>Feature sequence01 737 234 gene locus_tag LOCUS_00010 737 234 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227752.1 protein_id gnl|my_center|LOCUS_00010 1676 945 gene locus_tag LOCUS_00020 1676 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2614 1673 gene locus_tag LOCUS_00030 gene osmV 2614 1673 CDS product osmoprotectant ABC transporter ATP-binding protein OsmV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593089.1 protein_id gnl|my_center|LOCUS_00030 3743 2631 gene locus_tag LOCUS_00040 3743 2631 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168156.1 protein_id gnl|my_center|LOCUS_00040 4755 3853 gene locus_tag LOCUS_00050 gene osmF 4755 3853 CDS product glycine betaine ABC transporter substrate-binding protein OsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131268.1 protein_id gnl|my_center|LOCUS_00050 5263 4913 gene locus_tag LOCUS_00060 5263 4913 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479725.1 protein_id gnl|my_center|LOCUS_00060 6230 5469 gene locus_tag LOCUS_00070 6230 5469 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888897.1 protein_id gnl|my_center|LOCUS_00070 6270 6860 gene locus_tag LOCUS_00080 6270 6860 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888898.1 protein_id gnl|my_center|LOCUS_00080 6896 8956 gene locus_tag LOCUS_00090 6896 8956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888899.1 protein_id gnl|my_center|LOCUS_00090 8991 9560 gene locus_tag LOCUS_00100 8991 9560 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889227.1 protein_id gnl|my_center|LOCUS_00100 9557 10240 gene locus_tag LOCUS_00110 gene ispD 9557 10240 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889228.1 protein_id gnl|my_center|LOCUS_00110 10233 11081 gene locus_tag LOCUS_00120 10233 11081 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889229.1 protein_id gnl|my_center|LOCUS_00120 11264 11641 gene locus_tag LOCUS_00130 11264 11641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 11696 14086 gene locus_tag LOCUS_00140 11696 14086 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259579.1 protein_id gnl|my_center|LOCUS_00140 14103 14702 gene locus_tag LOCUS_00150 14103 14702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480243.1 protein_id gnl|my_center|LOCUS_00150 15426 14755 gene locus_tag LOCUS_00160 15426 14755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 16283 15423 gene locus_tag LOCUS_00170 16283 15423 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259359.1 protein_id gnl|my_center|LOCUS_00170 16567 16283 gene locus_tag LOCUS_00180 16567 16283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 16566 17045 gene locus_tag LOCUS_00190 16566 17045 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350861.1 protein_id gnl|my_center|LOCUS_00190 17443 18660 gene locus_tag LOCUS_00200 17443 18660 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886683.1 protein_id gnl|my_center|LOCUS_00200 18843 19499 gene locus_tag LOCUS_00210 gene folE 18843 19499 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871165.1 protein_id gnl|my_center|LOCUS_00210 21027 19576 gene locus_tag LOCUS_00220 gene glmU 21027 19576 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479974.1 protein_id gnl|my_center|LOCUS_00220 22021 21065 gene locus_tag LOCUS_00230 22021 21065 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350359.1 protein_id gnl|my_center|LOCUS_00230 22951 22172 gene locus_tag LOCUS_00240 gene tatC 22951 22172 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887452.1 protein_id gnl|my_center|LOCUS_00240 23192 22962 gene locus_tag LOCUS_00250 23192 22962 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479975.1 protein_id gnl|my_center|LOCUS_00250 23596 23838 gene locus_tag LOCUS_00260 23596 23838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 23935 24492 gene locus_tag LOCUS_00270 23935 24492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 24482 25195 gene locus_tag LOCUS_00280 24482 25195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 25459 26409 gene locus_tag LOCUS_00290 25459 26409 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107136145.1 protein_id gnl|my_center|LOCUS_00290 27219 26473 gene locus_tag LOCUS_00300 27219 26473 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479969.1 protein_id gnl|my_center|LOCUS_00300 27558 27247 gene locus_tag LOCUS_00310 27558 27247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 28142 27555 gene locus_tag LOCUS_00320 28142 27555 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889002.1 protein_id gnl|my_center|LOCUS_00320 28260 29354 gene locus_tag LOCUS_00330 28260 29354 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889086.1 protein_id gnl|my_center|LOCUS_00330 29355 29657 gene locus_tag LOCUS_00340 29355 29657 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034351049.1 protein_id gnl|my_center|LOCUS_00340 30794 29634 gene locus_tag LOCUS_00350 gene chrA 30794 29634 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889039.1 protein_id gnl|my_center|LOCUS_00350 32390 31275 gene locus_tag LOCUS_00360 32390 31275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 32585 33040 gene locus_tag LOCUS_00370 32585 33040 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888871.1 protein_id gnl|my_center|LOCUS_00370 33037 33981 gene locus_tag LOCUS_00380 33037 33981 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034351200.1 protein_id gnl|my_center|LOCUS_00380 34761 33985 gene locus_tag LOCUS_00390 gene bshB1 34761 33985 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888991.1 protein_id gnl|my_center|LOCUS_00390 34793 34867 gene locus_tag LOCUS_t00010 34793 34867 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 35551 34901 gene locus_tag LOCUS_00400 gene kynB 35551 34901 CDS product kynurenine formamidase KynB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114853.1 protein_id gnl|my_center|LOCUS_00400 35550 38048 gene locus_tag LOCUS_00410 35550 38048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 38118 39848 gene locus_tag LOCUS_00420 38118 39848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 42054 40024 gene locus_tag LOCUS_00430 42054 40024 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887551.1 protein_id gnl|my_center|LOCUS_00430 42321 44333 gene locus_tag LOCUS_00440 42321 44333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 44401 44883 gene locus_tag LOCUS_00450 44401 44883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887554.1 protein_id gnl|my_center|LOCUS_00450 45009 46352 gene locus_tag LOCUS_00460 45009 46352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 46763 46383 gene locus_tag LOCUS_00470 46763 46383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 46917 47204 gene locus_tag LOCUS_00480 46917 47204 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349642.1 protein_id gnl|my_center|LOCUS_00480 47201 47614 gene locus_tag LOCUS_00490 47201 47614 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887547.1 protein_id gnl|my_center|LOCUS_00490 47637 48113 gene locus_tag LOCUS_00500 47637 48113 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887521.1 protein_id gnl|my_center|LOCUS_00500 48115 49593 gene locus_tag LOCUS_00510 48115 49593 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618861.1 protein_id gnl|my_center|LOCUS_00510 49722 50525 gene locus_tag LOCUS_00520 49722 50525 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887533.1 protein_id gnl|my_center|LOCUS_00520 50614 52344 gene locus_tag LOCUS_00530 50614 52344 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888195.1 protein_id gnl|my_center|LOCUS_00530 52341 53462 gene locus_tag LOCUS_00540 52341 53462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888196.1 protein_id gnl|my_center|LOCUS_00540 53459 54124 gene locus_tag LOCUS_00550 53459 54124 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350151.1 protein_id gnl|my_center|LOCUS_00550 54167 54724 gene locus_tag LOCUS_00560 54167 54724 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096486.1 protein_id gnl|my_center|LOCUS_00560 54727 55254 gene locus_tag LOCUS_00570 54727 55254 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531041.1 protein_id gnl|my_center|LOCUS_00570 56042 55302 gene locus_tag LOCUS_00580 56042 55302 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869292.1 protein_id gnl|my_center|LOCUS_00580 57169 56126 gene locus_tag LOCUS_00590 57169 56126 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903488.1 protein_id gnl|my_center|LOCUS_00590 57359 59668 gene locus_tag LOCUS_00600 57359 59668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 59743 60105 gene locus_tag LOCUS_00610 59743 60105 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888330.1 protein_id gnl|my_center|LOCUS_00610 61258 60110 gene locus_tag LOCUS_00620 61258 60110 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480158.1 protein_id gnl|my_center|LOCUS_00620 62387 61362 gene locus_tag LOCUS_00630 62387 61362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 63356 62442 gene locus_tag LOCUS_00640 63356 62442 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480159.1 protein_id gnl|my_center|LOCUS_00640 65326 63356 gene locus_tag LOCUS_00650 65326 63356 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177742.1 protein_id gnl|my_center|LOCUS_00650 65394 65825 gene locus_tag LOCUS_00660 gene ndk 65394 65825 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480121.1 protein_id gnl|my_center|LOCUS_00660 65930 66970 gene locus_tag LOCUS_00670 65930 66970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 67466 66972 gene locus_tag LOCUS_00680 67466 66972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480236.1 protein_id gnl|my_center|LOCUS_00680 67465 67800 gene locus_tag LOCUS_00690 67465 67800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887915.1 protein_id gnl|my_center|LOCUS_00690 67824 68615 gene locus_tag LOCUS_00700 67824 68615 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887914.1 protein_id gnl|my_center|LOCUS_00700 68612 69637 gene locus_tag LOCUS_00710 68612 69637 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775809.1 protein_id gnl|my_center|LOCUS_00710 69711 70634 gene locus_tag LOCUS_00720 69711 70634 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618835.1 protein_id gnl|my_center|LOCUS_00720 70806 71873 gene locus_tag LOCUS_00730 70806 71873 CDS product type III polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177684.1 protein_id gnl|my_center|LOCUS_00730 72249 71920 gene locus_tag LOCUS_00740 72249 71920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 72577 72386 gene locus_tag LOCUS_00750 72577 72386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 73133 72672 gene locus_tag LOCUS_00760 73133 72672 CDS product heme-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888078.1 protein_id gnl|my_center|LOCUS_00760 75105 73177 gene locus_tag LOCUS_00770 75105 73177 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480054.1 protein_id gnl|my_center|LOCUS_00770 76093 75311 gene locus_tag LOCUS_00780 76093 75311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 76264 77478 gene locus_tag LOCUS_00790 76264 77478 CDS product erythromycin esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889604.1 protein_id gnl|my_center|LOCUS_00790 78304 77468 gene locus_tag LOCUS_00800 78304 77468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034377527.1 protein_id gnl|my_center|LOCUS_00800 78493 81204 gene locus_tag LOCUS_00810 gene acnA 78493 81204 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888355.1 protein_id gnl|my_center|LOCUS_00810 81385 81711 gene locus_tag LOCUS_00820 81385 81711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480013.1 protein_id gnl|my_center|LOCUS_00820 83277 81766 gene locus_tag LOCUS_00830 83277 81766 CDS product HAMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888464.1 protein_id gnl|my_center|LOCUS_00830 83746 83342 gene locus_tag LOCUS_00840 83746 83342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 84585 83743 gene locus_tag LOCUS_00850 84585 83743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888466.1 protein_id gnl|my_center|LOCUS_00850 85420 84758 gene locus_tag LOCUS_00860 85420 84758 CDS product DUF2847 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888467.1 protein_id gnl|my_center|LOCUS_00860 86439 85489 gene locus_tag LOCUS_00870 86439 85489 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888469.1 protein_id gnl|my_center|LOCUS_00870 87500 86580 gene locus_tag LOCUS_00880 gene mraY 87500 86580 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888470.1 protein_id gnl|my_center|LOCUS_00880 88140 87670 gene locus_tag LOCUS_00890 88140 87670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 88894 88286 gene locus_tag LOCUS_00900 88894 88286 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886843.1 protein_id gnl|my_center|LOCUS_00900 89371 88931 gene locus_tag LOCUS_00910 89371 88931 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887264.1 protein_id gnl|my_center|LOCUS_00910 89454 89882 gene locus_tag LOCUS_00920 89454 89882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887283.1 protein_id gnl|my_center|LOCUS_00920 89879 90091 gene locus_tag LOCUS_00930 89879 90091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479506.1 protein_id gnl|my_center|LOCUS_00930 90084 90959 gene locus_tag LOCUS_00940 gene rsmI 90084 90959 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887281.1 protein_id gnl|my_center|LOCUS_00940 90963 92030 gene locus_tag LOCUS_00950 gene pfkA 90963 92030 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887280.1 protein_id gnl|my_center|LOCUS_00950 93165 92092 gene locus_tag LOCUS_00960 gene ftsZ 93165 92092 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887276.1 protein_id gnl|my_center|LOCUS_00960 94662 93346 gene locus_tag LOCUS_00970 94662 93346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 95243 94659 gene locus_tag LOCUS_00980 95243 94659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00980 96184 95297 gene locus_tag LOCUS_00990 96184 95297 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887273.1 protein_id gnl|my_center|LOCUS_00990 97626 96181 gene locus_tag LOCUS_01000 gene murC 97626 96181 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887272.1 protein_id gnl|my_center|LOCUS_01000 98801 97623 gene locus_tag LOCUS_01010 gene murG 98801 97623 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349463.1 protein_id gnl|my_center|LOCUS_01010 99702 98932 gene locus_tag LOCUS_01020 99702 98932 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887270.1 protein_id gnl|my_center|LOCUS_01020 99829 100776 gene locus_tag LOCUS_01030 99829 100776 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883974.1 protein_id gnl|my_center|LOCUS_01030 100786 101706 gene locus_tag LOCUS_01040 100786 101706 CDS product sucrase ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404642.1 protein_id gnl|my_center|LOCUS_01040 101737 102735 gene locus_tag LOCUS_01050 101737 102735 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883972.1 protein_id gnl|my_center|LOCUS_01050 102785 103711 gene locus_tag LOCUS_01060 gene yfmC 102785 103711 CDS product Fe(3+)-citrate ABC transporter substrate-binding protein YfmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243996.1 protein_id gnl|my_center|LOCUS_01060 103732 104757 gene locus_tag LOCUS_01070 103732 104757 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180970221.1 protein_id gnl|my_center|LOCUS_01070 104780 105589 gene locus_tag LOCUS_01080 104780 105589 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883970.1 protein_id gnl|my_center|LOCUS_01080 106797 105631 gene locus_tag LOCUS_01090 106797 105631 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887268.1 protein_id gnl|my_center|LOCUS_01090 107322 106843 gene locus_tag LOCUS_01100 107322 106843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 108001 107417 gene locus_tag LOCUS_01110 108001 107417 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887536.1 protein_id gnl|my_center|LOCUS_01110 109080 107998 gene locus_tag LOCUS_01120 109080 107998 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618860.1 protein_id gnl|my_center|LOCUS_01120 109900 109292 gene locus_tag LOCUS_01130 109900 109292 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391567.1 protein_id gnl|my_center|LOCUS_01130 111738 109915 gene locus_tag LOCUS_01140 gene lepA 111738 109915 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887788.1 protein_id gnl|my_center|LOCUS_01140 111828 112634 gene locus_tag LOCUS_01150 111828 112634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 113173 112631 gene locus_tag LOCUS_01160 113173 112631 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480299.1 protein_id gnl|my_center|LOCUS_01160 113838 113170 gene locus_tag LOCUS_01170 113838 113170 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888582.1 protein_id gnl|my_center|LOCUS_01170 114081 115274 gene locus_tag LOCUS_01180 114081 115274 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349636.1 protein_id gnl|my_center|LOCUS_01180 115483 117030 gene locus_tag LOCUS_01190 115483 117030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 117150 118595 gene locus_tag LOCUS_01200 117150 118595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 118592 119593 gene locus_tag LOCUS_01210 118592 119593 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887563.1 protein_id gnl|my_center|LOCUS_01210 119590 120702 gene locus_tag LOCUS_01220 119590 120702 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887564.1 protein_id gnl|my_center|LOCUS_01220 120708 120992 gene locus_tag LOCUS_01230 120708 120992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 122260 120989 gene locus_tag LOCUS_01240 122260 120989 CDS product lipid-A-disaccharide synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889249.1 protein_id gnl|my_center|LOCUS_01240 122296 122718 gene locus_tag LOCUS_01250 122296 122718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 123646 122795 gene locus_tag LOCUS_01260 123646 122795 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888075.1 protein_id gnl|my_center|LOCUS_01260 124610 123657 gene locus_tag LOCUS_01270 124610 123657 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618829.1 protein_id gnl|my_center|LOCUS_01270 126120 124855 gene locus_tag LOCUS_01280 126120 124855 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888077.1 protein_id gnl|my_center|LOCUS_01280 128171 126426 gene locus_tag LOCUS_01290 128171 126426 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888829.1 protein_id gnl|my_center|LOCUS_01290 128503 128168 gene locus_tag LOCUS_01300 128503 128168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 128991 128614 gene locus_tag LOCUS_01310 128991 128614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888623.1 protein_id gnl|my_center|LOCUS_01310 130079 128988 gene locus_tag LOCUS_01320 gene truD 130079 128988 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479835.1 protein_id gnl|my_center|LOCUS_01320 131052 130264 gene locus_tag LOCUS_01330 131052 130264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887936.1 protein_id gnl|my_center|LOCUS_01330 131795 131049 gene locus_tag LOCUS_01340 131795 131049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 132745 131867 gene locus_tag LOCUS_01350 132745 131867 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887731.1 protein_id gnl|my_center|LOCUS_01350 133845 132742 gene locus_tag LOCUS_01360 gene recF 133845 132742 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887732.1 protein_id gnl|my_center|LOCUS_01360 133974 134792 gene locus_tag LOCUS_01370 133974 134792 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085037.1 protein_id gnl|my_center|LOCUS_01370 134843 135631 gene locus_tag LOCUS_01380 134843 135631 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888036.1 protein_id gnl|my_center|LOCUS_01380 136622 135633 gene locus_tag LOCUS_01390 gene crtE 136622 135633 CDS product geranylgeranyl diphosphate synthase CrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888034.1 protein_id gnl|my_center|LOCUS_01390 137025 138146 gene locus_tag LOCUS_01400 137025 138146 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889319.1 protein_id gnl|my_center|LOCUS_01400 138715 138587 gene locus_tag LOCUS_01410 138715 138587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 139569 138835 gene locus_tag LOCUS_01420 139569 138835 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889173.1 protein_id gnl|my_center|LOCUS_01420 139875 139675 gene locus_tag LOCUS_01430 139875 139675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 140941 139901 gene locus_tag LOCUS_01440 140941 139901 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227788.1 protein_id gnl|my_center|LOCUS_01440 141998 141033 gene locus_tag LOCUS_01450 141998 141033 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887299.1 protein_id gnl|my_center|LOCUS_01450 142059 142364 gene locus_tag LOCUS_01460 142059 142364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887426.1 protein_id gnl|my_center|LOCUS_01460 142938 143606 gene locus_tag LOCUS_01470 142938 143606 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887427.1 protein_id gnl|my_center|LOCUS_01470 144305 143640 gene locus_tag LOCUS_01480 144305 143640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479787.1 protein_id gnl|my_center|LOCUS_01480 144550 145638 gene locus_tag LOCUS_01490 144550 145638 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888452.1 protein_id gnl|my_center|LOCUS_01490 145717 145893 gene locus_tag LOCUS_01500 145717 145893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 145890 146783 gene locus_tag LOCUS_01510 gene uvsE 145890 146783 CDS product UV DNA damage repair endonuclease UvsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350019.1 protein_id gnl|my_center|LOCUS_01510 147117 146791 gene locus_tag LOCUS_01520 147117 146791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 147181 147732 gene locus_tag LOCUS_01530 147181 147732 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618862.1 protein_id gnl|my_center|LOCUS_01530 148360 147710 gene locus_tag LOCUS_01540 148360 147710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888214.1 protein_id gnl|my_center|LOCUS_01540 148884 148369 gene locus_tag LOCUS_01550 148884 148369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 150461 149010 gene locus_tag LOCUS_01560 150461 149010 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889218.1 protein_id gnl|my_center|LOCUS_01560 151043 150543 gene locus_tag LOCUS_01570 151043 150543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480275.1 protein_id gnl|my_center|LOCUS_01570 151947 151045 gene locus_tag LOCUS_01580 151947 151045 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257820.1 protein_id gnl|my_center|LOCUS_01580 152389 151982 gene locus_tag LOCUS_01590 152389 151982 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204656.1 protein_id gnl|my_center|LOCUS_01590 153054 152386 gene locus_tag LOCUS_01600 153054 152386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275165.1 protein_id gnl|my_center|LOCUS_01600 153168 153611 gene locus_tag LOCUS_01610 gene soxR 153168 153611 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878334.1 protein_id gnl|my_center|LOCUS_01610 154470 153604 gene locus_tag LOCUS_01620 154470 153604 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028478.1 protein_id gnl|my_center|LOCUS_01620 154497 155039 gene locus_tag LOCUS_01630 154497 155039 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968485.1 protein_id gnl|my_center|LOCUS_01630 156091 155012 gene locus_tag LOCUS_01640 156091 155012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 156891 156214 gene locus_tag LOCUS_01650 156891 156214 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542425.1 protein_id gnl|my_center|LOCUS_01650 157412 156951 gene locus_tag LOCUS_01660 157412 156951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 158263 157595 gene locus_tag LOCUS_01670 158263 157595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 158542 159984 gene locus_tag LOCUS_01680 gene gatB 158542 159984 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480100.1 protein_id gnl|my_center|LOCUS_01680 159981 160625 gene locus_tag LOCUS_01690 159981 160625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889179.1 protein_id gnl|my_center|LOCUS_01690 162703 160628 gene locus_tag LOCUS_01700 162703 160628 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025567362.1 protein_id gnl|my_center|LOCUS_01700 164951 162915 gene locus_tag LOCUS_01710 164951 162915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 165036 165998 gene locus_tag LOCUS_01720 165036 165998 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889178.1 protein_id gnl|my_center|LOCUS_01720 165995 167026 gene locus_tag LOCUS_01730 gene mltG 165995 167026 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889177.1 protein_id gnl|my_center|LOCUS_01730 167066 167257 gene locus_tag LOCUS_01740 167066 167257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886695.1 protein_id gnl|my_center|LOCUS_01740 167254 168039 gene locus_tag LOCUS_01750 167254 168039 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886696.1 protein_id gnl|my_center|LOCUS_01750 168444 168046 gene locus_tag LOCUS_01760 168444 168046 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618816.1 protein_id gnl|my_center|LOCUS_01760 170177 168489 gene locus_tag LOCUS_01770 170177 168489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 171883 170240 gene locus_tag LOCUS_01780 171883 170240 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350668.1 protein_id gnl|my_center|LOCUS_01780 172752 171937 gene locus_tag LOCUS_01790 172752 171937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889129.1 protein_id gnl|my_center|LOCUS_01790 173535 172792 gene locus_tag LOCUS_01800 173535 172792 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887877.1 protein_id gnl|my_center|LOCUS_01800 173981 173532 gene locus_tag LOCUS_01810 173981 173532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 174442 173978 gene locus_tag LOCUS_01820 174442 173978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 176091 174487 gene locus_tag LOCUS_01830 176091 174487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 177206 176166 gene locus_tag LOCUS_01840 177206 176166 CDS product peptidase C39 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889130.1 protein_id gnl|my_center|LOCUS_01840 178290 177280 gene locus_tag LOCUS_01850 178290 177280 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480119.1 protein_id gnl|my_center|LOCUS_01850 180198 178516 gene locus_tag LOCUS_01860 180198 178516 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480118.1 protein_id gnl|my_center|LOCUS_01860 180531 180355 gene locus_tag LOCUS_01870 180531 180355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 180997 180575 gene locus_tag LOCUS_01880 gene ruvX 180997 180575 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889134.1 protein_id gnl|my_center|LOCUS_01880 181040 181825 gene locus_tag LOCUS_01890 181040 181825 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889135.1 protein_id gnl|my_center|LOCUS_01890 182424 181888 gene locus_tag LOCUS_01900 182424 181888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 182501 183694 gene locus_tag LOCUS_01910 182501 183694 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027597.1 protein_id gnl|my_center|LOCUS_01910 183742 184272 gene locus_tag LOCUS_01920 183742 184272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 184282 185283 gene locus_tag LOCUS_01930 184282 185283 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888504.1 protein_id gnl|my_center|LOCUS_01930 185364 186719 gene locus_tag LOCUS_01940 185364 186719 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886822.1 protein_id gnl|my_center|LOCUS_01940 186778 187377 gene locus_tag LOCUS_01950 gene rdgB 186778 187377 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886825.1 protein_id gnl|my_center|LOCUS_01950 187981 187457 gene locus_tag LOCUS_01960 187981 187457 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886862.1 protein_id gnl|my_center|LOCUS_01960 188066 188929 gene locus_tag LOCUS_01970 188066 188929 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886863.1 protein_id gnl|my_center|LOCUS_01970 190049 188994 gene locus_tag LOCUS_01980 190049 188994 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975879.1 protein_id gnl|my_center|LOCUS_01980 191520 190060 gene locus_tag LOCUS_01990 191520 190060 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349591.1 protein_id gnl|my_center|LOCUS_01990 192869 191550 gene locus_tag LOCUS_02000 192869 191550 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887834.1 protein_id gnl|my_center|LOCUS_02000 192966 193040 gene locus_tag LOCUS_t00020 192966 193040 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 193160 195034 gene locus_tag LOCUS_02010 193160 195034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 195529 195068 gene locus_tag LOCUS_02020 195529 195068 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392966.1 protein_id gnl|my_center|LOCUS_02020 196581 195589 gene locus_tag LOCUS_02030 196581 195589 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889322.1 protein_id gnl|my_center|LOCUS_02030 197321 196620 gene locus_tag LOCUS_02040 197321 196620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 198306 197440 gene locus_tag LOCUS_02050 198306 197440 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887476.1 protein_id gnl|my_center|LOCUS_02050 199553 198378 gene locus_tag LOCUS_02060 199553 198378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 199840 199658 gene locus_tag LOCUS_02070 199840 199658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 200318 199977 gene locus_tag LOCUS_02080 200318 199977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 201722 200532 gene locus_tag LOCUS_02090 201722 200532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 201613 202011 gene locus_tag LOCUS_02100 201613 202011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 202059 202331 gene locus_tag LOCUS_02110 202059 202331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 202510 205677 gene locus_tag LOCUS_02120 202510 205677 CDS product ExeM/NucH family extracellular endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884009.1 protein_id gnl|my_center|LOCUS_02120 205770 206525 gene locus_tag LOCUS_02130 205770 206525 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887189.1 protein_id gnl|my_center|LOCUS_02130 206522 206812 gene locus_tag LOCUS_02140 206522 206812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479532.1 protein_id gnl|my_center|LOCUS_02140 207031 209376 gene locus_tag LOCUS_02150 207031 209376 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480129.1 protein_id gnl|my_center|LOCUS_02150 209400 210575 gene locus_tag LOCUS_02160 209400 210575 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350610.1 protein_id gnl|my_center|LOCUS_02160 210568 211002 gene locus_tag LOCUS_02170 210568 211002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 211016 212215 gene locus_tag LOCUS_02180 211016 212215 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889105.1 protein_id gnl|my_center|LOCUS_02180 213151 212414 gene locus_tag LOCUS_02190 213151 212414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 214215 213352 gene locus_tag LOCUS_02200 214215 213352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 215103 214273 gene locus_tag LOCUS_02210 gene nadE 215103 214273 CDS product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889460.1 protein_id gnl|my_center|LOCUS_02210 215241 216674 gene locus_tag LOCUS_02220 gene pncB 215241 216674 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889531.1 protein_id gnl|my_center|LOCUS_02220 216769 217665 gene locus_tag LOCUS_02230 216769 217665 CDS product bifunctional nicotinamide-nucleotide adenylyltransferase/Nudix hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889532.1 protein_id gnl|my_center|LOCUS_02230 217904 217662 gene locus_tag LOCUS_02240 217904 217662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 218181 217906 gene locus_tag LOCUS_02250 218181 217906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 218247 219446 gene locus_tag LOCUS_02260 218247 219446 CDS product 23S rRNA (cytosine(2499)-C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886697.1 protein_id gnl|my_center|LOCUS_02260 219526 221460 gene locus_tag LOCUS_02270 219526 221460 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176758209.1 protein_id gnl|my_center|LOCUS_02270 221491 222189 gene locus_tag LOCUS_02280 221491 222189 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902869.1 protein_id gnl|my_center|LOCUS_02280 223197 222169 gene locus_tag LOCUS_02290 223197 222169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 223693 223202 gene locus_tag LOCUS_02300 223693 223202 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868112.1 protein_id gnl|my_center|LOCUS_02300 223692 224180 gene locus_tag LOCUS_02310 223692 224180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 225862 224225 gene locus_tag LOCUS_02320 gene pgi 225862 224225 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888377.1 protein_id gnl|my_center|LOCUS_02320 225996 226193 gene locus_tag LOCUS_02330 225996 226193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 226912 226262 gene locus_tag LOCUS_02340 226912 226262 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887724.1 protein_id gnl|my_center|LOCUS_02340 227171 227737 gene locus_tag LOCUS_02350 gene raiA 227171 227737 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887725.1 protein_id gnl|my_center|LOCUS_02350 227843 228925 gene locus_tag LOCUS_02360 227843 228925 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349597.1 protein_id gnl|my_center|LOCUS_02360 228927 229298 gene locus_tag LOCUS_02370 228927 229298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887764.1 protein_id gnl|my_center|LOCUS_02370 229451 231472 gene locus_tag LOCUS_02380 229451 231472 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349512.1 protein_id gnl|my_center|LOCUS_02380 231886 231476 gene locus_tag LOCUS_02390 231886 231476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 232308 232568 gene locus_tag LOCUS_02400 232308 232568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 234722 232683 gene locus_tag LOCUS_02410 234722 232683 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776694.1 protein_id gnl|my_center|LOCUS_02410 236458 234719 gene locus_tag LOCUS_02420 236458 234719 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227095.1 