COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..439565 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 106..423 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633424.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 gene rpsJ CDS 420..1046 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173714.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 gene rplC CDS 1046..1672 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173713.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 gene rplD CDS 1669..1959 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633421.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS 1969..2802 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173712.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 gene rplB CDS 2877..3095 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173711.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 gene rpsS CDS 3107..3445 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173710.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 gene rplV CDS 3438..4181 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633418.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 gene rpsC CDS 4168..4593 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228846.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 gene rplP CDS 4580..4777 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633416.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 gene rpmC CDS 4791..5084 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228845.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 gene rpsQ CDS 5081..5449 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228844.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 gene rplN CDS 5449..5787 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173707.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 gene rplX CDS 5796..6344 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228843.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 gene rplE CDS 6354..6539 product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633399.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS 6608..7003 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173705.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 gene rpsH CDS 7005..7550 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173704.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 gene rplF CDS 7553..7891 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633391.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 gene rplR CDS 7903..8373 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633389.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 gene rpsE CDS 8373..8558 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258249.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 gene rpmD CDS 8555..9040 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173703.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 gene rplO CDS 9042..10364 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228842.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 gene secY CDS 10364..10933 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173701.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS 10933..11685 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173700.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 gene map CDS 11696..11914 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633373.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 gene infA CDS 11918..12037 product 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633370.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 gene rpmJ CDS 12052..12432 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633368.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 gene rpsM CDS 12523..12918 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633365.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 gene rpsK CDS 12932..13561 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173699.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 gene rpsD CDS 13573..14541 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173698.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS 14545..14901 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633358.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 gene rplQ CDS complement(14961..15530) product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888630.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS complement(15606..15815) product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582834.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS complement(15877..16908) product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227956.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS complement(16948..17415) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979852.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS 17486..18442 product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228450.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS 18447..18995 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228452.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS 19020..20090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS complement(20066..21199) product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227978.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 gene hemW CDS 21236..21946 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS 21983..23176 product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228725.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 gene hemA CDS 23178..23921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS 23939..24169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS 24162..24896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS 24893..25264 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS 25261..25563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS 25560..25940 product DUF2089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480250.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS complement(25891..27327) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228722.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS complement(27374..28081) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024119401.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS complement(28167..28799) product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888515.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS complement(28809..29576) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889246.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS 29608..30789 product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887566.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(30847..31506) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880523.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS 31610..33976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228364.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS 33973..36726 product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228363.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS complement(36911..37336) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228632.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS complement(37359..38189) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968528.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS 38188..38508 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174252.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS complement(38501..38974) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174165.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS complement(38987..39367) product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212541.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 gene acpS CDS 39391..40743 product 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228642.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 gene rsmF CDS complement(40740..41405) product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228805.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS complement(41402..42007) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228804.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS 42043..42291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS complement(42335..42841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS complement(42817..43446) product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173647.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 gene tmk CDS complement(43449..44201) product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228802.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS complement(44180..44659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS complement(44669..45100) product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227714.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS complement(45105..46538) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227710.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS complement(46543..47169) product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886943.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS complement(47178..47777) product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886944.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS complement(47793..48863) product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227709.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS complement(48906..50726) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227708.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS complement(50788..51135) product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228822.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 gene erpA CDS complement(51230..52645) product tyrosine phenol-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256475.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS 52740..53954 product DUF3179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256451.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS complement(54959..56764) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228160.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 gene lepA tRNA complement(56848..56934) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS complement(56989..58659) product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228147.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS complement(58705..60561) product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350148.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS complement(60566..62809) product vWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228411.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS complement(62813..64006) product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227844.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 gene ispG CDS complement(64829..67168) product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229047.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 gene pheT CDS complement(67179..68195) product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229046.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 gene pheS CDS 68375..69463 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480301.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS complement(69527..70291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS complement(70359..71579) product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618921.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS complement(71678..72832) product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227845.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 gene tgt CDS complement(72882..73658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS complement(73655..74092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(74089..74529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS complement(74529..76937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS 77110..77469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS 77481..77822 product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008634053.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS 77873..78703 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS 78762..79319 product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227865.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS 79324..80190 product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229196.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS complement(80239..81972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS 82111..82257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS complement(82231..82608) product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392516.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS complement(82605..83678) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065216.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 gene alr CDS 83860..84432 product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173934.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS 84399..85385 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228513.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS 85382..86170 product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143432.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS 86171..86950 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143437.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS 86968..87582 product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228511.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 gene plsY CDS 87579..88256 product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228508.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 gene bshB1 CDS complement(88789..90495) product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909408.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS complement(90492..90938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS 91035..91937 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228507.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 gene argF CDS 91925..92971 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173267.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 gene argC CDS 92982..94124 product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228506.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 gene argJ CDS 94218..94667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS 94683..95279 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228505.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 tRNA 95328..95404 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS 95466..97100 product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228733.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS complement(97097..97684) product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938294.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS complement(97770..98471) product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228693.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS complement(98482..100173) product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228694.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 gene sdhA CDS complement(100224..100625) product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632977.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS complement(100625..100987) product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173507.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 gene sdhC CDS 101142..101561 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS complement(101548..103008) product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228647.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS complement(103012..103455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01230 note possible pseudo, frameshifted CDS 103472..103804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS 104116..104868 product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228646.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS complement(105089..106558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS complement(106679..107977) product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228645.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 gene der CDS complement(108183..109400) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228734.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS 109442..109666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS 109656..110195 product MoaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227738.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS 110198..110830 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813053.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS 110864..111493 product acetoin utilization AcuB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172560.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS 111481..112617 product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227961.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS complement(112604..113071) product DNA base-flipping protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228767.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS complement(113068..113673) product TetR family transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227711.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 gene fadR CDS complement(113703..114440) product DUF4388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228649.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(114425..115297) product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228648.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 gene thrB CDS complement(115309..115935) product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228763.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS complement(115932..116390) product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479994.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 gene argR CDS complement(116380..117555) product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228764.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 gene coaBC CDS complement(117620..117922) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633185.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 gene rpoZ CDS complement(117925..118557) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633187.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 gene gmk CDS 118686..120125 product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228766.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS 120248..123133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS 124140..124625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS 125268..127580 product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871577.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS 127591..128619 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS 128964..129947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01480 tRNA 130267..130342 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS 130421..131224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS 131221..132354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS complement(132351..133301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682355.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS complement(133412..133840) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS complement(133851..135011) product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878064.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS 135140..135898 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462044.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS 135920..137083 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194779.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS complement(137349..137852) product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926813.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS complement(137849..139783) product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228569.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS complement(139780..140652) product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060384824.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS complement(140656..141333) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173343.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS complement(141366..141830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS complement(141834..142082) product DUF3248 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173341.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS complement(142079..143260) product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228566.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS 143411..143725 product V-type ATPase subunit subunit G family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632725.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS 143722..145695 product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228564.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS 145729..146031 product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173338.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS 146098..146664 product V-type ATP synthase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228563.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS 146708..147658 product V-type ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228562.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS 147655..147981 product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228561.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 gene atpF CDS 148001..149737 product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228560.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS 149750..151153 product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173333.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS 151166..151801 product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173332.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 gene atpD CDS complement(151862..152332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS complement(152368..153366) product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480024.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS complement(153883..155196) product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081001.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS complement(155193..156587) product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081003.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS complement(156620..157504) product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228200.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 gene holA CDS complement(157574..158647) product TIGR04053 family radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046898.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS complement(158715..159050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS complement(159047..159688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(159808..161352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS complement(161529..165095) product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228073.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 gene metH CDS complement(165412..166635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS complement(166714..167025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS complement(167073..167462) product DUF3197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173575.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS complement(167512..168513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS complement(168572..170188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(170154..170912) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816573.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS complement(170919..172241) product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228576.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS 172332..173015 product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173352.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 gene ftsE CDS 173067..173618 product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632742.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 gene raiA CDS complement(173665..174867) product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228419.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS complement(174864..175730) product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228418.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS 175795..176679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS 176706..177254 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037101.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS 177313..178560 product nitrous oxide reductase family maturation protein NosD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113112.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS 178545..179294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS 179266..179913 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS 179926..180417 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS 180420..181193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01990 tRNA complement(181242..181318) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS 181414..182199 product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228884.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 gene pyrF CDS 182209..182760 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228883.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 gene pyrE CDS 182762..183799 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228882.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS 183803..184780 product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173761.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS complement(184826..186136) product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393107.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS complement(186158..186847) product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810453.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 gene narI CDS complement(186844..187344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02060 note possible pseudo, internal stop codon, frameshifted CDS complement(187349..188860) product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702660.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 gene narH CDS complement(188871..192464) product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459023.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS complement(192461..193249) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS 193340..195268 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS complement(195275..195541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS complement(195544..196314) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228880.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS complement(196302..196502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228879.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS complement(196499..196930) product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228878.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS complement(196999..198216) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228877.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS complement(198273..199601) product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173864.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 gene sufD CDS complement(199602..201011) product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228950.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 gene sufB CDS complement(201020..201769) product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228949.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 gene sufC CDS complement(201853..202200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS complement(202219..203355) product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434058.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS complement(203376..204416) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228826.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS 204764..205012 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS 205029..205790 product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228633.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS complement(205752..206567) product YhjD/YihY/BrkB family envelope integrity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229022.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS complement(206569..207828) product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229021.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS complement(207855..208976) product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633899.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 gene proB CDS complement(209009..211876) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228683.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 gene uvrA CDS complement(212642..213313) product CidB/LrgB family autolysis modulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968210.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS complement(213304..213639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS complement(213636..215204) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228735.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS 215249..215527 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631991.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS 215524..216804 product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942269.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 tRNA complement(216817..216893) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS complement(216930..217361) product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173409.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 gene aroQ CDS complement(217371..218405) product 3-dehydroquinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228641.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS complement(218392..218952) product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632876.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS complement(218952..220052) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228640.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 gene aroC CDS complement(220175..221731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS complement(221728..222582) product competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228638.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS complement(222579..223169) product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173434.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 gene pilO CDS complement(223159..223800) product competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228637.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS complement(223793..224914) product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228636.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 gene pilM CDS complement(225044..226069) product homoisocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173431.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS complement(226100..226684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS complement(226570..227373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS 227456..227767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS 228552..229547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227854.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS complement(230326..230607) product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216166.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS complement(231450..231875) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228953.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS 231927..232283 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS 232295..233740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS 233737..234315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS complement(234312..235247) product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926064.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 gene hemB CDS 235349..235663 product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633232.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS 235660..236253 product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228798.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 gene recR CDS 236262..236627 product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887638.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS 236624..236959 product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173642.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS 236975..237340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS 237337..237618 product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173644.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS complement(237679..238914) product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227920.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 gene fabF CDS complement(238980..239213) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631656.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 gene acpP CDS complement(239267..240004) product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172504.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 gene fabG CDS complement(240001..240918) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172505.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 gene fabD CDS complement(240921..241898) product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172506.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS complement(241900..242097) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631660.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 gene rpmF CDS complement(242162..242704) product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227921.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS 242777..243712 product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038039155.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 gene rocF CDS complement(243741..244298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS complement(244332..245060) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202429.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS complement(245057..245929) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889267.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS complement(245926..246246) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174185.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS complement(246236..246802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS 246892..247599 product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228483.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 gene hisA CDS 247602..248399 product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173830.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS 248535..248978 product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172800.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 gene rimP CDS 249000..250205 product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172799.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 gene nusA CDS 250448..252175 product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172797.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 gene infB CDS 252189..252485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS 252555..254714 product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172795.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 gene secD CDS 254788..255126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS 255123..257231 product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228485.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 gene recJ CDS 257330..258286 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668256.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS 258363..259880 product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180345411.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 gene rbsA CDS 259877..260824 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774051.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS 260836..261267 product RbsD/FucU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912113.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS 261298..261867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228486.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS complement(261910..264510) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228487.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS 264522..264869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS 264942..266603 product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228762.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS 266613..267485 product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173573.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS 267592..268917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS complement(268901..269290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS complement(269287..270651) product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228410.