 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS 25013..27517 product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228033.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 gene secA CDS 27716..28705 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096001716.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 gene prfB CDS 28835..29695 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242677.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS 29755..30081 product cytochrome c-551 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727964.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 gene cccB CDS 30242..30928 product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228039.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 gene ftsE CDS 30918..31811 product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645021.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 gene ftsX CDS 31831..33096 product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726096.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS 33271..34707 product carboxy-terminal processing protease CtpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228041.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 gene ctpB CDS complement(34744..35172) product chromosome-anchoring protein RacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227642.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 gene racA CDS 35352..36515 product cell division topological determinant MinJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242631.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 gene minJ CDS 36517..36741 product CsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228053.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS 36849..38822 product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243787.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 gene uvrB CDS 38826..41678 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045563.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 gene uvrA CDS 41756..42085 product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678055.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS 42082..42279 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS 42276..42620 product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228066.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS 42700..43635 product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228097.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 gene hprK CDS 43650..44459 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242661.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 gene lgt CDS 44480..45415 product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243723.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS 45405..46052 product pyrophosphatase PpaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222403.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 gene ppaX CDS 46049..46537 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255064.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS 46690..47868 product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244441.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS 47868..48509 product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968235.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 gene hisG CDS 48499..49776 product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243286.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 gene hisD CDS 49776..50360 product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243389.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 gene hisB CDS 50361..50993 product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244267.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 gene hisH CDS 50993..51721 product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242559.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 gene hisA CDS 51718..52476 product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244585.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 gene hisF CDS 52473..53096 product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243045.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 gene hisIE CDS 53180..54628 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242799.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS 54724..55671 product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288072.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 gene trxB CDS 55903..56361 product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190080.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS 56380..57270 product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243903.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 gene rapZ CDS 57267..58232 product gluconeogenesis morphogenetic factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244450.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 gene mgfK CDS 58245..59207 product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006561.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 gene whiA CDS 59227..59484 product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219835.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS complement(59513..60103) product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228214.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 gene clpP tRNA 60315..60389 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS 60623..61903 product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647965.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 gene rpoN CDS 61916..62149 product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869729.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 CDS 62285..63316 product gapA transcriptional regulator CggR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968188.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 gene cggR CDS 63353..64360 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219957.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 gene gap CDS 64477..65661 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243051.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 CDS 65679..66434 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243394.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 gene tpiA CDS 66431..67966 product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228330.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 gene gpmI CDS 67986..69281 product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228333.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 gene eno CDS complement(69694..70452) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21740 note possible pseudo, internal stop codon, frameshifted CDS complement(70529..70777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS 70967..71881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS 71918..72586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS 72610..73407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144124.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 sequence13 source 1..73701 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(70..576) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS complement(660..1790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS 2041..2274 product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220028.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 gene secG CDS 2328..3065 product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761976.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 gene estA CDS 3086..5362 product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391084.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 gene rnr CDS 5441..5905 product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220025.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 gene smpB tmRNA 6001..6350 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS 6537..7469 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000748469.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS 7617..8519 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002204710.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS 8506..9297 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626552.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS 9327..9536 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS 9533..10585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS 10607..10918 product heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829739.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS complement(10959..11129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS complement(11204..12355) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS complement(12430..12753) product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228564.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS complement(12766..13017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228567.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS 13182..14099 product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436772.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS complement(14118..14264) product YuzL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228571.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS 14413..16791 product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486377.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS 16804..17976 product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228574.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS 17992..19773 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416279.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS 19842..20201 product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222779.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS 20259..20642 product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222781.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 gene gcvH CDS 20685..20924 product YusG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228581.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS 21022..21369 product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640869.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS 21444..21647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS 21777..22076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22050 CDS 22141..23433 product homocysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272631.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS 23573..25315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS 25627..26655 product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242531.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 gene metN CDS 26645..27313 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359401.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS 27331..28155 product methionine ABC transporter substrate-binding lipoprotein MetQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735115.