protein_id gnl|my_center|LOCUS_02420 236700 237713 gene locus_tag LOCUS_02430 236700 237713 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618830.1 protein_id gnl|my_center|LOCUS_02430 237914 238927 gene locus_tag LOCUS_02440 237914 238927 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177600.1 protein_id gnl|my_center|LOCUS_02440 238930 239319 gene locus_tag LOCUS_02450 238930 239319 CDS product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382894.1 protein_id gnl|my_center|LOCUS_02450 239331 240071 gene locus_tag LOCUS_02460 239331 240071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164994009.1 protein_id gnl|my_center|LOCUS_02460 240291 240956 gene locus_tag LOCUS_02470 240291 240956 CDS product peptidase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026982.1 protein_id gnl|my_center|LOCUS_02470 241560 241054 gene locus_tag LOCUS_02480 241560 241054 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480055.1 protein_id gnl|my_center|LOCUS_02480 241728 241652 gene locus_tag LOCUS_t00030 241728 241652 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 241920 242957 gene locus_tag LOCUS_02490 gene fni 241920 242957 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017870894.1 protein_id gnl|my_center|LOCUS_02490 243553 242954 gene locus_tag LOCUS_02500 gene ruvA 243553 242954 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887917.1 protein_id gnl|my_center|LOCUS_02500 243622 244227 gene locus_tag LOCUS_02510 243622 244227 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971767.1 protein_id gnl|my_center|LOCUS_02510 245526 244318 gene locus_tag LOCUS_02520 245526 244318 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972257.1 protein_id gnl|my_center|LOCUS_02520 245824 247818 gene locus_tag LOCUS_02530 gene metG 245824 247818 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888072.1 protein_id gnl|my_center|LOCUS_02530 247815 248702 gene locus_tag LOCUS_02540 gene rapZ 247815 248702 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888073.1 protein_id gnl|my_center|LOCUS_02540 248699 250045 gene locus_tag LOCUS_02550 248699 250045 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888074.1 protein_id gnl|my_center|LOCUS_02550 250113 251411 gene locus_tag LOCUS_02560 250113 251411 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888461.1 protein_id gnl|my_center|LOCUS_02560 252950 251859 gene locus_tag LOCUS_02570 252950 251859 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797323.1 protein_id gnl|my_center|LOCUS_02570 252840 253157 gene locus_tag LOCUS_02580 252840 253157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 255057 253165 gene locus_tag LOCUS_02590 gene dxs 255057 253165 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888114.1 protein_id gnl|my_center|LOCUS_02590 255746 255054 gene locus_tag LOCUS_02600 255746 255054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888113.1 protein_id gnl|my_center|LOCUS_02600 256552 255875 gene locus_tag LOCUS_02610 256552 255875 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888112.1 protein_id gnl|my_center|LOCUS_02610 257531 256725 gene locus_tag LOCUS_02620 257531 256725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177676.1 protein_id gnl|my_center|LOCUS_02620 257694 258353 gene locus_tag LOCUS_02630 257694 258353 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025567218.1 protein_id gnl|my_center|LOCUS_02630 258381 259271 gene locus_tag LOCUS_02640 gene purU 258381 259271 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887229.1 protein_id gnl|my_center|LOCUS_02640 259360 259827 gene locus_tag LOCUS_02650 259360 259827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 259896 260339 gene locus_tag LOCUS_02660 259896 260339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 261456 260329 gene locus_tag LOCUS_02670 261456 260329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 262511 261522 gene locus_tag LOCUS_02680 262511 261522 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479639.1 protein_id gnl|my_center|LOCUS_02680 262594 264735 gene locus_tag LOCUS_02690 262594 264735 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480226.1 protein_id gnl|my_center|LOCUS_02690 264708 265019 gene locus_tag LOCUS_02700 264708 265019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 265067 266248 gene locus_tag LOCUS_02710 265067 266248 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480052.1 protein_id gnl|my_center|LOCUS_02710 266290 267084 gene locus_tag LOCUS_02720 266290 267084 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480305.1 protein_id gnl|my_center|LOCUS_02720 267081 267707 gene locus_tag LOCUS_02730 gene tmk 267081 267707 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886759.1 protein_id gnl|my_center|LOCUS_02730 268575 267697 gene locus_tag LOCUS_02740 268575 267697 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886760.1 protein_id gnl|my_center|LOCUS_02740 269710 268613 gene locus_tag LOCUS_02750 gene queG 269710 268613 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480231.1 protein_id gnl|my_center|LOCUS_02750 270712 269768 gene locus_tag LOCUS_02760 270712 269768 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888235.1 protein_id gnl|my_center|LOCUS_02760 272525 270783 gene locus_tag LOCUS_02770 gene zwf 272525 270783 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888234.1 protein_id gnl|my_center|LOCUS_02770 273592 272522 gene locus_tag LOCUS_02780 gene gnd 273592 272522 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350162.1 protein_id gnl|my_center|LOCUS_02780 273778 274959 gene locus_tag LOCUS_02790 gene mqnC 273778 274959 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886712.1 protein_id gnl|my_center|LOCUS_02790 274937 275350 gene locus_tag LOCUS_02800 274937 275350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 275421 276383 gene locus_tag LOCUS_02810 gene cysK 275421 276383 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887435.1 protein_id gnl|my_center|LOCUS_02810 277173 276436 gene locus_tag LOCUS_02820 277173 276436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 277388 278194 gene locus_tag LOCUS_02830 277388 278194 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161617863.1 protein_id gnl|my_center|LOCUS_02830 278187 279014 gene locus_tag LOCUS_02840 278187 279014 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886850.1 protein_id gnl|my_center|LOCUS_02840 279117 280064 gene locus_tag LOCUS_02850 279117 280064 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350706.1 protein_id gnl|my_center|LOCUS_02850 280181 281143 gene locus_tag LOCUS_02860 280181 281143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 281176 281814 gene locus_tag LOCUS_02870 281176 281814 CDS product 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888705.1 protein_id gnl|my_center|LOCUS_02870 282521 281865 gene locus_tag LOCUS_02880 282521 281865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 282779 283312 gene locus_tag LOCUS_02890 282779 283312 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889277.1 protein_id gnl|my_center|LOCUS_02890 283309 283716 gene locus_tag LOCUS_02900 283309 283716 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140612.1 protein_id gnl|my_center|LOCUS_02900 284683 283730 gene locus_tag LOCUS_02910 gene meaB 284683 283730 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479640.1 protein_id gnl|my_center|LOCUS_02910 285041 284715 gene locus_tag LOCUS_02920 285041 284715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 285495 285055 gene locus_tag LOCUS_02930 285495 285055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 287642 285492 gene locus_tag LOCUS_02940 gene scpA 287642 285492 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887727.1 protein_id gnl|my_center|LOCUS_02940 287860 288504 gene locus_tag LOCUS_02950 287860 288504 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070683.1 protein_id gnl|my_center|LOCUS_02950 288606 289304 gene locus_tag LOCUS_02960 gene rpe 288606 289304 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480039.1 protein_id gnl|my_center|LOCUS_02960 289411 290124 gene locus_tag LOCUS_02970 289411 290124 CDS product 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888039.1 protein_id gnl|my_center|LOCUS_02970 290182 290676 gene locus_tag LOCUS_02980 290182 290676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 290732 292354 gene locus_tag LOCUS_02990 290732 292354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063653051.1 protein_id gnl|my_center|LOCUS_02990 292486 293706 gene locus_tag LOCUS_03000 gene nspC 292486 293706 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051056484.1 protein_id gnl|my_center|LOCUS_03000 295416 294136 gene locus_tag LOCUS_03010 295416 294136 CDS product DUF4384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479624.1 protein_id gnl|my_center|LOCUS_03010 296338 295562 gene locus_tag LOCUS_03020 296338 295562 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888267.1 protein_id gnl|my_center|LOCUS_03020 297358 296408 gene locus_tag LOCUS_03030 297358 296408 CDS product leishmanolysin-related zinc metalloendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618881.1 protein_id gnl|my_center|LOCUS_03030 297787 297990 gene locus_tag LOCUS_03040 297787 297990 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480233.1 protein_id gnl|my_center|LOCUS_03040 298087 298809 gene locus_tag LOCUS_03050 298087 298809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871581.1 protein_id gnl|my_center|LOCUS_03050 300093 298828 gene locus_tag LOCUS_03060 300093 298828 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029132.1 protein_id gnl|my_center|LOCUS_03060 300925 300086 gene locus_tag LOCUS_03070 300925 300086 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888010.1 protein_id gnl|my_center|LOCUS_03070 301563 300922 gene locus_tag LOCUS_03080 301563 300922 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888009.1 protein_id gnl|my_center|LOCUS_03080 301819 304476 gene locus_tag LOCUS_03090 301819 304476 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887024.1 protein_id gnl|my_center|LOCUS_03090 304590 306155 gene locus_tag LOCUS_03100 304590 306155 CDS product NFACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479527.1 protein_id gnl|my_center|LOCUS_03100 306252 307607 gene locus_tag LOCUS_03110 306252 307607 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887364.1 protein_id gnl|my_center|LOCUS_03110 308598 307663 gene locus_tag LOCUS_03120 308598 307663 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887373.1 protein_id gnl|my_center|LOCUS_03120 309403 308918 gene locus_tag LOCUS_03130 309403 308918 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886834.1 protein_id gnl|my_center|LOCUS_03130 309969 309403 gene locus_tag LOCUS_03140 309969 309403 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088247881.1 protein_id gnl|my_center|LOCUS_03140 311062 310028 gene locus_tag LOCUS_03150 311062 310028 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886988.1 protein_id gnl|my_center|LOCUS_03150 311547 311062 gene locus_tag LOCUS_03160 311547 311062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 312128 311547 gene locus_tag LOCUS_03170 312128 311547 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886835.1 protein_id gnl|my_center|LOCUS_03170 314150 312168 gene locus_tag LOCUS_03180 314150 312168 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886991.1 protein_id gnl|my_center|LOCUS_03180 314634 314161 gene locus_tag LOCUS_03190 gene ccmE 314634 314161 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228655.1 protein_id gnl|my_center|LOCUS_03190 314756 314631 gene locus_tag LOCUS_03200 314756 314631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 315468 314749 gene locus_tag LOCUS_03210 gene ccsA 315468 314749 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886993.1 protein_id gnl|my_center|LOCUS_03210 317490 315679 gene locus_tag LOCUS_03220 317490 315679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 317727 320120 gene locus_tag LOCUS_03230 317727 320120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228954.1 protein_id gnl|my_center|LOCUS_03230 320856 320155 gene locus_tag LOCUS_03240 320856 320155 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887052.1 protein_id gnl|my_center|LOCUS_03240 321497 320853 gene locus_tag LOCUS_03250 gene ccmA 321497 320853 CDS product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887051.1 protein_id gnl|my_center|LOCUS_03250 322177 321494 gene locus_tag LOCUS_03260 322177 321494 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887942.1 protein_id gnl|my_center|LOCUS_03260 322662 322237 gene locus_tag LOCUS_03270 322662 322237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 325138 322709 gene locus_tag LOCUS_03280 325138 322709 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177182973.1 protein_id gnl|my_center|LOCUS_03280 325547 325170 gene locus_tag LOCUS_03290 325547 325170 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888057.1 protein_id gnl|my_center|LOCUS_03290 326703 325609 gene locus_tag LOCUS_03300 326703 325609 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228826.1 protein_id gnl|my_center|LOCUS_03300 327447 326830 gene locus_tag LOCUS_03310 327447 326830 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888617.1 protein_id gnl|my_center|LOCUS_03310 327777 327559 gene locus_tag LOCUS_03320 gene rpmE 327777 327559 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887471.1 protein_id gnl|my_center|LOCUS_03320 328423 327860 gene locus_tag LOCUS_03330 328423 327860 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888592.1 protein_id gnl|my_center|LOCUS_03330 329424 328420 gene locus_tag LOCUS_03340 329424 328420 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888591.1 protein_id gnl|my_center|LOCUS_03340 329336 330031 gene locus_tag LOCUS_03350 329336 330031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 330237 330962 gene locus_tag LOCUS_03360 330237 330962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 331310 331618 gene locus_tag LOCUS_03370 331310 331618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 331615 334401 gene locus_tag LOCUS_03380 331615 334401 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886794.1 protein_id gnl|my_center|LOCUS_03380 334427 334963 gene locus_tag LOCUS_03390 334427 334963 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889092.1 protein_id gnl|my_center|LOCUS_03390 334960 335631 gene locus_tag LOCUS_03400 334960 335631 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889091.1 protein_id gnl|my_center|LOCUS_03400 336761 335622 gene locus_tag LOCUS_03410 336761 335622 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480170.1 protein_id gnl|my_center|LOCUS_03410 338496 336772 gene locus_tag LOCUS_03420 338496 336772 CDS product PASTA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886995.1 protein_id gnl|my_center|LOCUS_03420 338846 338550 gene locus_tag LOCUS_03430 338846 338550 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887279.1 protein_id gnl|my_center|LOCUS_03430 339547 338843 gene locus_tag LOCUS_03440 339547 338843 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887278.1 protein_id gnl|my_center|LOCUS_03440 340448 339600 gene locus_tag LOCUS_03450 340448 339600 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028257.1 protein_id gnl|my_center|LOCUS_03450 340518 341327 gene locus_tag LOCUS_03460 340518 341327 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350175.1 protein_id gnl|my_center|LOCUS_03460 342026 341331 gene locus_tag LOCUS_03470 342026 341331 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034351086.1 protein_id gnl|my_center|LOCUS_03470 342494 342240 gene locus_tag LOCUS_03480 342494 342240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 343263 342505 gene locus_tag LOCUS_03490 343263 342505 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480335.1 protein_id gnl|my_center|LOCUS_03490 343290 343757 gene locus_tag LOCUS_03500 343290 343757 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887593.1 protein_id gnl|my_center|LOCUS_03500 344917 343754 gene locus_tag LOCUS_03510 344917 343754 CDS product permease prefix domain 1-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888586.1 protein_id gnl|my_center|LOCUS_03510 345243 344914 gene locus_tag LOCUS_03520 345243 344914 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888587.1 protein_id gnl|my_center|LOCUS_03520 345376 346065 gene locus_tag LOCUS_03530 345376 346065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888589.1 protein_id gnl|my_center|LOCUS_03530 347250 346111 gene locus_tag LOCUS_03540 347250 346111 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887595.1 protein_id gnl|my_center|LOCUS_03540 348171 347467 gene locus_tag LOCUS_03550 348171 347467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 349189 348356 gene locus_tag LOCUS_03560 349189 348356 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385373.1 protein_id gnl|my_center|LOCUS_03560 350172 349186 gene locus_tag LOCUS_03570 350172 349186 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385369.1 protein_id gnl|my_center|LOCUS_03570 351053 350175 gene locus_tag LOCUS_03580 351053 350175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 352810 351140 gene locus_tag LOCUS_03590 352810 351140 CDS product methanol/ethanol family PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088960.1 protein_id gnl|my_center|LOCUS_03590 353489 352917 gene locus_tag LOCUS_03600 353489 352917 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088961.1 protein_id gnl|my_center|LOCUS_03600 354941 353796 gene locus_tag LOCUS_03610 354941 353796 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339152.1 protein_id gnl|my_center|LOCUS_03610 356269 355022 gene locus_tag LOCUS_03620 356269 355022 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119349.1 protein_id gnl|my_center|LOCUS_03620 356555 357526 gene locus_tag LOCUS_03630 356555 357526 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532064.1 protein_id gnl|my_center|LOCUS_03630 357552 358349 gene locus_tag LOCUS_03640 357552 358349 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969566.1 protein_id gnl|my_center|LOCUS_03640 358346 359086 gene locus_tag LOCUS_03650 358346 359086 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382989.1 protein_id gnl|my_center|LOCUS_03650 359083 359655 gene locus_tag LOCUS_03660 359083 359655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 359652 361121 gene locus_tag LOCUS_03670 359652 361121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 361118 362146 gene locus_tag LOCUS_03680 361118 362146 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385367.1 protein_id gnl|my_center|LOCUS_03680 362154 363029 gene locus_tag LOCUS_03690 362154 363029 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385368.1 protein_id gnl|my_center|LOCUS_03690 363040 366963 gene locus_tag LOCUS_03700 363040 366963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 367072 367560 gene locus_tag LOCUS_03710 367072 367560 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259306.1 protein_id gnl|my_center|LOCUS_03710 367658 370048 gene locus_tag LOCUS_03720 367658 370048 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388721.1 protein_id gnl|my_center|LOCUS_03720 370144 370938 gene locus_tag LOCUS_03730 370144 370938 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259304.1 protein_id gnl|my_center|LOCUS_03730 371991 371335 gene locus_tag LOCUS_03740 371991 371335 CDS product DUF1345 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479591.1 protein_id gnl|my_center|LOCUS_03740 372628 375756 gene locus_tag LOCUS_03750 372628 375756 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888171.1 protein_id gnl|my_center|LOCUS_03750 375813 376007 gene locus_tag LOCUS_03760 375813 376007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 376004 376192 gene locus_tag LOCUS_03770 376004 376192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 376244 376432 gene locus_tag LOCUS_03780 376244 376432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 377342 376740 gene locus_tag LOCUS_03790 377342 376740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 381742 377342 gene locus_tag LOCUS_03800 381742 377342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 382550 381801 gene locus_tag LOCUS_03810 382550 381801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 383279 382749 gene locus_tag LOCUS_03820 383279 382749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 384363 383365 gene locus_tag LOCUS_03830 384363 383365 CDS product alpha/beta fold hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887517.1 protein_id gnl|my_center|LOCUS_03830 385700 384360 gene locus_tag LOCUS_03840 385700 384360 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187767762.1 protein_id gnl|my_center|LOCUS_03840 386458 386039 gene locus_tag LOCUS_03850 386458 386039 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887511.1 protein_id gnl|my_center|LOCUS_03850 387140 386505 gene locus_tag LOCUS_03860 387140 386505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887510.1 protein_id gnl|my_center|LOCUS_03860 387880 387137 gene locus_tag LOCUS_03870 387880 387137 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349651.1 protein_id gnl|my_center|LOCUS_03870 387959 388627 gene locus_tag LOCUS_03880 387959 388627 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889187.1 protein_id gnl|my_center|LOCUS_03880 388701 389597 gene locus_tag LOCUS_03890 388701 389597 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177599.1 protein_id gnl|my_center|LOCUS_03890 389656 391326 gene locus_tag LOCUS_03900 gene crtI 389656 391326 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887507.1 protein_id gnl|my_center|LOCUS_03900 392513 391683 gene locus_tag LOCUS_03910 392513 391683 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028328024.1 protein_id gnl|my_center|LOCUS_03910 392591 393028 gene locus_tag LOCUS_03920 392591 393028 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479850.1 protein_id gnl|my_center|LOCUS_03920 393372 393100 gene locus_tag LOCUS_03930 393372 393100 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887574.1 protein_id gnl|my_center|LOCUS_03930 393615 403340 gene locus_tag LOCUS_03940 393615 403340 CDS product translocation/assembly module TamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618893.1 protein_id gnl|my_center|LOCUS_03940 403858 403403 gene locus_tag LOCUS_03950 403858 403403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034351008.1 protein_id gnl|my_center|LOCUS_03950 405968 403902 gene locus_tag LOCUS_03960 405968 403902 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479627.1 protein_id gnl|my_center|LOCUS_03960 406047 406934 gene locus_tag LOCUS_03970 406047 406934 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887743.1 protein_id gnl|my_center|LOCUS_03970 407993 406938 gene locus_tag LOCUS_03980 407993 406938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887741.1 protein_id gnl|my_center|LOCUS_03980 408369 408100 gene locus_tag LOCUS_03990 408369 408100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887245.1 protein_id gnl|my_center|LOCUS_03990 409305 408469 gene locus_tag LOCUS_04000 409305 408469 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887711.1 protein_id gnl|my_center|LOCUS_04000 409869 409318 gene locus_tag LOCUS_04010 409869 409318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 410247 409933 gene locus_tag LOCUS_04020 410247 409933 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887714.1 protein_id gnl|my_center|LOCUS_04020 411434 410253 gene locus_tag LOCUS_04030 411434 410253 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887715.1 protein_id gnl|my_center|LOCUS_04030 411524 412399 gene locus_tag LOCUS_04040 411524 412399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 412467 413804 gene locus_tag LOCUS_04050 gene ffh 412467 413804 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888471.1 protein_id gnl|my_center|LOCUS_04050 413872 413947 gene locus_tag LOCUS_t00040 413872 413947 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 413998 414189 gene locus_tag LOCUS_04060 413998 414189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 415586 414309 gene locus_tag LOCUS_04070 415586 414309 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887158.1 protein_id gnl|my_center|LOCUS_04070 415703 415939 gene locus_tag LOCUS_04080 415703 415939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 419509 415973 gene locus_tag LOCUS_04090 419509 415973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 420283 419927 gene locus_tag LOCUS_04100 420283 419927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 421444 420749 gene locus_tag LOCUS_04110 421444 420749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 421653 421444 gene locus_tag LOCUS_04120 421653 421444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 421805 422233 gene locus_tag LOCUS_04130 421805 422233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 422375 422527 gene locus_tag LOCUS_04140 422375 422527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 422733 423407 gene locus_tag LOCUS_04150 422733 423407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 423404 423676 gene locus_tag LOCUS_04160 423404 423676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 423673 424095 gene locus_tag LOCUS_04170 423673 424095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 424253 425128 gene locus_tag LOCUS_04180 424253 425128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 425193 426299 gene locus_tag LOCUS_04190 425193 426299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 426766 426302 gene locus_tag LOCUS_04200 426766 426302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 427280 426939 gene locus_tag LOCUS_04210 427280 426939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 427774 427277 gene locus_tag LOCUS_04220 427774 427277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 427947 427771 gene locus_tag LOCUS_04230 427947 427771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 428204 427944 gene locus_tag LOCUS_04240 428204 427944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 428395 428201 gene locus_tag LOCUS_04250 428395 428201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 428712 428416 gene locus_tag LOCUS_04260 428712 428416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 429000 428761 gene locus_tag LOCUS_04270 429000 428761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 429542 428997 gene locus_tag LOCUS_04280 429542 428997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 432967 429539 gene locus_tag LOCUS_04290 432967 429539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 433331 433077 gene locus_tag LOCUS_04300 433331 433077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 436446 434383 gene locus_tag LOCUS_04310 436446 434383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 437556 436558 gene locus_tag LOCUS_04320 437556 436558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 442114 437774 gene locus_tag LOCUS_04330 442114 437774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 442077 442358 gene locus_tag LOCUS_04340 442077 442358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 443521 443123 gene locus_tag LOCUS_04350 443521 443123 CDS product barstar family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887097.1 protein_id gnl|my_center|LOCUS_04350 443999 443535 gene locus_tag LOCUS_04360 443999 443535 CDS product ribonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871555.1 protein_id gnl|my_center|LOCUS_04360 444979 443993 gene locus_tag LOCUS_04370 444979 443993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 445883 445047 gene locus_tag LOCUS_04380 445883 445047 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887099.1 protein_id gnl|my_center|LOCUS_04380 445949 446758 gene locus_tag LOCUS_04390 445949 446758 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034360134.1 protein_id gnl|my_center|LOCUS_04390 446900 447652 gene locus_tag LOCUS_04400 gene rpsB 446900 447652 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888152.1 protein_id gnl|my_center|LOCUS_04400 447749 448543 gene locus_tag LOCUS_04410 gene tsf 447749 448543 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888151.1 protein_id gnl|my_center|LOCUS_04410 448659 449366 gene locus_tag LOCUS_04420 gene pyrH 448659 449366 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480220.1 protein_id gnl|my_center|LOCUS_04420 449452 450003 gene locus_tag LOCUS_04430 gene frr 449452 450003 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888149.1 protein_id gnl|my_center|LOCUS_04430 450242 451075 gene locus_tag LOCUS_04440 450242 451075 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480221.1 protein_id gnl|my_center|LOCUS_04440 451935 451090 gene locus_tag LOCUS_04450 451935 451090 CDS product leishmanolysin-related zinc metalloendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088772.1 protein_id gnl|my_center|LOCUS_04450 452025 453185 gene locus_tag LOCUS_04460 gene dxr 452025 453185 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888147.1 protein_id gnl|my_center|LOCUS_04460 453182 454300 gene locus_tag LOCUS_04470 453182 454300 CDS product RIP metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888146.1 protein_id gnl|my_center|LOCUS_04470 454873 454310 gene locus_tag LOCUS_04480 454873 454310 CDS product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480348.1 protein_id gnl|my_center|LOCUS_04480 456158 454992 gene locus_tag LOCUS_04490 456158 454992 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228579.1 protein_id gnl|my_center|LOCUS_04490 456325 457281 gene locus_tag LOCUS_04500 gene msrP 456325 457281 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889161.1 protein_id gnl|my_center|LOCUS_04500 457281 457955 gene locus_tag LOCUS_04510 457281 457955 CDS product sulfoxide reductase heme-binding subunit YedZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889162.1 protein_id gnl|my_center|LOCUS_04510 458000 458533 gene locus_tag LOCUS_04520 458000 458533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 458530 458982 gene locus_tag LOCUS_04530 458530 458982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 459854 458961 gene locus_tag LOCUS_04540 459854 458961 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228580.1 protein_id gnl|my_center|LOCUS_04540 460934 459879 gene locus_tag LOCUS_04550 460934 459879 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228581.1 protein_id gnl|my_center|LOCUS_04550 462478 460934 gene locus_tag LOCUS_04560 462478 460934 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228582.1 protein_id gnl|my_center|LOCUS_04560 462604 463269 gene locus_tag LOCUS_04570 462604 463269 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618820.1 protein_id gnl|my_center|LOCUS_04570 464553 463426 gene locus_tag LOCUS_04580 gene ssuD 464553 463426 CDS product FMNH2-dependent alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268305.1 protein_id gnl|my_center|LOCUS_04580 465455 464601 gene locus_tag LOCUS_04590 465455 464601 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314872.1 protein_id gnl|my_center|LOCUS_04590 466366 465452 gene locus_tag LOCUS_04600 466366 465452 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992469.1 protein_id gnl|my_center|LOCUS_04600 467612 466371 gene locus_tag LOCUS_04610 467612 466371 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972909.1 protein_id gnl|my_center|LOCUS_04610 467789 469588 gene locus_tag LOCUS_04620 467789 469588 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017872038.1 protein_id gnl|my_center|LOCUS_04620 471261 469648 gene locus_tag LOCUS_04630 471261 469648 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479947.1 protein_id gnl|my_center|LOCUS_04630 472129 471305 gene locus_tag LOCUS_04640 472129 471305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 472831 472175 gene locus_tag LOCUS_04650 472831 472175 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479948.1 protein_id gnl|my_center|LOCUS_04650 472864 473661 gene locus_tag LOCUS_04660 472864 473661 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888014.1 protein_id gnl|my_center|LOCUS_04660 474292 473693 gene locus_tag LOCUS_04670 474292 473693 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222865.1 protein_id gnl|my_center|LOCUS_04670 474375 474947 gene locus_tag LOCUS_04680 474375 474947 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887694.1 protein_id gnl|my_center|LOCUS_04680 475596 474934 gene locus_tag LOCUS_04690 475596 474934 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888088.1 protein_id gnl|my_center|LOCUS_04690 476005 475607 gene locus_tag LOCUS_04700 476005 475607 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888089.1 protein_id gnl|my_center|LOCUS_04700 476697 476002 gene locus_tag LOCUS_04710 476697 476002 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350459.1 protein_id gnl|my_center|LOCUS_04710 476746 477963 gene locus_tag LOCUS_04720 476746 477963 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888092.1 protein_id gnl|my_center|LOCUS_04720 478617 477970 gene locus_tag LOCUS_04730 gene hisG 478617 477970 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888084.1 protein_id gnl|my_center|LOCUS_04730 479765 478614 gene locus_tag LOCUS_04740 479765 478614 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888083.1 protein_id gnl|my_center|LOCUS_04740 479901 480476 gene locus_tag LOCUS_04750 479901 480476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887809.1 protein_id gnl|my_center|LOCUS_04750 480530 481120 gene locus_tag LOCUS_04760 480530 481120 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887810.1 protein_id gnl|my_center|LOCUS_04760 481168 481914 gene locus_tag LOCUS_04770 481168 481914 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165439355.1 protein_id gnl|my_center|LOCUS_04770 481911 482942 gene locus_tag LOCUS_04780 481911 482942 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888338.1 protein_id gnl|my_center|LOCUS_04780 482952 483545 gene locus_tag LOCUS_04790 482952 483545 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350207.1 protein_id gnl|my_center|LOCUS_04790 483550 484473 gene locus_tag LOCUS_04800 483550 484473 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350204.1 protein_id gnl|my_center|LOCUS_04800 485685 484543 gene locus_tag LOCUS_04810 gene mnmA 485685 484543 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480311.1 protein_id gnl|my_center|LOCUS_04810 485804 486946 gene locus_tag LOCUS_04820 gene lysA 485804 486946 