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 gene mgtE CDS 270863..272167 product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173116.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 gene ffh CDS 272175..272471 product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173115.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 gene rpsP CDS 272471..272689 product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173114.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS 272686..273162 product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228392.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 gene rimM CDS 273165..273902 product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632436.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 gene trmD CDS 274201..275484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS 275648..276112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS 276185..276598 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227839.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS complement(277417..280491) product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228069.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 gene carB CDS complement(280617..281696) product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227756.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS 282440..284389 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228977.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 gene thrS CDS 284400..285182 product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228978.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS 285192..285758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228986.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS complement(285763..287070) product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228985.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS 287154..287558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03070 tRNA complement(287593..287669) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA complement(287676..287750) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS 287850..289298 product 2-phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118965.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 289295..290302 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS complement(290299..290586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS complement(290573..290875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS complement(290878..291183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172574.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS complement(291222..292274) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227974.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 gene thrC CDS complement(292276..293298) product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172571.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS 293350..294585 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228007.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS 294582..295058 product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228008.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS 295081..295608 product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172617.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS complement(295636..296322) product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228599.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS complement(296426..297709) product sulfite oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228598.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS complement(297843..298472) product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228599.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS complement(298459..299427) product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869205.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 gene ptb CDS complement(299408..300481) product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115773.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 gene buk CDS 300559..301773 product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228593.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS complement(301820..302635) product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228211.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS complement(302640..303764) product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172898.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 gene mqnE CDS 303821..304441 product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103021216.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS 304422..304817 product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707897.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS 304828..306606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS 306633..308144 product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173324.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 gene malQ CDS complement(308131..309099) product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632957.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 gene glpX CDS complement(309141..309770) product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228687.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 gene hisIE CDS complement(309767..310534) product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228686.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 gene hisF CDS complement(310545..310937) product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227971.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS complement(310937..311173) product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227972.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS complement(311192..312418) product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228618.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS complement(312431..314374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS 314462..314701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS 314710..315438 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228477.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS 315448..315813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS complement(315769..316674) product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228479.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS complement(316635..316904) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS 316970..317734 product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172528.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 gene lptB CDS 317742..319232 product DUF3084 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227936.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS complement(319220..320116) product delta(1)-pyrroline-2-carboxylate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198445.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS complement(320113..320745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS complement(320826..322280) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228005.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 gene rpoD CDS complement(322283..323407) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228006.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS 323439..324428 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173315.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 gene tsaD CDS 324469..327486 product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228548.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 gene secA CDS complement(327551..328027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS complement(328360..328875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS complement(328862..330727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS complement(330971..332014) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173163.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 gene ftsZ CDS complement(332023..333282) product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228430.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 gene ftsA CDS complement(333279..333866) product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632515.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS complement(333863..334702) product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228429.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS complement(334699..336051) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887272.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 gene murC CDS complement(336048..337103) product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349463.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 gene murG CDS complement(337100..338194) product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228426.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS complement(338179..339435) product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173156.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 gene murD CDS complement(339432..340295) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228425.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS complement(340289..341032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS complement(341025..342305) product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228423.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS complement(342324..343730) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173152.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS complement(343727..343975) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS complement(343972..344832) product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228422.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 gene rsmH CDS complement(344838..345278) product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632499.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 gene mraZ CDS 345969..346472 product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227651.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS complement(346456..347022) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228251.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS complement(347093..347521) product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932912.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene mscL CDS complement(347678..348955) product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078068420.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 gene icd CDS complement(348988..349566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03720 tRNA 349970..350046 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA 350105..350189 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS 350228..351448 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228070.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 gene tig CDS 351519..352103 product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631995.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 gene clpP CDS 352150..353286 product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228071.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 gene clpX CDS 353292..355670 product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172865.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 gene lon CDS complement(355567..356418) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03770 tRNA 356529..356605 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS 356660..358246 product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393317.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS 358233..358757 product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024119826.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS 358757..359251 product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173005.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 gene coaD CDS 359252..360277 product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228278.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 gene hslO CDS complement(360267..361121) product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228063.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 gene ubiA CDS complement(361125..361475) product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172694.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS complement(362477..363997) product NFACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228066.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS 364034..365260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS complement(365162..365995) product tRNA (adenine(58)-N(1))-methyltransferase TrmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228067.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 gene trmI CDS complement(365995..366774) product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228068.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS complement(366927..367256) product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631989.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS complement(367285..367650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03890 note possible pseudo, frameshifted CDS complement(367884..368918) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228159.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS complement(368925..370043) product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228038.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 gene ugpC CDS 370158..371477 product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228685.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 gene trmFO CDS 371536..372081 product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228081.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 gene hslV CDS 372078..373337 product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172715.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 gene hslU CDS 373348..374442 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228080.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS 374539..375483 product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227999.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS 375480..377210 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228000.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS 377220..378383 product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228572.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS 378370..381063 product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228571.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS 381106..382560 product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228570.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 gene murJ CDS complement(383484..383825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS complement(385315..386589) product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228692.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 gene aspS CDS complement(386721..387458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS complement(387470..387775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS complement(387772..389073) product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228691.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS complement(389121..390287) product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173822.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 gene thiI CDS complement(390281..391096) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228690.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS 391171..392946 product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390531.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS 392948..393808 product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439562.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS 393870..394877 product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081481465.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS complement(395353..396750) product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889307.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS 396795..398954 product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888410.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS 398960..399403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS 399391..400281 product isoaspartyl peptidase/L-asparaginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939517.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS 400352..401107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS 401097..401879 product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228482.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 gene trpC CDS 402009..402773 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227942.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS 402770..404719 product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227943.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS 404716..405609 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227944.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS 405618..406679 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227945.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS 406725..407897 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926030.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS 407956..408777 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227947.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 tRNA 408852..408928 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 tRNA 408933..409008 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 tRNA 409044..409119 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS 409192..410661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS complement(410658..411563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS complement(411563..412252) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978899.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS complement(412265..413494) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261736.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS complement(413494..414246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS complement(414237..415466) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261735.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS complement(415463..415930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS complement(415987..416649) product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228158.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 gene sdaAB CDS 416718..418691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172834.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS 418688..419536 product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228157.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS 419551..420360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS 420364..420972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS complement(420920..421318) product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564559.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS complement(421328..422698) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228155.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS complement(422704..423114) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228397.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS complement(423069..423413) product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173125.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 gene ybeY CDS complement(423481..424506) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228398.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS complement(424515..425060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS complement(425064..426038) product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173128.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 gene floA CDS complement(426042..427322) product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926053.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS complement(427338..427784) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227839.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS complement(427821..428891) product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228208.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS complement(428899..429927) product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228209.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 gene aroF CDS complement(430112..430519) product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228753.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS 430400..431317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS 431319..431669 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228752.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS complement(431600..433357) product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878912.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS 433409..433603 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS 433651..434088 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228751.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS complement(434085..435158) product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228739.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS 435192..436763 product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228750.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 gene tilS tRNA 436767..436856 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS complement(437250..438044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS complement(438055..439563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04550 sequence02 source 1..371779 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(429..3212) product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259651.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS 3271..5046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS 5055..5606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS 5618..8503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS complement(8609..9352) product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228813.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS complement(9368..10039) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227718.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 gene nth CDS 10061..10447 product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174243.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS complement(10348..12177) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926018.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS complement(12225..13661) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227720.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 gene proS CDS complement(14313..15377) product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986423.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS complement(15387..16535) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058074.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS 16595..16909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS 16918..17241 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS complement(17238..18350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS 18458..18775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS 18792..19082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS complement(19128..19973) product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228704.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS complement(19985..20659) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173524.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS complement(20663..21394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS complement(21397..21891) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS complement(21902..23899) product DUF505 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880454.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS complement(24109..25221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS complement(25238..25678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS complement(25683..26183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS complement(26195..26629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS 26723..27547 product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227857.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 gene rapZ CDS 27528..28805 product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174031.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS 28802..29497 product glucodextranase DOMON-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227856.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS 29508..31073 product 1,4-alpha-glucan branching protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228999.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS 31076..32554 product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228916.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS 32572..33123 product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174218.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 gene dcd CDS 33120..34001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 34166..34690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS 34687..35328 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140258.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS complement(35337..36149) product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887404.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS 36237..36509 product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633933.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS complement(36570..37016) product DUF1931 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228706.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS complement(37039..37461) product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173534.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS complement(37482..38666) product VLRF1 family aeRF1-type release factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228710.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS complement(38685..39134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS 39258..40493 product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227721.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS complement(40848..41969) product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174284.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS 42112..45030 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228191.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS complement(45027..45788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS complement(45785..46591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS complement(46639..47310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS 47790..48218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS complement(48751..49653) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008630929.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 gene era CDS 49744..50721 product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024119789.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 gene moaA CDS complement(50734..51411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS complement(51420..51761) product DUF6394 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880147.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS complement(51748..52842) product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880148.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS complement(52911..54077) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227871.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS complement(54097..54597) product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227870.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS complement(54634..55647) product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618830.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS 55742..56593 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS complement(56616..57917) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067615.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS 57953..58579 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008634004.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS 58583..59311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS complement(59308..59697) product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227791.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 59730..60626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS 60607..60975 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS complement(60984..62273) product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813565.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS complement(62270..62851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS complement(62923..63906) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813561.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS 64081..64296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS 64342..64896 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140681.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS complement(64884..65609) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS complement(65616..66176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS complement(66176..66586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05250 note possible pseudo, frameshifted CDS complement(66668..67807) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213919.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS 68322..69251 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014509818.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 gene prfB note possible pseudo, frameshifted CDS 69496..71199 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS complement(71207..71914) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928484.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS complement(71930..72445) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS complement(72447..74480) product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227773.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS complement(74564..75787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS complement(75801..76565) product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679769.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS complement(76558..78807) product hydrophobe/amphiphile efflux-3 (HAE3) family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868797.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS 78932..79540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS complement(79537..81246) product aldehyde ferredoxin oxidoreductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938476.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS 81378..82106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS 82103..82855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS 82885..84378 product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174141.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS 84431..84994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS 85004..85942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS complement(85939..87297) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173520.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 gene dnaB CDS 87474..89807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS complement(89874..90329) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227802.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 gene rplI CDS complement(90340..90594) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886749.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 gene rpsR CDS complement(90591..91406) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227803.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS complement(91426..91734) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886746.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 gene rpsF CDS complement(91835..93523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS complement(93651..95363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS complement(95444..96184) product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209337.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 gene speD CDS complement(96181..97053) product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172918.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 gene speE CDS complement(97148..98338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS 98473..99618 product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258380.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS 99653..101596 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259450.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS 101622..102347 product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228624.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS 102337..103722 product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228625.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS 103715..104644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS 104647..105639 product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903344.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS 105673..106521 product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228054.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS 106518..107924 product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228083.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS complement(108320..109036) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227745.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS complement(109102..110967) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227877.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 tRNA 111011..111087 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS 111210..112034 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227875.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS 112036..112497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS 112517..113341 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS complement(113402..114220) product YwiC-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256233.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS complement(114280..114762) product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174341.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS complement(114770..115132) product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227874.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS 115191..115754 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038060574.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS 115751..116647 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393400.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 116634..117758 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393399.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS 117795..118610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 118610..119269 product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228374.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS complement(120113..120688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS complement(120699..121055) product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888250.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS complement(121116..121619) product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888812.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS complement(121607..122257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888813.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS complement(122444..123133) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227647.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS complement(123183..125519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS complement(125554..126240) product two-component system response regulator CreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170873813.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 gene creB CDS complement(126289..126786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05810 tRNA complement(127232..127327) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS complement(127442..130546) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS 130628..131560 product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228808.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 gene trmB CDS complement(131724..132041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS 131943..133964 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS complement(134107..135255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS 135304..135912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS 135966..136316 product nucleoside triphosphate pyrophosphohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125076.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS 136325..138031 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804132.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS 138085..139314 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS complement(139397..140536) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS complement(140546..142357) product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140584.