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 gene metQ CDS 28227..28571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS 28755..29534 product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151872.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 gene sufC CDS 29553..30854 product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228602.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 gene sufD CDS 30851..32074 product cysteine desulfurase SufS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228604.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 gene sufS CDS 32064..32504 product iron-sulfur cluster assembly scaffold protein SufU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009523.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 gene sufU CDS 32528..33925 product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228608.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 gene sufB CDS 34004..34852 product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243895.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 CDS 34865..35683 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455757.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS 35697..37097 product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242525.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 CDS 37151..37453 product YunC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242587.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS 37508..38251 product sporulation protein YunB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968113.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 gene yunB CDS 38437..39948 product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450066.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS complement(40073..41044) product L-Ala--D-Glu endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243462.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 gene lytH CDS 41200..42084 product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222888.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 gene lipA CDS complement(42134..42766) product YhcN/YlaJ family sporulation lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243821.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 CDS 42878..43153 product YutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228682.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS complement(43176..43448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS complement(43486..43752) product DUF3055 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392606.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS 43868..44308 product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000274012.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS 44356..44991 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503345.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 CDS 45084..45854 product 5' nucleotidase NucF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243196.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 gene nucF CDS complement(45884..46381) product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665093.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS 46515..47453 product spore coat protein CotS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614215.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 gene cotS CDS 47501..48472 product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468866.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS 48573..49928 product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228694.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 CDS 49928..50986 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228697.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 gene thrC CDS 50983..51897 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228699.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 gene thrB CDS complement(51935..52171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS 52266..52571 product DUF1462 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248594.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS complement(52609..53676) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242518.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS 53843..54082 product YuzB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595027.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 CDS complement(54088..54771) product DUF2225 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393240.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 CDS 54918..55772 product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243745.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 gene dapF CDS 55789..56151 product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244166.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS complement(56179..57174) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002026689.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS 57477..58694 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886605.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS 58788..58916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS 58974..59297 product YuiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243877.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS 59398..60099 product stationary phase survival protein SpsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969090.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 gene spsC CDS complement(60117..60701) product BioY family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228737.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS 60813..60962 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS complement(60950..61246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS complement(61308..62633) product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545209.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS complement(62656..63084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS 63198..63395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22550 CDS 63449..63961 product superoxide dismutase [Cu-Zn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000746504.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 gene sodC CDS 64053..64553 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968070.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS 64553..65719 product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808537.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS complement(65736..66101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS 66232..66576 product S1 domain-containing post-transcriptional regulator GSP13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003764.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 gene yugI CDS complement(66586..66819) product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220771.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS 66949..68109 product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179093.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS 68220..69569 product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103658.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 CDS 69643..70047 product YugN-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612334.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS complement(70039..71007) product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842311.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 CDS 71110..71289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22660 tRNA complement(71320..71392) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS complement(71487..71702) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22670 note possible pseudo, frameshifted CDS complement(71817..72494) product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386684.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS 72547..73413 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841777.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 sequence14 source 1..60673 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(180..575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130055558.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS complement(588..1739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS complement(1795..1995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS complement(1952..2272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS 2623..3699 product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164993978.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS complement(3750..3977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS complement(4209..4367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS complement(4408..5034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS complement(5027..5893) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433732.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS complement(5877..7571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS complement(8020..8415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS complement(8509..9144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS complement(9144..10475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS complement(11244..12653) product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230365.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 gene gndA CDS complement(12718..13185) product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816185.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 CDS complement(13190..14314) product tripeptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609811.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS 14479..15816 product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269023.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS complement(15863..17410) product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081020.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS complement(17410..17823) product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 gene mce CDS complement(18094..18597) product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146547.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS complement(18648..19595) product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246146.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS complement(19652..20752) product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099360647.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 gene meaB CDS complement(20749..22944) product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258367.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 gene scpA CDS complement(22928..24949) product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258368.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS complement(25109..26407) product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257660.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS complement(26420..27403) product 3-methyl-2-oxobutanoate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290076.