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888393.1 protein_id gnl|my_center|LOCUS_04820 487643 487005 gene locus_tag LOCUS_04830 487643 487005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 487714 488343 gene locus_tag LOCUS_04840 487714 488343 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177694.1 protein_id gnl|my_center|LOCUS_04840 488517 489299 gene locus_tag LOCUS_04850 488517 489299 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480398.1 protein_id gnl|my_center|LOCUS_04850 489424 489681 gene locus_tag LOCUS_04860 489424 489681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 491025 489706 gene locus_tag LOCUS_04870 491025 489706 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888130.1 protein_id gnl|my_center|LOCUS_04870 491646 491104 gene locus_tag LOCUS_04880 491646 491104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 491752 492930 gene locus_tag LOCUS_04890 491752 492930 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618807.1 protein_id gnl|my_center|LOCUS_04890 492964 493638 gene locus_tag LOCUS_04900 492964 493638 CDS product TrmB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886653.1 protein_id gnl|my_center|LOCUS_04900 493719 493794 gene locus_tag LOCUS_t00050 493719 493794 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 495473 493851 gene locus_tag LOCUS_04910 495473 493851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 495596 495672 gene locus_tag LOCUS_t00060 495596 495672 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 496517 495708 gene locus_tag LOCUS_04920 496517 495708 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887375.1 protein_id gnl|my_center|LOCUS_04920 497585 496635 gene locus_tag LOCUS_04930 497585 496635 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887615.1 protein_id gnl|my_center|LOCUS_04930 498343 497582 gene locus_tag LOCUS_04940 498343 497582 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887616.1 protein_id gnl|my_center|LOCUS_04940 498543 499214 gene locus_tag LOCUS_04950 498543 499214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887617.1 protein_id gnl|my_center|LOCUS_04950 499635 499255 gene locus_tag LOCUS_04960 499635 499255 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887618.1 protein_id gnl|my_center|LOCUS_04960 499903 502140 gene locus_tag LOCUS_04970 499903 502140 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887760.1 protein_id gnl|my_center|LOCUS_04970 503353 502181 gene locus_tag LOCUS_04980 503353 502181 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888618.1 protein_id gnl|my_center|LOCUS_04980 503389 503676 gene locus_tag LOCUS_04990 503389 503676 CDS product DUF2087 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887747.1 protein_id gnl|my_center|LOCUS_04990 503639 505012 gene locus_tag LOCUS_05000 gene radA 503639 505012 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479626.1 protein_id gnl|my_center|LOCUS_05000 505894 505373 gene locus_tag LOCUS_05010 505894 505373 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197821.1 protein_id gnl|my_center|LOCUS_05010 506597 505887 gene locus_tag LOCUS_05020 506597 505887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 509169 506611 gene locus_tag LOCUS_05030 gene clpB 509169 506611 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479647.1 protein_id gnl|my_center|LOCUS_05030 510688 509705 gene locus_tag LOCUS_05040 510688 509705 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349612.1 protein_id gnl|my_center|LOCUS_05040 511519 510779 gene locus_tag LOCUS_05050 511519 510779 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887677.1 protein_id gnl|my_center|LOCUS_05050 512324 511512 gene locus_tag LOCUS_05060 512324 511512 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887678.1 protein_id gnl|my_center|LOCUS_05060 513952 512321 gene locus_tag LOCUS_05070 513952 512321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 514962 513949 gene locus_tag LOCUS_05080 514962 513949 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479651.1 protein_id gnl|my_center|LOCUS_05080 516312 515158 gene locus_tag LOCUS_05090 516312 515158 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869357.1 protein_id gnl|my_center|LOCUS_05090 517965 516601 gene locus_tag LOCUS_05100 517965 516601 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887096.1 protein_id gnl|my_center|LOCUS_05100 518343 520499 gene locus_tag LOCUS_05110 518343 520499 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480377.1 protein_id gnl|my_center|LOCUS_05110 520609 521415 gene locus_tag LOCUS_05120 520609 521415 CDS product AAC(3) family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480376.1 protein_id gnl|my_center|LOCUS_05120 522838 521480 gene locus_tag LOCUS_05130 522838 521480 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479549.1 protein_id gnl|my_center|LOCUS_05130 523658 523047 gene locus_tag LOCUS_05140 523658 523047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 526400 523965 gene locus_tag LOCUS_05150 gene gyrA 526400 523965 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888548.1 protein_id gnl|my_center|LOCUS_05150 527392 526727 gene locus_tag LOCUS_05160 527392 526727 CDS product peptidase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026982.1 protein_id gnl|my_center|LOCUS_05160 527552 527902 gene locus_tag LOCUS_05170 527552 527902 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887638.1 protein_id gnl|my_center|LOCUS_05170 527899 528237 gene locus_tag LOCUS_05180 527899 528237 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887637.1 protein_id gnl|my_center|LOCUS_05180 528240 528554 gene locus_tag LOCUS_05190 528240 528554 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887636.1 protein_id gnl|my_center|LOCUS_05190 528627 529625 gene locus_tag LOCUS_05200 gene hemB 528627 529625 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618813.1 protein_id gnl|my_center|LOCUS_05200 529622 530176 gene locus_tag LOCUS_05210 529622 530176 CDS product cyclin-dependent kinase inhibitor 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888792.1 protein_id gnl|my_center|LOCUS_05210 530173 530493 gene locus_tag LOCUS_05220 530173 530493 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258292.1 protein_id gnl|my_center|LOCUS_05220 530563 531072 gene locus_tag LOCUS_05230 530563 531072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887823.1 protein_id gnl|my_center|LOCUS_05230 532011 531232 gene locus_tag LOCUS_05240 532011 531232 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177613.1 protein_id gnl|my_center|LOCUS_05240 533792 532041 gene locus_tag LOCUS_05250 gene sdhA 533792 532041 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887597.1 protein_id gnl|my_center|LOCUS_05250 534187 533810 gene locus_tag LOCUS_05260 534187 533810 CDS product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887598.1 protein_id gnl|my_center|LOCUS_05260 534543 534187 gene locus_tag LOCUS_05270 gene sdhC 534543 534187 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887599.1 protein_id gnl|my_center|LOCUS_05270 534750 535094 gene locus_tag LOCUS_05280 534750 535094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 537628 535211 gene locus_tag LOCUS_05290 537628 535211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 538689 537724 gene locus_tag LOCUS_05300 538689 537724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 538952 540232 gene locus_tag LOCUS_05310 538952 540232 CDS product homoaconitate hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888413.1 protein_id gnl|my_center|LOCUS_05310 540243 540833 gene locus_tag LOCUS_05320 gene rhtC 540243 540833 CDS product threonine export protein RhtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703986.1 protein_id gnl|my_center|LOCUS_05320 540836 542077 gene locus_tag LOCUS_05330 540836 542077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888416.1 protein_id gnl|my_center|LOCUS_05330 542116 542682 gene locus_tag LOCUS_05340 542116 542682 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888419.1 protein_id gnl|my_center|LOCUS_05340 542675 543733 gene locus_tag LOCUS_05350 gene leuB 542675 543733 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888420.1 protein_id gnl|my_center|LOCUS_05350 544239 543784 gene locus_tag LOCUS_05360 544239 543784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 544909 544265 gene locus_tag LOCUS_05370 544909 544265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 545055 545237 gene locus_tag LOCUS_05380 545055 545237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 545756 545295 gene locus_tag LOCUS_05390 545756 545295 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480176.1 protein_id gnl|my_center|LOCUS_05390 546014 547441 gene locus_tag LOCUS_05400 546014 547441 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479718.1 protein_id gnl|my_center|LOCUS_05400 547456 547956 gene locus_tag LOCUS_05410 547456 547956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 547962 549323 gene locus_tag LOCUS_05420 547962 549323 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889289.1 protein_id gnl|my_center|LOCUS_05420 550220 549378 gene locus_tag LOCUS_05430 550220 549378 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887790.1 protein_id gnl|my_center|LOCUS_05430 551630 550278 gene locus_tag LOCUS_05440 551630 550278 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887635.1 protein_id gnl|my_center|LOCUS_05440 552553 551666 gene locus_tag LOCUS_05450 552553 551666 CDS product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888081.1 protein_id gnl|my_center|LOCUS_05450 553413 552610 gene locus_tag LOCUS_05460 553413 552610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 554323 553403 gene locus_tag LOCUS_05470 554323 553403 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258911.1 protein_id gnl|my_center|LOCUS_05470 554748 554293 gene locus_tag LOCUS_05480 554748 554293 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228322.1 protein_id gnl|my_center|LOCUS_05480 554847 556040 gene locus_tag LOCUS_05490 554847 556040 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479659.1 protein_id gnl|my_center|LOCUS_05490 557595 556099 gene locus_tag LOCUS_05500 557595 556099 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183192023.1 protein_id gnl|my_center|LOCUS_05500 558113 557595 gene locus_tag LOCUS_05510 558113 557595 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729642.1 protein_id gnl|my_center|LOCUS_05510 559161 558208 gene locus_tag LOCUS_05520 559161 558208 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966067.1 protein_id gnl|my_center|LOCUS_05520 559367 560980 gene locus_tag LOCUS_05530 559367 560980 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706287.1 protein_id gnl|my_center|LOCUS_05530 560977 561693 gene locus_tag LOCUS_05540 560977 561693 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030483.1 protein_id gnl|my_center|LOCUS_05540 561813 562856 gene locus_tag LOCUS_05550 561813 562856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889566.1 protein_id gnl|my_center|LOCUS_05550 563246 562866 gene locus_tag LOCUS_05560 563246 562866 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887782.1 protein_id gnl|my_center|LOCUS_05560 563659 563261 gene locus_tag LOCUS_05570 563659 563261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887783.1 protein_id gnl|my_center|LOCUS_05570 564578 563691 gene locus_tag LOCUS_05580 564578 563691 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350357.1 protein_id gnl|my_center|LOCUS_05580 564694 565923 gene locus_tag LOCUS_05590 564694 565923 CDS product lycopene cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887447.1 protein_id gnl|my_center|LOCUS_05590 565955 566620 gene locus_tag LOCUS_05600 gene sdaAB 565955 566620 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479548.1 protein_id gnl|my_center|LOCUS_05600 567353 566607 gene locus_tag LOCUS_05610 567353 566607 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889412.1 protein_id gnl|my_center|LOCUS_05610 568628 567363 gene locus_tag LOCUS_05620 568628 567363 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015207390.1 protein_id gnl|my_center|LOCUS_05620 569257 568625 gene locus_tag LOCUS_05630 569257 568625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 569461 571155 gene locus_tag LOCUS_05640 gene hutU 569461 571155 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889411.1 protein_id gnl|my_center|LOCUS_05640 571152 572063 gene locus_tag LOCUS_05650 571152 572063 CDS product arginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889409.1 protein_id gnl|my_center|LOCUS_05650 572056 573255 gene locus_tag LOCUS_05660 gene hutI 572056 573255 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889408.1 protein_id gnl|my_center|LOCUS_05660 573297 574799 gene locus_tag LOCUS_05670 gene hutH 573297 574799 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889407.1 protein_id gnl|my_center|LOCUS_05670 575109 575717 gene locus_tag LOCUS_05680 575109 575717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 575818 576705 gene locus_tag LOCUS_05690 gene sdaAA 575818 576705 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479580.1 protein_id gnl|my_center|LOCUS_05690 577424 576732 gene locus_tag LOCUS_05700 577424 576732 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888259.1 protein_id gnl|my_center|LOCUS_05700 577762 577421 gene locus_tag LOCUS_05710 577762 577421 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888258.1 protein_id gnl|my_center|LOCUS_05710 578013 578924 gene locus_tag LOCUS_05720 578013 578924 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107136145.1 protein_id gnl|my_center|LOCUS_05720 578997 580112 gene locus_tag LOCUS_05730 578997 580112 CDS product crosslink repair DNA glycosylase YcaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888703.1 protein_id gnl|my_center|LOCUS_05730 581068 580064 gene locus_tag LOCUS_05740 581068 580064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 581385 581083 gene locus_tag LOCUS_05750 581385 581083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 581406 582749 gene locus_tag LOCUS_05760 gene glmM 581406 582749 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888702.1 protein_id gnl|my_center|LOCUS_05760 582790 585552 gene locus_tag LOCUS_05770 gene polA 582790 585552 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034351289.1 protein_id gnl|my_center|LOCUS_05770 586901 586083 gene locus_tag LOCUS_05780 586901 586083 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927080.1 protein_id gnl|my_center|LOCUS_05780 588411 587191 gene locus_tag LOCUS_05790 588411 587191 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888498.1 protein_id gnl|my_center|LOCUS_05790 588500 589132 gene locus_tag LOCUS_05800 588500 589132 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888497.1 protein_id gnl|my_center|LOCUS_05800 589150 589659 gene locus_tag LOCUS_05810 gene scpB 589150 589659 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888496.1 protein_id gnl|my_center|LOCUS_05810 589771 590532 gene locus_tag LOCUS_05820 589771 590532 CDS product DUF4388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479797.1 protein_id gnl|my_center|LOCUS_05820 590579 592033 gene locus_tag LOCUS_05830 gene gatA 590579 592033 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888491.1 protein_id gnl|my_center|LOCUS_05830 595546 592064 gene locus_tag LOCUS_05840 595546 592064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 597224 595539 gene locus_tag LOCUS_05850 597224 595539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 598895 597522 gene locus_tag LOCUS_05860 598895 597522 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_05860 599354 598929 gene locus_tag LOCUS_05870 599354 598929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888341.1 protein_id gnl|my_center|LOCUS_05870 600291 599371 gene locus_tag LOCUS_05880 600291 599371 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256995.1 protein_id gnl|my_center|LOCUS_05880 601135 600284 gene locus_tag LOCUS_05890 601135 600284 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080851.1 protein_id gnl|my_center|LOCUS_05890 601546 601313 gene locus_tag LOCUS_05900 601546 601313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479851.1 protein_id gnl|my_center|LOCUS_05900 601717 603018 gene locus_tag LOCUS_05910 gene icd 601717 603018 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479852.1 protein_id gnl|my_center|LOCUS_05910 603088 603444 gene locus_tag LOCUS_05920 603088 603444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 603441 604211 gene locus_tag LOCUS_05930 603441 604211 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887728.1 protein_id gnl|my_center|LOCUS_05930 604280 604768 gene locus_tag LOCUS_05940 604280 604768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 604761 605171 gene locus_tag LOCUS_05950 604761 605171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 605241 605648 gene locus_tag LOCUS_05960 605241 605648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 605771 607303 gene locus_tag LOCUS_05970 605771 607303 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480009.1 protein_id gnl|my_center|LOCUS_05970 607396 608481 gene locus_tag LOCUS_05980 607396 608481 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162991727.1 protein_id gnl|my_center|LOCUS_05980 608562 609857 gene locus_tag LOCUS_05990 608562 609857 CDS product homoaconitate hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888248.1 protein_id gnl|my_center|LOCUS_05990 609857 610354 gene locus_tag LOCUS_06000 609857 610354 CDS product 3-isopropylmalate dehydratase small subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888252.1 protein_id gnl|my_center|LOCUS_06000 610376 610726 gene locus_tag LOCUS_06010 610376 610726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479920.1 protein_id gnl|my_center|LOCUS_06010 610783 610956 gene locus_tag LOCUS_06020 gene lysW 610783 610956 CDS product lysine biosynthesis protein LysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229005.1 protein_id gnl|my_center|LOCUS_06020 611034 611900 gene locus_tag LOCUS_06030 gene lysX 611034 611900 CDS product lysine biosynthesis protein LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479919.1 protein_id gnl|my_center|LOCUS_06030 611976 614219 gene locus_tag LOCUS_06040 611976 614219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 614309 615100 gene locus_tag LOCUS_06050 gene proC 614309 615100 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888161.1 protein_id gnl|my_center|LOCUS_06050 615227 615742 gene locus_tag LOCUS_06060 615227 615742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 616391 615750 gene locus_tag LOCUS_06070 616391 615750 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887723.1 protein_id gnl|my_center|LOCUS_06070 616483 618312 gene locus_tag LOCUS_06080 616483 618312 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889193.1 protein_id gnl|my_center|LOCUS_06080 619361 618405 gene locus_tag LOCUS_06090 619361 618405 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889194.1 protein_id gnl|my_center|LOCUS_06090 620492 619365 gene locus_tag LOCUS_06100 620492 619365 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177656.1 protein_id gnl|my_center|LOCUS_06100 621608 620499 gene locus_tag LOCUS_06110 621608 620499 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887765.1 protein_id gnl|my_center|LOCUS_06110 621764 622495 gene locus_tag LOCUS_06120 621764 622495 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888493.1 protein_id gnl|my_center|LOCUS_06120 622565 623140 gene locus_tag LOCUS_06130 gene msrA 622565 623140 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017870242.1 protein_id gnl|my_center|LOCUS_06130 623816 623142 gene locus_tag LOCUS_06140 623816 623142 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479800.1 protein_id gnl|my_center|LOCUS_06140 623930 625498 gene locus_tag LOCUS_06150 623930 625498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 625554 625994 gene locus_tag LOCUS_06160 625554 625994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888517.1 protein_id gnl|my_center|LOCUS_06160 625991 626338 gene locus_tag LOCUS_06170 625991 626338 CDS product RNHCP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888516.1 protein_id gnl|my_center|LOCUS_06170 626382 626555 gene locus_tag LOCUS_06180 626382 626555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 626552 627481 gene locus_tag LOCUS_06190 626552 627481 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888069.1 protein_id gnl|my_center|LOCUS_06190 627481 628728 gene locus_tag LOCUS_06200 gene purD 627481 628728 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480053.1 protein_id gnl|my_center|LOCUS_06200 628798 628879 gene locus_tag LOCUS_t00070 628798 628879 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 629048 629320 gene locus_tag LOCUS_06210 629048 629320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 630046 629399 gene locus_tag LOCUS_06220 630046 629399 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151451.1 protein_id gnl|my_center|LOCUS_06220 630490 630912 gene locus_tag LOCUS_06230 630490 630912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 631126 631338 gene locus_tag LOCUS_06240 631126 631338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 631845 633161 gene locus_tag LOCUS_06250 631845 633161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 633657 633415 gene locus_tag LOCUS_06260 633657 633415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 633550 634155 gene locus_tag LOCUS_06270 633550 634155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 634803 634228 gene locus_tag LOCUS_06280 634803 634228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 634911 635075 gene locus_tag LOCUS_06290 634911 635075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 635105 635527 gene locus_tag LOCUS_06300 635105 635527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 636697 635816 gene locus_tag LOCUS_06310 636697 635816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 637329 639632 gene locus_tag LOCUS_06320 637329 639632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 639869 639645 gene locus_tag LOCUS_06330 639869 639645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 640113 640343 gene locus_tag LOCUS_06340 gene secG 640113 640343 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479791.1 protein_id gnl|my_center|LOCUS_06340 640607 642364 gene locus_tag LOCUS_06350 640607 642364 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227959.1 protein_id gnl|my_center|LOCUS_06350 642444 643424 gene locus_tag LOCUS_06360 642444 643424 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024119337.1 protein_id gnl|my_center|LOCUS_06360 643448 644563 gene locus_tag LOCUS_06370 643448 644563 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888208.1 protein_id gnl|my_center|LOCUS_06370 644613 645659 gene locus_tag LOCUS_06380 644613 645659 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618802.1 protein_id gnl|my_center|LOCUS_06380 645656 646681 gene locus_tag LOCUS_06390 645656 646681 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888206.1 protein_id gnl|my_center|LOCUS_06390 646790 648076 gene locus_tag LOCUS_06400 646790 648076 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887614.1 protein_id gnl|my_center|LOCUS_06400 648969 648214 gene locus_tag LOCUS_06410 648969 648214 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887613.1 protein_id gnl|my_center|LOCUS_06410 652673 648966 gene locus_tag LOCUS_06420 gene metH 652673 648966 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887611.1 protein_id gnl|my_center|LOCUS_06420 655689 652957 gene locus_tag LOCUS_06430 655689 652957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 655772 655975 gene locus_tag LOCUS_06440 655772 655975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 655993 656523 gene locus_tag LOCUS_06450 655993 656523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162150129.1 protein_id gnl|my_center|LOCUS_06450 656620 657315 gene locus_tag LOCUS_06460 656620 657315 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887056.1 protein_id gnl|my_center|LOCUS_06460 657312 658250 gene locus_tag LOCUS_06470 657312 658250 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349507.1 protein_id gnl|my_center|LOCUS_06470 658297 658923 gene locus_tag LOCUS_06480 658297 658923 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479568.1 protein_id gnl|my_center|LOCUS_06480 658942 661434 gene locus_tag LOCUS_06490 gene hrpB 658942 661434 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887065.1 protein_id gnl|my_center|LOCUS_06490 662243 661458 gene locus_tag LOCUS_06500 662243 661458 CDS product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887067.1 protein_id gnl|my_center|LOCUS_06500 663063 662458 gene locus_tag LOCUS_06510 gene ddrA 663063 662458 CDS product single-stranded DNA-binding protein DdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887068.1 protein_id gnl|my_center|LOCUS_06510 664720 663182 gene locus_tag LOCUS_06520 664720 663182 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480084.1 protein_id gnl|my_center|LOCUS_06520 665040 665627 gene locus_tag LOCUS_06530 gene hisB 665040 665627 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479567.1 protein_id gnl|my_center|LOCUS_06530 665624 666247 gene locus_tag LOCUS_06540 gene hisH 665624 666247 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887071.1 protein_id gnl|my_center|LOCUS_06540 666318 667358 gene locus_tag LOCUS_06550 gene ilvE 666318 667358 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618798.1 protein_id gnl|my_center|LOCUS_06550 667506 669401 gene locus_tag LOCUS_06560 667506 669401 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888483.1 protein_id gnl|my_center|LOCUS_06560 669398 669664 gene locus_tag LOCUS_06570 669398 669664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 669821 670795 gene locus_tag LOCUS_06580 669821 670795 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350008.1 protein_id gnl|my_center|LOCUS_06580 670856 671410 gene locus_tag LOCUS_06590 670856 671410 CDS product DUF2271 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888428.1 protein_id gnl|my_center|LOCUS_06590 671388 672068 gene locus_tag LOCUS_06600 671388 672068 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888427.1 protein_id gnl|my_center|LOCUS_06600 672176 672946 gene locus_tag LOCUS_06610 672176 672946 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888038.1 protein_id gnl|my_center|LOCUS_06610 672997 674175 gene locus_tag LOCUS_06620 672997 674175 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337844.1 protein_id gnl|my_center|LOCUS_06620 674924 674325 gene locus_tag LOCUS_06630 674924 674325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887441.1 protein_id gnl|my_center|LOCUS_06630 675481 674921 gene locus_tag LOCUS_06640 675481 674921 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887442.1 protein_id gnl|my_center|LOCUS_06640 675919 675539 gene locus_tag LOCUS_06650 675919 675539 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888724.1 protein_id gnl|my_center|LOCUS_06650 676382 675924 gene locus_tag LOCUS_06660 gene ybeY 676382 675924 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479950.1 protein_id gnl|my_center|LOCUS_06660 677579 676509 gene locus_tag LOCUS_06670 677579 676509 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871086.1 protein_id gnl|my_center|LOCUS_06670 677899 678777 gene locus_tag LOCUS_06680 gene aroE 677899 678777 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081608222.1 protein_id gnl|my_center|LOCUS_06680 678828 682097 gene locus_tag LOCUS_06690 678828 682097 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479605.1 protein_id gnl|my_center|LOCUS_06690 682094 683296 gene locus_tag LOCUS_06700 682094 683296 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177602.1 protein_id gnl|my_center|LOCUS_06700 683344 683748 gene locus_tag LOCUS_06710 683344 683748 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887820.1 protein_id gnl|my_center|LOCUS_06710 686219 684108 gene locus_tag LOCUS_06720 686219 684108 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173259.1 protein_id gnl|my_center|LOCUS_06720 686752 686216 gene locus_tag LOCUS_06730 686752 686216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 687528 686749 gene locus_tag LOCUS_06740 687528 686749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 688157 687525 gene locus_tag LOCUS_06750 688157 687525 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887849.1 protein_id gnl|my_center|LOCUS_06750 688831 688157 gene locus_tag LOCUS_06760 gene deoC 688831 688157 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887848.1 protein_id gnl|my_center|LOCUS_06760 688935 689426 gene locus_tag LOCUS_06770 688935 689426 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887492.1 protein_id gnl|my_center|LOCUS_06770 689419 690123 gene locus_tag LOCUS_06780 gene rpiA 689419 690123 CDS product ribose 5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887491.1 protein_id gnl|my_center|LOCUS_06780 692259 690220 gene locus_tag LOCUS_06790 692259 690220 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479701.1 protein_id gnl|my_center|LOCUS_06790 692368 693285 gene locus_tag LOCUS_06800 692368 693285 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887489.1 protein_id gnl|my_center|LOCUS_06800 693332 694489 gene locus_tag LOCUS_06810 gene argJ 693332 694489 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888339.1 protein_id gnl|my_center|LOCUS_06810 694560 695300 gene locus_tag LOCUS_06820 694560 695300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889400.1 protein_id gnl|my_center|LOCUS_06820 695371 696117 gene locus_tag LOCUS_06830 695371 696117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 696534 696121 gene locus_tag LOCUS_06840 696534 696121 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350200.1 protein_id gnl|my_center|LOCUS_06840 696561 697493 gene locus_tag LOCUS_06850 gene miaA 696561 697493 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888325.1 protein_id gnl|my_center|LOCUS_06850 697730 698971 gene locus_tag LOCUS_06860 gene glgC 697730 698971 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479907.1 protein_id gnl|my_center|LOCUS_06860 700693 699047 gene locus_tag LOCUS_06870 700693 699047 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479602.1 protein_id gnl|my_center|LOCUS_06870 701586 700765 gene locus_tag LOCUS_06880 701586 700765 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349577.1 protein_id gnl|my_center|LOCUS_06880 701774 703006 gene locus_tag LOCUS_06890 701774 703006 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887831.1 protein_id gnl|my_center|LOCUS_06890 703146 704927 gene locus_tag LOCUS_06900 gene typA 703146 704927 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887841.1 protein_id gnl|my_center|LOCUS_06900 705991 705080 gene locus_tag LOCUS_06910 705991 705080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 706089 706658 gene locus_tag LOCUS_06920 706089 706658 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887825.1 protein_id gnl|my_center|LOCUS_06920 706704 707648 gene locus_tag LOCUS_06930 706704 707648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618789.1 protein_id gnl|my_center|LOCUS_06930 707707 709899 gene locus_tag LOCUS_06940 gene recQ 707707 709899 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887932.1 protein_id gnl|my_center|LOCUS_06940 711593 710088 gene locus_tag LOCUS_06950 711593 710088 CDS product S10 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197480502.1 protein_id gnl|my_center|LOCUS_06950 712469 711675 gene locus_tag LOCUS_06960 712469 711675 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887971.1 protein_id gnl|my_center|LOCUS_06960 713411 712530 gene locus_tag LOCUS_06970 713411 712530 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480019.1 protein_id gnl|my_center|LOCUS_06970 713456 713371 gene locus_tag LOCUS_t00080 713456 713371 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 714191 713487 gene locus_tag LOCUS_06980 714191 713487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480215.1 protein_id gnl|my_center|LOCUS_06980 714372 717245 gene locus_tag LOCUS_06990 714372 717245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887844.1 protein_id gnl|my_center|LOCUS_06990 717252 717650 gene locus_tag LOCUS_07000 717252 717650 CDS product DUF3208 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888787.1 protein_id gnl|my_center|LOCUS_07000 717658 717855 gene locus_tag LOCUS_07010 717658 717855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888788.1 protein_id gnl|my_center|LOCUS_07010 717852 718412 gene locus_tag LOCUS_07020 717852 718412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 719278 718427 gene locus_tag LOCUS_07030 719278 718427 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887095.1 protein_id gnl|my_center|LOCUS_07030 719518 719288 gene locus_tag LOCUS_07040 719518 719288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479999.1 protein_id gnl|my_center|LOCUS_07040 719565 720191 gene locus_tag LOCUS_07050 719565 720191 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888320.1 protein_id gnl|my_center|LOCUS_07050 720203 720439 gene locus_tag LOCUS_07060 720203 720439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 720436 720930 gene locus_tag LOCUS_07070 720436 720930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 720934 721881 gene locus_tag LOCUS_07080 gene gluQRS 720934 721881 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888322.1 protein_id gnl|my_center|LOCUS_07080 721941 723182 gene locus_tag LOCUS_07090 gene trpB 721941 723182 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349629.1 protein_id gnl|my_center|LOCUS_07090 723179 723982 gene locus_tag LOCUS_07100 gene trpA 723179 723982 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887587.1 protein_id gnl|my_center|LOCUS_07100 725264 724041 gene locus_tag LOCUS_07110 725264 724041 CDS product sugar efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887964.1 protein_id gnl|my_center|LOCUS_07110 725353 727191 gene locus_tag LOCUS_07120 gene pepF 725353 727191 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888264.1 protein_id gnl|my_center|LOCUS_07120 727822 727355 gene locus_tag LOCUS_07130 727822 727355 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480199.1 protein_id gnl|my_center|LOCUS_07130 728490 727951 gene locus_tag LOCUS_07140 728490 727951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 729536 728487 gene locus_tag LOCUS_07150 729536 728487 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887889.1 