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS 142439..142801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS 142791..143471 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403437.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS 143468..144244 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS 144241..144759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS 144816..146159 product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227825.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 gene pgi CDS 146156..147016 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250352.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS 147013..147222 product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228586.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS complement(147219..147860) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228202.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS 147888..148943 product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172884.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS complement(148940..149296) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS 149389..149922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS 149889..151145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS complement(151135..151509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS complement(151506..152183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS complement(152238..152894) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173524.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS 152929..153678 product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889023.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 gene surE CDS complement(153675..154457) product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227867.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS complement(154459..155955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS 156065..156745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227869.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS complement(157361..158170) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS complement(158176..158664) product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228960.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS complement(158661..158903) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933389.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS complement(158916..159692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS complement(159686..159937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS complement(159952..160302) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632121.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS complement(160326..161321) product arsenic resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080192.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS complement(161331..162365) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660365.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS complement(162362..162664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06200 tRNA complement(162817..162891) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS complement(162982..164130) product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228579.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS complement(164146..165006) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228580.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS complement(165006..166094) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228581.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS complement(166091..167587) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228582.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS complement(167681..168796) product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173990.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS complement(168808..171459) product type IV pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173991.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 gene pilB CDS complement(171540..172073) product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888598.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS complement(172084..172815) product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227882.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 gene pgeF CDS complement(172818..173141) product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633725.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS complement(173138..174262) product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257568.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS 174228..174605 product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228922.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 gene mgsA CDS complement(175133..175540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS complement(175528..175785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS 175912..177108 product CinA family nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228938.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS 177105..177680 product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173843.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 gene thpR CDS 177628..178635 product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228937.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 gene recA CDS 178649..180397 product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228936.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 gene rny CDS 180508..183081 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258122.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS 183176..187054 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS 187192..188151 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228207.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS 188304..191612 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS 191667..193127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS 193208..193843 product two-component system response regulator YpdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295458.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 gene ypdB note possible pseudo, frameshifted CDS complement(193885..195120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS 195413..197497 product marine proteobacterial sortase target protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083797.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS 197494..198150 product class GN sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083796.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS 198538..199926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS 199937..201169 product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929473.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS 201166..201927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS complement(202021..202407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS complement(202418..202765) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974464.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS complement(204114..205529) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227883.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 gene gatB CDS 205709..207505 product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942518.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(207655..207906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS complement(208215..209471) product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229023.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS complement(209481..210107) product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229024.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS complement(210107..210589) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229025.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS complement(210599..211627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS complement(211762..212547) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926101.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS complement(212544..213743) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229029.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS complement(213753..214532) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173899.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS complement(214532..215410) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228942.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS complement(215421..215951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633771.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS 216667..217098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS 217098..217601 product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210981.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS 217700..217966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS 217970..218311 product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887307.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS 218554..219324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS complement(219336..221138) product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887841.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 gene typA CDS complement(221191..221862) product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526170.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS complement(221928..223715) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227748.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS 223931..225364 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919105.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 gene glpK CDS complement(225382..225567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS 225672..226508 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392145.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS 226529..227842 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080298.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS 227895..228788 product sn-glycerol-3-phosphate ABC transporter permease UgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811262.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 gene ugpA CDS 228799..229626 product sn-glycerol-3-phosphate ABC transporter permease UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550999.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 gene ugpE CDS 229628..230416 product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258662.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS complement(230473..231084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS 231194..231508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS complement(231391..231921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS 232024..232227 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS 232270..233415 product putative Ig domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227728.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS 233501..234022 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS 234019..235065 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS complement(235062..235763) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174202.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS 235787..236737 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS complement(236734..237108) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS 237361..238386 product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227724.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 gene dprA CDS 238481..239482 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227642.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 gene ispH CDS 239484..240449 product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888333.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 gene dusA CDS 240446..241342 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228395.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS 241443..242417 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931690.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS 242420..242869 product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268760.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS 242880..244385 product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382837.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS 244454..245017 product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761174.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS 245022..246023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS 246014..247018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS complement(247001..248200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS complement(248235..248948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS complement(248945..250264) product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227645.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS complement(250268..250768) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173948.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS complement(250734..251810) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173949.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 gene prfA CDS 251896..252561 product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228173.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS 252558..253808 product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721929.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS 253810..254634 product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022831.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS complement(254684..255340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS complement(255337..256845) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS complement(256848..257729) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766165.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS complement(257719..258324) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS complement(258899..259369) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS complement(259528..260034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS 260170..260697 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043900134.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS complement(261380..262603) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS complement(262705..263439) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS complement(263654..264589) product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038340.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS complement(264620..266671) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS 266908..267639 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS complement(267821..269248) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839831.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS complement(269245..269940) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405200.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS complement(269979..270758) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970319.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS 270869..271195 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172803.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS 271278..273350 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889332.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS 273401..275230 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS complement(275236..275778) product asparaginase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036092.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS 276122..277003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS complement(277000..278049) product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080645.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS complement(278049..278846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS 278764..279672 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926022.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS 279719..280549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS complement(280505..280693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS 280733..281164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS 281482..282033 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229041.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS 282020..282781 product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229040.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 gene argB CDS 282823..283446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228841.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS 283453..285288 product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920876.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS complement(285265..286872) product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887112.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS complement(286869..287669) product histidinol-phosphatase HisJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227864.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 gene hisJ CDS complement(288400..289602) product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174122.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS 290097..290603 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS complement(290666..292882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS complement(292895..294412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS 294749..295987 product carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259418.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS 296009..297157 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926069.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS 297172..297447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173720.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS 297444..297779 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660653.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS 297781..298497 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228179.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS 298528..299115 product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888994.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS complement(299283..300350) product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228318.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS 300444..300614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS 300619..300783 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS 300780..301115 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS complement(301112..301687) product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS complement(301740..303089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS 303167..303652 product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228919.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 gene ispF CDS 303649..304446 product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920665.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS complement(304443..305063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227753.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS complement(305074..305328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS complement(305337..306413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS complement(306416..307843) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227631.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 gene pyk CDS complement(307833..309101) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173981.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 gene eno CDS complement(309122..310207) product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227630.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 gene dnaN CDS complement(310468..311853) product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229057.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 gene dnaA CDS 311885..313708 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229056.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 gene mnmG CDS 313705..314247 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS 314244..315002 product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480253.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS 314986..315798 product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229053.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS complement(315795..317840) product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888489.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS complement(317837..318352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS complement(318331..319017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS 319096..319290 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS 319278..320450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS 320683..321672 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227641.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS 321870..322247 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS 322307..322840 product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173971.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS 322883..324124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS complement(324132..324317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS 324634..326439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS 326451..326798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS 326758..327423 product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259108.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS 327420..328601 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228175.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS 328610..329158 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694149.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS complement(329241..330635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS complement(330704..331639) product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000960294.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS complement(331932..333206) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227732.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 gene murA CDS 333326..333541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS 333564..335405 product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227731.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS 335471..337225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS complement(337335..339230) product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942985.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 339309..341108 product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172451083.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS 341312..342133 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227776.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS complement(342200..344785) product arsenate reductase (azurin) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229171.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS complement(344795..345277) product arsenate reductase (azurin) small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229170.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS complement(345395..346264) product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212226.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 gene yedA CDS 346391..346870 product DUF456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227896.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS 346889..347104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS 347108..347962 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227898.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 gene lgt CDS 347959..349371 product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024119056.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 gene glmU CDS 349368..349604 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS 349611..350360 product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227900.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 gene tatC CDS 350376..351458 product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227901.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS 351470..352420 product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227902.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS complement(352492..352794) product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014062.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS complement(352869..353159) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939017.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS complement(353294..354553) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228622.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS complement(354566..355273) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228621.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS complement(355233..355661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS 355713..356324 product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227693.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS 356668..357855 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228048.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS 357852..358727 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172673.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS 358729..359505 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228047.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS 359514..360263 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228046.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS 360260..362128 product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228045.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS 362118..363188 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228044.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS 363203..364342 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118974.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS complement(364339..365166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS 365346..366563 product S-methyl-5-thioribose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033250.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 gene mtnK CDS 366560..367591 product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080652.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 gene mtnA CDS 367588..368496 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272027.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS 368493..369494 product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893542.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS 369580..370728 product 5-methylthioribulose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389751.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS 370725..371675 product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975474.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 sequence03 source 1..309289 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 151..969 product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228435.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 gene thyX CDS complement(966..1796) product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038038884.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 gene pheA CDS 1818..2405 product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887917.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 gene ruvA CDS 2412..3485 product peptidoglycan bridge formation glycyltransferase FemA/FemB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228441.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS 3517..3957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS 3954..5270 product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228153.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS 5267..6277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS 6267..7484 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017870666.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS 7481..10786 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887385.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS 10822..11928 product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257064.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 gene apbC CDS 12001..14232 product DUF1998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173320.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS complement(14229..16148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS complement(16204..17664) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889165.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS 17695..18180 product ADP-ribose pyrophosphatase Ndx4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172615.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 gene ndx4 CDS 18177..19064 product riboflavin biosynthesis protein RibF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228004.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 gene ribF CDS 19097..20182 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS 20163..20771 product transcriptional regulator UhpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209570.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 gene uhpA CDS 20880..21416 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS 21400..23709 product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546592.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS 23710..24297 product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183894.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS 24294..25091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS 25131..25577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS complement(25598..26005) product DUF4258 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632741.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS complement(26027..26623) product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228420.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS complement(26775..27812) product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228031.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 gene tdh CDS 27871..28602 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172915.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS 28606..29097 product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173164.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 gene ruvC CDS 29174..30499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS 30509..31093 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS 31161..32276 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041443464.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS 32269..33138 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173304.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS 33135..33917 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228542.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS 33920..34945 product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887947.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS 35000..35464 product cytochrome C-552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228671.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 gene cycA CDS 35525..36253 product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881043.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 gene modA CDS 36250..36912 product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172814.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 gene modB CDS 36879..37910 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228140.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS complement(37877..38044) product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172713.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 gene tatA CDS complement(38055..38792) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228197.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS complement(38831..39910) product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228544.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 gene rodA CDS complement(39907..40137) product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631340.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 gene minE CDS complement(40137..40970) product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479992.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 gene minD CDS 41045..42367 product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228250.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS complement(42425..43246) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228627.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 gene lepB CDS complement(43233..43997) product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228628.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS 44105..44869 product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228629.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS complement(44922..46061) product citrate synthase/methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228614.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS complement(46178..46978) product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228615.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 gene moeB CDS complement(46965..47354) product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014629200.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS 47454..49421 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228719.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS complement(49480..49710) product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632496.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 gene rpmE CDS 49873..50205 product SPW repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401238.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS 50368..50904 product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172875.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 gene pyrR CDS 50892..51809 product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172874.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS 51806..53107 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228195.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS 53088..53879 product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942400.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS 53876..54781 product dihydroorotate oxidase B catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081049.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 gene pyrD CDS 54820..55353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS complement(55422..56045) product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228223.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS 56147..57301 product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030238.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS complement(57280..58020) product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228854.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS complement(58068..58355) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631344.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS 58417..58560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS 58572..60128 product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173309.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS complement(60130..60636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS 60657..61064 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173310.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS 61213..61752 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS complement(61801..62790) product YpdA family putative bacillithiol disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228521.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS 62859..64259 product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121489.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS 64376..64996 product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172643.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 tRNA 65126..65201 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS 65248..66339 product DUF815 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228701.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS complement(66344..68008) product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228700.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 68122..70629 product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228489.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 gene glgP CDS 70692..72032 product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143591337.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 gene miaB CDS 72029..72445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS 72452..73318 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228584.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS complement(73315..74907) product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228174.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS complement(74967..75482) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS complement(75492..75869) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228235.