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 gene bfmBAB CDS complement(27406..28395) product 3-methyl-2-oxobutanoate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852548.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 gene bfmBAA CDS complement(28410..29831) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051291.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 gene lpdA CDS complement(29844..30944) product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115781.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 gene buk CDS complement(31010..32113) product branched-chain amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230309.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 gene bcd CDS complement(32130..33032) product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764677.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 gene yqiS CDS complement(33161..35227) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810985.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS 35352..35603 product DUF2627 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230304.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS complement(35595..36329) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172591.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS 36385..36531 product YycC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242786.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS complement(36552..37331) product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110369.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 gene spo0A CDS complement(37549..38826) product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002054681.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 gene spoIVB CDS complement(38927..40669) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230267.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 gene recN CDS complement(40688..41137) product arginine repressor ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032581.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 gene argR CDS complement(41231..42073) product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274739.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS complement(42077..43969) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366452.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 gene dxs CDS complement(44142..45020) product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150378.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 gene ispA CDS complement(45024..45236) product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226409.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS complement(45233..46582) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415249.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 gene xseA CDS complement(46597..47448) product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226720.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 gene folD CDS complement(47472..47858) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230256.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 gene nusB CDS complement(47979..48374) product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807630.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS complement(48396..49748) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230253.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 gene accC CDS complement(49762..50262) product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472869.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 gene accB CDS complement(50453..51016) product stage III sporulation ratchet engulfment protein SpoIIIAH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230250.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 gene spoIIIAH CDS complement(51029..51595) product stage III sporulation protein AG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230248.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 gene spoIIIAG CDS complement(51602..52171) product stage III sporulation protein AF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230233.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 gene spoIIIAF CDS complement(52188..53348) product stage III sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943694.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 gene spoIIIAE CDS complement(53353..53739) product stage III sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230228.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 gene spoIIIAD CDS complement(53761..53967) product stage III sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003153142.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 gene spoIIIAC CDS complement(53983..54495) product stage III sporulation protein SpoIIIAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238702.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 gene spoIIIAB CDS complement(54496..55419) product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665889.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 gene spoIIIAA CDS complement(55433..55705) product YqhV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398639.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS 55922..56407 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221050.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS complement(56477..57034) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226377.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 gene efp CDS complement(57053..58114) product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411056.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 gene pepQ CDS complement(58117..58563) product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757082.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 gene aroQ CDS complement(58602..59120) product YqhR family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230222.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS 59281..60210 product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807121.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 CDS 60231..60572 product SA1362 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226367.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 sequence15 source 1..56989 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 261..335 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 tRNA 338..410 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 tRNA 425..499 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 tRNA 506..581 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 tRNA 632..707 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 tRNA 713..797 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 tRNA 816..890 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA 901..974 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 tRNA 980..1054 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 tRNA 1055..1129 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS 1281..2177 product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711563.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 gene rocF CDS 2300..2863 product RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234958.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 gene sigW CDS 2884..3498 product anti-sigma-W factor RsiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234951.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 gene rsiW CDS 3562..4383 product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223651.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 gene cdaA CDS 4376..5611 product CdaA regulatory protein CdaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234947.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 gene cdaR CDS 5628..6974 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234946.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 gene glmM CDS 7361..9163 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334158.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 gene glmS CDS complement(9233..9550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS complement(9679..10344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS complement(10236..10910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23440 note possible pseudo, frameshifted CDS complement(11216..11494) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23450 CDS complement(11617..12606) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243554.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS 13044..13748 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243600.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS 13761..14021 product PqqD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242779.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 CDS 14038..14532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243073.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS 14539..16764 product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244103.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 gene asnB CDS 16783..17976 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244232.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS complement(18119..18559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS complement(18550..20820) product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232565.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 gene metE CDS 21485..21835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23540 CDS 21850..22473 product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814146.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 CDS 22547..23272 product cell wall-active antibiotics response protein LiaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003734006.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 gene liaF CDS 23269..24276 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722885.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS 24289..24915 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598709.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS 25007..25768 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813595.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS 25861..26904 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078275.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS 26968..27672 product DUF3298 and DUF4163 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810326.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS complement(27688..29307) product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948291.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS complement(29304..29819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS 29984..30619 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229253.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS 30716..31858 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245114.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS 31871..33511 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941764.