protein_id gnl|my_center|LOCUS_07150 729725 730888 gene locus_tag LOCUS_07160 gene sucC 729725 730888 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887890.1 protein_id gnl|my_center|LOCUS_07160 730888 731793 gene locus_tag LOCUS_07170 gene sucD 730888 731793 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887891.1 protein_id gnl|my_center|LOCUS_07170 731916 732482 gene locus_tag LOCUS_07180 731916 732482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887892.1 protein_id gnl|my_center|LOCUS_07180 733727 732606 gene locus_tag LOCUS_07190 gene bshA 733727 732606 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618804.1 protein_id gnl|my_center|LOCUS_07190 733919 734761 gene locus_tag LOCUS_07200 733919 734761 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063653047.1 protein_id gnl|my_center|LOCUS_07200 738015 734815 gene locus_tag LOCUS_07210 gene ileS 738015 734815 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228416.1 protein_id gnl|my_center|LOCUS_07210 737951 738181 gene locus_tag LOCUS_07220 737951 738181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 738604 739881 gene locus_tag LOCUS_07230 gene rho 738604 739881 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869108.1 protein_id gnl|my_center|LOCUS_07230 739940 741304 gene locus_tag LOCUS_07240 739940 741304 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228133.1 protein_id gnl|my_center|LOCUS_07240 741301 741702 gene locus_tag LOCUS_07250 741301 741702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 741764 742654 gene locus_tag LOCUS_07260 gene pdxS 741764 742654 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480030.1 protein_id gnl|my_center|LOCUS_07260 742665 743258 gene locus_tag LOCUS_07270 gene pdxT 742665 743258 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888007.1 protein_id gnl|my_center|LOCUS_07270 743371 744111 gene locus_tag LOCUS_07280 743371 744111 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887993.1 protein_id gnl|my_center|LOCUS_07280 744108 744854 gene locus_tag LOCUS_07290 744108 744854 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887992.1 protein_id gnl|my_center|LOCUS_07290 746678 744942 gene locus_tag LOCUS_07300 gene aspS 746678 744942 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480025.1 protein_id gnl|my_center|LOCUS_07300 748015 746675 gene locus_tag LOCUS_07310 gene hisS 748015 746675 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887990.1 protein_id gnl|my_center|LOCUS_07310 748540 748124 gene locus_tag LOCUS_07320 748540 748124 CDS product IPT/TIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480028.1 protein_id gnl|my_center|LOCUS_07320 748539 749531 gene locus_tag LOCUS_07330 748539 749531 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888004.1 protein_id gnl|my_center|LOCUS_07330 749726 750694 gene locus_tag LOCUS_07340 749726 750694 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479751.1 protein_id gnl|my_center|LOCUS_07340 752177 750702 gene locus_tag LOCUS_07350 gene lnt 752177 750702 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350439.1 protein_id gnl|my_center|LOCUS_07350 752232 752936 gene locus_tag LOCUS_07360 752232 752936 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888001.1 protein_id gnl|my_center|LOCUS_07360 754169 753000 gene locus_tag LOCUS_07370 754169 753000 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350436.1 protein_id gnl|my_center|LOCUS_07370 754358 755068 gene locus_tag LOCUS_07380 754358 755068 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887985.1 protein_id gnl|my_center|LOCUS_07380 755065 756054 gene locus_tag LOCUS_07390 755065 756054 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480024.1 protein_id gnl|my_center|LOCUS_07390 756116 756982 gene locus_tag LOCUS_07400 756116 756982 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480027.1 protein_id gnl|my_center|LOCUS_07400 756979 757998 gene locus_tag LOCUS_07410 756979 757998 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903344.1 protein_id gnl|my_center|LOCUS_07410 757995 759200 gene locus_tag LOCUS_07420 757995 759200 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177705.1 protein_id gnl|my_center|LOCUS_07420 759294 761198 gene locus_tag LOCUS_07430 gene uvrC 759294 761198 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887995.1 protein_id gnl|my_center|LOCUS_07430 761274 761438 gene locus_tag LOCUS_07440 761274 761438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 761646 762380 gene locus_tag LOCUS_07450 761646 762380 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887996.1 protein_id gnl|my_center|LOCUS_07450 763776 762364 gene locus_tag LOCUS_07460 763776 762364 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888006.1 protein_id gnl|my_center|LOCUS_07460 764001 764993 gene locus_tag LOCUS_07470 gene gap 764001 764993 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887984.1 protein_id gnl|my_center|LOCUS_07470 765058 766248 gene locus_tag LOCUS_07480 765058 766248 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480023.1 protein_id gnl|my_center|LOCUS_07480 766245 766982 gene locus_tag LOCUS_07490 gene tpiA 766245 766982 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480022.1 protein_id gnl|my_center|LOCUS_07490 767123 768466 gene locus_tag LOCUS_07500 gene asnS 767123 768466 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480195.1 protein_id gnl|my_center|LOCUS_07500 769491 768586 gene locus_tag LOCUS_07510 769491 768586 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026138789.1 protein_id gnl|my_center|LOCUS_07510 770679 769543 gene locus_tag LOCUS_07520 gene wecB 770679 769543 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350154.1 protein_id gnl|my_center|LOCUS_07520 771821 770676 gene locus_tag LOCUS_07530 771821 770676 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888201.1 protein_id gnl|my_center|LOCUS_07530 772499 771876 gene locus_tag LOCUS_07540 gene upp 772499 771876 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479860.1 protein_id gnl|my_center|LOCUS_07540 773361 772522 gene locus_tag LOCUS_07550 773361 772522 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888203.1 protein_id gnl|my_center|LOCUS_07550 774403 773396 gene locus_tag LOCUS_07560 774403 773396 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479861.1 protein_id gnl|my_center|LOCUS_07560 774432 775175 gene locus_tag LOCUS_07570 774432 775175 CDS product zinc/iron-chelating domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941567.1 protein_id gnl|my_center|LOCUS_07570 775718 775203 gene locus_tag LOCUS_07580 775718 775203 CDS product metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479804.1 protein_id gnl|my_center|LOCUS_07580 775829 777919 gene locus_tag LOCUS_07590 775829 777919 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350148.1 protein_id gnl|my_center|LOCUS_07590 778934 777930 gene locus_tag LOCUS_07600 778934 777930 CDS product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869284.1 protein_id gnl|my_center|LOCUS_07600 779281 780621 gene locus_tag LOCUS_07610 779281 780621 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888807.1 protein_id gnl|my_center|LOCUS_07610 780618 781067 gene locus_tag LOCUS_07620 gene cdd 780618 781067 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888808.1 protein_id gnl|my_center|LOCUS_07620 782457 781147 gene locus_tag LOCUS_07630 gene aceA 782457 781147 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479968.1 protein_id gnl|my_center|LOCUS_07630 783343 782726 gene locus_tag LOCUS_07640 783343 782726 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887473.1 protein_id gnl|my_center|LOCUS_07640 784068 783406 gene locus_tag LOCUS_07650 784068 783406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 784141 785151 gene locus_tag LOCUS_07660 784141 785151 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887472.1 protein_id gnl|my_center|LOCUS_07660 786309 785152 gene locus_tag LOCUS_07670 786309 785152 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888618.1 protein_id gnl|my_center|LOCUS_07670 787159 786314 gene locus_tag LOCUS_07680 787159 786314 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888619.1 protein_id gnl|my_center|LOCUS_07680 790401 787183 gene locus_tag LOCUS_07690 790401 787183 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480098.1 protein_id gnl|my_center|LOCUS_07690 790642 791667 gene locus_tag LOCUS_07700 790642 791667 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887814.1 protein_id gnl|my_center|LOCUS_07700 791756 792892 gene locus_tag LOCUS_07710 791756 792892 CDS product VWA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887812.1 protein_id gnl|my_center|LOCUS_07710 792889 793740 gene locus_tag LOCUS_07720 gene nudC 792889 793740 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887811.1 protein_id gnl|my_center|LOCUS_07720 793737 795134 gene locus_tag LOCUS_07730 793737 795134 CDS product DUF2336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480344.1 protein_id gnl|my_center|LOCUS_07730 795131 795592 gene locus_tag LOCUS_07740 795131 795592 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034351108.1 protein_id gnl|my_center|LOCUS_07740 795589 795846 gene locus_tag LOCUS_07750 795589 795846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 798151 795929 gene locus_tag LOCUS_07760 798151 795929 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888410.1 protein_id gnl|my_center|LOCUS_07760 798253 799152 gene locus_tag LOCUS_07770 798253 799152 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350720.1 protein_id gnl|my_center|LOCUS_07770 799274 802336 gene locus_tag LOCUS_07780 gene fdhF 799274 802336 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245240.1 protein_id gnl|my_center|LOCUS_07780 802359 802862 gene locus_tag LOCUS_07790 802359 802862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 802880 803671 gene locus_tag LOCUS_07800 gene fdhD 802880 803671 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776960.1 protein_id gnl|my_center|LOCUS_07800 804577 803732 gene locus_tag LOCUS_07810 804577 803732 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887968.1 protein_id gnl|my_center|LOCUS_07810 804636 805151 gene locus_tag LOCUS_07820 804636 805151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480045.1 protein_id gnl|my_center|LOCUS_07820 806652 805192 gene locus_tag LOCUS_07830 806652 805192 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350448.1 protein_id gnl|my_center|LOCUS_07830 806956 806663 gene locus_tag LOCUS_07840 806956 806663 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887215.1 protein_id gnl|my_center|LOCUS_07840 807053 807331 gene locus_tag LOCUS_07850 807053 807331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 807331 807690 gene locus_tag LOCUS_07860 807331 807690 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479928.1 protein_id gnl|my_center|LOCUS_07860 808468 807785 gene locus_tag LOCUS_07870 808468 807785 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886840.1 protein_id gnl|my_center|LOCUS_07870 808885 808589 gene locus_tag LOCUS_07880 808885 808589 CDS product stage V sporulation protein S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008630673.1 protein_id gnl|my_center|LOCUS_07880 809102 809644 gene locus_tag LOCUS_07890 809102 809644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350419.1 protein_id gnl|my_center|LOCUS_07890 810315 809650 gene locus_tag LOCUS_07900 810315 809650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 811089 810328 gene locus_tag LOCUS_07910 gene map 811089 810328 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480012.1 protein_id gnl|my_center|LOCUS_07910 811152 812021 gene locus_tag LOCUS_07920 811152 812021 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888478.1 protein_id gnl|my_center|LOCUS_07920 812050 812460 gene locus_tag LOCUS_07930 812050 812460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888477.1 protein_id gnl|my_center|LOCUS_07930 812582 812917 gene locus_tag LOCUS_07940 812582 812917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 813368 812928 gene locus_tag LOCUS_07950 813368 812928 CDS product DUF4259 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887029.1 protein_id gnl|my_center|LOCUS_07950 814971 813748 gene locus_tag LOCUS_07960 gene ispG 814971 813748 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887031.1 protein_id gnl|my_center|LOCUS_07960 815588 815004 gene locus_tag LOCUS_07970 815588 815004 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221284040.1 protein_id gnl|my_center|LOCUS_07970 815635 815988 gene locus_tag LOCUS_07980 815635 815988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 815985 816725 gene locus_tag LOCUS_07990 815985 816725 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231294.1 protein_id gnl|my_center|LOCUS_07990 817515 816763 gene locus_tag LOCUS_08000 817515 816763 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089217.1 protein_id gnl|my_center|LOCUS_08000 818409 817612 gene locus_tag LOCUS_08010 818409 817612 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085709.1 protein_id gnl|my_center|LOCUS_08010 819413 818406 gene locus_tag LOCUS_08020 819413 818406 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942650.1 protein_id gnl|my_center|LOCUS_08020 820297 819410 gene locus_tag LOCUS_08030 820297 819410 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 protein_id gnl|my_center|LOCUS_08030 821486 820332 gene locus_tag LOCUS_08040 821486 820332 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_08040 822704 821544 gene locus_tag LOCUS_08050 822704 821544 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942648.1 protein_id gnl|my_center|LOCUS_08050 823401 822754 gene locus_tag LOCUS_08060 823401 822754 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267425.1 protein_id gnl|my_center|LOCUS_08060 823614 825473 gene locus_tag LOCUS_08070 823614 825473 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350387.1 protein_id gnl|my_center|LOCUS_08070 825506 825895 gene locus_tag LOCUS_08080 825506 825895 CDS product NADH-quinone oxidoreductase subunit 15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480001.1 protein_id gnl|my_center|LOCUS_08080 826408 825947 gene locus_tag LOCUS_08090 826408 825947 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888697.1 protein_id gnl|my_center|LOCUS_08090 827276 826392 gene locus_tag LOCUS_08100 827276 826392 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228455.1 protein_id gnl|my_center|LOCUS_08100 827758 827273 gene locus_tag LOCUS_08110 gene nusB 827758 827273 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888698.1 protein_id gnl|my_center|LOCUS_08110 828105 827755 gene locus_tag LOCUS_08120 828105 827755 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888699.1 protein_id gnl|my_center|LOCUS_08120 830232 828142 gene locus_tag LOCUS_08130 gene ligA 830232 828142 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871048.1 protein_id gnl|my_center|LOCUS_08130 830413 831510 gene locus_tag LOCUS_08140 830413 831510 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479956.1 protein_id gnl|my_center|LOCUS_08140 831643 832071 gene locus_tag LOCUS_08150 831643 832071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 833119 832088 gene locus_tag LOCUS_08160 833119 832088 CDS product protease complex subunit PrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888260.1 protein_id gnl|my_center|LOCUS_08160 834992 833220 gene locus_tag LOCUS_08170 gene recN 834992 833220 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888116.1 protein_id gnl|my_center|LOCUS_08170 835071 836162 gene locus_tag LOCUS_08180 835071 836162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 836506 838092 gene locus_tag LOCUS_08190 gene pckA 836506 838092 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234944679.1 protein_id gnl|my_center|LOCUS_08190 838233 838430 gene locus_tag LOCUS_08200 838233 838430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 839867 838485 gene locus_tag LOCUS_08210 839867 838485 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887208.1 protein_id gnl|my_center|LOCUS_08210 841273 839864 gene locus_tag LOCUS_08220 841273 839864 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887207.1 protein_id gnl|my_center|LOCUS_08220 842664 841483 gene locus_tag LOCUS_08230 842664 841483 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887206.1 protein_id gnl|my_center|LOCUS_08230 842846 842661 gene locus_tag LOCUS_08240 842846 842661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 842952 844199 gene locus_tag LOCUS_08250 842952 844199 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350283.1 protein_id gnl|my_center|LOCUS_08250 844258 845526 gene locus_tag LOCUS_08260 844258 845526 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479925.1 protein_id gnl|my_center|LOCUS_08260 846230 845523 gene locus_tag LOCUS_08270 gene deoD 846230 845523 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479926.1 protein_id gnl|my_center|LOCUS_08270 847446 846259 gene locus_tag LOCUS_08280 847446 846259 CDS product serine-tRNA(Ala) deacylase AlaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349482.1 protein_id gnl|my_center|LOCUS_08280 847516 848328 gene locus_tag LOCUS_08290 847516 848328 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888160.1 protein_id gnl|my_center|LOCUS_08290 848483 849199 gene locus_tag LOCUS_08300 848483 849199 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480216.1 protein_id gnl|my_center|LOCUS_08300 849949 849206 gene locus_tag LOCUS_08310 gene recO 849949 849206 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887465.1 protein_id gnl|my_center|LOCUS_08310 850033 850434 gene locus_tag LOCUS_08320 850033 850434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 850551 851033 gene locus_tag LOCUS_08330 850551 851033 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887462.1 protein_id gnl|my_center|LOCUS_08330 851092 851745 gene locus_tag LOCUS_08340 851092 851745 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618822.1 protein_id gnl|my_center|LOCUS_08340 851742 852674 gene locus_tag LOCUS_08350 851742 852674 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887460.1 protein_id gnl|my_center|LOCUS_08350 852755 854326 gene locus_tag LOCUS_08360 gene pruA 852755 854326 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887459.1 protein_id gnl|my_center|LOCUS_08360 854714 856456 gene locus_tag LOCUS_08370 854714 856456 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887458.1 protein_id gnl|my_center|LOCUS_08370 857845 856499 gene locus_tag LOCUS_08380 857845 856499 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161617985.1 protein_id gnl|my_center|LOCUS_08380 858739 857849 gene locus_tag LOCUS_08390 858739 857849 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479973.1 protein_id gnl|my_center|LOCUS_08390 858847 859767 gene locus_tag LOCUS_08400 gene carH 858847 859767 CDS product HTH-type transcriptional repressor CarH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229194.1 protein_id gnl|my_center|LOCUS_08400 859764 860663 gene locus_tag LOCUS_08410 859764 860663 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479830.1 protein_id gnl|my_center|LOCUS_08410 861191 860643 gene locus_tag LOCUS_08420 861191 860643 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479526.1 protein_id gnl|my_center|LOCUS_08420 861718 861188 gene locus_tag LOCUS_08430 861718 861188 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887523.1 protein_id gnl|my_center|LOCUS_08430 863145 861757 gene locus_tag LOCUS_08440 863145 861757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 863305 863763 gene locus_tag LOCUS_08450 863305 863763 CDS product DUF4395 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258477.1 protein_id gnl|my_center|LOCUS_08450 863776 865362 gene locus_tag LOCUS_08460 863776 865362 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479711.1 protein_id gnl|my_center|LOCUS_08460 865359 865898 gene locus_tag LOCUS_08470 gene cysC 865359 865898 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479712.1 protein_id gnl|my_center|LOCUS_08470 865895 866614 gene locus_tag LOCUS_08480 865895 866614 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349823.1 protein_id gnl|my_center|LOCUS_08480 866707 867876 gene locus_tag LOCUS_08490 gene sat 866707 867876 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889276.1 protein_id gnl|my_center|LOCUS_08490 868000 868983 gene locus_tag LOCUS_08500 868000 868983 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887920.1 protein_id gnl|my_center|LOCUS_08500 868988 869827 gene locus_tag LOCUS_08510 868988 869827 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888827.1 protein_id gnl|my_center|LOCUS_08510 869824 870600 gene locus_tag LOCUS_08520 869824 870600 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888828.1 protein_id gnl|my_center|LOCUS_08520 870736 871866 gene locus_tag LOCUS_08530 870736 871866 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797323.1 protein_id gnl|my_center|LOCUS_08530 873341 871926 gene locus_tag LOCUS_08540 873341 871926 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887438.1 protein_id gnl|my_center|LOCUS_08540 874258 873398 gene locus_tag LOCUS_08550 874258 873398 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479789.1 protein_id gnl|my_center|LOCUS_08550 874580 874269 gene locus_tag LOCUS_08560 874580 874269 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888479.1 protein_id gnl|my_center|LOCUS_08560 875117 874590 gene locus_tag LOCUS_08570 gene yjjX 875117 874590 CDS product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261320.1 protein_id gnl|my_center|LOCUS_08570 875553 875128 gene locus_tag LOCUS_08580 875553 875128 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887054.1 protein_id gnl|my_center|LOCUS_08580 875766 876227 gene locus_tag LOCUS_08590 875766 876227 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017870060.1 protein_id gnl|my_center|LOCUS_08590 877408 876257 gene locus_tag LOCUS_08600 877408 876257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887661.1 protein_id gnl|my_center|LOCUS_08600 878217 877405 gene locus_tag LOCUS_08610 878217 877405 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887660.1 protein_id gnl|my_center|LOCUS_08610 878310 878702 gene locus_tag LOCUS_08620 878310 878702 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479552.1 protein_id gnl|my_center|LOCUS_08620 878710 879720 gene locus_tag LOCUS_08630 878710 879720 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887127.1 protein_id gnl|my_center|LOCUS_08630 879738 880295 gene locus_tag LOCUS_08640 879738 880295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887126.1 protein_id gnl|my_center|LOCUS_08640 880322 881251 gene locus_tag LOCUS_08650 880322 881251 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887144.1 protein_id gnl|my_center|LOCUS_08650 881248 882111 gene locus_tag LOCUS_08660 881248 882111 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887145.1 protein_id gnl|my_center|LOCUS_08660 883735 882257 gene locus_tag LOCUS_08670 883735 882257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 883926 885167 gene locus_tag LOCUS_08680 883926 885167 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920974.1 protein_id gnl|my_center|LOCUS_08680 885256 887298 gene locus_tag LOCUS_08690 885256 887298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 887461 889041 gene locus_tag LOCUS_08700 887461 889041 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887933.1 protein_id gnl|my_center|LOCUS_08700 889145 890173 gene locus_tag LOCUS_08710 889145 890173 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887604.1 protein_id gnl|my_center|LOCUS_08710 890178 891182 gene locus_tag LOCUS_08720 890178 891182 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887603.1 protein_id gnl|my_center|LOCUS_08720 891630 891229 gene locus_tag LOCUS_08730 891630 891229 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349510.1 protein_id gnl|my_center|LOCUS_08730 891770 894952 gene locus_tag LOCUS_08740 891770 894952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 895179 897128 gene locus_tag LOCUS_08750 895179 897128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 898060 897209 gene locus_tag LOCUS_08760 898060 897209 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479988.1 protein_id gnl|my_center|LOCUS_08760 899410 898145 gene locus_tag LOCUS_08770 899410 898145 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887571.1 protein_id gnl|my_center|LOCUS_08770 900149 899400 gene locus_tag LOCUS_08780 900149 899400 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887572.1 protein_id gnl|my_center|LOCUS_08780 900584 901093 gene locus_tag LOCUS_08790 900584 901093 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480048.1 protein_id gnl|my_center|LOCUS_08790 901195 901524 gene locus_tag LOCUS_08800 901195 901524 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480049.1 protein_id gnl|my_center|LOCUS_08800 901878 901663 gene locus_tag LOCUS_08810 901878 901663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 902099 902386 gene locus_tag LOCUS_08820 902099 902386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 902540 905002 gene locus_tag LOCUS_08830 902540 905002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 905179 906222 gene locus_tag LOCUS_08840 905179 906222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 908275 907058 gene locus_tag LOCUS_08850 908275 907058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 908713 908456 gene locus_tag LOCUS_08860 908713 908456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 909080 909307 gene locus_tag LOCUS_08870 909080 909307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 909413 909694 gene locus_tag LOCUS_08880 909413 909694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 909776 910039 gene locus_tag LOCUS_08890 909776 910039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 910414 910797 gene locus_tag LOCUS_08900 910414 910797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 911449 910826 gene locus_tag LOCUS_08910 911449 910826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 911488 911871 gene locus_tag LOCUS_08920 911488 911871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 912038 911892 gene locus_tag LOCUS_08930 912038 911892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 912329 912087 gene locus_tag LOCUS_08940 912329 912087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 912658 912512 gene locus_tag LOCUS_08950 912658 912512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 912709 913146 gene locus_tag LOCUS_08960 912709 913146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 913488 913721 gene locus_tag LOCUS_08970 913488 913721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 913789 913971 gene locus_tag LOCUS_08980 913789 913971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 914389 914315 gene locus_tag LOCUS_t00090 914389 914315 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 915869 914442 gene locus_tag LOCUS_08990 915869 914442 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350172.1 protein_id gnl|my_center|LOCUS_08990 917542 915917 gene locus_tag LOCUS_09000 gene serA 917542 915917 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887934.1 protein_id gnl|my_center|LOCUS_09000 917721 918977 gene locus_tag LOCUS_09010 917721 918977 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888344.1 protein_id gnl|my_center|LOCUS_09010 919637 919044 gene locus_tag LOCUS_09020 919637 919044 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259303.1 protein_id gnl|my_center|LOCUS_09020 920370 919750 gene locus_tag LOCUS_09030 gene aat 920370 919750 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888348.1 protein_id gnl|my_center|LOCUS_09030 920787 920374 gene locus_tag LOCUS_09040 920787 920374 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479700.1 protein_id gnl|my_center|LOCUS_09040 921964 920816 gene locus_tag LOCUS_09050 921964 920816 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887494.1 protein_id gnl|my_center|LOCUS_09050 922451 922011 gene locus_tag LOCUS_09060 gene dtd 922451 922011 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887535.1 protein_id gnl|my_center|LOCUS_09060 922722 922453 gene locus_tag LOCUS_09070 922722 922453 CDS product DUF1844 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479690.1 protein_id gnl|my_center|LOCUS_09070 923130 922741 gene locus_tag LOCUS_09080 923130 922741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888385.1 protein_id gnl|my_center|LOCUS_09080 923468 924109 gene locus_tag LOCUS_09090 923468 924109 CDS product peptidoglycan endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888384.1 protein_id gnl|my_center|LOCUS_09090 924866 924219 gene locus_tag LOCUS_09100 924866 924219 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888011.1 protein_id gnl|my_center|LOCUS_09100 925933 924959 gene locus_tag LOCUS_09110 925933 924959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177706.1 protein_id gnl|my_center|LOCUS_09110 926035 926532 gene locus_tag LOCUS_09120 926035 926532 CDS product LEA type 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888013.1 protein_id gnl|my_center|LOCUS_09120 926562 927734 gene locus_tag LOCUS_09130 926562 927734 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480033.1 protein_id gnl|my_center|LOCUS_09130 927731 928153 gene locus_tag LOCUS_09140 927731 928153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888037.1 protein_id gnl|my_center|LOCUS_09140 928183 928710 gene locus_tag LOCUS_09150 928183 928710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888123.1 protein_id gnl|my_center|LOCUS_09150 929057 929332 gene locus_tag LOCUS_09160 929057 929332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 929592 929897 gene locus_tag LOCUS_09170 929592 929897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 930016 930306 gene locus_tag LOCUS_09180 930016 930306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 930464 930697 gene locus_tag LOCUS_09190 930464 930697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 931225 931395 gene locus_tag LOCUS_09200 931225 931395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 931413 932774 gene locus_tag LOCUS_09210 gene miaB 931413 932774 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479611.1 protein_id gnl|my_center|LOCUS_09210 933266 932784 gene locus_tag LOCUS_09220 933266 932784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 933369 933944 gene locus_tag LOCUS_09230 933369 933944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 934060 934629 gene locus_tag LOCUS_09240 934060 934629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084049234.1 protein_id gnl|my_center|LOCUS_09240 936864 934684 gene locus_tag LOCUS_09250 936864 934684 CDS product ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479865.1 protein_id gnl|my_center|LOCUS_09250 937564 936947 gene locus_tag LOCUS_09260 937564 936947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 938033 939532 gene locus_tag LOCUS_09270 938033 939532 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479959.1 protein_id gnl|my_center|LOCUS_09270 940018 939596 gene locus_tag LOCUS_09280 940018 939596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 940635 940039 gene locus_tag LOCUS_09290 940635 940039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 941335 940772 gene locus_tag LOCUS_09300 941335 940772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 941649 942101 gene locus_tag LOCUS_09310 941649 942101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 943810 942212 gene locus_tag LOCUS_09320 943810 942212 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888192.1 protein_id gnl|my_center|LOCUS_09320 944141 945661 gene locus_tag LOCUS_09330 944141 945661 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027994.1 protein_id gnl|my_center|LOCUS_09330 946669 945728 gene locus_tag LOCUS_09340 946669 945728 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887479.1 protein_id gnl|my_center|LOCUS_09340 946708 947715 gene locus_tag LOCUS_09350 946708 947715 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878198.1 protein_id gnl|my_center|LOCUS_09350 947806 948807 gene locus_tag LOCUS_09360 947806 948807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 948840 949418 gene locus_tag LOCUS_09370 948840 949418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 950573 949578 gene locus_tag LOCUS_09380 950573 949578 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888889.1 protein_id gnl|my_center|LOCUS_09380 950699 951433 gene locus_tag LOCUS_09390 950699 951433 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082427.1 protein_id gnl|my_center|LOCUS_09390 951470 952027 gene locus_tag LOCUS_09400 951470 952027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 952746 952033 gene locus_tag LOCUS_09410 952746 952033 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887762.1 protein_id gnl|my_center|LOCUS_09410 952880 952804 gene locus_tag LOCUS_t00100 952880 952804 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 953497 952961 gene locus_tag LOCUS_09420 gene recX 953497 952961 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869852.1 protein_id gnl|my_center|LOCUS_09420 953683 953958 gene locus_tag LOCUS_09430 gene rpsT 953683 953958 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887951.1 protein_id gnl|my_center|LOCUS_09430 954393 954028 gene locus_tag LOCUS_09440 954393 954028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 955906 954419 gene locus_tag LOCUS_09450 955906 954419 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888422.1 protein_id gnl|my_center|LOCUS_09450 956190 955879 gene locus_tag LOCUS_09460 956190 955879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888421.1 protein_id gnl|my_center|LOCUS_09460 957267 956248 gene locus_tag LOCUS_09470 gene trpD 957267 956248 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480347.1 protein_id gnl|my_center|LOCUS_09470 957893 957264 gene locus_tag LOCUS_09480 957893 957264 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888401.1 protein_id gnl|my_center|LOCUS_09480 958279 957890 gene locus_tag LOCUS_09490 958279 957890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 959729 958296 gene locus_tag LOCUS_09500 gene trpE 959729 958296 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888426.1 protein_id gnl|my_center|LOCUS_09500 963276 959902 gene locus_tag LOCUS_09510 963276 959902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 964558 963449 gene locus_tag LOCUS_09520 964558 963449 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040383028.1 