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS complement(75922..76611) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228234.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS 76772..77719 product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228061.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS 77731..79011 product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228305.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 gene hemL CDS 79015..80325 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228302.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 gene mnmE CDS complement(80329..88389) product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228030.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS 88449..88718 product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631905.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS complement(89290..91038) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172981.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS complement(91055..92251) product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228276.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS complement(92266..94587) product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228275.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS 94762..96438 product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228677.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS 96507..98174 product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228698.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS 98203..100197 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102966.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS 100194..102041 product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102967.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS complement(102076..104670) product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228106.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 gene ppdK CDS complement(104791..105234) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172543.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS complement(105278..106078) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172542.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS complement(106071..106817) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227948.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS complement(106847..107260) product peroxide-responsive transcriptional repressor PerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002002038.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 gene perR CDS complement(107331..109283) product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228545.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 gene acs CDS complement(109344..110258) product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228033.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 gene miaA CDS 110301..110714 product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172656.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS complement(110711..111307) product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966171.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS 111361..112257 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173548.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS 112260..113012 product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926088.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS complement(112981..113787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS complement(114035..115753) product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930711.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS 115805..116335 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227889.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 gene tsaB CDS 116392..117909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS 117903..119363 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228549.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS 119368..119823 product DUF1999 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173317.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS 119847..120056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632685.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS 120154..122859 product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228149.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 gene acnA CDS 122921..124222 product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889440.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 gene guaD CDS 124219..124542 product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172646.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS 124553..125047 product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172509.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS complement(125095..126294) product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228024.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS 126399..128819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS 128898..129614 product heat-stable protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173533.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS complement(129611..130294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS complement(130297..131292) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173293.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 gene trpS tRNA complement(131361..131447) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS 131625..131759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS 131903..132109 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09430 note possible pseudo, frameshifted CDS 132121..132390 product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809333.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 gene yidD CDS 132387..133775 product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227939.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS 133779..134405 product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227938.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS 134402..135235 product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886891.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 gene prmC CDS 135245..136024 product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227694.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS complement(136016..136351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS complement(136384..137727) product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228206.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS 137762..138223 product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228204.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS 138332..140746 product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632827.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 gene gyrA CDS 140797..141114 product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632829.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS 141173..141784 product Crp/Fnr family transcriptional regulator SdrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173413.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 gene sdrP CDS 141800..142834 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227955.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS 142895..144376 product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390236.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS 144630..145970 product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173386.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 gene glnA CDS 146264..147421 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS 147498..148661 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256819.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS 148658..150010 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080270.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS 149997..150773 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256821.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS 150773..151492 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081214215.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS 151653..153221 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887933.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS 153276..154331 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887604.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS 154340..155206 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583225.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS 155256..156338 product protease complex subunit PrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228610.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS complement(156312..157457) product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228611.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS complement(157461..158957) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480009.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS complement(159013..159261) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS complement(159294..160814) product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889407.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 gene hutH CDS 160836..161555 product recombination protein O N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926033.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS complement(161552..163348) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS 163438..165087 product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228394.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS complement(165192..166070) product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173325.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS complement(166080..167696) product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583555.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 gene cimA CDS complement(167701..168582) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228552.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS complement(168617..169315) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS complement(169312..170271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS complement(170264..171499) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228553.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS complement(171496..172722) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228554.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS complement(172730..172897) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS 172820..175120 product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228555.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 gene recG CDS 175130..175441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS 175719..176393 product IS1595 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980932.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS 176983..177438 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706874.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS 177441..178205 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228556.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS 178210..179178 product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228198.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS 179270..179848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS 179853..180692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS complement(180696..181337) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172747.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS complement(181351..181899) product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875912.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS 182044..183447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS 183515..184090 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057625.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS complement(184100..184534) product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228761.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 gene rnhA CDS complement(184572..184835) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS 185183..185353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS complement(185373..185948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS complement(185966..186676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS complement(186673..187326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS complement(187576..187890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS complement(187900..188343) product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887544.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 gene rnhA CDS complement(188343..189857) product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228757.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 gene guaA CDS complement(189876..191159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228143.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS 191328..191696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632112.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS 191705..192322 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228142.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS 192324..192488 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS complement(192485..193999) product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041443404.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 gene purH CDS complement(194039..195388) product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024119347.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 gene lnt CDS 195457..196167 product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227969.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS complement(196150..197241) product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227970.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 gene queG CDS complement(197246..198172) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167345969.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS complement(198182..199846) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060384639.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 gene hflX CDS 199927..200460 product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172651.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS complement(200465..200911) product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228028.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS complement(200923..201564) product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228027.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS complement(201567..202388) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228026.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS 202448..204898 product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228025.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS 204967..205389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173321.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS 205390..208542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS 208517..210280 product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228551.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 gene dnaG CDS complement(210496..211515) product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173135.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 gene queA CDS complement(211512..212066) product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228408.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS complement(212063..212806) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990915.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS complement(212835..215453) product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172711.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS complement(215450..216208) product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228079.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS complement(216216..217730) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228438.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS complement(217796..218878) product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228437.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS 219042..221027 product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228436.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 gene ligA CDS 221039..221632 product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229033.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS 221632..222120 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS complement(222089..223153) product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228177.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 gene metX CDS complement(223155..224429) product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228178.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS 224743..225363 product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886805.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 gene udk CDS 225360..227081 product DUF5693 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228037.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS 227066..228064 product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228036.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 gene csaB CDS complement(228106..229209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228035.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS complement(229210..229968) product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172659.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS complement(229971..231407) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888491.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 gene gatA CDS complement(231479..232699) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228203.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS 232731..233324 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172885.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS 233321..233845 product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632201.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 gene scpB CDS 233872..234597 product 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888039.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS 234594..235325 product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172511.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS 235350..238589 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258122.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS 238624..238809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS complement(238801..240393) product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228516.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 gene cimA CDS complement(240386..240616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS complement(240624..242156) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480228.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS complement(242143..243168) product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173279.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 gene ilvC CDS complement(243165..243677) product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173280.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 gene ilvN CDS complement(243674..245356) product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228519.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 gene ilvB CDS complement(245432..245719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS complement(245704..245901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS 246071..247492 product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173294.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 gene leuC CDS 247492..248112 product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228533.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 gene leuD CDS 248152..249195 product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228534.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 gene leuB CDS 249204..249953 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228537.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS 249934..251634 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880508.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 gene ilvD CDS 251728..252876 product NEW3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173509.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS 252876..253811 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228695.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS 253795..254754 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228696.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS complement(254768..255142) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173512.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS complement(255147..255785) product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228697.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS 255840..256532 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392343.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS complement(256529..257191) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704088.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS complement(257188..258072) product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173484.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS complement(258138..258971) product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228679.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS complement(258974..259693) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173486.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS complement(259690..260427) product 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632942.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS complement(260411..261067) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174250.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 gene rpe CDS complement(261071..261760) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228681.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS 261817..262476 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228680.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS complement(262473..263009) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173652.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS complement(263015..263572) product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633254.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS 263594..264025 product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633255.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS complement(264036..264365) product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118710.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS complement(264362..265648) product MiaB/RimO family radical SAM methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173655.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS 265742..267385 product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149407.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS complement(267432..267746) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393397.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS complement(268143..269309) product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174069.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 gene carA CDS complement(269313..269852) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038039476.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS complement(269849..271255) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227830.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 gene argH CDS complement(271258..272436) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227831.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS complement(272621..272929) product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057662.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS 273040..273474 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173515.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 gene rplM CDS 273474..273866 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228699.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 gene rpsI CDS 273954..274748 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856127.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS complement(274794..277202) product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228720.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 gene ppsA CDS complement(277259..278257) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803699.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS complement(278257..279228) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803698.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS complement(279241..280086) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528572.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS complement(280086..281006) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067605.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS complement(281068..282357) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066871940.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS 282594..284051 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227935.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 gene gltX CDS 284023..285345 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256710.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS 285351..285968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071652.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS 285981..286898 product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227933.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 gene ftsY CDS 286908..287330 product disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228417.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS complement(287359..287739) product NADH-quinone oxidoreductase subunit 15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227977.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS 288179..289972 product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228755.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 gene uvrC CDS 289985..290404 product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173118.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS 290407..290952 product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085061.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 gene plsY CDS complement(290941..292251) product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228145.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 gene hisD CDS complement(292254..292976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228144.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS 293026..294147 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229012.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS complement(294144..295469) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494235.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS complement(295466..295954) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS complement(295951..297198) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973289.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS 297415..299688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS complement(299809..301023) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083337.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS 301133..301321 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS 301335..301529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS complement(301587..303473) product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926065.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS complement(303497..304555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227632.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS complement(304620..305606) product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172559.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS complement(305603..306625) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227960.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS complement(306643..307005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11170 note possible pseudo, internal stop codon CDS complement(307036..308121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11180 note possible pseudo, internal stop codon CDS complement(308130..309128) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024119337.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 sequence04 source 1..305053 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(919..2742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS complement(2739..3389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS complement(3439..4122) product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227680.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS complement(4112..5044) product HrcA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227679.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS complement(5074..6309) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173220.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS complement(6319..7701) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227677.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS 7918..9231 product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227678.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS 9228..9584 product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631113.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS complement(9638..10375) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS complement(10441..11292) product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173912.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS complement(11289..12149) product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228998.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS 12215..12655 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762782.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS complement(12652..13335) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228853.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS 13437..14243 product DUF4388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633435.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS 14256..15605 product amino acid carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173723.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS 15661..16215 product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173927.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS 16221..16886 product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174170.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 gene ispD CDS 16923..17231 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11370 tRNA 17318..17393 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS 17488..18309 product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122780.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(18370..19401) product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545362.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS complement(19460..20263) product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933433.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 gene lsrF CDS complement(20274..20939) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385415.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 gene rpe CDS complement(20932..22194) product S-methyl-5-thioribose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087665.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 gene mtnK CDS complement(22197..23309) product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970692.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 gene mtnA CDS complement(23311..24294) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392223.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS complement(24299..25804) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392222.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS complement(25868..26926) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392221.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS complement(27032..27877) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969648.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS 27959..28621 product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228855.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS 28611..29744 product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174219.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS 29741..30373 product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174220.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 gene hisG CDS complement(30420..31982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS 32116..32760 product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174221.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 gene trmH CDS complement(32940..34076) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS complement(34252..34980) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173565.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(35129..36439) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228728.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 gene purB CDS 36530..36961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS complement(36988..38244) product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776294.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS 38324..38524 product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228586.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS 38552..39721 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257321.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS complement(39722..40486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS 40542..40937 product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243483.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS complement(40927..41382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS complement(41491..42138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS complement(42138..44342) product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228863.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 tRNA complement(44448..44535) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS complement(44657..46060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS complement(46073..47335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS complement(47348..49219) product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869266.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS complement(49213..49752) product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209691.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS 50130..52163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS 52516..53397 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228165.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS 53405..54409 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228166.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS 54402..55178 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228167.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS 55175..55537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228168.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS 55518..56060 product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229235.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 gene cobO CDS 56070..56873 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228495.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS 56870..58201 product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229236.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS 58198..59070 product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174539.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 gene cbiB CDS 59067..60035 product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926108.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS 60032..60778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS 60775..61308 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229232.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS 61293..63272 product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926109.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS 63285..63854 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385055.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS complement(63892..64362) product cytochrome C-552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228671.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 gene cycA CDS complement(64462..65292) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722710.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS complement(65350..66312) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776866.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS complement(66377..67672) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258532.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS complement(67677..69236) product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031132272.