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 CDS 33523..34884 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231523.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS 34877..35089 product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001985297.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS 35100..35990 product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231525.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 gene ldeG CDS 35990..36772 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231526.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 CDS 36776..38323 product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886744.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS 38510..39178 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890976.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 CDS 39193..39774 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221277454.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 CDS 39790..40902 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245161.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 CDS complement(40919..41992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS complement(42043..43506) product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393538.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 CDS complement(43503..44585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23770 CDS 44732..45775 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161427.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS 45785..47161 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610677.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 gene murF CDS 47307..48713 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206592.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 CDS 48763..49125 product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583416.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 gene acpS CDS 49200..50219 product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234282.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS 50314..51471 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234284.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 gene alr CDS 51624..51905 product antitoxin EndoAI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004570.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS 51910..52260 product type II toxin-antitoxin system endoribonuclease NdoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156187.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 gene ndoA CDS 52318..54483 product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211477896.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS 54664..55119 product SprT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344247.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 tRNA 55396..55470 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 tRNA 55473..55565 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 tRNA 55581..55655 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 tRNA 55693..55766 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 tRNA 55773..55848 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 tRNA 55880..55954 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 tRNA 56104..56179 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 tRNA 56185..56268 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA 56291..56376 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 tRNA 56435..56511 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 tRNA 56532..56608 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 tRNA 56782..56852 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 sequence16 source 1..55643 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 325..1086 product polysaccharide deacetylase family sporulation protein PdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235130.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 gene pdaB CDS complement(1103..1699) product KinB signaling pathway activation protein KbaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088508.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 gene kbaA CDS 1831..2427 product spore germination lipoprotein GerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827295.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 gene gerD CDS complement(2444..3451) product iron-sulfur carrier protein/transcriptional regulator SalA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235124.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 gene salA CDS complement(3531..4229) product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399672.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 gene cwlD CDS complement(4285..4689) product YbaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101006.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS complement(4778..5170) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079986.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 gene rpsI CDS complement(5193..5627) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003241966.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 gene rplM CDS complement(5774..6514) product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001995175.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 gene truA CDS complement(6530..7327) product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399656.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS complement(7324..8193) product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406513.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS complement(8151..9005) product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711776.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS complement(9119..9481) product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331490.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 gene rplQ CDS complement(9542..10468) product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569643.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 gene rpoA assembly_gap 10351..10360 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(10637..11026) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101798.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 gene rpsK CDS complement(11052..11417) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090788.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 gene rpsM CDS complement(11584..11802) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156508.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 gene infA CDS complement(11901..12647) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225828.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 gene map CDS complement(12647..13297) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399686.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 CDS complement(13357..14649) product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490114.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 gene secY CDS complement(14649..15089) product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766081.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 gene rplO CDS complement(15104..15292) product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156497.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 gene rpmD CDS complement(15307..15807) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003328273.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 gene rpsE CDS complement(15827..16189) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225816.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 gene rplR CDS complement(16222..16761) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399690.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 gene rplF CDS complement(16791..17189) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000245511.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 gene rpsH CDS complement(17223..17408) product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085700.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 gene rpsN CDS complement(17443..17982) product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080831.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 gene rplE CDS complement(18012..18323) product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558200.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 gene rplX CDS complement(18360..18728) product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225805.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 gene rplN CDS complement(18777..19040) product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225804.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 gene rpsQ CDS complement(19066..19266) product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156482.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 gene rpmC CDS complement(19256..19690) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225801.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 gene rplP CDS complement(19693..20349) product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235068.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 gene rpsC CDS complement(20353..20694) product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148024.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 gene rplV CDS complement(20715..20993) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124453.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 gene rpsS CDS complement(21051..21881) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225795.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 gene rplB CDS complement(21909..22196) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156467.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 gene rplW CDS complement(22196..22819) product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399658.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 gene rplD CDS complement(22847..23473) product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399671.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 gene rplC CDS complement(23497..23805) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040596.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 gene rpsJ CDS complement(24082..25269) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029614.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 gene tuf CDS complement(25390..27468) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090364.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 gene fusA CDS complement(27603..28073) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137491.1 transl_table 11 codon_start 1 locus_tag LOCUS_24310 gene rpsG CDS complement(28118..28540) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225781.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 gene rpsL CDS complement(28642..28890) product 50S ribosomal protein L7ae-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225778.