protein_id gnl|my_center|LOCUS_09520 964937 964641 gene locus_tag LOCUS_09530 964937 964641 CDS product YiaA/YiaB family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349694.1 protein_id gnl|my_center|LOCUS_09530 966486 965161 gene locus_tag LOCUS_09540 gene aroA 966486 965161 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479628.1 protein_id gnl|my_center|LOCUS_09540 966574 966981 gene locus_tag LOCUS_09550 966574 966981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887734.1 protein_id gnl|my_center|LOCUS_09550 969291 966994 gene locus_tag LOCUS_09560 969291 966994 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256532.1 protein_id gnl|my_center|LOCUS_09560 970282 969293 gene locus_tag LOCUS_09570 970282 969293 CDS product EfeM/EfeO family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256531.1 protein_id gnl|my_center|LOCUS_09570 972060 970456 gene locus_tag LOCUS_09580 972060 970456 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088214.1 protein_id gnl|my_center|LOCUS_09580 972593 972171 gene locus_tag LOCUS_09590 972593 972171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 972592 973809 gene locus_tag LOCUS_09600 972592 973809 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887895.1 protein_id gnl|my_center|LOCUS_09600 974511 973855 gene locus_tag LOCUS_09610 974511 973855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 974922 974560 gene locus_tag LOCUS_09620 974922 974560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 976686 974992 gene locus_tag LOCUS_09630 976686 974992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 977459 976683 gene locus_tag LOCUS_09640 977459 976683 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816573.1 protein_id gnl|my_center|LOCUS_09640 978199 977495 gene locus_tag LOCUS_09650 978199 977495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 978728 978204 gene locus_tag LOCUS_09660 978728 978204 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227910.1 protein_id gnl|my_center|LOCUS_09660 981420 978886 gene locus_tag LOCUS_09670 981420 978886 CDS product DUF3656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479940.1 protein_id gnl|my_center|LOCUS_09670 982243 981674 gene locus_tag LOCUS_09680 982243 981674 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888772.1 protein_id gnl|my_center|LOCUS_09680 982281 983066 gene locus_tag LOCUS_09690 982281 983066 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887924.1 protein_id gnl|my_center|LOCUS_09690 983181 985655 gene locus_tag LOCUS_09700 983181 985655 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887926.1 protein_id gnl|my_center|LOCUS_09700 986314 986033 gene locus_tag LOCUS_09710 986314 986033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 986378 987820 gene locus_tag LOCUS_09720 986378 987820 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888111.1 protein_id gnl|my_center|LOCUS_09720 988371 987880 gene locus_tag LOCUS_09730 988371 987880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 991768 988454 gene locus_tag LOCUS_09740 991768 988454 CDS product chromosome segregation SMC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480229.1 protein_id gnl|my_center|LOCUS_09740 992398 991853 gene locus_tag LOCUS_09750 992398 991853 CDS product GerMN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888109.1 protein_id gnl|my_center|LOCUS_09750 993801 992395 gene locus_tag LOCUS_09760 993801 992395 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888108.1 protein_id gnl|my_center|LOCUS_09760 994229 993798 gene locus_tag LOCUS_09770 gene smpB 994229 993798 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480230.1 protein_id gnl|my_center|LOCUS_09770 995030 994314 gene locus_tag LOCUS_09780 995030 994314 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888106.1 protein_id gnl|my_center|LOCUS_09780 997004 995082 gene locus_tag LOCUS_09790 997004 995082 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888269.1 protein_id gnl|my_center|LOCUS_09790 997066 998169 gene locus_tag LOCUS_09800 997066 998169 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618796.1 protein_id gnl|my_center|LOCUS_09800 998755 998117 gene locus_tag LOCUS_09810 998755 998117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 999705 998884 gene locus_tag LOCUS_09820 gene pcaD 999705 998884 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532964.1 protein_id gnl|my_center|LOCUS_09820 999913 1000833 gene locus_tag LOCUS_09830 999913 1000833 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101866.1 protein_id gnl|my_center|LOCUS_09830 1002652 1000841 gene locus_tag LOCUS_09840 gene tilS 1002652 1000841 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029732762.1 protein_id gnl|my_center|LOCUS_09840 1002560 1003048 gene locus_tag LOCUS_09850 1002560 1003048 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887852.1 protein_id gnl|my_center|LOCUS_09850 1003804 1003064 gene locus_tag LOCUS_09860 1003804 1003064 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479643.1 protein_id gnl|my_center|LOCUS_09860 1003852 1004790 gene locus_tag LOCUS_09870 1003852 1004790 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887048.1 protein_id gnl|my_center|LOCUS_09870 1006202 1004808 gene locus_tag LOCUS_09880 1006202 1004808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 1006503 1009019 gene locus_tag LOCUS_09890 1006503 1009019 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888825.1 protein_id gnl|my_center|LOCUS_09890 1009084 1009530 gene locus_tag LOCUS_09900 gene pcaC 1009084 1009530 CDS product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114672762.1 protein_id gnl|my_center|LOCUS_09900 1009558 1010427 gene locus_tag LOCUS_09910 1009558 1010427 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034357836.1 protein_id gnl|my_center|LOCUS_09910 1011175 1010444 gene locus_tag LOCUS_09920 1011175 1010444 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188202.1 protein_id gnl|my_center|LOCUS_09920 1011251 1012195 gene locus_tag LOCUS_09930 1011251 1012195 CDS product proline racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037557.1 protein_id gnl|my_center|LOCUS_09930 1012245 1013318 gene locus_tag LOCUS_09940 1012245 1013318 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533810.1 protein_id gnl|my_center|LOCUS_09940 1013311 1013565 gene locus_tag LOCUS_09950 1013311 1013565 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188713.1 protein_id gnl|my_center|LOCUS_09950 1013555 1014823 gene locus_tag LOCUS_09960 1013555 1014823 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187897.1 protein_id gnl|my_center|LOCUS_09960 1014873 1015760 gene locus_tag LOCUS_09970 1014873 1015760 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037553.1 protein_id gnl|my_center|LOCUS_09970 1015757 1017295 gene locus_tag LOCUS_09980 1015757 1017295 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920632.1 protein_id gnl|my_center|LOCUS_09980 1018969 1017356 gene locus_tag LOCUS_09990 1018969 1017356 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887602.1 protein_id gnl|my_center|LOCUS_09990 1019018 1019884 gene locus_tag LOCUS_10000 1019018 1019884 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618859.1 protein_id gnl|my_center|LOCUS_10000 1019978 1020658 gene locus_tag LOCUS_10010 1019978 1020658 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889112.1 protein_id gnl|my_center|LOCUS_10010 1020994 1020668 gene locus_tag LOCUS_10020 1020994 1020668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480013.1 protein_id gnl|my_center|LOCUS_10020 1022027 1021011 gene locus_tag LOCUS_10030 1022027 1021011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 1022068 1022463 gene locus_tag LOCUS_10040 1022068 1022463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888253.1 protein_id gnl|my_center|LOCUS_10040 1022521 1023186 gene locus_tag LOCUS_10050 1022521 1023186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 1023290 1023910 gene locus_tag LOCUS_10060 1023290 1023910 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480313.1 protein_id gnl|my_center|LOCUS_10060 1024077 1024556 gene locus_tag LOCUS_10070 gene rimP 1024077 1024556 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888431.1 protein_id gnl|my_center|LOCUS_10070 1024600 1025787 gene locus_tag LOCUS_10080 gene nusA 1024600 1025787 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350009.1 protein_id gnl|my_center|LOCUS_10080 1025792 1026058 gene locus_tag LOCUS_10090 1025792 1026058 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350011.1 protein_id gnl|my_center|LOCUS_10090 1026138 1028066 gene locus_tag LOCUS_10100 gene infB 1026138 1028066 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888434.1 protein_id gnl|my_center|LOCUS_10100 1028712 1028131 gene locus_tag LOCUS_10110 1028712 1028131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 1028929 1029231 gene locus_tag LOCUS_10120 1028929 1029231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092263717.1 protein_id gnl|my_center|LOCUS_10120 1029292 1031604 gene locus_tag LOCUS_10130 gene secD 1029292 1031604 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888457.1 protein_id gnl|my_center|LOCUS_10130 1031719 1032768 gene locus_tag LOCUS_10140 gene argC 1031719 1032768 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887608.1 protein_id gnl|my_center|LOCUS_10140 1032987 1034174 gene locus_tag LOCUS_10150 gene lysS 1032987 1034174 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480200.1 protein_id gnl|my_center|LOCUS_10150 1034221 1035051 gene locus_tag LOCUS_10160 1034221 1035051 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887821.1 protein_id gnl|my_center|LOCUS_10160 1035062 1036093 gene locus_tag LOCUS_10170 gene rlmN 1035062 1036093 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887581.1 protein_id gnl|my_center|LOCUS_10170 1036288 1037904 gene locus_tag LOCUS_10180 1036288 1037904 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887582.1 protein_id gnl|my_center|LOCUS_10180 1037901 1038878 gene locus_tag LOCUS_10190 1037901 1038878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10190 1038880 1039572 gene locus_tag LOCUS_10200 1038880 1039572 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479676.1 protein_id gnl|my_center|LOCUS_10200 1039569 1040180 gene locus_tag LOCUS_10210 1039569 1040180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177597.1 protein_id gnl|my_center|LOCUS_10210 1042158 1040251 gene locus_tag LOCUS_10220 gene cpdB 1042158 1040251 CDS product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480317.1 protein_id gnl|my_center|LOCUS_10220 1043503 1042235 gene locus_tag LOCUS_10230 1043503 1042235 CDS product lactate 2-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978098.1 protein_id gnl|my_center|LOCUS_10230 1044577 1043606 gene locus_tag LOCUS_10240 1044577 1043606 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888164.1 protein_id gnl|my_center|LOCUS_10240 1045513 1044653 gene locus_tag LOCUS_10250 gene rsmA 1045513 1044653 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618805.1 protein_id gnl|my_center|LOCUS_10250 1045580 1046422 gene locus_tag LOCUS_10260 1045580 1046422 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479848.1 protein_id gnl|my_center|LOCUS_10260 1046439 1047923 gene locus_tag LOCUS_10270 1046439 1047923 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869246.1 protein_id gnl|my_center|LOCUS_10270 1047933 1048640 gene locus_tag LOCUS_10280 1047933 1048640 CDS product DUF4388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480203.1 protein_id gnl|my_center|LOCUS_10280 1048668 1050350 gene locus_tag LOCUS_10290 1048668 1050350 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887436.1 protein_id gnl|my_center|LOCUS_10290 1050462 1051955 gene locus_tag LOCUS_10300 1050462 1051955 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177590.1 protein_id gnl|my_center|LOCUS_10300 1052058 1053053 gene locus_tag LOCUS_10310 gene ispH 1052058 1053053 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888795.1 protein_id gnl|my_center|LOCUS_10310 1053175 1053495 gene locus_tag LOCUS_10320 1053175 1053495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 1053513 1054364 gene locus_tag LOCUS_10330 1053513 1054364 CDS product [LysW]-aminoadipate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888059.1 protein_id gnl|my_center|LOCUS_10330 1054377 1054679 gene locus_tag LOCUS_10340 1054377 1054679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888060.1 protein_id gnl|my_center|LOCUS_10340 1056032 1054731 gene locus_tag LOCUS_10350 1056032 1054731 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888391.1 protein_id gnl|my_center|LOCUS_10350 1056570 1056175 gene locus_tag LOCUS_10360 1056570 1056175 CDS product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480312.1 protein_id gnl|my_center|LOCUS_10360 1056709 1057338 gene locus_tag LOCUS_10370 1056709 1057338 CDS product MazG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887826.1 protein_id gnl|my_center|LOCUS_10370 1057366 1057950 gene locus_tag LOCUS_10380 1057366 1057950 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887827.1 protein_id gnl|my_center|LOCUS_10380 >Feature sequence02 728 204 gene locus_tag LOCUS_10390 728 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 639 857 gene locus_tag LOCUS_10400 639 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 2325 1408 gene locus_tag LOCUS_10410 2325 1408 CDS product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966649.1 protein_id gnl|my_center|LOCUS_10410 2477 3448 gene locus_tag LOCUS_10420 2477 3448 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366639.1 protein_id gnl|my_center|LOCUS_10420 3542 4126 gene locus_tag LOCUS_10430 3542 4126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 4187 5467 gene locus_tag LOCUS_10440 4187 5467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 5496 6296 gene locus_tag LOCUS_10450 5496 6296 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463734.1 protein_id gnl|my_center|LOCUS_10450 6772 8247 gene locus_tag LOCUS_10460 gene pelF 6772 8247 CDS product GT4 family glycosyltransferase PelF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887358.1 protein_id gnl|my_center|LOCUS_10460 8244 9596 gene locus_tag LOCUS_10470 8244 9596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887357.1 protein_id gnl|my_center|LOCUS_10470 9593 10627 gene locus_tag LOCUS_10480 9593 10627 CDS product NAD-dependent 4,6-dehydratase LegB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887356.1 protein_id gnl|my_center|LOCUS_10480 10700 11437 gene locus_tag LOCUS_10490 10700 11437 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480005.1 protein_id gnl|my_center|LOCUS_10490 11444 12334 gene locus_tag LOCUS_10500 11444 12334 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177698.1 protein_id gnl|my_center|LOCUS_10500 12366 14552 gene locus_tag LOCUS_10510 12366 14552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887353.1 protein_id gnl|my_center|LOCUS_10510 14561 15286 gene locus_tag LOCUS_10520 14561 15286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887351.1 protein_id gnl|my_center|LOCUS_10520 15283 16215 gene locus_tag LOCUS_10530 15283 16215 CDS product endo alpha-1,4 polygalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887350.1 protein_id gnl|my_center|LOCUS_10530 16242 17282 gene locus_tag LOCUS_10540 16242 17282 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972097.1 protein_id gnl|my_center|LOCUS_10540 18221 17298 gene locus_tag LOCUS_10550 18221 17298 CDS product isoaspartyl peptidase/L-asparaginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311984.1 protein_id gnl|my_center|LOCUS_10550 18290 19111 gene locus_tag LOCUS_10560 18290 19111 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114603.1 protein_id gnl|my_center|LOCUS_10560 19935 19180 gene locus_tag LOCUS_10570 19935 19180 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902034.1 protein_id gnl|my_center|LOCUS_10570 21452 19932 gene locus_tag LOCUS_10580 21452 19932 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405197.1 protein_id gnl|my_center|LOCUS_10580 22203 21601 gene locus_tag LOCUS_10590 22203 21601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 23618 22200 gene locus_tag LOCUS_10600 23618 22200 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258857.1 protein_id gnl|my_center|LOCUS_10600 24379 23615 gene locus_tag LOCUS_10610 24379 23615 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776489.1 protein_id gnl|my_center|LOCUS_10610 25443 24376 gene locus_tag LOCUS_10620 25443 24376 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189804125.1 protein_id gnl|my_center|LOCUS_10620 26147 25440 gene locus_tag LOCUS_10630 26147 25440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 27151 26147 gene locus_tag LOCUS_10640 27151 26147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 28191 27148 gene locus_tag LOCUS_10650 28191 27148 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039184056.1 protein_id gnl|my_center|LOCUS_10650 29189 28188 gene locus_tag LOCUS_10660 29189 28188 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528136.1 protein_id gnl|my_center|LOCUS_10660 30034 29186 gene locus_tag LOCUS_10670 30034 29186 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339156.1 protein_id gnl|my_center|LOCUS_10670 31001 30063 gene locus_tag LOCUS_10680 31001 30063 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_10680 32654 31080 gene locus_tag LOCUS_10690 32654 31080 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970216.1 protein_id gnl|my_center|LOCUS_10690 33028 34230 gene locus_tag LOCUS_10700 33028 34230 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368549.1 protein_id gnl|my_center|LOCUS_10700 34200 34538 gene locus_tag LOCUS_10710 34200 34538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 34535 35365 gene locus_tag LOCUS_10720 34535 35365 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326598.1 protein_id gnl|my_center|LOCUS_10720 35367 36566 gene locus_tag LOCUS_10730 gene eboE 35367 36566 CDS product metabolite traffic protein EboE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368548.1 protein_id gnl|my_center|LOCUS_10730 36556 37437 gene locus_tag LOCUS_10740 36556 37437 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176762490.1 protein_id gnl|my_center|LOCUS_10740 37439 38854 gene locus_tag LOCUS_10750 37439 38854 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715488.1 protein_id gnl|my_center|LOCUS_10750 40265 38934 gene locus_tag LOCUS_10760 40265 38934 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582759.1 protein_id gnl|my_center|LOCUS_10760 41178 40291 gene locus_tag LOCUS_10770 41178 40291 CDS product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258521.1 protein_id gnl|my_center|LOCUS_10770 41999 41175 gene locus_tag LOCUS_10780 41999 41175 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393881.1 protein_id gnl|my_center|LOCUS_10780 42946 41996 gene locus_tag LOCUS_10790 gene glmD 42946 41996 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250706.1 protein_id gnl|my_center|LOCUS_10790 43926 42943 gene locus_tag LOCUS_10800 43926 42943 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030497.1 protein_id gnl|my_center|LOCUS_10800 45167 43926 gene locus_tag LOCUS_10810 45167 43926 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180947114.1 protein_id gnl|my_center|LOCUS_10810 46099 45212 gene locus_tag LOCUS_10820 46099 45212 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722710.1 protein_id gnl|my_center|LOCUS_10820 47018 46086 gene locus_tag LOCUS_10830 47018 46086 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776897.1 protein_id gnl|my_center|LOCUS_10830 48506 47052 gene locus_tag LOCUS_10840 48506 47052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 49282 48503 gene locus_tag LOCUS_10850 49282 48503 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391560.1 protein_id gnl|my_center|LOCUS_10850 49790 50179 gene locus_tag LOCUS_10860 49790 50179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 50280 51407 gene locus_tag LOCUS_10870 50280 51407 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532464.1 protein_id gnl|my_center|LOCUS_10870 52790 51474 gene locus_tag LOCUS_10880 gene guaD 52790 51474 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889440.1 protein_id gnl|my_center|LOCUS_10880 53623 52787 gene locus_tag LOCUS_10890 gene xdhC 53623 52787 CDS product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479762.1 protein_id gnl|my_center|LOCUS_10890 56011 53663 gene locus_tag LOCUS_10900 gene xdhB 56011 53663 CDS product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974005.1 protein_id gnl|my_center|LOCUS_10900 57423 56008 gene locus_tag LOCUS_10910 57423 56008 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889437.1 protein_id gnl|my_center|LOCUS_10910 57814 59217 gene locus_tag LOCUS_10920 57814 59217 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764153.1 protein_id gnl|my_center|LOCUS_10920 59235 60401 gene locus_tag LOCUS_10930 59235 60401 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770934.1 protein_id gnl|my_center|LOCUS_10930 60441 61046 gene locus_tag LOCUS_10940 60441 61046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 61043 62770 gene locus_tag LOCUS_10950 61043 62770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 62928 64577 gene locus_tag LOCUS_10960 62928 64577 CDS product FAD-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889497.1 protein_id gnl|my_center|LOCUS_10960 65564 64728 gene locus_tag LOCUS_10970 gene kynA 65564 64728 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889598.1 protein_id gnl|my_center|LOCUS_10970 66793 65561 gene locus_tag LOCUS_10980 gene kynU 66793 65561 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480133.1 protein_id gnl|my_center|LOCUS_10980 67163 66864 gene locus_tag LOCUS_10990 67163 66864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 67068 68345 gene locus_tag LOCUS_11000 gene paaF 67068 68345 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889515.1 protein_id gnl|my_center|LOCUS_11000 69272 68397 gene locus_tag LOCUS_11010 69272 68397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 70742 69408 gene locus_tag LOCUS_11020 70742 69408 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256764.1 protein_id gnl|my_center|LOCUS_11020 71422 70739 gene locus_tag LOCUS_11030 71422 70739 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086341.1 protein_id gnl|my_center|LOCUS_11030 71588 73024 gene locus_tag LOCUS_11040 71588 73024 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065240.1 protein_id gnl|my_center|LOCUS_11040 73021 74067 gene locus_tag LOCUS_11050 73021 74067 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479997.1 protein_id gnl|my_center|LOCUS_11050 74064 75419 gene locus_tag LOCUS_11060 74064 75419 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583203.1 protein_id gnl|my_center|LOCUS_11060 75416 76153 gene locus_tag LOCUS_11070 75416 76153 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173093.1 protein_id gnl|my_center|LOCUS_11070 76150 77478 gene locus_tag LOCUS_11080 76150 77478 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173094.1 protein_id gnl|my_center|LOCUS_11080 77490 78086 gene locus_tag LOCUS_11090 77490 78086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 78238 79311 gene locus_tag LOCUS_11100 78238 79311 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528461.1 protein_id gnl|my_center|LOCUS_11100 79408 79713 gene locus_tag LOCUS_11110 79408 79713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 80725 79721 gene locus_tag LOCUS_11120 gene mgrA 80725 79721 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640297.1 protein_id gnl|my_center|LOCUS_11120 81099 80794 gene locus_tag LOCUS_11130 81099 80794 CDS product UBP-type zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144139.1 protein_id gnl|my_center|LOCUS_11130 82779 81115 gene locus_tag LOCUS_11140 82779 81115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 83227 82787 gene locus_tag LOCUS_11150 83227 82787 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966951.1 protein_id gnl|my_center|LOCUS_11150 84221 83250 gene locus_tag LOCUS_11160 84221 83250 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972087.1 protein_id gnl|my_center|LOCUS_11160 84279 84566 gene locus_tag LOCUS_11170 84279 84566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 84616 84852 gene locus_tag LOCUS_11180 84616 84852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 86921 84855 gene locus_tag LOCUS_11190 86921 84855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 89940 86941 gene locus_tag LOCUS_11200 89940 86941 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258829.1 protein_id gnl|my_center|LOCUS_11200 91182 90034 gene locus_tag LOCUS_11210 gene dgoD 91182 90034 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199088.1 protein_id gnl|my_center|LOCUS_11210 91283 92065 gene locus_tag LOCUS_11220 91283 92065 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530852.1 protein_id gnl|my_center|LOCUS_11220 93160 92117 gene locus_tag LOCUS_11230 93160 92117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 94116 93268 gene locus_tag LOCUS_11240 94116 93268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 96405 94468 gene locus_tag LOCUS_11250 96405 94468 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189643347.1 protein_id gnl|my_center|LOCUS_11250 97449 96616 gene locus_tag LOCUS_11260 gene iolB 97449 96616 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640197.1 protein_id gnl|my_center|LOCUS_11260 98486 97446 gene locus_tag LOCUS_11270 gene iolG 98486 97446 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037387540.1 protein_id gnl|my_center|LOCUS_11270 99306 98479 gene locus_tag LOCUS_11280 99306 98479 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393881.1 protein_id gnl|my_center|LOCUS_11280 100313 99303 gene locus_tag LOCUS_11290 100313 99303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 101260 100310 gene locus_tag LOCUS_11300 101260 100310 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315826.1 protein_id gnl|my_center|LOCUS_11300 103187 101298 gene locus_tag LOCUS_11310 gene iolD 103187 101298 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729994.1 protein_id gnl|my_center|LOCUS_11310 104257 103184 gene locus_tag LOCUS_11320 gene iolX 104257 103184 CDS product scyllo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244942.1 protein_id gnl|my_center|LOCUS_11320 105163 104330 gene locus_tag LOCUS_11330 105163 104330 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193469.1 protein_id gnl|my_center|LOCUS_11330 106203 105160 gene locus_tag LOCUS_11340 106203 105160 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192697.1 protein_id gnl|my_center|LOCUS_11340 107223 106300 gene locus_tag LOCUS_11350 107223 106300 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223780.1 protein_id gnl|my_center|LOCUS_11350 108228 107344 gene locus_tag LOCUS_11360 108228 107344 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331332.1 protein_id gnl|my_center|LOCUS_11360 109684 108689 gene locus_tag LOCUS_11370 109684 108689 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479751.1 protein_id gnl|my_center|LOCUS_11370 110504 109782 gene locus_tag LOCUS_11380 110504 109782 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889519.1 protein_id gnl|my_center|LOCUS_11380 112309 110501 gene locus_tag LOCUS_11390 112309 110501 CDS product branched-chain amino acid ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350675.1 protein_id gnl|my_center|LOCUS_11390 113355 112306 gene locus_tag LOCUS_11400 113355 112306 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889521.1 protein_id gnl|my_center|LOCUS_11400 113946 114953 gene locus_tag LOCUS_11410 113946 114953 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226239.1 protein_id gnl|my_center|LOCUS_11410 114972 115904 gene locus_tag LOCUS_11420 114972 115904 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026976.1 protein_id gnl|my_center|LOCUS_11420 115962 116870 gene locus_tag LOCUS_11430 115962 116870 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026977.1 protein_id gnl|my_center|LOCUS_11430 117032 118351 gene locus_tag LOCUS_11440 117032 118351 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804375.1 protein_id gnl|my_center|LOCUS_11440 118435 119787 gene locus_tag LOCUS_11450 118435 119787 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969771.1 protein_id gnl|my_center|LOCUS_11450 120137 119967 gene locus_tag LOCUS_11460 120137 119967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 120431 122017 gene locus_tag LOCUS_11470 120431 122017 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479846.1 protein_id gnl|my_center|LOCUS_11470 122910 122179 gene locus_tag LOCUS_11480 122910 122179 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889570.1 protein_id gnl|my_center|LOCUS_11480 123647 122979 gene locus_tag LOCUS_11490 gene ureG 123647 122979 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889571.1 protein_id gnl|my_center|LOCUS_11490 124372 123728 gene locus_tag LOCUS_11500 124372 123728 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889572.1 protein_id gnl|my_center|LOCUS_11500 124830 124369 gene locus_tag LOCUS_11510 gene ureE 124830 124369 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889573.1 protein_id gnl|my_center|LOCUS_11510 125489 124827 gene locus_tag LOCUS_11520 gene hypB 125489 124827 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889574.1 protein_id gnl|my_center|LOCUS_11520 125848 125486 gene locus_tag LOCUS_11530 125848 125486 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889575.1 protein_id gnl|my_center|LOCUS_11530 126442 125879 gene locus_tag LOCUS_11540 126442 125879 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889576.1 protein_id gnl|my_center|LOCUS_11540 128177 126456 gene locus_tag LOCUS_11550 gene ureC 128177 126456 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889577.1 protein_id gnl|my_center|LOCUS_11550 128434 128519 gene locus_tag LOCUS_t00110 128434 128519 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 129022 129729 gene locus_tag LOCUS_11560 129022 129729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 130236 130000 gene locus_tag LOCUS_11570 130236 130000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 130118 131302 gene locus_tag LOCUS_11580 gene urtA 130118 131302 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889579.1 protein_id gnl|my_center|LOCUS_11580 131399 132289 gene locus_tag LOCUS_11590 gene urtB 131399 132289 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889580.1 protein_id gnl|my_center|LOCUS_11590 132286 133401 gene locus_tag LOCUS_11600 gene urtC 132286 133401 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889581.1 protein_id gnl|my_center|LOCUS_11600 133391 134155 gene locus_tag LOCUS_11610 gene urtD 133391 134155 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889582.1 protein_id gnl|my_center|LOCUS_11610 134259 134963 gene locus_tag LOCUS_11620 gene urtE 134259 134963 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889583.1 protein_id gnl|my_center|LOCUS_11620 134980 135987 gene locus_tag LOCUS_11630 134980 135987 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971356.1 protein_id gnl|my_center|LOCUS_11630 135984 136811 gene locus_tag LOCUS_11640 135984 136811 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162687942.1 protein_id gnl|my_center|LOCUS_11640 136822 137646 gene locus_tag LOCUS_11650 136822 137646 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971358.1 protein_id gnl|my_center|LOCUS_11650 138118 137657 gene locus_tag LOCUS_11660 138118 137657 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177769.1 protein_id gnl|my_center|LOCUS_11660 138939 138145 gene locus_tag LOCUS_11670 138939 138145 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110588.1 protein_id gnl|my_center|LOCUS_11670 141104 139053 gene locus_tag LOCUS_11680 141104 139053 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031640.1 protein_id gnl|my_center|LOCUS_11680 141964 141104 gene locus_tag LOCUS_11690 141964 141104 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530185.1 protein_id gnl|my_center|LOCUS_11690 142863 141961 gene locus_tag LOCUS_11700 142863 141961 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530184.1 protein_id gnl|my_center|LOCUS_11700 144225 142936 gene locus_tag LOCUS_11710 144225 142936 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530183.1 protein_id gnl|my_center|LOCUS_11710 144252 145448 gene locus_tag LOCUS_11720 144252 145448 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311957.1 protein_id gnl|my_center|LOCUS_11720 146598 145459 gene locus_tag LOCUS_11730 146598 145459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 146788 147879 gene locus_tag LOCUS_11740 146788 147879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 149222 148098 gene locus_tag LOCUS_11750 149222 148098 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040383028.1 protein_id gnl|my_center|LOCUS_11750 149572 149363 gene locus_tag LOCUS_11760 149572 149363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 149809 153003 gene locus_tag LOCUS_11770 149809 153003 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584105.1 protein_id gnl|my_center|LOCUS_11770 153774 153040 gene locus_tag LOCUS_11780 153774 153040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 155288 153861 gene locus_tag LOCUS_11790 155288 153861 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976070.1 protein_id gnl|my_center|LOCUS_11790 155867 155349 gene locus_tag LOCUS_11800 155867 155349 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228802.1 protein_id gnl|my_center|LOCUS_11800 156042 156938 gene locus_tag LOCUS_11810 156042 156938 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092776.1 protein_id gnl|my_center|LOCUS_11810 158073 157072 gene locus_tag LOCUS_11820 gene rhaS 158073 157072 CDS product rhamnose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226381.1 protein_id gnl|my_center|LOCUS_11820 159136 158147 gene locus_tag LOCUS_11830 159136 158147 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226380.1 protein_id gnl|my_center|LOCUS_11830 160170 159133 gene locus_tag LOCUS_11840 160170 159133 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226379.1 protein_id gnl|my_center|LOCUS_11840 161804 160170 gene locus_tag LOCUS_11850 161804 160170 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978049.1 protein_id gnl|my_center|LOCUS_11850 162126 161797 gene locus_tag LOCUS_11860 162126 161797 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226382.1 