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS complement(69233..70108) product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889472.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 gene murQ CDS complement(70105..71142) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889475.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS 71215..71973 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185897.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS 71970..73049 product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040384667.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS complement(73050..73487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS complement(73602..73778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS 73758..74642 product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631396.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 gene cobT CDS 74660..75388 product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889498.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS 75456..76766 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080298.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS 76845..77735 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080296.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS 77737..78561 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014683564.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS 78563..79258 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229158.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS 79327..79581 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS 79578..79784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS complement(79933..80781) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS complement(80778..81614) product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937487.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS complement(82536..84008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS 84110..85402 product arsenite efflux transporter membrane subunit ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012540054.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 gene arsB CDS complement(85423..86064) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727243.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS complement(86061..87755) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS complement(87742..88629) product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255931.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 gene phnD CDS 88804..89700 product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255934.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS 89712..90905 product Hdr-like menaquinol oxidoreductase integral membrane subunit HmeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878007.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 gene hmeB CDS 90907..94101 product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255936.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS 94146..94544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS complement(94612..97179) product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228712.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 gene clpB CDS complement(97440..99278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS 99867..102731 product DUF11 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926080.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS 102788..105907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS 105938..106642 product Clp1/GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227746.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS 106652..107023 product hotdog domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173828.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS 107189..108232 product thiamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228931.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS 108337..109878 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228930.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS 109879..110841 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926098.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS 110838..111488 product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393953.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS 111593..113326 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350502.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS 113336..113566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS 113569..115332 product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879160.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS 115332..115634 product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015097.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS complement(115705..117174) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227931.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 gene guaB CDS complement(117215..117496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS 117520..118590 product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228926.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS 118624..119598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS 119621..120382 product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173797.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 gene panC CDS 120379..121464 product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228908.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS 121497..122423 product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633565.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 gene fba CDS complement(122495..123793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS 123952..125244 product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228906.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS 125297..126229 product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228905.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS 126240..126677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS 126677..127537 product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228904.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 gene accD CDS 127527..128477 product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228903.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS 128569..129987 product PEGA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228902.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS 130046..130792 product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227758.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS 130776..131327 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174164.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS 131402..131650 product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008630832.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS complement(131712..132917) product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225440.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS complement(132926..134296) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS complement(134367..134684) product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227905.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS complement(134681..135076) product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172482.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 gene mce CDS complement(135081..135293) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS complement(135293..135652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS complement(135649..136161) product DUF1572 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118787.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS complement(136171..137262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS 137201..137419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS complement(137416..137631) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227757.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(137814..140444) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227747.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 gene leuS CDS 140614..141510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889566.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS 141572..142480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889566.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS complement(142611..143423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS complement(143456..143644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS complement(143607..144479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS complement(144510..145160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS complement(145237..145497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS 145530..145934 product heavy metal-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632647.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS 145987..147594 product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228473.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 gene merA CDS 147608..148336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS complement(148333..148542) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS 148595..151252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS complement(151328..152377) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405115.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS complement(152374..153915) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840173.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS complement(154013..155071) product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405117.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS complement(155265..156620) product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227665.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS 156653..157375 product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880570.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS 157372..157800 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS 157785..159077 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879270.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS 159070..160275 product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967584.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS complement(160281..161192) product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393573.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 gene ligD CDS 161250..163028 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926052.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS complement(163041..163805) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172461.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS complement(163877..165226) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS complement(165455..166417) product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926009.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS complement(166461..167027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS complement(167076..169454) product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227851.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 gene ctaD CDS complement(169466..170488) product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227850.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 gene coxB CDS complement(170624..171613) product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227850.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 gene coxB CDS complement(171615..173459) product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227849.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS complement(173554..175140) product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227826.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 gene pckA CDS complement(175214..175708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS complement(175705..176643) product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 tRNA 176754..176830 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS complement(176895..177137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS 177350..177862 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227729.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS 177841..179175 product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403127.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS complement(179128..180069) product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227730.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 gene meaB CDS complement(180070..180912) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838714.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 tRNA 181067..181160 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS complement(181299..182243) product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174155.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS 182390..183664 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888077.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS 183717..184607 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173997.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS 184617..185456 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888075.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS 185453..186364 product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230154.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS 186352..188697 product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140201.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS 188755..189534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS 189539..191047 product thermostable carboxypeptidase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174078.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS 191164..192744 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815878.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS 192805..193722 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS 193715..194548 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707089.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS 194550..195677 product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227840.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS 195944..196717 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS 196756..196920 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS 197012..197407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS 197482..197832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS 197857..198060 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS 198311..198847 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS complement(199358..199651) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS 199563..199754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS 199862..200197 product SPW repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969441.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS 200281..200883 product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478760.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 gene slmA CDS complement(200964..201737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228312.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS complement(201730..202653) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173018.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS complement(202713..203222) product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868874.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS complement(203261..203731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS complement(203782..204375) product MazG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229037.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS complement(204380..205468) product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227821.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS 205652..206044 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS 206095..206526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS 206523..206876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS 206873..207337 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS 207352..208554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS 208538..210190 product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393063.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS 210191..211390 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228203.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS 211387..211878 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS 212045..212974 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS 213224..215473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13300 tRNA complement(215518..215594) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS complement(215680..216612) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479611.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS complement(216716..217639) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930636.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 tRNA 217765..217840 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS 217958..218308 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633581.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 gene rplU CDS 218312..218572 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228914.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 gene rpmA CDS 218603..219850 product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228913.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 gene obgE CDS 219851..220432 product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228912.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 gene nadD CDS 220398..220949 product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173800.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 gene yqeK CDS 220930..222060 product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228910.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS 222067..222414 product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633572.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 gene rsfS CDS 222419..222745 product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227887.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS 222802..223044 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS 223048..223716 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173744.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS 223713..224822 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228866.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS 224871..225410 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS 225397..226839 product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189292.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS 226839..227462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS 227546..229705 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228876.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS 229780..230184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS 230184..230372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS 230375..230956 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS 230953..231552 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS 231549..232214 product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227636.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS 232211..232654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS 232758..234227 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS 234345..234902 product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229198.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS 234899..235723 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS 235726..236157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS 236154..236816 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118816.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS 236813..238069 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228367.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS 238062..238832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13600 repeat_region 238962..239105 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggcatgatgggcggctacggc CDS 239680..242418 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992271.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS complement(242476..242772) product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173405.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS complement(242833..243531) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS complement(243540..244271) product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173403.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS complement(244268..245155) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173402.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS complement(245185..245937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS complement(246012..246140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS 246402..247046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS complement(247000..247845) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227674.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS complement(247871..248650) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227673.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS 248532..249479 product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227672.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS complement(249476..250558) product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618804.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 gene bshA CDS 250649..251845 product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003128157.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 note possible pseudo, frameshifted CDS 251901..252989 product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227928.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS 252970..253554 product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227929.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 gene hisB CDS 253566..254195 product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172519.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 gene hisH CDS complement(254147..255073) product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227930.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS 255310..258126 product periplasmic nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852404.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 gene napA CDS 258137..258853 product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852504.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 gene napG CDS 258843..259661 product quinol dehydrogenase ferredoxin subunit NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891886.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 gene napH CDS 259667..260305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS 260307..260768 product ferredoxin-type protein NapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208536.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 gene napF CDS 260756..261682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS 261679..262047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS complement(262052..262627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS 262677..264059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS 264056..264991 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257437.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS 264988..266088 product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887564.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS 266123..267592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS 267638..267976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS complement(267973..268362) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228981.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS complement(268349..269218) product DUF1028 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228982.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS 269292..269753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS 269819..270283 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS complement(270350..270820) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008634034.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS 270929..271840 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227873.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 gene cysK CDS complement(271837..272151) product FUN14 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926073.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS 272212..273819 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229182.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS 273949..275145 product maltose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228835.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS 275255..276553 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228834.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS 276550..278064 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228833.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS 278061..279803 product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926067.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS 279796..281928 product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249928.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS complement(281992..283005) product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766269.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS 283108..284019 product tRNA-dihydrouridine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017870267.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS 285135..285650 product DUF84 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869966.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS complement(285597..286169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS complement(286169..286903) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173676.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS complement(286906..287847) product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173675.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS 288059..290686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS 290834..293260 product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228447.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 gene lon CDS complement(294062..297490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS complement(297929..298174) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS 298467..299108 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS 299224..299835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS 299832..300152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS 300547..301317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS 301314..304163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS complement(304333..304572) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14190 tRNA 304568..304643 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 tRNA 304657..304742 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 tRNA 304746..304821 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA 304827..304902 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 sequence05 source 1..220522 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 43..1443 product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197525141.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS 1478..2200 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173250.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS 2178..3803 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228496.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS complement(3816..5159) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227806.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS 5229..5948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS 5983..6642 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174204.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS 6639..7544 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227733.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS 7537..8193 product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174206.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 gene phoU CDS 8236..9297 product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479753.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 gene pstS CDS 9359..10303 product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479754.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 gene pstC CDS 10300..11127 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889419.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 gene pstA CDS 11133..11900 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889420.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 gene pstB CDS 11909..12373 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS complement(12368..13867) product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259263.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS 13894..15747 product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270140.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS 15782..17959 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926052.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS complement(18367..19047) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173858.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS complement(19047..20186) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228946.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS 20246..22933 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228945.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 gene alaS CDS 23131..23538 product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393142.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 gene ruvX CDS 23535..24560 product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024119531.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 gene mltG CDS complement(24541..25149) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS complement(25212..27662) product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228476.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS complement(27763..28749) product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228475.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS 28988..30010 product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393776.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS 30022..31239 product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093005186.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS 31388..32374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS complement(32468..32680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS 32711..34816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS 35337..37148 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS complement(37156..38115) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227819.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS 38213..39355 product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174136.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS 39352..39645 product proton-translocating transhydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227778.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS 39649..41022 product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227779.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS 41085..42272 product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228785.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS 42372..43490 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228826.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS complement(43487..44665) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173679.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 gene metK CDS complement(44733..45554) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227698.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 gene rsmA CDS complement(45532..46026) product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810219.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS complement(46037..46807) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174274.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS complement(46807..47322) product Rad52/Rad22 family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174275.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 tRNA 47417..47492 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS complement(47538..49148) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389262.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS complement(49145..50635) product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815059.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 gene glpK CDS complement(50687..52306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS complement(52343..54043) product ABC-ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228055.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS 54093..54548 product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174302.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS 54646..55161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS 55182..55760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS complement(55757..56854) product [LysW]-lysine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228894.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS complement(56851..58014) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228893.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS complement(58173..58757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS complement(58803..59201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS complement(59301..60116) product [LysW]-aminoadipate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229000.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS complement(60208..61227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS complement(61244..61825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS complement(61838..62620) product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093005130.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 gene amrB CDS complement(62634..63743) product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228858.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 gene amrS CDS complement(64600..65634) product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229001.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 gene argC CDS 65763..66275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS 66498..67136 product organomercurial lyase MerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790334.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 gene merB CDS complement(67281..67775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS complement(67820..68656) product lysine biosynthesis protein LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229004.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 gene lysX CDS complement(68730..68894) product lysine biosynthesis protein LysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229005.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 gene lysW CDS complement(68891..69190) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229006.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS complement(69194..69712) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229007.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS complement(69709..70947) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926083.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS complement(71078..72220) product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173924.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 gene lysS CDS complement(72486..72623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS complement(72724..73374) product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227951.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 gene cmk CDS 73433..74092 product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174104.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 gene lipB CDS 74103..75077 product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174105.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 gene lipA CDS 75070..75396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS 75410..76288 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174107.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS complement(76298..78454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS 78585..78962 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS complement(79038..80723) product sugar phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096407.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS complement(80711..81967) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037226281.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS complement(81981..83216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS complement(83218..84477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS complement(84535..85866) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031698.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS complement(85863..86858) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229210.