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 CDS complement(29016..32615) product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399688.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 gene rpoC CDS complement(32665..36225) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966326.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 gene rpoB CDS complement(36433..37032) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235045.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 CDS complement(37120..37485) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159736.1 transl_table 11 codon_start 1 locus_tag LOCUS_24370 gene rplL CDS complement(37531..38031) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235042.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 gene rplJ CDS complement(38272..38973) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001987630.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 gene rplA CDS complement(39077..39502) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156430.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 gene rplK CDS complement(39654..40187) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415794.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 gene nusG CDS complement(40307..40489) product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399676.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 gene secE CDS complement(40521..40670) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966428.1 transl_table 11 codon_start 1 locus_tag LOCUS_24430 gene rpmG CDS complement(40734..41384) product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966312.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 gene sigH CDS complement(41452..41961) product ribosome-dependent mRNA decay endonuclease Rae1/YacP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235032.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 gene rae1 CDS complement(41963..42700) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200237.1 transl_table 11 codon_start 1 locus_tag LOCUS_24460 gene rlmB CDS complement(42703..43128) product mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399685.1 transl_table 11 codon_start 1 locus_tag LOCUS_24470 CDS complement(43133..44530) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399682.1 transl_table 11 codon_start 1 locus_tag LOCUS_24480 gene cysS CDS complement(44511..45176) product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071396735.1 transl_table 11 codon_start 1 locus_tag LOCUS_24490 gene cysE CDS complement(45494..46954) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415154.1 transl_table 11 codon_start 1 locus_tag LOCUS_24500 gene gltX CDS complement(47018..47500) product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488386.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 gene ispF CDS complement(47500..48186) product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235019.1 transl_table 11 codon_start 1 locus_tag LOCUS_24520 gene ispD CDS complement(48206..49294) product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235014.1 transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS complement(49384..50778) product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399687.1 transl_table 11 codon_start 1 locus_tag LOCUS_24540 gene radA CDS complement(50838..53270) product ATP-dependent protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971183.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 gene clpC CDS complement(53291..54355) product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235007.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 CDS complement(54348..54902) product protein-arginine kinase activator protein McsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966297.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 gene mcsA CDS complement(54917..55378) product transcriptional regulator CtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225724.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 gene ctsR sequence17 source 1..49928 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 8..1951 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24590 CDS 1957..2667 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435381.1 transl_table 11 codon_start 1 locus_tag LOCUS_24600 CDS 2714..4177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24610 CDS complement(4390..5217) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878847.1 transl_table 11 codon_start 1 locus_tag LOCUS_24620 CDS complement(5317..5649) product DUF779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057670999.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS complement(5701..7221) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329122.1 transl_table 11 codon_start 1 locus_tag LOCUS_24640 CDS complement(7421..8101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217519.1 transl_table 11 codon_start 1 locus_tag LOCUS_24650 CDS complement(8115..9224) product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704492.1 transl_table 11 codon_start 1 locus_tag LOCUS_24660 CDS complement(9272..10684) product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711547.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 gene nhaC CDS 10813..11928 product M20 peptidase aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853516.1 transl_table 11 codon_start 1 locus_tag LOCUS_24680 CDS 11932..12384 product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234318.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 CDS 12377..13771 product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966602.1 transl_table 11 codon_start 1 locus_tag LOCUS_24700 CDS complement(13812..14522) product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846381.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 gene cobB CDS 14768..15406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS 15489..15668 product small acid-soluble spore protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244276.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 CDS complement(15700..16581) product cysJI operon transcriptional regulator CysL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243173.1 transl_table 11 codon_start 1 locus_tag LOCUS_24740 gene cysL CDS 16718..18493 product assimilatory sulfite reductase (NADPH) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243259.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 CDS 18505..20220 product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243849.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 gene cysI CDS 20332..20649 product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637511.1 transl_table 11 codon_start 1 locus_tag LOCUS_24770 CDS 20808..21086 product autorepressor SdpR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070523.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS 21083..21709 product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065619.1 transl_table 11 codon_start 1 locus_tag LOCUS_24790 CDS 21724..22473 product YhfC family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254517.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 CDS 22654..23217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS 23417..24619 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543417.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS complement(24656..25360) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639796.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS complement(25377..25775) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968618.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 CDS complement(25831..26271) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111427.1 transl_table 11 codon_start 1 locus_tag LOCUS_24850 CDS 26561..27148 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24860 CDS 27266..28138 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080497.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 CDS 28150..28944 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080494.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS 29142..31325 product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763731.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 CDS 31383..32147 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391955.1 transl_table 11 codon_start 1 locus_tag LOCUS_24900 CDS 32214..34274 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24910 CDS complement(34369..35133) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24920 CDS 35357..36757 product PTS mannitol transporter subunit IICB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886406.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 CDS 36953..39028 product mannitol operon transcriptional activator MtlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246695.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 gene mtlR CDS 39035..39466 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246714.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 CDS 39468..40607 product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246548.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 CDS 41177..41326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24970 CDS complement(41356..42246) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000500302.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 CDS complement(42259..43509) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000584801.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 CDS 43690..44907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25000 CDS complement(45462..46112) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345960.1 transl_table 11 codon_start 1 locus_tag LOCUS_25010 CDS complement(46127..46780) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112672.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 CDS complement(46843..47694) product glutamine ABC transporter substrate-binding protein GlnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916480.1 transl_table 11 codon_start 1 locus_tag LOCUS_25030 gene glnH CDS complement(47716..48444) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246180.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 CDS 48684..49007 product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461986.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 CDS 49019..49750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25060 sequence18 source 1..49653 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(300..1784) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000369671.1 transl_table 11 codon_start 1 locus_tag LOCUS_25070 gene lysS CDS complement(1853..2854) product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912262.1 transl_table 11 codon_start 1 locus_tag LOCUS_25080 gene dusB CDS complement(2854..3390) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242690.1 transl_table 11 codon_start 1 locus_tag LOCUS_25090 gene folK CDS complement(3394..3756) product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358062.1 transl_table 11 codon_start 1 locus_tag LOCUS_25100 gene folB CDS complement(3746..4582) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025985130.