protein_id gnl|my_center|LOCUS_11860 162943 162843 gene locus_tag LOCUS_t00120 162943 162843 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 163052 164266 gene locus_tag LOCUS_11870 gene rhaI 163052 164266 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226383.1 protein_id gnl|my_center|LOCUS_11870 164299 166383 gene locus_tag LOCUS_11880 164299 166383 CDS product bifunctional aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244479.1 protein_id gnl|my_center|LOCUS_11880 166373 167824 gene locus_tag LOCUS_11890 166373 167824 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258145.1 protein_id gnl|my_center|LOCUS_11890 167821 168564 gene locus_tag LOCUS_11900 167821 168564 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888542.1 protein_id gnl|my_center|LOCUS_11900 168561 170000 gene locus_tag LOCUS_11910 168561 170000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 169997 170635 gene locus_tag LOCUS_11920 169997 170635 CDS product lactate utilization protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888544.1 protein_id gnl|my_center|LOCUS_11920 170954 170652 gene locus_tag LOCUS_11930 170954 170652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 171195 171962 gene locus_tag LOCUS_11940 171195 171962 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971207.1 protein_id gnl|my_center|LOCUS_11940 172281 172874 gene locus_tag LOCUS_11950 172281 172874 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350382.1 protein_id gnl|my_center|LOCUS_11950 172963 174381 gene locus_tag LOCUS_11960 172963 174381 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161617954.1 protein_id gnl|my_center|LOCUS_11960 174378 175439 gene locus_tag LOCUS_11970 174378 175439 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479997.1 protein_id gnl|my_center|LOCUS_11970 175436 176680 gene locus_tag LOCUS_11980 175436 176680 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017870666.1 protein_id gnl|my_center|LOCUS_11980 176677 180102 gene locus_tag LOCUS_11990 176677 180102 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887385.1 protein_id gnl|my_center|LOCUS_11990 180288 180821 gene locus_tag LOCUS_12000 180288 180821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 180818 182740 gene locus_tag LOCUS_12010 180818 182740 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889320.1 protein_id gnl|my_center|LOCUS_12010 182868 183347 gene locus_tag LOCUS_12020 182868 183347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480141.1 protein_id gnl|my_center|LOCUS_12020 183479 183931 gene locus_tag LOCUS_12030 183479 183931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 183980 184378 gene locus_tag LOCUS_12040 183980 184378 CDS product copper resistance protein CopC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480143.1 protein_id gnl|my_center|LOCUS_12040 184383 185339 gene locus_tag LOCUS_12050 184383 185339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 185565 186761 gene locus_tag LOCUS_12060 185565 186761 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889306.1 protein_id gnl|my_center|LOCUS_12060 187580 186846 gene locus_tag LOCUS_12070 187580 186846 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349836.1 protein_id gnl|my_center|LOCUS_12070 188125 187577 gene locus_tag LOCUS_12080 188125 187577 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889303.1 protein_id gnl|my_center|LOCUS_12080 189024 188122 gene locus_tag LOCUS_12090 gene rfbA 189024 188122 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889302.1 protein_id gnl|my_center|LOCUS_12090 190043 189021 gene locus_tag LOCUS_12100 gene rfbB 190043 189021 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889301.1 protein_id gnl|my_center|LOCUS_12100 190872 191810 gene locus_tag LOCUS_12110 190872 191810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 192995 191838 gene locus_tag LOCUS_12120 192995 191838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 194230 192992 gene locus_tag LOCUS_12130 194230 192992 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889299.1 protein_id gnl|my_center|LOCUS_12130 196770 195661 gene locus_tag LOCUS_12140 196770 195661 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122447.1 protein_id gnl|my_center|LOCUS_12140 197759 196767 gene locus_tag LOCUS_12150 197759 196767 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816872.1 protein_id gnl|my_center|LOCUS_12150 199068 197752 gene locus_tag LOCUS_12160 gene wzx 199068 197752 CDS product O157 family O-antigen flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033576.1 protein_id gnl|my_center|LOCUS_12160 199991 199065 gene locus_tag LOCUS_12170 199991 199065 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462197.1 protein_id gnl|my_center|LOCUS_12170 200863 199988 gene locus_tag LOCUS_12180 200863 199988 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546302.1 protein_id gnl|my_center|LOCUS_12180 201865 200873 gene locus_tag LOCUS_12190 201865 200873 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545190.1 protein_id gnl|my_center|LOCUS_12190 203193 201844 gene locus_tag LOCUS_12200 gene rfbH 203193 201844 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126347.1 protein_id gnl|my_center|LOCUS_12200 204185 203190 gene locus_tag LOCUS_12210 204185 203190 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546520.1 protein_id gnl|my_center|LOCUS_12210 204952 204182 gene locus_tag LOCUS_12220 gene rfbF 204952 204182 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037178.1 protein_id gnl|my_center|LOCUS_12220 206898 205465 gene locus_tag LOCUS_12230 206898 205465 CDS product undecaprenyl-phosphate galactose phosphotransferase WbaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889294.1 protein_id gnl|my_center|LOCUS_12230 208602 206902 gene locus_tag LOCUS_12240 208602 206902 CDS product tyrosine-protein kinase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889293.1 protein_id gnl|my_center|LOCUS_12240 209435 209052 gene locus_tag LOCUS_12250 209435 209052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 209673 211334 gene locus_tag LOCUS_12260 209673 211334 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480156.1 protein_id gnl|my_center|LOCUS_12260 211956 211477 gene locus_tag LOCUS_12270 211956 211477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 213247 212108 gene locus_tag LOCUS_12280 213247 212108 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480157.1 protein_id gnl|my_center|LOCUS_12280 213529 214224 gene locus_tag LOCUS_12290 213529 214224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 214666 215631 gene locus_tag LOCUS_12300 214666 215631 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529215.1 protein_id gnl|my_center|LOCUS_12300 215624 216490 gene locus_tag LOCUS_12310 gene rbsK 215624 216490 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119387.1 protein_id gnl|my_center|LOCUS_12310 216549 217541 gene locus_tag LOCUS_12320 216549 217541 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529214.1 protein_id gnl|my_center|LOCUS_12320 217628 219127 gene locus_tag LOCUS_12330 217628 219127 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978049.1 protein_id gnl|my_center|LOCUS_12330 219102 220073 gene locus_tag LOCUS_12340 219102 220073 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529212.1 protein_id gnl|my_center|LOCUS_12340 220889 220140 gene locus_tag LOCUS_12350 220889 220140 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704990.1 protein_id gnl|my_center|LOCUS_12350 222000 220963 gene locus_tag LOCUS_12360 222000 220963 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973687.1 protein_id gnl|my_center|LOCUS_12360 223618 222011 gene locus_tag LOCUS_12370 223618 222011 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027258.1 protein_id gnl|my_center|LOCUS_12370 224465 223623 gene locus_tag LOCUS_12380 224465 223623 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973683.1 protein_id gnl|my_center|LOCUS_12380 225363 224455 gene locus_tag LOCUS_12390 225363 224455 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973684.1 protein_id gnl|my_center|LOCUS_12390 226589 225360 gene locus_tag LOCUS_12400 226589 225360 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973685.1 protein_id gnl|my_center|LOCUS_12400 227559 227260 gene locus_tag LOCUS_12410 gene yidD 227559 227260 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887235.1 protein_id gnl|my_center|LOCUS_12410 228856 227630 gene locus_tag LOCUS_12420 228856 227630 CDS product DUF790 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141365.1 protein_id gnl|my_center|LOCUS_12420 230330 228843 gene locus_tag LOCUS_12430 230330 228843 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141364.1 protein_id gnl|my_center|LOCUS_12430 230586 230320 gene locus_tag LOCUS_12440 230586 230320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 230789 231169 gene locus_tag LOCUS_12450 230789 231169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 231215 231976 gene locus_tag LOCUS_12460 231215 231976 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889261.1 protein_id gnl|my_center|LOCUS_12460 231973 232848 gene locus_tag LOCUS_12470 231973 232848 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889262.1 protein_id gnl|my_center|LOCUS_12470 234164 233298 gene locus_tag LOCUS_12480 234164 233298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 234958 234182 gene locus_tag LOCUS_12490 234958 234182 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889261.1 protein_id gnl|my_center|LOCUS_12490 235278 235567 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctatcggacaacttgcgccgtt 235705 237120 gene locus_tag LOCUS_12500 235705 237120 CDS product replication initiator protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229172.1 protein_id gnl|my_center|LOCUS_12500 237635 237183 gene locus_tag LOCUS_12510 237635 237183 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889511.1 protein_id gnl|my_center|LOCUS_12510 238606 237632 gene locus_tag LOCUS_12520 238606 237632 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479781.1 protein_id gnl|my_center|LOCUS_12520 238755 240551 gene locus_tag LOCUS_12530 238755 240551 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479780.1 protein_id gnl|my_center|LOCUS_12530 241377 240595 gene locus_tag LOCUS_12540 241377 240595 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889616.1 protein_id gnl|my_center|LOCUS_12540 242126 241389 gene locus_tag LOCUS_12550 242126 241389 CDS product DUF4388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889615.1 protein_id gnl|my_center|LOCUS_12550 244888 242123 gene locus_tag LOCUS_12560 244888 242123 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025567610.1 protein_id gnl|my_center|LOCUS_12560 247137 244891 gene locus_tag LOCUS_12570 247137 244891 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889613.1 protein_id gnl|my_center|LOCUS_12570 249387 247174 gene locus_tag LOCUS_12580 249387 247174 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889611.1 protein_id gnl|my_center|LOCUS_12580 249880 249458 gene locus_tag LOCUS_12590 249880 249458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 250250 249888 gene locus_tag LOCUS_12600 250250 249888 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479704.1 protein_id gnl|my_center|LOCUS_12600 251141 250311 gene locus_tag LOCUS_12610 251141 250311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 251316 252086 gene locus_tag LOCUS_12620 251316 252086 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889459.1 protein_id gnl|my_center|LOCUS_12620 252083 252517 gene locus_tag LOCUS_12630 252083 252517 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523514.1 protein_id gnl|my_center|LOCUS_12630 252517 252966 gene locus_tag LOCUS_12640 252517 252966 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889458.1 protein_id gnl|my_center|LOCUS_12640 252974 253318 gene locus_tag LOCUS_12650 252974 253318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 253315 254619 gene locus_tag LOCUS_12660 253315 254619 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889455.1 protein_id gnl|my_center|LOCUS_12660 254698 255228 gene locus_tag LOCUS_12670 254698 255228 CDS product CbrC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911837.1 protein_id gnl|my_center|LOCUS_12670 255244 256044 gene locus_tag LOCUS_12680 255244 256044 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889454.1 protein_id gnl|my_center|LOCUS_12680 256041 257174 gene locus_tag LOCUS_12690 256041 257174 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889453.1 protein_id gnl|my_center|LOCUS_12690 257171 257863 gene locus_tag LOCUS_12700 257171 257863 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889452.1 protein_id gnl|my_center|LOCUS_12700 258643 257942 gene locus_tag LOCUS_12710 258643 257942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 260229 258640 gene locus_tag LOCUS_12720 260229 258640 CDS product methanol/ethanol family PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088960.1 protein_id gnl|my_center|LOCUS_12720 260713 260336 gene locus_tag LOCUS_12730 260713 260336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 261324 260713 gene locus_tag LOCUS_12740 261324 260713 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234149.1 protein_id gnl|my_center|LOCUS_12740 262237 261572 gene locus_tag LOCUS_12750 262237 261572 CDS product nucleoside/nucleotide kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731541.1 protein_id gnl|my_center|LOCUS_12750 263447 262257 gene locus_tag LOCUS_12760 263447 262257 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887119.1 protein_id gnl|my_center|LOCUS_12760 263465 263998 gene locus_tag LOCUS_12770 263465 263998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 265251 263986 gene locus_tag LOCUS_12780 265251 263986 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889588.1 protein_id gnl|my_center|LOCUS_12780 266247 265297 gene locus_tag LOCUS_12790 266247 265297 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533130.1 protein_id gnl|my_center|LOCUS_12790 267336 266320 gene locus_tag LOCUS_12800 267336 266320 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721763.1 protein_id gnl|my_center|LOCUS_12800 268837 267323 gene locus_tag LOCUS_12810 268837 267323 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338818.1 protein_id gnl|my_center|LOCUS_12810 269203 269006 gene locus_tag LOCUS_12820 269203 269006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 269549 271066 gene locus_tag LOCUS_12830 gene pelF 269549 271066 CDS product GT4 family glycosyltransferase PelF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887358.1 protein_id gnl|my_center|LOCUS_12830 271063 272451 gene locus_tag LOCUS_12840 271063 272451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 272575 273570 gene locus_tag LOCUS_12850 272575 273570 CDS product NAD-dependent 4,6-dehydratase LegB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887356.1 protein_id gnl|my_center|LOCUS_12850 273642 274418 gene locus_tag LOCUS_12860 273642 274418 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480005.1 protein_id gnl|my_center|LOCUS_12860 274415 275353 gene locus_tag LOCUS_12870 274415 275353 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177698.1 protein_id gnl|my_center|LOCUS_12870 275334 277433 gene locus_tag LOCUS_12880 275334 277433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887353.1 protein_id gnl|my_center|LOCUS_12880 277433 278182 gene locus_tag LOCUS_12890 277433 278182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887351.1 protein_id gnl|my_center|LOCUS_12890 279626 278241 gene locus_tag LOCUS_12900 279626 278241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 282229 280016 gene locus_tag LOCUS_12910 282229 280016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 283633 282491 gene locus_tag LOCUS_12920 283633 282491 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187767773.1 protein_id gnl|my_center|LOCUS_12920 284327 283626 gene locus_tag LOCUS_12930 284327 283626 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889586.1 protein_id gnl|my_center|LOCUS_12930 285448 284324 gene locus_tag LOCUS_12940 285448 284324 CDS product type III polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480137.1 protein_id gnl|my_center|LOCUS_12940 286673 285510 gene locus_tag LOCUS_12950 286673 285510 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234334.1 protein_id gnl|my_center|LOCUS_12950 287934 286693 gene locus_tag LOCUS_12960 287934 286693 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931108.1 protein_id gnl|my_center|LOCUS_12960 288968 287931 gene locus_tag LOCUS_12970 288968 287931 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976055.1 protein_id gnl|my_center|LOCUS_12970 289221 290564 gene locus_tag LOCUS_12980 289221 290564 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197580.1 protein_id gnl|my_center|LOCUS_12980 290669 291592 gene locus_tag LOCUS_12990 290669 291592 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550807.1 protein_id gnl|my_center|LOCUS_12990 291594 292442 gene locus_tag LOCUS_13000 291594 292442 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003369336.1 protein_id gnl|my_center|LOCUS_13000 292553 294022 gene locus_tag LOCUS_13010 292553 294022 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730628.1 protein_id gnl|my_center|LOCUS_13010 294056 294823 gene locus_tag LOCUS_13020 294056 294823 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067241.1 protein_id gnl|my_center|LOCUS_13020 294852 295925 gene locus_tag LOCUS_13030 gene gutB 294852 295925 CDS product sorbitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244156.1 protein_id gnl|my_center|LOCUS_13030 296013 296972 gene locus_tag LOCUS_13040 296013 296972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 296969 297736 gene locus_tag LOCUS_13050 296969 297736 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881009.1 protein_id gnl|my_center|LOCUS_13050 300048 297880 gene locus_tag LOCUS_13060 300048 297880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 301389 300838 gene locus_tag LOCUS_13070 301389 300838 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529260.1 protein_id gnl|my_center|LOCUS_13070 302997 301411 gene locus_tag LOCUS_13080 302997 301411 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887662.1 protein_id gnl|my_center|LOCUS_13080 304608 303082 gene locus_tag LOCUS_13090 gene glpK 304608 303082 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888563.1 protein_id gnl|my_center|LOCUS_13090 306490 304727 gene locus_tag LOCUS_13100 306490 304727 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810951.1 protein_id gnl|my_center|LOCUS_13100 306915 306643 gene locus_tag LOCUS_13110 306915 306643 CDS product DUF2160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267211.1 protein_id gnl|my_center|LOCUS_13110 307798 306938 gene locus_tag LOCUS_13120 307798 306938 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337643.1 protein_id gnl|my_center|LOCUS_13120 308712 307795 gene locus_tag LOCUS_13130 308712 307795 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810946.1 protein_id gnl|my_center|LOCUS_13130 309841 308759 gene locus_tag LOCUS_13140 309841 308759 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810943.1 protein_id gnl|my_center|LOCUS_13140 310941 309841 gene locus_tag LOCUS_13150 310941 309841 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085224.1 protein_id gnl|my_center|LOCUS_13150 311235 312227 gene locus_tag LOCUS_13160 311235 312227 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618838.1 protein_id gnl|my_center|LOCUS_13160 314099 312231 gene locus_tag LOCUS_13170 314099 312231 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928975.1 protein_id gnl|my_center|LOCUS_13170 315130 314198 gene locus_tag LOCUS_13180 gene tal 315130 314198 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073375.1 protein_id gnl|my_center|LOCUS_13180 316164 315259 gene locus_tag LOCUS_13190 316164 315259 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889450.1 protein_id gnl|my_center|LOCUS_13190 317786 316257 gene locus_tag LOCUS_13200 gene mmsA 317786 316257 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028544.1 protein_id gnl|my_center|LOCUS_13200 318384 317821 gene locus_tag LOCUS_13210 318384 317821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 319746 318385 gene locus_tag LOCUS_13220 319746 318385 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110217.1 protein_id gnl|my_center|LOCUS_13220 321417 319864 gene locus_tag LOCUS_13230 321417 319864 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884006.1 protein_id gnl|my_center|LOCUS_13230 322470 321487 gene locus_tag LOCUS_13240 322470 321487 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252564.1 protein_id gnl|my_center|LOCUS_13240 323250 322528 gene locus_tag LOCUS_13250 323250 322528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 323773 325104 gene locus_tag LOCUS_13260 323773 325104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 325207 327825 gene locus_tag LOCUS_13270 325207 327825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 327842 328822 gene locus_tag LOCUS_13280 327842 328822 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368572.1 protein_id gnl|my_center|LOCUS_13280 328819 329667 gene locus_tag LOCUS_13290 328819 329667 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037580.1 protein_id gnl|my_center|LOCUS_13290 329660 330991 gene locus_tag LOCUS_13300 329660 330991 CDS product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211273.1 protein_id gnl|my_center|LOCUS_13300 330988 331971 gene locus_tag LOCUS_13310 330988 331971 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase III C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275332.1 protein_id gnl|my_center|LOCUS_13310 331968 333035 gene locus_tag LOCUS_13320 331968 333035 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886737.1 protein_id gnl|my_center|LOCUS_13320 333534 333046 gene locus_tag LOCUS_13330 333534 333046 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088894.1 protein_id gnl|my_center|LOCUS_13330 334789 333623 gene locus_tag LOCUS_13340 334789 333623 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228579.1 protein_id gnl|my_center|LOCUS_13340 335008 337113 gene locus_tag LOCUS_13350 335008 337113 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112888.1 protein_id gnl|my_center|LOCUS_13350 337917 337123 gene locus_tag LOCUS_13360 337917 337123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 339161 337914 gene locus_tag LOCUS_13370 339161 337914 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922632.1 protein_id gnl|my_center|LOCUS_13370 340140 339277 gene locus_tag LOCUS_13380 340140 339277 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224928.1 protein_id gnl|my_center|LOCUS_13380 340294 340974 gene locus_tag LOCUS_13390 340294 340974 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226429.1 protein_id gnl|my_center|LOCUS_13390 342157 341099 gene locus_tag LOCUS_13400 342157 341099 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530916.1 protein_id gnl|my_center|LOCUS_13400 343172 342186 gene locus_tag LOCUS_13410 343172 342186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 344032 343148 gene locus_tag LOCUS_13420 344032 343148 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391201.1 protein_id gnl|my_center|LOCUS_13420 344857 344036 gene locus_tag LOCUS_13430 344857 344036 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240183.1 protein_id gnl|my_center|LOCUS_13430 346239 344854 gene locus_tag LOCUS_13440 gene hydA 346239 344854 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255348.1 protein_id gnl|my_center|LOCUS_13440 346553 346296 gene locus_tag LOCUS_13450 346553 346296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 347966 346587 gene locus_tag LOCUS_13460 gene preA 347966 346587 CDS product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066584.1 protein_id gnl|my_center|LOCUS_13460 349314 347959 gene locus_tag LOCUS_13470 349314 347959 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530893.1 protein_id gnl|my_center|LOCUS_13470 350760 349639 gene locus_tag LOCUS_13480 350760 349639 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889467.1 protein_id gnl|my_center|LOCUS_13480 351728 350757 gene locus_tag LOCUS_13490 351728 350757 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479770.1 protein_id gnl|my_center|LOCUS_13490 353592 351823 gene locus_tag LOCUS_13500 353592 351823 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479771.1 protein_id gnl|my_center|LOCUS_13500 353714 354484 gene locus_tag LOCUS_13510 353714 354484 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152423797.1 protein_id gnl|my_center|LOCUS_13510 354549 355445 gene locus_tag LOCUS_13520 gene murQ 354549 355445 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889472.1 protein_id gnl|my_center|LOCUS_13520 355442 356440 gene locus_tag LOCUS_13530 355442 356440 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889475.1 protein_id gnl|my_center|LOCUS_13530 357339 356446 gene locus_tag LOCUS_13540 357339 356446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 357664 359130 gene locus_tag LOCUS_13550 357664 359130 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889250.1 protein_id gnl|my_center|LOCUS_13550 359156 359593 gene locus_tag LOCUS_13560 359156 359593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 359766 361988 gene locus_tag LOCUS_13570 359766 361988 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388680.1 protein_id gnl|my_center|LOCUS_13570 361990 363090 gene locus_tag LOCUS_13580 361990 363090 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099261595.1 protein_id gnl|my_center|LOCUS_13580 363105 364109 gene locus_tag LOCUS_13590 363105 364109 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022353.1 protein_id gnl|my_center|LOCUS_13590 364212 365372 gene locus_tag LOCUS_13600 364212 365372 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889596.1 protein_id gnl|my_center|LOCUS_13600 365377 367110 gene locus_tag LOCUS_13610 gene asnB 365377 367110 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532773.1 protein_id gnl|my_center|LOCUS_13610 369612 367198 gene locus_tag LOCUS_13620 369612 367198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 371062 369890 gene locus_tag LOCUS_13630 371062 369890 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119434.1 protein_id gnl|my_center|LOCUS_13630 372276 371059 gene locus_tag LOCUS_13640 372276 371059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 373361 372399 gene locus_tag LOCUS_13650 373361 372399 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257102.1 protein_id gnl|my_center|LOCUS_13650 374758 373361 gene locus_tag LOCUS_13660 374758 373361 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141796.1 protein_id gnl|my_center|LOCUS_13660 377023 374879 gene locus_tag LOCUS_13670 377023 374879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 379359 377263 gene locus_tag LOCUS_13680 379359 377263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 381464 379965 gene locus_tag LOCUS_13690 381464 379965 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202937.1 protein_id gnl|my_center|LOCUS_13690 382719 381442 gene locus_tag LOCUS_13700 382719 381442 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257983.1 protein_id gnl|my_center|LOCUS_13700 382935 383609 gene locus_tag LOCUS_13710 382935 383609 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941290.1 protein_id gnl|my_center|LOCUS_13710 383680 385878 gene locus_tag LOCUS_13720 383680 385878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 387796 385985 gene locus_tag LOCUS_13730 387796 385985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 388516 389967 gene locus_tag LOCUS_13740 388516 389967 CDS product undecaprenyl-phosphate galactose phosphotransferase WbaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889294.1 protein_id gnl|my_center|LOCUS_13740 389957 391147 gene locus_tag LOCUS_13750 389957 391147 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203058.1 protein_id gnl|my_center|LOCUS_13750 391144 392313 gene locus_tag LOCUS_13760 391144 392313 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222487.1 protein_id gnl|my_center|LOCUS_13760 392380 393636 gene locus_tag LOCUS_13770 392380 393636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 393767 394870 gene locus_tag LOCUS_13780 393767 394870 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930876.1 protein_id gnl|my_center|LOCUS_13780 394867 396369 gene locus_tag LOCUS_13790 394867 396369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 396366 397133 gene locus_tag LOCUS_13800 396366 397133 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920874.1 protein_id gnl|my_center|LOCUS_13800 397253 398119 gene locus_tag LOCUS_13810 397253 398119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 398130 399074 gene locus_tag LOCUS_13820 398130 399074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 399071 400204 gene locus_tag LOCUS_13830 399071 400204 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729107.1 protein_id gnl|my_center|LOCUS_13830 401509 400259 gene locus_tag LOCUS_13840 401509 400259 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942151.1 protein_id gnl|my_center|LOCUS_13840 402397 401525 gene locus_tag LOCUS_13850 402397 401525 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942150.1 protein_id gnl|my_center|LOCUS_13850 403450 402416 gene locus_tag LOCUS_13860 403450 402416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 404572 403595 gene locus_tag LOCUS_13870 404572 403595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 407085 404731 gene locus_tag LOCUS_13880 407085 404731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 408719 407313 gene locus_tag LOCUS_13890 408719 407313 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889307.1 protein_id gnl|my_center|LOCUS_13890 408859 409914 gene locus_tag LOCUS_13900 408859 409914 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479721.1 protein_id gnl|my_center|LOCUS_13900 409973 411019 gene locus_tag LOCUS_13910 gene galE 409973 411019 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992438.1 protein_id gnl|my_center|LOCUS_13910 411132 412178 gene locus_tag LOCUS_13920 gene gmd 411132 412178 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056481.1 protein_id gnl|my_center|LOCUS_13920 412178 413134 gene locus_tag LOCUS_13930 412178 413134 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941290.1 protein_id gnl|my_center|LOCUS_13930 413364 413624 gene locus_tag LOCUS_13940 gene pprM 413364 413624 CDS product DNA damage response modulator PprM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869024.1 protein_id gnl|my_center|LOCUS_13940 414243 413695 gene locus_tag LOCUS_13950 414243 413695 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350686.1 protein_id gnl|my_center|LOCUS_13950 415111 414251 gene locus_tag LOCUS_13960 415111 414251 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479763.1 protein_id gnl|my_center|LOCUS_13960 417463 415196 gene locus_tag LOCUS_13970 gene yicI 417463 415196 CDS product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027547.1 protein_id gnl|my_center|LOCUS_13970 419496 417460 gene locus_tag LOCUS_13980 419496 417460 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582883.1 protein_id gnl|my_center|LOCUS_13980 421862 419493 gene locus_tag LOCUS_13990 421862 419493 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027033.1 protein_id gnl|my_center|LOCUS_13990 423680 422022 gene locus_tag LOCUS_14000 423680 422022 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582717.1 protein_id gnl|my_center|LOCUS_14000 424622 423729 gene locus_tag LOCUS_14010 424622 423729 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582718.1 protein_id gnl|my_center|LOCUS_14010 425593 424634 gene locus_tag LOCUS_14020 425593 424634 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582719.1 protein_id gnl|my_center|LOCUS_14020 425802 426815 gene locus_tag LOCUS_14030 425802 426815 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226192.1 protein_id gnl|my_center|LOCUS_14030 426812 427573 gene locus_tag LOCUS_14040 gene fabG 426812 427573 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259260.1 protein_id gnl|my_center|LOCUS_14040 >Feature sequence03 486 1286 gene locus_tag LOCUS_14050 gene istB 486 1286 CDS product IS21-like element IS21 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544830.1 protein_id gnl|my_center|LOCUS_14050 2110 2036 gene locus_tag LOCUS_t00130 2110 2036 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 2729 2202 gene locus_tag LOCUS_14060 2729 2202 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479588.1 protein_id gnl|my_center|LOCUS_14060 3806 2913 gene locus_tag LOCUS_14070 3806 2913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 6345 3892 gene locus_tag LOCUS_14080 gene lon 6345 3892 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886994.1 protein_id gnl|my_center|LOCUS_14080 6602 7726 gene locus_tag LOCUS_14090 6602 7726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 8900 7671 gene locus_tag LOCUS_14100 8900 7671 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889163.1 protein_id gnl|my_center|LOCUS_14100 8962 9609 gene locus_tag LOCUS_14110 8962 9609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 11119 9959 gene locus_tag LOCUS_14120 gene hemW 11119 9959 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886778.1 protein_id gnl|my_center|LOCUS_14120 12487 11183 gene locus_tag LOCUS_14130 12487 11183 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349496.1 protein_id gnl|my_center|LOCUS_14130 13067 12537 gene locus_tag LOCUS_14140 13067 12537 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804402.1 protein_id gnl|my_center|LOCUS_14140 13539 13060 gene locus_tag LOCUS_14150 13539 13060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 14240 13593 gene locus_tag LOCUS_14160 14240 13593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 16264 14237 gene locus_tag LOCUS_14170 16264 14237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 17350 16373 gene locus_tag LOCUS_14180 17350 16373 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886703.1 protein_id gnl|my_center|LOCUS_14180 17453 17932 gene locus_tag LOCUS_14190 17453 17932 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886701.1 protein_id gnl|my_center|LOCUS_14190 17938 18411 gene locus_tag LOCUS_14200 17938 18411 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886701.1 protein_id gnl|my_center|LOCUS_14200 18408 18821 gene locus_tag LOCUS_14210 18408 18821 CDS