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS 87003..88253 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227981.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS 88285..89037 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776260.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS complement(89372..90370) product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227723.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS complement(90382..91725) product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332883.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 gene aroA CDS complement(91732..92655) product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229044.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS complement(92664..94523) product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229043.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS complement(94585..95364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS complement(95380..95763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS complement(95784..96194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS complement(96191..96631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS complement(96628..98667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS complement(98840..100717) product DUF4900 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229178.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS complement(100728..101693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS complement(101698..102132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS complement(102129..102593) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS complement(102693..104078) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118855.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 gene lpdA CDS complement(104088..105440) product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227796.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS complement(105456..106430) product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227794.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS complement(106446..107555) product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227793.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS 107713..108147 product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227792.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS 108223..108525 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631344.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS complement(108591..110222) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174077.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 gene groL CDS complement(110235..110543) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174076.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 gene groES CDS complement(110674..111450) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227823.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS 111527..112786 product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227648.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 gene glgC CDS 112783..113481 product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174327.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS 113481..113867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS complement(113836..114135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS 114258..114650 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480093.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS 114654..115397 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS 115390..116166 product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227952.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS 116139..116552 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172548.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS 116545..117258 product bifunctional dihydropteridine reductase/dihydrofolate reductase TmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172549.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 gene tmpR CDS 117267..117881 product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633832.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 gene folE CDS complement(117893..118339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS complement(118352..121543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS complement(121546..122052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926043.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS complement(122063..122926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228189.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS complement(122984..123847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS 124113..125900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228185.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS complement(125897..126379) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173961.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS complement(126381..127082) product type-5 uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173217.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS complement(127063..128628) product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926057.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS complement(128659..129048) product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024119983.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS complement(129060..129302) product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024119982.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS 129672..130160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS complement(130312..131277) product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041443441.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS complement(131287..132045) product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228467.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS complement(132055..133209) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173212.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS 133374..134744 product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404453.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS 135506..136648 product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228414.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 gene ribD CDS 136648..137238 product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228413.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS 137235..138428 product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228412.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS 138513..138965 product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008634050.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 gene ribH CDS 138982..139257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS 139291..140529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS complement(140799..141158) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS 141486..142349 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228840.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS complement(142321..142851) product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633352.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS complement(142864..143097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS complement(143103..144065) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173480.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 tmRNA 144152..144503 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS 144605..145894 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870113.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS complement(145954..147108) product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228823.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS 148127..149092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15640 note possible pseudo, frameshifted CDS 149173..150174 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173671.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS 150184..151572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS 151646..152359 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174056.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 gene rlmB CDS 152369..153481 product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227840.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS 153468..153713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS 153710..153952 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS 153933..154853 product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174053.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS complement(154850..155650) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228258.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS 155716..155952 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS 155970..156830 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227640.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS 156840..157640 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229050.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 gene rsmI CDS 157637..158605 product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173968.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 gene pfkA CDS complement(158609..159082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS complement(159120..160460) product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977149.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS 160459..160845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259429.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS 161037..161795 product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228100.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS 161792..162493 product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228101.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS complement(162793..162978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS 162955..164859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS 164914..165324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172750.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS complement(165263..166177) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228102.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS complement(166180..167895) product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173208.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS complement(167953..170118) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228463.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 gene pnp CDS complement(170200..170469) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632621.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 gene rpsO CDS complement(170623..172308) product ba3-type cytochrome C oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173204.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 gene cbaA CDS complement(172310..172807) product ba3-type cytochrome C oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173203.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 gene cbaB CDS 173038..174765 product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228471.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 gene polX CDS complement(174762..175610) product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228128.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS complement(175619..175972) product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227991.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS complement(176039..177205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS complement(177210..177809) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS complement(177885..178202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS complement(178438..178683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS 178705..178980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS 178968..179387 product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173262.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 tRNA complement(179437..179513) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS 179686..181188 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228839.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS 181207..182022 product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173694.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS 182022..182663 product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173693.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS 182660..183223 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS 183270..184211 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228837.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS 184245..185516 product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228780.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS 185513..186796 product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228779.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS 186853..187413 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228778.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS 187391..188296 product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228777.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS 188307..191108 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228772.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS 191134..193125 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227715.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 gene tkt CDS 193129..194037 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173196.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS 194062..194619 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173195.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 gene efp CDS 194630..195133 product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228456.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 gene accB CDS 195141..196481 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173193.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 gene accC CDS 196507..196842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS 196832..197260 product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632549.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 gene nusB CDS 197264..198106 product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228455.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS 198103..198549 product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888697.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS 198619..200661 product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228453.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS 200719..201081 product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118979.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS 201140..202288 product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227919.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS complement(202285..204291) product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228793.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS complement(204288..205058) product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926063.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS 205096..206940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228795.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS 206984..208183 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228796.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS 208208..209950 product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228959.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS 209991..210482 product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228460.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS 210486..211076 product ADP-ribosylation factor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228461.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS 211119..212192 product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228001.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 gene gcvT CDS 212223..212609 product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228002.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 gene gcvH CDS 212620..213936 product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172605.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 gene gcvPA CDS 213933..215378 product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228003.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 gene gcvPB CDS 215379..215657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174017.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS 215654..216475 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS complement(216445..217200) product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173668.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 gene truA CDS 217488..217862 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118744.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 gene rpsL CDS 217874..218344 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633429.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 gene rpsG CDS 218347..220419 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228848.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 gene fusA sequence06 source 1..166250 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 235..1362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS complement(1524..1865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS complement(1868..2068) product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173482.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS complement(2124..3110) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228015.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS complement(3230..5323) product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392141.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 gene glyS CDS complement(5320..6177) product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460838.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 gene glyQ CDS 6346..8550 product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172629.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS 8564..9898 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228013.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 gene radA CDS 9895..10941 product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228012.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS complement(10923..11807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS complement(11804..12241) product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461534.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS 12357..13490 product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228010.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 gene sucC CDS 13487..14356 product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228009.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 gene sucD CDS complement(14418..15530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS complement(15561..16724) product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225440.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS complement(16734..17894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS complement(17968..20721) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS complement(20788..21252) product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228225.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS 21353..22021 product CBS and ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228227.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS complement(22079..22459) product dimethylsulfonioproprionate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000909989.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS complement(22475..24031) product autoinducer-2 kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042875210.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 gene lsrK CDS complement(24082..25116) product autoinducer 2 ABC transporter substrate-binding protein LsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823631.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 gene lsrB CDS complement(25170..26210) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878507.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS complement(26207..27190) product autoinducer 2 ABC transporter permease LsrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369589.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 gene lsrC CDS complement(27187..28713) product autoinducer 2 ABC transporter ATP-binding protein LsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170086.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 gene lsrA CDS 28974..29963 product sugar-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257220.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS complement(29960..30949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228439.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS complement(30942..31826) product LptA/OstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228440.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS complement(31834..32391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173176.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS 32464..32829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632453.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS 32885..33355 product GreA/GreB family elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228396.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS 33358..34854 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173121.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 gene lysS CDS 34927..35175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS complement(35176..35988) product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228389.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 gene sdaAA CDS complement(36051..37421) product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228057.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 gene hemG CDS complement(37433..38398) product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228058.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 gene hemH CDS complement(38395..39420) product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228059.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 gene hemE CDS 39501..40295 product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228401.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 gene aroE CDS 40295..40831 product DUF2179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830398.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS 40828..41430 product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888833.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS 41436..43946 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228405.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 gene polA CDS 43969..45273 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228407.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 gene glmM CDS 45305..45598 product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349642.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS 45600..46013 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228286.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS 46060..47295 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228287.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS 47344..49671 product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228288.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 gene rnr CDS 49766..51712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS 51709..53346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS complement(53410..54276) product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140791.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS complement(54476..54940) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173028.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 gene dtd CDS complement(54961..55803) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228320.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS 55943..57505 product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228321.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 gene serA CDS 57496..58575 product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228041.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS complement(58550..59152) product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228042.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS complement(59154..59531) product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172959.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 gene aroH CDS complement(59528..60928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS complement(60928..62034) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228257.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS complement(62037..63152) product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228432.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 gene mqnC CDS 63151..63678 product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228431.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS 63698..64180 product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228578.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 gene bcp CDS 64170..64853 product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632746.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 gene rpiA CDS 64850..65119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS 65147..65428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS 65438..65770 product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265729.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS 65767..66504 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229019.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS 66501..67667 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229018.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS 67723..69603 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228577.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 gene metG CDS complement(69596..70747) product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173000.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 gene amrB CDS complement(70704..72038) product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887834.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS 72056..72652 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173002.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 gene coaE CDS 72636..73448 product helical backbone metal receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228146.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 tRNA complement(73461..73550) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS 73611..74396 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228245.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 gene proC CDS 74393..74953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926046.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS complement(74943..75581) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172947.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS complement(75584..76633) product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228247.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS complement(76630..77733) product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228248.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 gene dxr CDS complement(77730..78596) product CDP-archaeol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172950.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS complement(78532..79218) product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920928.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 gene uppS CDS complement(79215..79772) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172951.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 gene frr CDS complement(79789..80496) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172952.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 gene pyrH CDS complement(80576..81166) product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228249.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 gene tsf CDS complement(81163..81930) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172954.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 gene rpsB tRNA 82132..82206 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS 82377..85427 product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546362.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 gene fdnG CDS 85441..86214 product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368961.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 gene fdxH CDS 86211..86978 product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461605.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 gene nrfD CDS 86997..87638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS 87638..88426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS complement(88337..88924) product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228583.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS 89100..90320 product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173169.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 gene trpB CDS 90317..91090 product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228434.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 gene trpA CDS 91095..91940 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479789.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS complement(91948..92127) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS complement(92124..93239) product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480242.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 gene menC CDS complement(93249..94547) product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089911.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS complement(94548..95036) product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811089.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS complement(95046..96020) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811594.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS 96125..96883 product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229109.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS 96880..98388 product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228353.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 gene pxpB CDS complement(98385..99182) product endonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228231.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 gene nfo CDS complement(99184..99750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS complement(99754..100788) product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228417.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS complement(100821..102140) product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228137.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 gene asnS CDS complement(102150..102731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS complement(102721..102918) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093358.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS complement(102911..103132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS 103262..103867 product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889422.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS 103864..104280 product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889423.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS complement(104299..104865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS complement(105111..105929) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228138.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS complement(105926..106825) product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172808.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS complement(106829..108583) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172809.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 gene aspS CDS complement(108580..109842) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172810.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 gene hisS CDS 109975..111012 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883962.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS 111009..111392 product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028411.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS complement(111357..112421) product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887018.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 gene cax CDS complement(112418..115660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS complement(115650..115979) product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810206.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS complement(115976..116512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS complement(116509..117831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS complement(117822..118250) product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172991.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 gene smpB CDS 118339..119577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS 119567..120790 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926087.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS 120807..122072 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227893.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS 122174..123163 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228284.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 gene gap CDS 123182..124378 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228285.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS 124375..125145 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228317.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 gene tpiA CDS complement(125197..125781) product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228136.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 gene pdxT CDS complement(125855..126736) product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024119184.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 gene pdxS CDS complement(126750..127913) product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228133.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS complement(127946..129226) product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173142.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 gene rho CDS complement(129223..129915) product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228415.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 gene fsa CDS 130421..133576 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228416.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 gene ileS CDS complement(133623..134294) product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228230.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS complement(134296..134916) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172926.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS complement(134894..137356) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228229.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS complement(137381..140347) product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228274.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 gene mfd CDS 140438..141610 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887866.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS complement(141587..142228) product tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479902.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 gene mnmD CDS 142263..143006 product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228262.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS 143011..143307 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933493.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 gene gatC CDS 143307..144560 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404592.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 gene serS CDS complement(144612..145754) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022798454.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS 145778..146167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS complement(146218..147810) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060384516.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS complement(147820..148131) product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173319.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS complement(148128..149468) product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227990.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS complement(149478..150206) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227989.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS complement(150341..152128) product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172599.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS 152170..153123 product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388965.