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 gene folP CDS complement(4579..5448) product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000909893.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 gene pabC CDS complement(5461..6030) product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602293.1 transl_table 11 codon_start 1 locus_tag LOCUS_25130 gene pabA CDS complement(6036..7436) product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189680.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 gene pabB CDS complement(7557..8483) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244491.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 gene cysK CDS complement(8561..9451) product redox-regulated molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226695.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 gene hslO CDS complement(9454..10227) product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886388.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 CDS complement(10327..12210) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243881.1 transl_table 11 codon_start 1 locus_tag LOCUS_25180 gene ftsH CDS complement(12297..12842) product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226700.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 gene hpt CDS complement(12863..14245) product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655465.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 gene tilS CDS complement(14379..15320) product serine/threonine protein kinase PrkT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966278.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 gene prkT CDS complement(15295..16038) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243782.1 transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS complement(16105..18576) product stage II sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243026.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 gene spoIIE tRNA complement(18747..18818) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 tRNA complement(18831..18907) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 CDS complement(19042..19446) product S1 domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021452.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS complement(19537..19908) product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722746.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 CDS complement(20537..20830) product sporulation protein YabP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059101.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 gene yabP CDS complement(20897..21154) product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234876.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 CDS complement(21156..22607) product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014253.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 gene mazG CDS complement(22610..24166) product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387598.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 CDS complement(24231..24767) product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218365.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 gene spoVT CDS complement(24963..28475) product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579713.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 gene mfd CDS complement(28533..28763) product anti-sigma-F factor Fin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243417.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 gene fin CDS complement(28830..29393) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254063.1 transl_table 11 codon_start 1 locus_tag LOCUS_25330 gene pth CDS complement(29451..30068) product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243443.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 CDS complement(30134..31084) product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107420.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 CDS complement(31102..32478) product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226732.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 gene glmU CDS complement(32665..32955) product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454041.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 gene spoVG CDS complement(33045..33425) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226738.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 CDS complement(33459..34283) product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078543208.1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 gene purR CDS complement(34299..35165) product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772104.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 gene ispE CDS complement(35293..35562) product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218330.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 CDS complement(35765..36643) product sporulation-specific protease PrtG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243478.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 gene prtG CDS complement(36717..37604) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226751.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 gene rsmA CDS complement(37597..38157) product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692835.1 transl_table 11 codon_start 1 locus_tag LOCUS_25440 gene rnmV CDS complement(38231..39424) product ubiquitin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226754.1 transl_table 11 codon_start 1 locus_tag LOCUS_25450 CDS complement(39629..40396) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895823.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 CDS complement(40514..42463) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134141.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 gene metG CDS 42956..43240 product transition state genes transcriptional regulator AbrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226760.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 gene abrB CDS complement(43275..44141) product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000267819.1 transl_table 11 codon_start 1 locus_tag LOCUS_25490 gene rsmI CDS complement(44148..44882) product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055361.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 CDS complement(44937..45284) product DNA replication initiation control protein YabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412056.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 gene yabA CDS complement(45300..46127) product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272429.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 CDS complement(46120..47118) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169561.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 gene holB CDS complement(47129..47758) product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243137.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 gene tmk CDS complement(47760..49184) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075300.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 CDS complement(49266..49448) product anti-sigma-G factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243294.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 gene csfB sequence19 source 1..47762 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(106..1443) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402274.1 transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS complement(1490..2176) product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228889.1 transl_table 11 codon_start 1 locus_tag LOCUS_25580 CDS complement(2330..3463) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967833.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 CDS complement(3517..3750) product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080491.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 CDS complement(3832..4608) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229890.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 CDS complement(4657..4884) product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229888.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 CDS complement(4896..5291) product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391975.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 CDS complement(5288..5869) product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023951.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 CDS complement(5881..6180) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661705.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS complement(6327..6479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25660 CDS complement(6535..6882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25670 CDS complement(7218..7841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25680 CDS complement(7919..9118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25690 CDS complement(9227..9904) product sporulation-specific N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244862.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 gene cwlC CDS complement(9986..10399) product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439566.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS complement(10410..11822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25720 CDS complement(11833..13518) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25730 CDS complement(13531..14262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25740 CDS complement(14262..17354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25750 CDS complement(17368..17535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25760 CDS complement(17547..17834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25770 CDS complement(17894..18463) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25780 CDS complement(18485..18808) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25790 CDS complement(18805..19194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25800 CDS complement(19194..19520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS complement(19501..19761) product head-tail connector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365101.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 CDS complement(19776..21053) product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002415255.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 CDS complement(21050..21625) product HK97 family phage prohead protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385658.1 transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS complement(21622..22782) product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524248.1 transl_table 11 codon_start 1 locus_tag LOCUS_25850 CDS complement(22798..24525) product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587519.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 CDS complement(24532..24918) product P27 family phage terminase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113444.