product DUF6157 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090582.1 protein_id gnl|my_center|LOCUS_14210 18818 19216 gene locus_tag LOCUS_14220 18818 19216 CDS product DUF3224 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071754.1 protein_id gnl|my_center|LOCUS_14220 19213 19722 gene locus_tag LOCUS_14230 19213 19722 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886698.1 protein_id gnl|my_center|LOCUS_14230 19754 20275 gene locus_tag LOCUS_14240 19754 20275 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886698.1 protein_id gnl|my_center|LOCUS_14240 20427 20825 gene locus_tag LOCUS_14250 20427 20825 CDS product low affinity iron permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392443.1 protein_id gnl|my_center|LOCUS_14250 20855 21262 gene locus_tag LOCUS_14260 20855 21262 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888350.1 protein_id gnl|my_center|LOCUS_14260 21259 21855 gene locus_tag LOCUS_14270 21259 21855 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222132.1 protein_id gnl|my_center|LOCUS_14270 21896 22594 gene locus_tag LOCUS_14280 21896 22594 CDS product S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479982.1 protein_id gnl|my_center|LOCUS_14280 22603 23610 gene locus_tag LOCUS_14290 gene zapE 22603 23610 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887405.1 protein_id gnl|my_center|LOCUS_14290 25661 23895 gene locus_tag LOCUS_14300 gene dnaG 25661 23895 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887246.1 protein_id gnl|my_center|LOCUS_14300 25871 26302 gene locus_tag LOCUS_14310 25871 26302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888437.1 protein_id gnl|my_center|LOCUS_14310 26666 26334 gene locus_tag LOCUS_14320 26666 26334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888215.1 protein_id gnl|my_center|LOCUS_14320 26812 27375 gene locus_tag LOCUS_14330 26812 27375 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887842.1 protein_id gnl|my_center|LOCUS_14330 27418 27825 gene locus_tag LOCUS_14340 27418 27825 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479784.1 protein_id gnl|my_center|LOCUS_14340 28276 27884 gene locus_tag LOCUS_14350 28276 27884 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888438.1 protein_id gnl|my_center|LOCUS_14350 28776 29096 gene locus_tag LOCUS_14360 28776 29096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 32412 29533 gene locus_tag LOCUS_14370 gene gcvP 32412 29533 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888444.1 protein_id gnl|my_center|LOCUS_14370 32876 32517 gene locus_tag LOCUS_14380 gene gcvH 32876 32517 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888446.1 protein_id gnl|my_center|LOCUS_14380 34055 32985 gene locus_tag LOCUS_14390 gene gcvT 34055 32985 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479785.1 protein_id gnl|my_center|LOCUS_14390 34203 34739 gene locus_tag LOCUS_14400 34203 34739 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888449.1 protein_id gnl|my_center|LOCUS_14400 34750 35373 gene locus_tag LOCUS_14410 34750 35373 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707473.1 protein_id gnl|my_center|LOCUS_14410 35840 35475 gene locus_tag LOCUS_14420 35840 35475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 35764 36396 gene locus_tag LOCUS_14430 35764 36396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 36970 36401 gene locus_tag LOCUS_14440 36970 36401 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888450.1 protein_id gnl|my_center|LOCUS_14440 37077 37871 gene locus_tag LOCUS_14450 37077 37871 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338355.1 protein_id gnl|my_center|LOCUS_14450 38743 37919 gene locus_tag LOCUS_14460 38743 37919 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531095.1 protein_id gnl|my_center|LOCUS_14460 39749 38880 gene locus_tag LOCUS_14470 39749 38880 CDS product DUF4394 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992211.1 protein_id gnl|my_center|LOCUS_14470 41337 40009 gene locus_tag LOCUS_14480 gene hisD 41337 40009 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888771.1 protein_id gnl|my_center|LOCUS_14480 42114 41446 gene locus_tag LOCUS_14490 42114 41446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888767.1 protein_id gnl|my_center|LOCUS_14490 43289 42111 gene locus_tag LOCUS_14500 43289 42111 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479937.1 protein_id gnl|my_center|LOCUS_14500 44000 43386 gene locus_tag LOCUS_14510 44000 43386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479834.1 protein_id gnl|my_center|LOCUS_14510 44501 44127 gene locus_tag LOCUS_14520 44501 44127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 45497 44592 gene locus_tag LOCUS_14530 gene pdxY 45497 44592 CDS product pyridoxal kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349874.1 protein_id gnl|my_center|LOCUS_14530 47009 45543 gene locus_tag LOCUS_14540 47009 45543 CDS product CHASE2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479881.1 protein_id gnl|my_center|LOCUS_14540 48561 46993 gene locus_tag LOCUS_14550 48561 46993 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888271.1 protein_id gnl|my_center|LOCUS_14550 48631 50502 gene locus_tag LOCUS_14560 48631 50502 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025567324.1 protein_id gnl|my_center|LOCUS_14560 51476 50553 gene locus_tag LOCUS_14570 51476 50553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 51772 53937 gene locus_tag LOCUS_14580 51772 53937 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889332.1 protein_id gnl|my_center|LOCUS_14580 53934 54293 gene locus_tag LOCUS_14590 53934 54293 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889330.1 protein_id gnl|my_center|LOCUS_14590 54319 55158 gene locus_tag LOCUS_14600 54319 55158 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227182.1 protein_id gnl|my_center|LOCUS_14600 56524 55298 gene locus_tag LOCUS_14610 56524 55298 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479620.1 protein_id gnl|my_center|LOCUS_14610 57530 56763 gene locus_tag LOCUS_14620 57530 56763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887781.1 protein_id gnl|my_center|LOCUS_14620 57662 57952 gene locus_tag LOCUS_14630 gene gatC 57662 57952 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887918.1 protein_id gnl|my_center|LOCUS_14630 57952 59229 gene locus_tag LOCUS_14640 gene serS 57952 59229 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887919.1 protein_id gnl|my_center|LOCUS_14640 60388 59237 gene locus_tag LOCUS_14650 60388 59237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 60436 60873 gene locus_tag LOCUS_14660 60436 60873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888245.1 protein_id gnl|my_center|LOCUS_14660 61174 60896 gene locus_tag LOCUS_14670 61174 60896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 61316 61831 gene locus_tag LOCUS_14680 61316 61831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 61824 62465 gene locus_tag LOCUS_14690 61824 62465 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480036.1 protein_id gnl|my_center|LOCUS_14690 62627 62481 gene locus_tag LOCUS_14700 62627 62481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 63129 62722 gene locus_tag LOCUS_14710 gene mgsA 63129 62722 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228922.1 protein_id gnl|my_center|LOCUS_14710 64024 63155 gene locus_tag LOCUS_14720 64024 63155 CDS product DUF1206 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118502.1 protein_id gnl|my_center|LOCUS_14720 64140 65171 gene locus_tag LOCUS_14730 64140 65171 CDS product bifunctional nicotinamide-nucleotide adenylyltransferase/Nudix hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889053.1 protein_id gnl|my_center|LOCUS_14730 67764 65236 gene locus_tag LOCUS_14740 67764 65236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 67880 70537 gene locus_tag LOCUS_14750 67880 70537 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886713.1 protein_id gnl|my_center|LOCUS_14750 70600 70673 gene locus_tag LOCUS_t00140 70600 70673 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 70835 71422 gene locus_tag LOCUS_14760 70835 71422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 72386 71493 gene locus_tag LOCUS_14770 72386 71493 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228840.1 protein_id gnl|my_center|LOCUS_14770 72467 74980 gene locus_tag LOCUS_14780 gene priA 72467 74980 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889230.1 protein_id gnl|my_center|LOCUS_14780 75019 75462 gene locus_tag LOCUS_14790 75019 75462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 77257 75497 gene locus_tag LOCUS_14800 77257 75497 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886809.1 protein_id gnl|my_center|LOCUS_14800 79124 80092 gene locus_tag LOCUS_14810 79124 80092 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028328036.1 protein_id gnl|my_center|LOCUS_14810 80174 80755 gene locus_tag LOCUS_14820 80174 80755 CDS product DUF2231 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350498.1 protein_id gnl|my_center|LOCUS_14820 81778 80807 gene locus_tag LOCUS_14830 gene csaB 81778 80807 CDS product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886807.1 protein_id gnl|my_center|LOCUS_14830 83634 81775 gene locus_tag LOCUS_14840 83634 81775 CDS product DUF5693 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871314.1 protein_id gnl|my_center|LOCUS_14840 84399 83767 gene locus_tag LOCUS_14850 gene udk 84399 83767 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886805.1 protein_id gnl|my_center|LOCUS_14850 85427 84396 gene locus_tag LOCUS_14860 85427 84396 CDS product Glu/Leu/Phe/Val dehydrogenase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480186.1 protein_id gnl|my_center|LOCUS_14860 85662 87197 gene locus_tag LOCUS_14870 85662 87197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 88334 87261 gene locus_tag LOCUS_14880 88334 87261 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460176.1 protein_id gnl|my_center|LOCUS_14880 88415 88717 gene locus_tag LOCUS_14890 88415 88717 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480331.1 protein_id gnl|my_center|LOCUS_14890 89069 89503 gene locus_tag LOCUS_14900 89069 89503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889401.1 protein_id gnl|my_center|LOCUS_14900 89522 90295 gene locus_tag LOCUS_14910 gene gmk 89522 90295 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480091.1 protein_id gnl|my_center|LOCUS_14910 90306 90836 gene locus_tag LOCUS_14920 90306 90836 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888916.1 protein_id gnl|my_center|LOCUS_14920 91142 91318 gene locus_tag LOCUS_14930 91142 91318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 91322 92047 gene locus_tag LOCUS_14940 91322 92047 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889063.1 protein_id gnl|my_center|LOCUS_14940 92669 92055 gene locus_tag LOCUS_14950 92669 92055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480327.1 protein_id gnl|my_center|LOCUS_14950 93639 92686 gene locus_tag LOCUS_14960 gene fmt 93639 92686 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889060.1 protein_id gnl|my_center|LOCUS_14960 94292 93636 gene locus_tag LOCUS_14970 gene def 94292 93636 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889059.1 protein_id gnl|my_center|LOCUS_14970 94404 95570 gene locus_tag LOCUS_14980 94404 95570 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480301.1 protein_id gnl|my_center|LOCUS_14980 97553 95850 gene locus_tag LOCUS_14990 97553 95850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 97807 98586 gene locus_tag LOCUS_15000 gene surE 97807 98586 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889023.1 protein_id gnl|my_center|LOCUS_15000 99771 98587 gene locus_tag LOCUS_15010 99771 98587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 100964 99768 gene locus_tag LOCUS_15020 100964 99768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 101290 100961 gene locus_tag LOCUS_15030 101290 100961 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618815.1 protein_id gnl|my_center|LOCUS_15030 101700 101467 gene locus_tag LOCUS_15040 101700 101467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 102594 101737 gene locus_tag LOCUS_15050 102594 101737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 102656 103444 gene locus_tag LOCUS_15060 gene truA 102656 103444 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888918.1 protein_id gnl|my_center|LOCUS_15060 104633 103491 gene locus_tag LOCUS_15070 104633 103491 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887567.1 protein_id gnl|my_center|LOCUS_15070 104719 104795 gene locus_tag LOCUS_t00150 104719 104795 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 104867 104952 gene locus_tag LOCUS_t00160 104867 104952 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 106692 105028 gene locus_tag LOCUS_15080 106692 105028 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177723.1 protein_id gnl|my_center|LOCUS_15080 107321 106842 gene locus_tag LOCUS_15090 gene moaC 107321 106842 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889196.1 protein_id gnl|my_center|LOCUS_15090 107953 107321 gene locus_tag LOCUS_15100 107953 107321 CDS product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480095.1 protein_id gnl|my_center|LOCUS_15100 109042 107984 gene locus_tag LOCUS_15110 109042 107984 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479720.1 protein_id gnl|my_center|LOCUS_15110 109176 109493 gene locus_tag LOCUS_15120 109176 109493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 109572 109901 gene locus_tag LOCUS_15130 109572 109901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 110571 109909 gene locus_tag LOCUS_15140 110571 109909 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036328.1 protein_id gnl|my_center|LOCUS_15140 111788 110568 gene locus_tag LOCUS_15150 111788 110568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 112984 111902 gene locus_tag LOCUS_15160 112984 111902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 113759 113049 gene locus_tag LOCUS_15170 113759 113049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 114102 115307 gene locus_tag LOCUS_15180 114102 115307 CDS product CinA family nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888964.1 protein_id gnl|my_center|LOCUS_15180 115304 116131 gene locus_tag LOCUS_15190 gene thpR 115304 116131 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888965.1 protein_id gnl|my_center|LOCUS_15190 116203 117198 gene locus_tag LOCUS_15200 gene recA 116203 117198 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888966.1 protein_id gnl|my_center|LOCUS_15200 117481 118029 gene locus_tag LOCUS_15210 117481 118029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 118019 118420 gene locus_tag LOCUS_15220 118019 118420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 118407 119390 gene locus_tag LOCUS_15230 118407 119390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 119387 121624 gene locus_tag LOCUS_15240 119387 121624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 122371 121793 gene locus_tag LOCUS_15250 122371 121793 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041443401.1 protein_id gnl|my_center|LOCUS_15250 123338 122406 gene locus_tag LOCUS_15260 123338 122406 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] synthetase/biotin operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028328034.1 protein_id gnl|my_center|LOCUS_15260 123459 123878 gene locus_tag LOCUS_15270 123459 123878 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174007.1 protein_id gnl|my_center|LOCUS_15270 124730 123897 gene locus_tag LOCUS_15280 gene prmC 124730 123897 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886891.1 protein_id gnl|my_center|LOCUS_15280 125315 124731 gene locus_tag LOCUS_15290 125315 124731 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886892.1 protein_id gnl|my_center|LOCUS_15290 125857 125387 gene locus_tag LOCUS_15300 125857 125387 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391393.1 protein_id gnl|my_center|LOCUS_15300 127032 125854 gene locus_tag LOCUS_15310 127032 125854 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888881.1 protein_id gnl|my_center|LOCUS_15310 128553 127042 gene locus_tag LOCUS_15320 128553 127042 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529468.1 protein_id gnl|my_center|LOCUS_15320 129993 128644 gene locus_tag LOCUS_15330 129993 128644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 130340 130071 gene locus_tag LOCUS_15340 130340 130071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 133509 130393 gene locus_tag LOCUS_15350 133509 130393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 133646 133972 gene locus_tag LOCUS_15360 133646 133972 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888587.1 protein_id gnl|my_center|LOCUS_15360 134048 135196 gene locus_tag LOCUS_15370 134048 135196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 136369 135218 gene locus_tag LOCUS_15380 136369 135218 CDS product beta-carotene 2-hydroxylase CYP287A1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889098.1 protein_id gnl|my_center|LOCUS_15380 137802 136357 gene locus_tag LOCUS_15390 137802 136357 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871916.1 protein_id gnl|my_center|LOCUS_15390 138569 137844 gene locus_tag LOCUS_15400 138569 137844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889478.1 protein_id gnl|my_center|LOCUS_15400 139661 138597 gene locus_tag LOCUS_15410 139661 138597 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886737.1 protein_id gnl|my_center|LOCUS_15410 140408 139743 gene locus_tag LOCUS_15420 140408 139743 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886738.1 protein_id gnl|my_center|LOCUS_15420 141414 140398 gene locus_tag LOCUS_15430 gene cruF 141414 140398 CDS product carotenoid 1,2-hydratase CruF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886739.1 protein_id gnl|my_center|LOCUS_15430 142954 141419 gene locus_tag LOCUS_15440 142954 141419 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886741.1 protein_id gnl|my_center|LOCUS_15440 142999 143499 gene locus_tag LOCUS_15450 142999 143499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 143561 143830 gene locus_tag LOCUS_15460 143561 143830 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230147.1 protein_id gnl|my_center|LOCUS_15460 143827 144312 gene locus_tag LOCUS_15470 143827 144312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 144316 144579 gene locus_tag LOCUS_15480 144316 144579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 145222 144635 gene locus_tag LOCUS_15490 145222 144635 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992379.1 protein_id gnl|my_center|LOCUS_15490 145659 145219 gene locus_tag LOCUS_15500 145659 145219 CDS product ketosteroid isomerase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338370.1 protein_id gnl|my_center|LOCUS_15500 145884 147230 gene locus_tag LOCUS_15510 145884 147230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034351083.1 protein_id gnl|my_center|LOCUS_15510 147303 148343 gene locus_tag LOCUS_15520 gene mutY 147303 148343 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888913.1 protein_id gnl|my_center|LOCUS_15520 148425 149240 gene locus_tag LOCUS_15530 148425 149240 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480324.1 protein_id gnl|my_center|LOCUS_15530 149574 150065 gene locus_tag LOCUS_15540 149574 150065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024119628.1 protein_id gnl|my_center|LOCUS_15540 150153 152471 gene locus_tag LOCUS_15550 150153 152471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 152577 155357 gene locus_tag LOCUS_15560 152577 155357 CDS product DUF11 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480374.1 protein_id gnl|my_center|LOCUS_15560 155357 160222 gene locus_tag LOCUS_15570 155357 160222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 160344 165413 gene locus_tag LOCUS_15580 160344 165413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 165450 166376 gene locus_tag LOCUS_15590 165450 166376 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889019.1 protein_id gnl|my_center|LOCUS_15590 166915 166430 gene locus_tag LOCUS_15600 166915 166430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 167006 167560 gene locus_tag LOCUS_15610 167006 167560 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189008657.1 protein_id gnl|my_center|LOCUS_15610 167791 167654 gene locus_tag LOCUS_15620 167791 167654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 168289 167822 gene locus_tag LOCUS_15630 168289 167822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15630 168368 169123 gene locus_tag LOCUS_15640 168368 169123 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886664.1 protein_id gnl|my_center|LOCUS_15640 169120 169569 gene locus_tag LOCUS_15650 169120 169569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 170138 169635 gene locus_tag LOCUS_15660 170138 169635 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257161.1 protein_id gnl|my_center|LOCUS_15660 171448 170237 gene locus_tag LOCUS_15670 171448 170237 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889017.1 protein_id gnl|my_center|LOCUS_15670 171563 173254 gene locus_tag LOCUS_15680 171563 173254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 173608 173270 gene locus_tag LOCUS_15690 173608 173270 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889215.1 protein_id gnl|my_center|LOCUS_15690 174403 173612 gene locus_tag LOCUS_15700 174403 173612 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480276.1 protein_id gnl|my_center|LOCUS_15700 175418 174396 gene locus_tag LOCUS_15710 175418 174396 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350864.1 protein_id gnl|my_center|LOCUS_15710 176288 175425 gene locus_tag LOCUS_15720 176288 175425 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480277.1 protein_id gnl|my_center|LOCUS_15720 176653 177039 gene locus_tag LOCUS_15730 176653 177039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 177691 177047 gene locus_tag LOCUS_15740 177691 177047 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871511.1 protein_id gnl|my_center|LOCUS_15740 177727 178356 gene locus_tag LOCUS_15750 177727 178356 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029782.1 protein_id gnl|my_center|LOCUS_15750 178593 178360 gene locus_tag LOCUS_15760 178593 178360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 178865 178590 gene locus_tag LOCUS_15770 178865 178590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 178821 179828 gene locus_tag LOCUS_15780 178821 179828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 179848 180516 gene locus_tag LOCUS_15790 179848 180516 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350872.1 protein_id gnl|my_center|LOCUS_15790 181168 180536 gene locus_tag LOCUS_15800 gene alkA 181168 180536 CDS product 3-methyladenine DNA glycosylase AlkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889208.1 protein_id gnl|my_center|LOCUS_15800 181879 182382 gene locus_tag LOCUS_15810 181879 182382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 182450 183106 gene locus_tag LOCUS_15820 182450 183106 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525015.1 protein_id gnl|my_center|LOCUS_15820 183066 185447 gene locus_tag LOCUS_15830 183066 185447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 185438 185968 gene locus_tag LOCUS_15840 185438 185968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 186706 185978 gene locus_tag LOCUS_15850 gene tmpR 186706 185978 CDS product bifunctional dihydropteridine reductase/dihydrofolate reductase TmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172549.1 protein_id gnl|my_center|LOCUS_15850 187113 186703 gene locus_tag LOCUS_15860 187113 186703 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172548.1 protein_id gnl|my_center|LOCUS_15860 188610 187147 gene locus_tag LOCUS_15870 188610 187147 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887156.1 protein_id gnl|my_center|LOCUS_15870 189554 188634 gene locus_tag LOCUS_15880 189554 188634 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871202.1 protein_id gnl|my_center|LOCUS_15880 189756 189947 gene locus_tag LOCUS_15890 189756 189947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177715.1 protein_id gnl|my_center|LOCUS_15890 190066 190716 gene locus_tag LOCUS_15900 190066 190716 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889003.1 protein_id gnl|my_center|LOCUS_15900 190762 191184 gene locus_tag LOCUS_15910 190762 191184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 191302 191601 gene locus_tag LOCUS_15920 gene rpoZ 191302 191601 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480122.1 protein_id gnl|my_center|LOCUS_15920 191682 192974 gene locus_tag LOCUS_15930 191682 192974 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017870846.1 protein_id gnl|my_center|LOCUS_15930 193576 193004 gene locus_tag LOCUS_15940 193576 193004 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177743.1 protein_id gnl|my_center|LOCUS_15940 194894 193635 gene locus_tag LOCUS_15950 194894 193635 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886882.1 protein_id gnl|my_center|LOCUS_15950 195502 194900 gene locus_tag LOCUS_15960 195502 194900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 196389 195655 gene locus_tag LOCUS_15970 196389 195655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887094.1 protein_id gnl|my_center|LOCUS_15970 196662 196432 gene locus_tag LOCUS_15980 196662 196432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 196680 197240 gene locus_tag LOCUS_15990 gene pyrE 196680 197240 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887092.1 protein_id gnl|my_center|LOCUS_15990 199394 197586 gene locus_tag LOCUS_16000 199394 197586 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886743.1 protein_id gnl|my_center|LOCUS_16000 201255 199459 gene locus_tag LOCUS_16010 201255 199459 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886744.1 protein_id gnl|my_center|LOCUS_16010 202162 201380 gene locus_tag LOCUS_16020 202162 201380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 202387 202175 gene locus_tag LOCUS_16030 202387 202175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 202278 202907 gene locus_tag LOCUS_16040 gene cmk 202278 202907 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480105.1 protein_id gnl|my_center|LOCUS_16040 203486 202911 gene locus_tag LOCUS_16050 203486 202911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 205721 203583 gene locus_tag LOCUS_16060 205721 203583 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227833.1 protein_id gnl|my_center|LOCUS_16060 207331 205718 gene locus_tag LOCUS_16070 207331 205718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 207640 208251 gene locus_tag LOCUS_16080 207640 208251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889166.1 protein_id gnl|my_center|LOCUS_16080 208350 209318 gene locus_tag LOCUS_16090 208350 209318 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480366.1 protein_id gnl|my_center|LOCUS_16090 209329 210414 gene locus_tag LOCUS_16100 209329 210414 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480366.1 protein_id gnl|my_center|LOCUS_16100 211300 210518 gene locus_tag LOCUS_16110 211300 210518 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480190.1 protein_id gnl|my_center|LOCUS_16110 211420 212043 gene locus_tag LOCUS_16120 211420 212043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051056491.1 protein_id gnl|my_center|LOCUS_16120 212066 212983 gene locus_tag LOCUS_16130 212066 212983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888947.1 protein_id gnl|my_center|LOCUS_16130 213015 214046 gene locus_tag LOCUS_16140 213015 214046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 214929 214000 gene locus_tag LOCUS_16150 214929 214000 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888990.1 protein_id gnl|my_center|LOCUS_16150 215427 214951 gene locus_tag LOCUS_16160 215427 214951 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888989.1 protein_id gnl|my_center|LOCUS_16160 217213 215492 gene locus_tag LOCUS_16170 217213 215492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 218096 217353 gene locus_tag LOCUS_16180 218096 217353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 221417 218400 gene locus_tag LOCUS_16190 221417 218400 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030729.1 protein_id gnl|my_center|LOCUS_16190 221502 222965 gene locus_tag LOCUS_16200 221502 222965 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349847.1 protein_id gnl|my_center|LOCUS_16200 223081 223581 gene locus_tag LOCUS_16210 223081 223581 CDS product DUF3105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029732672.1 protein_id gnl|my_center|LOCUS_16210 223687 225699 gene locus_tag LOCUS_16220 223687 225699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177805.1 protein_id gnl|my_center|LOCUS_16220 226876 225710 gene locus_tag LOCUS_16230 226876 225710 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889233.1 protein_id gnl|my_center|LOCUS_16230 226967 227386 gene locus_tag LOCUS_16240 226967 227386 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889232.1 protein_id gnl|my_center|LOCUS_16240 227445 229196 gene locus_tag LOCUS_16250 227445 229196 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889207.1 protein_id gnl|my_center|LOCUS_16250 230665 229259 gene locus_tag LOCUS_16260 gene lpdA 230665 229259 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480111.1 protein_id gnl|my_center|LOCUS_16260 231427 230765 gene locus_tag LOCUS_16270 231427 230765 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706286.1 protein_id gnl|my_center|LOCUS_16270 233127 231424 gene locus_tag LOCUS_16280 233127 231424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 233338 234666 gene locus_tag LOCUS_16290 233338 234666 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480112.1 protein_id gnl|my_center|LOCUS_16290 234794 235642 gene locus_tag LOCUS_16300 234794 235642 CDS product DUF2167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035601.1 protein_id gnl|my_center|LOCUS_16300 236644 235706 gene locus_tag LOCUS_16310 236644 235706 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888939.1 protein_id gnl|my_center|LOCUS_16310 237837 236692 gene locus_tag LOCUS_16320 237837 236692 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480088.1 protein_id gnl|my_center|LOCUS_16320 239056 238241 gene locus_tag LOCUS_16330 239056 238241 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888836.1 protein_id gnl|my_center|LOCUS_16330 240064 239066 gene locus_tag LOCUS_16340 240064 239066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 240857 240174 gene locus_tag LOCUS_16350 240857 240174 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311533.1 protein_id gnl|my_center|LOCUS_16350 240920 242347 gene locus_tag LOCUS_16360 240920 242347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 242847 242329 gene locus_tag LOCUS_16370 242847 242329 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034351055.1 protein_id gnl|my_center|LOCUS_16370 243349 242855 gene locus_tag LOCUS_16380 243349 242855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 244212 243346 gene locus_tag LOCUS_16390 244212 243346 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888839.1 protein_id gnl|my_center|LOCUS_16390 244575 245825 gene locus_tag LOCUS_16400 244575 245825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 245954 247873 gene locus_tag LOCUS_16410 245954 247873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 248883 247927 gene locus_tag LOCUS_16420 248883 247927 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886913.1 protein_id gnl|my_center|LOCUS_16420 249040 249918 gene locus_tag LOCUS_16430 249040 249918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129118061.1 protein_id gnl|my_center|LOCUS_16430 250052 250876 gene locus_tag LOCUS_16440 250052 250876 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034351059.1 protein_id gnl|my_center|LOCUS_16440 252917 250890 gene locus_tag LOCUS_16450 252917 250890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 254979 252991 gene locus_tag LOCUS_16460 254979 252991 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886811.1 protein_id gnl|my_center|LOCUS_16460 255235 255426 gene locus_tag LOCUS_16470 255235 255426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 255465 256580 gene locus_tag LOCUS_16480 255465 256580 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889118.1 protein_id gnl|my_center|LOCUS_16480 257079 256588 gene locus_tag LOCUS_16490 257079 256588 CDS product DUF4385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126352787.1 protein_id gnl|my_center|LOCUS_16490 257881 257240 gene locus_tag LOCUS_16500 257881 257240 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888891.1 protein_id gnl|my_center|LOCUS_16500 258865 257954 gene locus_tag LOCUS_16510 258865 257954 CDS product NmrA family NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530656.1 protein_id gnl|my_center|LOCUS_16510 259312 258929 gene locus_tag LOCUS_16520 259312 258929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 261763 259469 gene locus_tag LOCUS_16530 261763 259469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 262706 261810 gene locus_tag LOCUS_16540 262706 261810 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480339.1 protein_id gnl|my_center|LOCUS_16540 263352 262723 gene locus_tag LOCUS_16550 263352 262723 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883952.1 protein_id gnl|my_center|LOCUS_16550 264895 263345 gene locus_tag LOCUS_16560 264895 263345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 265041 267101 gene locus_tag LOCUS_16570 gene kdpB 265041 267101 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883953.1 protein_id gnl|my_center|LOCUS_16570 267269 268972 gene locus_tag LOCUS_16580 gene kdpA 267269 268972 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883954.1 protein_id gnl|my_center|LOCUS_16580 268969 269604 gene locus_tag LOCUS_16590 gene kdpC 268969 269604 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883955.1 protein_id gnl|my_center|LOCUS_16590 269609 270700 gene locus_tag LOCUS_16600 269609 270700 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883956.1 protein_id gnl|my_center|LOCUS_16600 270820 272976 gene locus_tag LOCUS_16610 270820 272976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888893.1 protein_id gnl|my_center|LOCUS_16610 274077 273181 gene locus_tag LOCUS_16620 274077 273181 