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 gene mdh CDS 153303..154070 product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227837.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS 154112..154582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS complement(154556..155122) product protoglobin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024119613.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS complement(155133..159716) product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259099.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 gene gltB CDS 159928..160200 product stage V sporulation protein S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008630673.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS 160293..160952 product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228280.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS 160963..162195 product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228244.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS complement(162192..162395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS complement(162441..163889) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228277.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 gene cysS CDS complement(163993..164436) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172943.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS complement(164446..164922) product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228243.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 gene recX CDS 165009..165647 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228242.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 sequence07 source 1..153541 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 194..300 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 CDS complement(1717..4638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS complement(4788..5993) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942261.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 gene dinB CDS 6334..6840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18020 tRNA complement(6883..6959) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS 7028..8176 product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227861.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS 8231..8962 product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227860.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 gene cdaA CDS 8949..9821 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227859.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS 9866..10465 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174028.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 gene def CDS 10471..11397 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227858.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 gene fmt CDS complement(11442..12071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS complement(12173..14671) product trimethylamine-N-oxide reductase TorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389042.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 gene torA CDS 14920..16722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS complement(17758..19566) product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227739.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS 19714..20586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS 20637..21941 product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461043.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS 21938..22867 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208044.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS 22864..23436 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS 23433..24548 product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017302733.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS 24560..25849 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS 25833..26939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS complement(26986..27189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS complement(27595..27792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS 28438..29463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS 29511..30416 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS 31067..31609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS 31600..32688 product O-antigen biosynthesis protein WlbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447875.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 gene wlbD CDS 32685..33896 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582958.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS 33877..34512 product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582959.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS 34502..35128 product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918895.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS 35138..36274 product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582967.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS 36271..38166 product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868795.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS 38467..39408 product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228049.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS 39434..40492 product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227788.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS 40534..41052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172744.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS 42351..43565 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227775.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 tRNA complement(43926..44002) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS complement(44054..46048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227922.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS 46109..47041 product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227789.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS 47038..47640 product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804347.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS 47661..48254 product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174021.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS 48336..48923 product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973167.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS complement(49100..49666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS complement(49710..49889) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS 50020..50955 product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889178.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS 50945..51472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174019.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS complement(51469..52017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS complement(52095..52643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS complement(52683..52850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS complement(52914..53612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227869.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS 53744..54061 product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229084.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS 54084..55049 product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172884.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS 55184..55810 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS 55807..56529 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174216.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS 56532..56984 product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174215.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 gene nrdR CDS 57154..57819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS 57832..59265 product nitric-oxide reductase subunit NorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113237.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 gene norB CDS 59258..59581 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS 59591..60331 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS 60428..62047 product nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111532.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 gene nirS CDS complement(62123..62353) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS complement(62552..63241) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975365.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 tRNA complement(63308..63384) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 CDS complement(63428..64411) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229015.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 gene trxB tRNA complement(64514..64589) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 tRNA complement(64611..64685) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 tRNA complement(64689..64762) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 CDS 64927..65379 product DUF2267 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228678.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS 65448..67085 product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480118.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS complement(67257..68357) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227848.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS complement(68362..69099) product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174315.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS complement(69161..69424) product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631133.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 gene rpmB CDS 69552..69980 product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174313.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 gene lspA CDS complement(69985..71088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS complement(71133..71852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS complement(72006..72704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS complement(72842..73990) product aspartate/prephenate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227669.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 gene aspC CDS complement(74438..75265) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048095630.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS complement(75262..76053) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18710 note possible pseudo, frameshifted CDS complement(76195..77211) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383348.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS 77251..77667 product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227764.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 gene ndk CDS complement(78368..79081) product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937792.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 gene fetB CDS 79271..80317 product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763402.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS 80324..83254 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS 83244..83648 product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537487.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS complement(83645..85840) product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926014.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS 85874..86566 product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229457.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS 86566..87648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS complement(87593..88585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS complement(88582..89049) product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228393.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS complement(89165..89317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS 89480..90295 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS 90398..91456 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173846.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS complement(91453..92523) product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926074.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS complement(92520..93233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228941.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS 93342..94436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS 94511..95308 product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869292.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS complement(95305..97323) product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036269.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS complement(97295..102964) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257798.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS complement(103142..103750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS complement(103751..104191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS complement(104188..104547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS complement(104645..105124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS complement(105121..106191) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068555034.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS complement(106563..107651) product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143360.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS complement(107676..108233) product DUF4433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143359.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS complement(108307..112608) product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256730.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS complement(112605..115346) product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883982.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS 115395..115547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS complement(115552..116346) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530269.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS complement(116339..117811) product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389022.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS complement(117808..118626) product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384441.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 tRNA 118743..118832 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 tRNA 118844..118935 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 CDS complement(118986..119651) product S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173838.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS complement(119656..120375) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479631.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS 120433..121299 product KaiC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880080.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS 121313..122476 product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889306.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS complement(122411..123625) product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887720.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS complement(123622..124719) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349606.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS complement(124716..125849) product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173181.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS complement(125850..126266) product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173839.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 gene fabZ CDS complement(126276..127310) product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173840.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS complement(127355..128017) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228812.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS 128073..128546 product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173658.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS complement(128604..129365) product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172783.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS 129408..130193 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250628.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS 130317..132098 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479585.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS 132219..133244 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887009.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS 133252..134283 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887010.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS 134477..136255 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479585.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS 136308..137333 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887009.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS 137326..138339 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081440.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS complement(138394..139146) product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256366.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS 139145..140329 product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888393.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 gene lysA CDS complement(140352..140747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS complement(140937..143273) product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926008.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS complement(143352..143576) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS complement(143573..144766) product alanine--tRNA ligase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227734.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS 144946..145665 product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039550.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS complement(145686..146852) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229031.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS 147029..147409 product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228887.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS 147512..148333 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926015.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS 148334..148981 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227689.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS 148978..149652 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227690.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS 149660..149992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19360 sequence08 source 1..122467 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(148..1854) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227959.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS complement(2044..2274) product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633583.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 gene secG tRNA complement(2294..2380) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 CDS complement(2440..3543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS complement(3554..4222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS complement(4215..5117) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228215.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS complement(5142..6185) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228214.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS 6232..6810 product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172902.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS 6813..8672 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025567324.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS 9724..10479 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888247.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS 10508..10921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS complement(10918..12726) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228612.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS complement(12726..14483) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228613.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS complement(14508..15353) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173406.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS complement(15383..15679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS complement(15660..16673) product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173407.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS complement(16670..17320) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632821.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS 17416..17913 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS 17922..18983 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257446.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS complement(18977..20101) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173365.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS 20148..20999 product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228587.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS 21010..21636 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173367.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 gene upp CDS 21704..22801 product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228588.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS 22798..23943 product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024119483.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 gene wecB CDS complement(23912..24889) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731382.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS complement(24900..25661) product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728711.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS complement(25693..26892) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228589.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS 26997..28880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS complement(28941..30947) product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070809.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS complement(30940..31434) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS complement(31445..32416) product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878139.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS 32565..33725 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228201.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS complement(33781..35139) product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227707.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS complement(35136..36554) product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227706.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS complement(36551..38377) product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227705.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 gene nuoL CDS complement(38380..38673) product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227704.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 gene nuoK CDS complement(38670..39227) product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227703.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS complement(39224..39754) product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174264.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 gene nuoI CDS complement(39751..40743) product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227702.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 gene nuoH CDS complement(40740..43130) product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227701.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 gene nuoG CDS complement(43133..44452) product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227700.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 gene nuoF CDS complement(44449..45021) product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174268.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 gene nuoE CDS complement(45034..46248) product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227699.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 gene nuoD CDS complement(46245..46874) product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174270.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS complement(46878..47417) product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174271.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS complement(47408..47767) product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174272.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS complement(47954..48223) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS 48340..48507 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS 48513..49181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS complement(49178..49765) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679594.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 gene purN CDS complement(49758..50777) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227884.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 gene purM CDS complement(50774..52057) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393539.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 gene purD CDS complement(52060..53475) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257473.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 gene purF CDS complement(53472..53969) product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582680.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 gene purE CDS complement(53962..54933) product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681898.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS complement(54945..58634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS 58793..59281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS complement(59288..59863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS complement(59867..60604) product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228016.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS complement(60597..60863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS 60929..62011 product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257106.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS complement(61987..62907) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227915.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS 62963..64198 product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139328014.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS complement(64160..65050) product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763100.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS complement(65058..65888) product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227914.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 gene panB CDS 65924..66571 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355190.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS complement(67602..68333) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228212.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS 68412..69398 product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227913.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 gene ruvB CDS 69395..70441 product DUF4388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172495.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS 70695..70973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS complement(72014..73747) product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338640.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 gene ade CDS 73831..74034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS 74031..75020 product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227962.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS complement(75007..76845) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS complement(76856..77512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632535.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS complement(77601..79007) product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268278.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 gene nuoN CDS complement(79004..80476) product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061939.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS complement(80473..82476) product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257848.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 gene nuoL CDS complement(82487..82795) product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392499.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 gene nuoK CDS complement(82795..83265) product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969267.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS complement(83262..83831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS complement(83833..85008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS complement(85020..86147) product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258751.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 gene nuoD CDS complement(86144..86641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS complement(86663..87217) product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183511.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS complement(87205..87582) product NADH-quinone oxidoreductase subunit NuoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179273.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 gene nuoA CDS 87722..88846 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228631.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS 88869..89534 product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228499.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 gene deoC CDS 89569..90648 product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228500.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS 90618..91211 product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228501.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS 91204..91980 product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228502.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 gene mreC CDS 91977..92462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS 92455..94218 product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173259.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS 94232..94789 product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228504.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS complement(94930..95220) product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228650.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 gene rpsT CDS complement(95299..95685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173449.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS 95742..97049 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173450.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 gene tyrS CDS 97109..97582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS complement(97659..98249) product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173451.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS complement(98252..99301) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228651.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS complement(99298..99768) product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228652.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS complement(99765..100301) product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228653.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS complement(100298..102250) product cytochrome c-type biogenesis CcmF C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228654.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS complement(102247..102678) product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228655.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 gene ccmE CDS complement(102668..102787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS complement(102780..103472) product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228656.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 gene ccsA CDS 103813..106155 product selenite/tellurite reduction operon c-type cytochrome ExtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943566.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 gene extM CDS 106244..107044 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS 107041..107622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS complement(107671..108333) product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228657.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS complement(108330..108953) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228658.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS complement(108960..109643) product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173460.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 gene ccdA CDS complement(109779..110627) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228932.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS complement(110620..110823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS complement(110875..115461) product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228934.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 gene rpoC CDS complement(115472..118846) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228935.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS complement(119074..119460) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008630582.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 gene rplL CDS complement(119479..120006) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008630583.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 gene rplJ CDS complement(120223..120912) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227804.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 gene rplA CDS complement(120905..121339) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174097.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 gene rplK CDS complement(121384..121953) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008630512.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 gene nusG CDS complement(121950..122132) product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008630510.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 gene secE CDS complement(122135..122299) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008630505.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 gene rpmG sequence09 source 1..113206 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(97..1332) product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105667.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 tRNA complement(1430..1505) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 tRNA complement(1511..1587) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 CDS 1704..2351 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633090.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS 2348..2704 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633088.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS complement(2771..3019) product chaperone modulator CbpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173538.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS complement(3016..3885) product molecular chaperone DnaJ2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228713.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 gene dnaJ2 CDS complement(3938..4513) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228714.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 gene gprE CDS complement(4566..6437) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228715.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 gene dnaK CDS 6585..8477 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173542.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 gene ftsH CDS 8503..8853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS 8960..9298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS 9295..9939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS complement(9968..10282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS complement(10396..11418) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918332.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS complement(11423..12517) product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195336.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 gene nagA CDS complement(12514..13170) product DUF5639 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618917.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS complement(13212..14765) product polyhydroxybutyrate depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227772.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS complement(14762..15862) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228861.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS complement(15867..16844) product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173767.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 gene plsX CDS complement(16849..17175) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173768.