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 CDS complement(25039..25257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25880 CDS complement(25386..25529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25890 CDS complement(25580..25810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS complement(26030..26323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS complement(26483..27025) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012145.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 CDS complement(27022..27465) product ArpU family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166128.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS complement(27489..27683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS complement(27812..28540) product phage antirepressor KilAC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399389.1 transl_table 11 codon_start 1 locus_tag LOCUS_25950 CDS complement(28556..28819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25960 CDS complement(28836..29036) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25970 CDS complement(29033..29221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25980 CDS complement(29233..29457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25990 CDS complement(29463..29633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS complement(29679..29888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26010 CDS complement(29951..30088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26020 CDS complement(30085..30345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26030 CDS complement(30347..30826) product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365050.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 CDS complement(30826..30990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26050 CDS complement(31057..31245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26060 CDS complement(31251..31451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26070 CDS complement(31461..32438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS complement(32490..32666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26090 CDS complement(32705..33034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26100 CDS complement(33039..33293) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26110 CDS complement(33540..33710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26120 CDS complement(33752..33889) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS complement(33904..34425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26140 CDS complement(34480..34710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26150 CDS complement(34787..34984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26160 CDS 35136..35543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS 35662..36360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26180 CDS 36377..37465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS 37558..38037 product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232721.1 transl_table 11 codon_start 1 locus_tag LOCUS_26200 CDS 38095..39648 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861147.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 CDS complement(39645..40814) product sporulation protein YhbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503517.1 transl_table 11 codon_start 1 locus_tag LOCUS_26220 gene yhbH CDS complement(41035..42930) product serine/threonine protein kinase PrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233433.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 gene prkA CDS complement(43212..43685) product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886453.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 gene trmL CDS complement(43697..44554) product amidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886452.1 transl_table 11 codon_start 1 locus_tag LOCUS_26250 CDS complement(44613..45749) product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345218.1 transl_table 11 codon_start 1 locus_tag LOCUS_26260 gene queG CDS 45814..46476 product B3/4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245517.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 tRNA complement(46557..46630) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 sequence20 source 1..25623 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(13..207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26280 CDS complement(225..806) product segregation/condensation protein ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000376225.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 gene scpB CDS complement(799..1539) product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246108.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 gene scpA CDS 1609..2115 product DUF309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230498.1 transl_table 11 codon_start 1 locus_tag LOCUS_26310 CDS complement(2122..2466) product GNAT family N-acetyltransferase RibT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223910.1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 gene ribT CDS complement(2549..3013) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230892.1 transl_table 11 codon_start 1 locus_tag LOCUS_26330 gene ribH CDS complement(3027..4220) product bifunctional 3,4-dihydroxy-2-butanone 4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468974.1 transl_table 11 codon_start 1 locus_tag LOCUS_26340 gene ribBA CDS complement(4226..4864) product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493908.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 gene ribE CDS complement(4870..5946) product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131960.1 transl_table 11 codon_start 1 locus_tag LOCUS_26360 gene ribD CDS complement(6368..6808) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853783.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 CDS 6928..7791 product DUF1002 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850516.1 transl_table 11 codon_start 1 locus_tag LOCUS_26380 CDS complement(7838..9151) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398851.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 gene lysA CDS complement(9227..10696) product spore germination protein SpoVAF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230471.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 gene spoVAF CDS complement(10653..11255) product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254415.1 transl_table 11 codon_start 1 locus_tag LOCUS_26410 CDS complement(11252..11572) product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345915.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 gene spoVAE CDS complement(11575..12582) product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241156.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 gene spoVAD CDS complement(12594..12938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26440 CDS complement(12949..13368) product stage V sporulation protein SpoVAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230463.1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 gene spoVAB CDS complement(13358..13978) product stage V sporulation protein SpoVAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438361.1 transl_table 11 codon_start 1 locus_tag LOCUS_26460 gene spoVAA CDS complement(14058..14795) product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230458.1 transl_table 11 codon_start 1 locus_tag LOCUS_26470 gene sigF CDS complement(14809..15249) product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230452.1 transl_table 11 codon_start 1 locus_tag LOCUS_26480 gene spoIIAB CDS complement(15250..15600) product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059133.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 gene spoIIAA CDS complement(15701..16858) product D-alanyl-D-alanine carboxypeptidase DacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398637.1 transl_table 11 codon_start 1 locus_tag LOCUS_26500 gene dacF CDS complement(16948..18249) product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243061.1 transl_table 11 codon_start 1 locus_tag LOCUS_26510 CDS complement(18268..19092) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078448.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 CDS complement(19109..20290) product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046067.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 gene deoB CDS complement(20448..21350) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390088.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 gene xerD CDS complement(21352..21564) product YqzK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230440.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 CDS complement(21663..22112) product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223972.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 gene fur CDS complement(22217..22861) product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269101.1 transl_table 11 codon_start 1 locus_tag LOCUS_26570 gene spoIIM CDS complement(22931..23485) product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398600.1 transl_table 11 codon_start 1 locus_tag LOCUS_26580 gene nudF CDS 23584..24498 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398525.1 transl_table 11 codon_start 1 locus_tag LOCUS_26590 CDS complement(24519..24713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26600 CDS 24771..24890 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26610 CDS complement(24912..25151) product DUF2552 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360793.1 transl_table 11 codon_start 1 locus_tag LOCUS_26620 CDS 25302..25508 product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081584587.1 transl_table 11 codon_start 1 locus_tag LOCUS_26630 sequence21 source 1..16697 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 466..1587 product dNTP triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020534.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 gene dgt CDS 1660..2190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26650 CDS 2208..2720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26660 CDS 2734..3984 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244857.1 transl_table 11 codon_start 1 locus_tag LOCUS_26670 CDS 4055..4678 product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660122.1 transl_table 11 codon_start 1 locus_tag LOCUS_26680 CDS complement(4794..4997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26690 CDS 5991..6173 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26700 CDS 6266..6616 product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002816285.1 transl_table 11 codon_start 1 locus_tag LOCUS_26710 CDS 6592..6873 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26720 CDS 6948..7202 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26730 CDS 7311..7826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26740 note possible pseudo, internal stop codon CDS 7887..8084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26750 note possible pseudo, frameshifted CDS complement(8647..9258) product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393784.