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 gene trxA CDS 17205..17537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS 17585..17902 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS 17911..18795 product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174253.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS 18930..20228 product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881057.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS 20325..20873 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS 20899..22020 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228498.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 gene ychF CDS complement(22646..23548) product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123168.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS complement(23595..24257) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970242.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS complement(24250..26019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS complement(26016..26957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS 26997..28127 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228462.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS 28129..28926 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228827.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 gene murI CDS 28923..29645 product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942439.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 gene rph CDS 29648..30262 product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926068.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 gene rdgB CDS 30268..31320 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173689.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS complement(31303..31845) product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632567.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS complement(31901..33337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS 33529..34380 product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228493.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS 34441..34875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS 34931..35821 product DUF4115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228492.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS 35849..37180 product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228491.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 gene rimO CDS 37196..38539 product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228490.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 gene trkA CDS 38542..39990 product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173241.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS complement(40110..43085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS complement(43082..43903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS 44417..45460 product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101591.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS complement(45439..46416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS complement(46413..49019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227908.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 CDS complement(49016..50056) product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227909.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS complement(50053..51060) product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631628.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 tRNA complement(51148..51224) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 CDS 51378..52013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS 52071..53822 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679750.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS complement(53852..54181) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS complement(54264..54716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS complement(54713..56101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21120 tRNA complement(56178..56254) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 CDS complement(56313..57674) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631640.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS 57767..59623 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227911.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 gene ftsH CDS complement(59688..60785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS 60840..62096 product glycosyl hydrolase family 8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191316782.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS complement(62081..65242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS complement(65449..67887) product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932772.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS complement(67884..68855) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228789.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 gene ddl CDS complement(70219..70872) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173630.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 gene pth CDS complement(70929..71567) product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173631.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS complement(71734..72654) product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173595.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS complement(72673..73374) product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350459.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS complement(73376..73846) product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173597.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS 73907..74899 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229118.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS 74909..77620 product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229117.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS 77633..79141 product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229116.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 gene casA CDS 79125..79625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS 79637..80770 product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229114.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 gene cas7e CDS 80770..81492 product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229113.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 gene cas5e CDS 81483..82085 product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229112.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 gene cas6e CDS 82088..83053 product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229111.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 gene cas1e CDS 83007..83402 product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926117.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 gene cas2e repeat_region 83423..87064 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttttccccgcgcatgcggggatgaaccg CDS 87262..87486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS 87587..88267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS 88312..89283 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS 89321..90064 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS complement(90543..90878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS 91046..92131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21390 note possible pseudo, frameshifted CDS 92191..92556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS 92580..92801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS complement(92821..93093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS complement(93151..94071) product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257591.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 gene rbsK CDS complement(94126..94260) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS 94558..95448 product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921611.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS 95458..96045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS 96050..96532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS 96597..98657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS 98654..99310 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222893.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS complement(99841..102045) product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814129.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 gene katG CDS complement(102147..103400) product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064707.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 gene nhaA CDS complement(103448..103921) product peroxide-responsive transcriptional repressor PerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733104.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 gene perR CDS complement(103985..104413) product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173532.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS complement(104506..104685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS complement(104720..107362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS complement(107443..107901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS 108263..108778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS complement(108827..110107) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405015.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS complement(110107..110502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21590 CDS complement(110499..111350) product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174171.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 gene ispE CDS 111425..112087 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 CDS 112065..112454 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21620 sequence10 source 1..78639 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 157..627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21630 CDS 627..1295 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227635.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS 1304..3163 product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227634.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 gene dxs CDS complement(3160..4194) product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227816.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 gene recF CDS complement(4191..4670) product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008630908.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 CDS 4706..5515 product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165446277.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS 5568..6509 product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926019.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS complement(6552..7736) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227815.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 CDS 7835..8341 product ferritin BfrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420920.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 gene bfrB CDS 8410..8862 product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229167.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 gene msrA CDS 9218..10588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS complement(10969..12357) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947960.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS complement(12367..13140) product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977216.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS complement(13194..13640) product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888169.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS complement(13630..13914) product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251211.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS complement(14127..14657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21780 note possible pseudo, frameshifted CDS 14897..15151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS 15188..15424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS 15421..15810 product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143544.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS complement(15910..16929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS complement(17292..18191) product IS481-like element IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931661.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS complement(18382..19767) product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972090.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS 19945..20193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS 20193..20618 product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067458002.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS complement(20615..21733) product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229030.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 gene rlmN CDS complement(21822..22154) product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191709.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS complement(22211..22543) product DUF2853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531020.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS complement(22649..23101) product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887593.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS 23170..23697 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS 23762..24937 product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390393.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS 24996..27632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS complement(27636..29900) product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228829.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 gene mutS2 CDS 29978..30955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS complement(30891..32018) product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174133.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS complement(32028..32462) product 3D domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174132.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS 32649..33314 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS complement(33304..34092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS complement(34175..35782) product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227781.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS complement(35775..36116) product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227782.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS complement(36139..36843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS complement(36907..38016) product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227783.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 gene ald CDS 38028..38603 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS complement(38600..39376) product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228020.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 CDS complement(39410..40219) product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886780.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS 40297..41250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS 41263..42222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS 42287..43210 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS complement(43211..43975) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388487.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS complement(44034..44876) product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937965.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS complement(44930..46609) product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228022.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS complement(46649..47185) product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228021.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS complement(47186..47536) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172639.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 gene rplT CDS complement(47547..47744) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172638.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 gene rpmI CDS 47902..49134 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS complement(49217..49732) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014629997.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 gene infC CDS 49954..50160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS 50163..50819 product futalosine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228023.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 gene mqnB CDS complement(50802..51083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS complement(51085..53205) product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887862.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 gene feoB CDS complement(53208..53432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS complement(53512..54264) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227785.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS 54324..55322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS 55338..56273 product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174127.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 gene truB CDS complement(56270..56812) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467655.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS 56952..57836 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459306.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS 57872..58135 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS 58122..58643 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS 58643..59497 product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229133.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 CDS complement(59508..60032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816992.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS complement(60029..61420) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262741.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS 61777..62292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS 62437..63861 product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173868.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 gene trpE CDS 64060..64422 product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530241.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 CDS 64419..65114 product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926075.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 CDS 65111..66109 product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173866.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 gene trpD CDS complement(66167..67333) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228955.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS complement(67568..68350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS 68634..69140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS 69283..71196 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228788.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 gene gyrB CDS 71346..72881 product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226417.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 CDS 72878..73531 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS 73638..75758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS 75774..76586 product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227843.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS 76658..77884 product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227717.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 sequence11 source 1..59191 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(102..1262) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436463.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS complement(1556..2380) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731601.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS complement(2377..3294) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS complement(3363..4880) product glutathione ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065212.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS 5034..6791 product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227888.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS 7362..8495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS 8602..9333 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS 9338..9610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS 9654..10745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22550 CDS 10752..13001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22560 CDS 13021..13707 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035813.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS complement(13668..14186) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS 14316..14759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS 14801..15712 product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174006.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 gene hemC CDS 15766..16161 product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174007.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS 16158..17369 product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227872.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS complement(17363..17860) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173770.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 gene folK CDS complement(17875..20517) product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942986.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS complement(20570..20935) product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227765.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 gene folB CDS complement(20936..21757) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227766.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 gene folP CDS 21831..22700 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174150.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 CDS 22731..23960 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174149.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS 24021..24581 product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403750.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS 24578..25954 product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403751.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS complement(26032..27111) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227769.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS complement(27208..27705) product DUF4384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227770.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS complement(27780..28373) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227771.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS complement(28366..29034) product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228828.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS 29091..29441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS complement(29445..30974) product PASTA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227886.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS complement(31058..33589) product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227833.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS complement(33593..35209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS 35407..36348 product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887127.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS 36403..37671 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS 37671..38366 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838698.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS complement(38411..40021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS complement(40018..40767) product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567449.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 gene phnC CDS complement(40785..41645) product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254057.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 CDS 41851..42648 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227787.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS 43606..44100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS 44097..44432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS 44445..45374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS 46087..46353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS 46358..50026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS 50249..50542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22910 CDS complement(51132..51413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227807.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS complement(51397..51669) product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174094.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS 51805..52245 product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227808.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS complement(52307..54493) product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228497.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 CDS complement(54504..54890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22960 tRNA complement(54953..55026) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 CDS 55111..56757 product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173521.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS complement(56882..57991) product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174090.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 gene mnmA CDS complement(58039..58884) product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197525142.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 sequence12 source 1..34729 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(162..692) product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227786.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 gene hpt CDS 728..1543 product 1,4-dihydroxy-6-naphthoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228771.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS complement(1596..2819) product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259724.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS 2941..3570 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660467.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS 3587..5092 product bacillithiol biosynthesis cysteine-adding enzyme BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228769.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 gene bshC CDS 5116..6228 product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926061.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS 6365..6886 product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174153.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS complement(6867..7454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS complement(7436..7714) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174283.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS 7835..9394 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926017.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS 9490..10719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23100 CDS complement(10775..11425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS complement(11431..13200) product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228994.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 gene glmS CDS 13820..16495 product S-layer homology domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228992.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS 16557..17276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23140 CDS 17284..19335 product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228991.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 gene uvrB CDS complement(20534..22003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS 22077..23162 product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228989.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 CDS complement(23131..23877) product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227818.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS complement(23916..25154) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173522.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS complement(25158..25718) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173523.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS 25717..27006 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888818.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 tRNA 27073..27148 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 CDS complement(27184..27528) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS complement(27605..29179) product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480084.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS complement(29232..29426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS complement(29597..30091) product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227752.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS complement(30088..30690) product TetR/AcrR family transcriptional regulator SbtR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174174.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 gene sbtR CDS 30774..31502 product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008630854.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS 31512..32378 product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479983.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS complement(32375..32842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23290 sequence13 source 1..28614 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(185..2659) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227691.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 gene topA CDS complement(2738..3196) product cytochrome C-552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228671.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 gene cycA CDS complement(3231..3878) product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228620.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS complement(3875..4312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23330 CDS 4375..5283 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228987.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 CDS 5276..6046 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228988.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 CDS 6057..6530 product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228918.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 gene moaC CDS 6605..7261 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228783.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 CDS 7252..8178 product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228782.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 CDS 8195..9748 product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228781.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 gene pruA CDS 9789..10436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23400 CDS 10582..12138 product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730646.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 CDS complement(12356..12766) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187137.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS 12785..14623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS 14673..15659 product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198871.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 CDS 15669..17000 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228947.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 CDS 17005..17484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS complement(17481..17768) product metal-sensitive transcriptional regulator CsoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173741.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 gene csoR CDS complement(17778..17981) product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228864.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 CDS 18065..18571 product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228871.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS 18633..19115 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS 19115..19921 product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172934.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS 19934..20419 product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173248.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS 20397..21200 product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228495.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS 21220..22011 product DUF4388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228494.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 CDS complement(22008..27179) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229122.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 misc_feature complement(27176..>28614) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_093006538.1:DUF11 domain-containing protein locus_tag LOCUS_23560 sequence14 source 1..19752 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 171..818 product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228885.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS 818..1246 product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228886.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS 1260..2696 product RNA ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228915.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 gene rtcB CDS 2755..3375 product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887473.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS 3372..3710 product DUF3208 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227682.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS complement(3707..5020) product coproporphyrinogen III oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891852.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS 5217..6350 product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256474.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS 6360..6959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS 7020..7412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS complement(7426..7656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23660 CDS complement(7667..8272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173885.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS 8271..9050 product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228966.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS 9054..9977 product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228965.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 CDS 9997..10743 product regulatory iron-sulfur-containing complex subunit RicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228964.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 gene ricT CDS 10746..11306 product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173882.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS 11309..11599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23720 CDS complement(11642..12577) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228963.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 CDS complement(12579..13964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23740 note possible pseudo, internal stop codon CDS complement(13971..14459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS 14526..15230 product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228961.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 gene ubiE CDS 15227..15772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23770 CDS 15769..16464 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228995.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS complement(16438..17409) product A/G-specific adenine glycosylase MutY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228996.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 gene mutY CDS complement(17391..17771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23800 CDS complement(17764..18036) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125708.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 CDS complement(18047..18469) product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228997.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS complement(18479..19159) product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174123.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 tRNA 19358..19443 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 sequence15 source 1..3173 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 240..3157 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 sequence16 source 1..2529 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 265..1793 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 sequence17 source 1..1424 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(227..1264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23840 sequence18 source 1..1230 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@