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 CDS complement(9272..10759) product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246151.1 transl_table 11 codon_start 1 locus_tag LOCUS_26770 gene zwf CDS 10879..11817 product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397455.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 gene rnz CDS 11814..12131 product CHY zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405189.1 transl_table 11 codon_start 1 locus_tag LOCUS_26790 CDS complement(12169..13170) product NADPH dehydrogenase NamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083631.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 gene namA CDS complement(13243..14076) product pyrroline-5-carboxylate reductase ProI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027249.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 gene proI CDS 14513..15460 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125147.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 CDS 15457..16242 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147802.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 CDS 16254..16571 product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226552.1 transl_table 11 codon_start 1 locus_tag LOCUS_26840 sequence22 source 1..14332 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(228..1385) product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546117.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 CDS 1446..1652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26860 CDS 1564..2046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26870 CDS complement(2859..3287) product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067126.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 CDS complement(3313..3921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26890 CDS complement(3926..7027) product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121523862.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 CDS complement(7042..7776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26910 CDS complement(7754..9904) product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181512.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 CDS complement(9901..10971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26930 CDS complement(10968..12752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26940 CDS complement(12762..13424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26950 CDS complement(13741..14127) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26960 sequence23 source 1..14292 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(313..1641) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833082.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 CDS complement(1940..3475) product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244399.1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 gene guaA CDS 3782..4315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431334.1 transl_table 11 codon_start 1 locus_tag LOCUS_26990 CDS complement(4332..4841) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527197.1 transl_table 11 codon_start 1 locus_tag LOCUS_27000 CDS complement(5012..6628) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029999.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 gene groEL CDS complement(6699..6983) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917311.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 gene groES CDS 7209..7946 product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745340.1 transl_table 11 codon_start 1 locus_tag LOCUS_27030 CDS 7943..8116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27040 CDS complement(8126..8761) product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234073.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 CDS 8989..10884 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602146.1 transl_table 11 codon_start 1 locus_tag LOCUS_27060 CDS complement(11179..12192) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414606.1 transl_table 11 codon_start 1 locus_tag LOCUS_27070 gene tsaD CDS complement(12189..12632) product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367197.1 transl_table 11 codon_start 1 locus_tag LOCUS_27080 gene rimI CDS complement(12633..13337) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865740.1 transl_table 11 codon_start 1 locus_tag LOCUS_27090 gene tsaB CDS complement(13318..13791) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049642.1 transl_table 11 codon_start 1 locus_tag LOCUS_27100 gene tsaE tRNA complement(13945..14021) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 sequence24 source 1..13280 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(316..582) product pro-sigmaK processing inhibitor BofA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089257.1 transl_table 11 codon_start 1 locus_tag LOCUS_27110 CDS complement(669..890) product YaaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466019.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 CDS complement(890..1486) product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225425.1 transl_table 11 codon_start 1 locus_tag LOCUS_27130 gene recR CDS complement(1496..1819) product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000984482.1 transl_table 11 codon_start 1 locus_tag LOCUS_27140 CDS complement(1836..3515) product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247135.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 gene dnaX CDS complement(3962..4450) product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247140.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 gene tadA CDS 4586..5224 product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148218.1 transl_table 11 codon_start 1 locus_tag LOCUS_27170 CDS 5221..5889 product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053585.1 transl_table 11 codon_start 1 locus_tag LOCUS_27180 tRNA complement(6010..6102) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 CDS complement(6182..7456) product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884181.1 transl_table 11 codon_start 1 locus_tag LOCUS_27190 gene serS CDS complement(7777..8355) product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238799.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 gene pdxT CDS complement(8374..9258) product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247145.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 gene pdxS CDS complement(9471..10799) product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966224.1 transl_table 11 codon_start 1 locus_tag LOCUS_27220 gene dacA CDS complement(10899..12365) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226803.1 transl_table 11 codon_start 1 locus_tag LOCUS_27230 gene guaB CDS 12485..13183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27240 sequence25 source 1..4103 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 22..417 product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437765.1 transl_table 11 codon_start 1 locus_tag LOCUS_27250 CDS 421..750 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098837.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 CDS complement(780..1820) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091307767.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 CDS complement(1911..2033) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27280 CDS complement(2064..2531) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27290 note possible pseudo, internal stop codon tRNA complement(2748..2833) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 tRNA complement(2884..2970) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 tRNA complement(2982..3055) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 tRNA complement(3066..3138) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 tRNA complement(3144..3218) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 tRNA complement(3236..3311) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 tRNA complement(3321..3394) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 tRNA complement(3399..3483) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00560 tRNA complement(3489..3564) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00570 tRNA complement(3575..3650) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00580 tRNA complement(3656..3731) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00590 tRNA complement(3736..3812) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00600 tRNA complement(3855..3930) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00610 rRNA complement(3945..4054) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 sequence26 source 1..3145 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(382..816) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27300 CDS complement(835..2199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27310 note possible pseudo, internal stop codon, frameshifted CDS complement(2579..2926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27320 sequence27 source 1..2944 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence28 source 1..2337 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(146..904) product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974232.1 transl_table 11 codon_start 1 locus_tag LOCUS_27330 gene istB CDS complement(901..1941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27340 sequence29 source 1..2237 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 86..1429 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27350 CDS complement(1472..2011) product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889051.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 CDS complement(1990..2121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27370 sequence30 source 1..1829 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 296..1477 product ISL3-like element IS1001 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927279.1 transl_table 11 codon_start 1 locus_tag LOCUS_27380 sequence31 source 1..1546 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence32 source 1..1532 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(77..1438) product IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223881838.1 transl_table 11 codon_start 1 locus_tag LOCUS_27390 sequence33 source 1..1528 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence34 source 1..1194 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(36..548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27400 note possible pseudo, frameshifted CDS complement(566..1096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27410 sequence35 source 1..1187 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(36..539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27420 CDS complement(613..1089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27430