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384730.1 protein_id gnl|my_center|LOCUS_16620 274248 275498 gene locus_tag LOCUS_16630 274248 275498 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152423537.1 protein_id gnl|my_center|LOCUS_16630 276869 275544 gene locus_tag LOCUS_16640 gene obgE 276869 275544 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886732.1 protein_id gnl|my_center|LOCUS_16640 277263 276988 gene locus_tag LOCUS_16650 gene rpmA 277263 276988 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886733.1 protein_id gnl|my_center|LOCUS_16650 277583 277281 gene locus_tag LOCUS_16660 gene rplU 277583 277281 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480310.1 protein_id gnl|my_center|LOCUS_16660 277965 278342 gene locus_tag LOCUS_16670 277965 278342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 278402 279814 gene locus_tag LOCUS_16680 278402 279814 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480147.1 protein_id gnl|my_center|LOCUS_16680 279878 281074 gene locus_tag LOCUS_16690 279878 281074 CDS product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965084.1 protein_id gnl|my_center|LOCUS_16690 282955 281168 gene locus_tag LOCUS_16700 282955 281168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 285506 283008 gene locus_tag LOCUS_16710 285506 283008 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871577.1 protein_id gnl|my_center|LOCUS_16710 286210 285521 gene locus_tag LOCUS_16720 286210 285521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 286737 286282 gene locus_tag LOCUS_16730 gene ddrD 286737 286282 CDS product DNA damage response protein DdrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886971.1 protein_id gnl|my_center|LOCUS_16730 288100 286916 gene locus_tag LOCUS_16740 288100 286916 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479600.1 protein_id gnl|my_center|LOCUS_16740 288525 288166 gene locus_tag LOCUS_16750 288525 288166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 288648 289340 gene locus_tag LOCUS_16760 288648 289340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 289458 289916 gene locus_tag LOCUS_16770 289458 289916 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479599.1 protein_id gnl|my_center|LOCUS_16770 290252 289977 gene locus_tag LOCUS_16780 gene rpsO 290252 289977 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886986.1 protein_id gnl|my_center|LOCUS_16780 290471 290553 gene locus_tag LOCUS_t00170 290471 290553 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 291064 290849 gene locus_tag LOCUS_16790 291064 290849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 291498 291094 gene locus_tag LOCUS_16800 291498 291094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480362.1 protein_id gnl|my_center|LOCUS_16800 291497 292219 gene locus_tag LOCUS_16810 291497 292219 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034351160.1 protein_id gnl|my_center|LOCUS_16810 293549 292290 gene locus_tag LOCUS_16820 293549 292290 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888819.1 protein_id gnl|my_center|LOCUS_16820 293870 293688 gene locus_tag LOCUS_16830 gene rpmF 293870 293688 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888992.1 protein_id gnl|my_center|LOCUS_16830 294008 294490 gene locus_tag LOCUS_16840 294008 294490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 294548 295651 gene locus_tag LOCUS_16850 gene proB 294548 295651 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888462.1 protein_id gnl|my_center|LOCUS_16850 295707 296453 gene locus_tag LOCUS_16860 295707 296453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 296450 297352 gene locus_tag LOCUS_16870 296450 297352 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228840.1 protein_id gnl|my_center|LOCUS_16870 298645 297356 gene locus_tag LOCUS_16880 298645 297356 CDS product DUF4127 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480316.1 protein_id gnl|my_center|LOCUS_16880 298725 299885 gene locus_tag LOCUS_16890 298725 299885 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887119.1 protein_id gnl|my_center|LOCUS_16890 299885 300571 gene locus_tag LOCUS_16900 299885 300571 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887118.1 protein_id gnl|my_center|LOCUS_16900 300868 300581 gene locus_tag LOCUS_16910 300868 300581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 304723 301010 gene locus_tag LOCUS_16920 gene pulA 304723 301010 CDS product pullulanase-type alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479569.1 protein_id gnl|my_center|LOCUS_16920 304827 305057 gene locus_tag LOCUS_16930 304827 305057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 305087 305392 gene locus_tag LOCUS_16940 305087 305392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479691.1 protein_id gnl|my_center|LOCUS_16940 306109 305402 gene locus_tag LOCUS_16950 306109 305402 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230868.1 protein_id gnl|my_center|LOCUS_16950 306145 307047 gene locus_tag LOCUS_16960 306145 307047 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479983.1 protein_id gnl|my_center|LOCUS_16960 307194 307661 gene locus_tag LOCUS_16970 307194 307661 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887429.1 protein_id gnl|my_center|LOCUS_16970 308379 307648 gene locus_tag LOCUS_16980 308379 307648 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230740.1 protein_id gnl|my_center|LOCUS_16980 308506 308841 gene locus_tag LOCUS_16990 308506 308841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 308915 310429 gene locus_tag LOCUS_17000 gene cobA 308915 310429 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349821.1 protein_id gnl|my_center|LOCUS_17000 310500 311066 gene locus_tag LOCUS_17010 310500 311066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 311063 312160 gene locus_tag LOCUS_17020 gene hemA 311063 312160 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480102.1 protein_id gnl|my_center|LOCUS_17020 312216 313091 gene locus_tag LOCUS_17030 312216 313091 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479587.1 protein_id gnl|my_center|LOCUS_17030 313084 313548 gene locus_tag LOCUS_17040 313084 313548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 314587 313574 gene locus_tag LOCUS_17050 314587 313574 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887010.1 protein_id gnl|my_center|LOCUS_17050 315647 314625 gene locus_tag LOCUS_17060 315647 314625 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887009.1 protein_id gnl|my_center|LOCUS_17060 317461 315743 gene locus_tag LOCUS_17070 317461 315743 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479585.1 protein_id gnl|my_center|LOCUS_17070 317670 318719 gene locus_tag LOCUS_17080 317670 318719 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887007.1 protein_id gnl|my_center|LOCUS_17080 318781 319248 gene locus_tag LOCUS_17090 318781 319248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 319393 320292 gene locus_tag LOCUS_17100 319393 320292 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480273.1 protein_id gnl|my_center|LOCUS_17100 320407 321090 gene locus_tag LOCUS_17110 320407 321090 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177725.1 protein_id gnl|my_center|LOCUS_17110 321787 321107 gene locus_tag LOCUS_17120 321787 321107 CDS product diphthine--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546873.1 protein_id gnl|my_center|LOCUS_17120 322269 321784 gene locus_tag LOCUS_17130 322269 321784 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887620.1 protein_id gnl|my_center|LOCUS_17130 323353 322256 gene locus_tag LOCUS_17140 gene prfA 323353 322256 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349619.1 protein_id gnl|my_center|LOCUS_17140 323612 324574 gene locus_tag LOCUS_17150 323612 324574 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887921.1 protein_id gnl|my_center|LOCUS_17150 325535 324801 gene locus_tag LOCUS_17160 325535 324801 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083847.1 protein_id gnl|my_center|LOCUS_17160 325980 325540 gene locus_tag LOCUS_17170 325980 325540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 327265 326051 gene locus_tag LOCUS_17180 327265 326051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 327864 327253 gene locus_tag LOCUS_17190 327864 327253 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141762.1 protein_id gnl|my_center|LOCUS_17190 329857 327992 gene locus_tag LOCUS_17200 gene ftsH 329857 327992 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480146.1 protein_id gnl|my_center|LOCUS_17200 330051 330713 gene locus_tag LOCUS_17210 330051 330713 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888953.1 protein_id gnl|my_center|LOCUS_17210 330724 332115 gene locus_tag LOCUS_17220 330724 332115 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888954.1 protein_id gnl|my_center|LOCUS_17220 332155 332934 gene locus_tag LOCUS_17230 332155 332934 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350521.1 protein_id gnl|my_center|LOCUS_17230 333016 333252 gene locus_tag LOCUS_17240 333016 333252 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480082.1 protein_id gnl|my_center|LOCUS_17240 333635 334573 gene locus_tag LOCUS_17250 333635 334573 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889088.1 protein_id gnl|my_center|LOCUS_17250 335000 334641 gene locus_tag LOCUS_17260 335000 334641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 335811 335065 gene locus_tag LOCUS_17270 gene rph 335811 335065 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888224.1 protein_id gnl|my_center|LOCUS_17270 336653 335808 gene locus_tag LOCUS_17280 gene murI 336653 335808 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166466071.1 protein_id gnl|my_center|LOCUS_17280 336697 337488 gene locus_tag LOCUS_17290 336697 337488 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031344.1 protein_id gnl|my_center|LOCUS_17290 337601 337852 gene locus_tag LOCUS_17300 337601 337852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 337963 338823 gene locus_tag LOCUS_17310 337963 338823 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226050.1 protein_id gnl|my_center|LOCUS_17310 340178 338958 gene locus_tag LOCUS_17320 340178 338958 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211249054.1 protein_id gnl|my_center|LOCUS_17320 340273 341190 gene locus_tag LOCUS_17330 gene fba 340273 341190 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888228.1 protein_id gnl|my_center|LOCUS_17330 341294 342010 gene locus_tag LOCUS_17340 341294 342010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 342215 344914 gene locus_tag LOCUS_17350 342215 344914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 345048 345461 gene locus_tag LOCUS_17360 345048 345461 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088942.1 protein_id gnl|my_center|LOCUS_17360 346446 345535 gene locus_tag LOCUS_17370 346446 345535 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886774.1 protein_id gnl|my_center|LOCUS_17370 347280 346465 gene locus_tag LOCUS_17380 347280 346465 CDS product VF530 family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350936.1 protein_id gnl|my_center|LOCUS_17380 347950 347294 gene locus_tag LOCUS_17390 347950 347294 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026138697.1 protein_id gnl|my_center|LOCUS_17390 349929 348049 gene locus_tag LOCUS_17400 gene dnaK 349929 348049 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886777.1 protein_id gnl|my_center|LOCUS_17400 350169 350579 gene locus_tag LOCUS_17410 350169 350579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 350576 350890 gene locus_tag LOCUS_17420 350576 350890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 352368 350887 gene locus_tag LOCUS_17430 352368 350887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 353402 352368 gene locus_tag LOCUS_17440 353402 352368 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889414.1 protein_id gnl|my_center|LOCUS_17440 354280 353399 gene locus_tag LOCUS_17450 354280 353399 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057222.1 protein_id gnl|my_center|LOCUS_17450 355185 354277 gene locus_tag LOCUS_17460 355185 354277 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056604.1 protein_id gnl|my_center|LOCUS_17460 356684 355431 gene locus_tag LOCUS_17470 356684 355431 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920974.1 protein_id gnl|my_center|LOCUS_17470 357651 356791 gene locus_tag LOCUS_17480 357651 356791 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098513.1 protein_id gnl|my_center|LOCUS_17480 358119 360230 gene locus_tag LOCUS_17490 358119 360230 CDS product glycosyl hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226876.1 protein_id gnl|my_center|LOCUS_17490 361179 360286 gene locus_tag LOCUS_17500 gene aguB 361179 360286 CDS product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889160.1 protein_id gnl|my_center|LOCUS_17500 361399 361163 gene locus_tag LOCUS_17510 361399 361163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 361670 362038 gene locus_tag LOCUS_17520 361670 362038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 362104 362346 gene locus_tag LOCUS_17530 362104 362346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 362980 362378 gene locus_tag LOCUS_17540 362980 362378 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889270.1 protein_id gnl|my_center|LOCUS_17540 364181 362991 gene locus_tag LOCUS_17550 364181 362991 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889269.1 protein_id gnl|my_center|LOCUS_17550 364996 364178 gene locus_tag LOCUS_17560 364996 364178 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889268.1 protein_id gnl|my_center|LOCUS_17560 365904 364993 gene locus_tag LOCUS_17570 365904 364993 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889267.1 protein_id gnl|my_center|LOCUS_17570 366447 366037 gene locus_tag LOCUS_17580 366447 366037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 366380 366607 gene locus_tag LOCUS_17590 366380 366607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 368280 367189 gene locus_tag LOCUS_17600 gene nos 368280 367189 CDS product nitric oxide synthase oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889221.1 protein_id gnl|my_center|LOCUS_17600 368468 369895 gene locus_tag LOCUS_17610 gene thrC 368468 369895 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889619.1 protein_id gnl|my_center|LOCUS_17610 369921 370199 gene locus_tag LOCUS_17620 369921 370199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 370235 371206 gene locus_tag LOCUS_17630 370235 371206 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888962.1 protein_id gnl|my_center|LOCUS_17630 371312 371965 gene locus_tag LOCUS_17640 371312 371965 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888961.1 protein_id gnl|my_center|LOCUS_17640 372328 371981 gene locus_tag LOCUS_17650 372328 371981 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979093.1 protein_id gnl|my_center|LOCUS_17650 373516 372368 gene locus_tag LOCUS_17660 373516 372368 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888960.1 protein_id gnl|my_center|LOCUS_17660 374580 373513 gene locus_tag LOCUS_17670 374580 373513 CDS product agmatine/peptidylarginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618851.1 protein_id gnl|my_center|LOCUS_17670 374957 374619 gene locus_tag LOCUS_17680 374957 374619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869659.1 protein_id gnl|my_center|LOCUS_17680 375360 375007 gene locus_tag LOCUS_17690 375360 375007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 376830 375442 gene locus_tag LOCUS_17700 376830 375442 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886668.1 protein_id gnl|my_center|LOCUS_17700 377481 377657 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq acgtgaacggcggcaatgtcc 377965 378264 gene locus_tag LOCUS_17710 377965 378264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 378314 379012 gene locus_tag LOCUS_17720 378314 379012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480249.1 protein_id gnl|my_center|LOCUS_17720 379101 379454 gene locus_tag LOCUS_17730 379101 379454 CDS product DUF2089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480250.1 protein_id gnl|my_center|LOCUS_17730 379827 379468 gene locus_tag LOCUS_17740 379827 379468 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724123.1 protein_id gnl|my_center|LOCUS_17740 380374 379916 gene locus_tag LOCUS_17750 380374 379916 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886773.1 protein_id gnl|my_center|LOCUS_17750 381186 380491 gene locus_tag LOCUS_17760 381186 380491 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888988.1 protein_id gnl|my_center|LOCUS_17760 381432 383267 gene locus_tag LOCUS_17770 381432 383267 CDS product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888987.1 protein_id gnl|my_center|LOCUS_17770 383336 383821 gene locus_tag LOCUS_17780 383336 383821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 383863 384615 gene locus_tag LOCUS_17790 383863 384615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 384612 384794 gene locus_tag LOCUS_17800 384612 384794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 384814 385692 gene locus_tag LOCUS_17810 384814 385692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 386401 385733 gene locus_tag LOCUS_17820 386401 385733 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889329.1 protein_id gnl|my_center|LOCUS_17820 386507 387301 gene locus_tag LOCUS_17830 386507 387301 CDS product peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888790.1 protein_id gnl|my_center|LOCUS_17830 387482 389281 gene locus_tag LOCUS_17840 387482 389281 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889020.1 protein_id gnl|my_center|LOCUS_17840 389283 389633 gene locus_tag LOCUS_17850 389283 389633 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349502.1 protein_id gnl|my_center|LOCUS_17850 390267 389677 gene locus_tag LOCUS_17860 390267 389677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 390206 390442 gene locus_tag LOCUS_17870 390206 390442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 391360 390488 gene locus_tag LOCUS_17880 391360 390488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 391432 392214 gene locus_tag LOCUS_17890 391432 392214 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211713.1 protein_id gnl|my_center|LOCUS_17890 392947 392228 gene locus_tag LOCUS_17900 gene ubiE 392947 392228 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889031.1 protein_id gnl|my_center|LOCUS_17900 393368 392991 gene locus_tag LOCUS_17910 393368 392991 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973223.1 protein_id gnl|my_center|LOCUS_17910 394567 393380 gene locus_tag LOCUS_17920 394567 393380 CDS product BioF/Kbl family PLP-dependent acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618850.1 protein_id gnl|my_center|LOCUS_17920 395051 394629 gene locus_tag LOCUS_17930 395051 394629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 396539 395100 gene locus_tag LOCUS_17940 396539 395100 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190031345.1 protein_id gnl|my_center|LOCUS_17940 397203 396616 gene locus_tag LOCUS_17950 397203 396616 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086729.1 protein_id gnl|my_center|LOCUS_17950 399264 397306 gene locus_tag LOCUS_17960 399264 397306 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225976.1 protein_id gnl|my_center|LOCUS_17960 400030 399401 gene locus_tag LOCUS_17970 400030 399401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886931.1 protein_id gnl|my_center|LOCUS_17970 400659 400027 gene locus_tag LOCUS_17980 400659 400027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886930.1 protein_id gnl|my_center|LOCUS_17980 402447 401044 gene locus_tag LOCUS_17990 gene lpdA 402447 401044 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888996.1 protein_id gnl|my_center|LOCUS_17990 402633 404069 gene locus_tag LOCUS_18000 402633 404069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 404262 408191 gene locus_tag LOCUS_18010 gene dnaE 404262 408191 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887152.1 protein_id gnl|my_center|LOCUS_18010 408703 408257 gene locus_tag LOCUS_18020 408703 408257 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088388.1 protein_id gnl|my_center|LOCUS_18020 411338 408735 gene locus_tag LOCUS_18030 411338 408735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 412631 411342 gene locus_tag LOCUS_18040 412631 411342 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028328044.1 protein_id gnl|my_center|LOCUS_18040 412543 412791 gene locus_tag LOCUS_18050 412543 412791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 413429 412923 gene locus_tag LOCUS_18060 413429 412923 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889066.1 protein_id gnl|my_center|LOCUS_18060 413590 414612 gene locus_tag LOCUS_18070 413590 414612 CDS product tRNA-dihydrouridine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017870267.1 protein_id gnl|my_center|LOCUS_18070 414609 415184 gene locus_tag LOCUS_18080 414609 415184 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034351055.1 protein_id gnl|my_center|LOCUS_18080 416129 415257 gene locus_tag LOCUS_18090 gene rocF 416129 415257 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887296.1 protein_id gnl|my_center|LOCUS_18090 416809 416270 gene locus_tag LOCUS_18100 416809 416270 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887298.1 protein_id gnl|my_center|LOCUS_18100 416937 417608 gene locus_tag LOCUS_18110 416937 417608 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926013.1 protein_id gnl|my_center|LOCUS_18110 417906 418355 gene locus_tag LOCUS_18120 417906 418355 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888860.1 protein_id gnl|my_center|LOCUS_18120 418973 418419 gene locus_tag LOCUS_18130 gene ddrB 418973 418419 CDS product single-stranded DNA-binding protein DdrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480237.1 protein_id gnl|my_center|LOCUS_18130 419822 419019 gene locus_tag LOCUS_18140 419822 419019 CDS product acyl-CoA N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886691.1 protein_id gnl|my_center|LOCUS_18140 420901 419819 gene locus_tag LOCUS_18150 gene menC 420901 419819 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480242.1 protein_id gnl|my_center|LOCUS_18150 >Feature sequence04 1275 286 gene locus_tag LOCUS_18160 1275 286 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225970.1 protein_id gnl|my_center|LOCUS_18160 1413 2837 gene locus_tag LOCUS_18170 1413 2837 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349804.1 protein_id gnl|my_center|LOCUS_18170 3130 3357 gene locus_tag LOCUS_18180 3130 3357 CDS product KGG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014508120.1 protein_id gnl|my_center|LOCUS_18180 3509 3865 gene locus_tag LOCUS_18190 3509 3865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 3947 4037 gene locus_tag LOCUS_t00180 3947 4037 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4081 4272 gene locus_tag LOCUS_18200 4081 4272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889188.1 protein_id gnl|my_center|LOCUS_18200 5151 4495 gene locus_tag LOCUS_18210 5151 4495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 5330 7240 gene locus_tag LOCUS_18220 gene treZ 5330 7240 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887109.1 protein_id gnl|my_center|LOCUS_18220 7237 7485 gene locus_tag LOCUS_18230 7237 7485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 7537 8421 gene locus_tag LOCUS_18240 7537 8421 CDS product FRG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017872006.1 protein_id gnl|my_center|LOCUS_18240 9324 8479 gene locus_tag LOCUS_18250 9324 8479 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525046.1 protein_id gnl|my_center|LOCUS_18250 10204 9305 gene locus_tag LOCUS_18260 10204 9305 CDS product isoaspartyl peptidase/L-asparaginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525045.1 protein_id gnl|my_center|LOCUS_18260 13010 10197 gene locus_tag LOCUS_18270 gene cphA 13010 10197 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207603497.1 protein_id gnl|my_center|LOCUS_18270 16068 13303 gene locus_tag LOCUS_18280 16068 13303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 16605 16120 gene locus_tag LOCUS_18290 16605 16120 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063653087.1 protein_id gnl|my_center|LOCUS_18290 17944 16868 gene locus_tag LOCUS_18300 17944 16868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 18325 18864 gene locus_tag LOCUS_18310 18325 18864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 20060 18885 gene locus_tag LOCUS_18320 20060 18885 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177803.1 protein_id gnl|my_center|LOCUS_18320 21832 20057 gene locus_tag LOCUS_18330 21832 20057 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883999.1 protein_id gnl|my_center|LOCUS_18330 22821 21829 gene locus_tag LOCUS_18340 22821 21829 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883998.1 protein_id gnl|my_center|LOCUS_18340 23260 22853 gene locus_tag LOCUS_18350 23260 22853 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883997.1 protein_id gnl|my_center|LOCUS_18350 23630 23235 gene locus_tag LOCUS_18360 23630 23235 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883996.1 protein_id gnl|my_center|LOCUS_18360 24489 23635 gene locus_tag LOCUS_18370 24489 23635 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618919.1 protein_id gnl|my_center|LOCUS_18370 25296 24541 gene locus_tag LOCUS_18380 25296 24541 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122046.1 protein_id gnl|my_center|LOCUS_18380 26321 25293 gene locus_tag LOCUS_18390 26321 25293 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192803839.1 protein_id gnl|my_center|LOCUS_18390 27648 26353 gene locus_tag LOCUS_18400 gene hisD 27648 26353 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152827738.1 protein_id gnl|my_center|LOCUS_18400 28480 27686 gene locus_tag LOCUS_18410 28480 27686 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027133324.1 protein_id gnl|my_center|LOCUS_18410 29126 28473 gene locus_tag LOCUS_18420 29126 28473 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036036.1 protein_id gnl|my_center|LOCUS_18420 29751 29131 gene locus_tag LOCUS_18430 29751 29131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 30125 31489 gene locus_tag LOCUS_18440 30125 31489 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066912.1 protein_id gnl|my_center|LOCUS_18440 31571 32524 gene locus_tag LOCUS_18450 31571 32524 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244087.1 protein_id gnl|my_center|LOCUS_18450 32524 33381 gene locus_tag LOCUS_18460 32524 33381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 33458 34537 gene locus_tag LOCUS_18470 33458 34537 CDS product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969925.1 protein_id gnl|my_center|LOCUS_18470 34537 35649 gene locus_tag LOCUS_18480 34537 35649 CDS product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969925.1 protein_id gnl|my_center|LOCUS_18480 35693 36634 gene locus_tag LOCUS_18490 35693 36634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18490 36654 37922 gene locus_tag LOCUS_18500 gene hisD 36654 37922 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328258.1 protein_id gnl|my_center|LOCUS_18500 37926 38831 gene locus_tag LOCUS_18510 37926 38831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 38874 39842 gene locus_tag LOCUS_18520 38874 39842 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403656.1 protein_id gnl|my_center|LOCUS_18520 40251 39931 gene locus_tag LOCUS_18530 40251 39931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 40144 40605 gene locus_tag LOCUS_18540 40144 40605 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479743.1 protein_id gnl|my_center|LOCUS_18540 41143 40697 gene locus_tag LOCUS_18550 41143 40697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889401.1 protein_id gnl|my_center|LOCUS_18550 41362 41562 gene locus_tag LOCUS_18560 41362 41562 CDS product DUF2945 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978014.1 protein_id gnl|my_center|LOCUS_18560 44249 41883 gene locus_tag LOCUS_18570 44249 41883 CDS product glucan 1,4-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528921.1 protein_id gnl|my_center|LOCUS_18570 45025 44249 gene locus_tag LOCUS_18580 45025 44249 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974207.1 protein_id gnl|my_center|LOCUS_18580 46494 45022 gene locus_tag LOCUS_18590 gene zwf 46494 45022 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528919.1 protein_id gnl|my_center|LOCUS_18590 47451 46666 gene locus_tag LOCUS_18600 47451 46666 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529940.1 protein_id gnl|my_center|LOCUS_18600 48053 47451 gene locus_tag LOCUS_18610 48053 47451 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405477.1 protein_id gnl|my_center|LOCUS_18610 48172 48474 gene locus_tag LOCUS_18620 48172 48474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 48778 48587 gene locus_tag LOCUS_18630 48778 48587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889188.1 protein_id gnl|my_center|LOCUS_18630 48999 49640 gene locus_tag LOCUS_18640 48999 49640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18640 50703 49666 gene locus_tag LOCUS_18650 50703 49666 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803888.1 protein_id gnl|my_center|LOCUS_18650 50824 52341 gene locus_tag LOCUS_18660 50824 52341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 54212 52356 gene locus_tag LOCUS_18670 54212 52356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 54353 55240 gene locus_tag LOCUS_18680 54353 55240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 55339 55788 gene locus_tag LOCUS_18690 55339 55788 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889046.1 protein_id gnl|my_center|LOCUS_18690 56981 55773 gene locus_tag LOCUS_18700 56981 55773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 57108 57335 gene locus_tag LOCUS_18710 57108 57335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 57348 57536 gene locus_tag LOCUS_18720 57348 57536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 57661 58137 gene locus_tag LOCUS_18730 57661 58137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 58220 59011 gene locus_tag LOCUS_18740 58220 59011 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888398.1 protein_id gnl|my_center|LOCUS_18740 59801 59073 gene locus_tag LOCUS_18750 59801 59073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886752.1 protein_id gnl|my_center|LOCUS_18750 59811 61049 gene locus_tag LOCUS_18760 59811 61049 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226756.1 protein_id gnl|my_center|LOCUS_18760 64236 61141 gene locus_tag LOCUS_18770 64236 61141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 64457 65326 gene locus_tag LOCUS_18780 64457 65326 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223929.1 protein_id gnl|my_center|LOCUS_18780 65586 68021 gene locus_tag LOCUS_18790 65586 68021 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728610.1 protein_id gnl|my_center|LOCUS_18790 68023 68481 gene locus_tag LOCUS_18800 68023 68481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 68478 69317 gene locus_tag LOCUS_18810 68478 69317 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115216.1 protein_id gnl|my_center|LOCUS_18810 69314 69838 gene locus_tag LOCUS_18820 69314 69838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 71070 70117 gene locus_tag LOCUS_18830 71070 70117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 73480 71168 gene locus_tag LOCUS_18840 73480 71168 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223208.1 protein_id gnl|my_center|LOCUS_18840 74721 73705 gene locus_tag LOCUS_18850 74721 73705 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223494.1 protein_id gnl|my_center|LOCUS_18850 75029 74802 gene locus_tag LOCUS_18860 75029 74802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 75162 75944 gene locus_tag LOCUS_18870 75162 75944 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223492.1 protein_id gnl|my_center|LOCUS_18870 75941 76960 gene locus_tag LOCUS_18880 75941 76960 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223491.1 protein_id gnl|my_center|LOCUS_18880 77048 78010 gene locus_tag LOCUS_18890 77048 78010 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975799.1 protein_id gnl|my_center|LOCUS_18890 78280 79590 gene locus_tag LOCUS_18900 78280 79590 CDS product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003829550.1 protein_id gnl|my_center|LOCUS_18900 79587 82859 gene locus_tag LOCUS_18910 79587 82859 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584105.1 protein_id gnl|my_center|LOCUS_18910 82856 83740 gene locus_tag LOCUS_18920 82856 83740 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026819.1 protein_id gnl|my_center|LOCUS_18920 84805 84023 gene locus_tag LOCUS_18930 84805 84023 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392440.1 protein_id gnl|my_center|LOCUS_18930 86547 85060 gene locus_tag LOCUS_18940 86547 85060 CDS product FGGY family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067976.1 protein_id gnl|my_center|LOCUS_18940 87549 86578 gene locus_tag LOCUS_18950 87549 86578 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400585.1 protein_id gnl|my_center|LOCUS_18950 89032 87536 gene locus_tag LOCUS_18960 89032 87536 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226378.1 protein_id gnl|my_center|LOCUS_18960 89976 89053 gene locus_tag LOCUS_18970 89976 89053 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067249.1 protein_id gnl|my_center|LOCUS_18970 92079 90253 gene locus_tag LOCUS_18980 92079 90253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 92494 92670 gene locus_tag LOCUS_18990 92494 92670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 92667 93074 gene locus_tag LOCUS_19000 92667 93074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19000 93085 93843 gene locus_tag LOCUS_19010 93085 93843 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026138672.1 protein_id gnl|my_center|LOCUS_19010 93873 95051 gene locus_tag LOCUS_19020 93873 95051 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140737.1 protein_id gnl|my_center|LOCUS_19020 95142 95351 gene locus_tag LOCUS_19030 95142 95351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 95451 96221 gene locus_tag LOCUS_19040 gene xth 95451 96221 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812032.1 protein_id gnl|my_center|LOCUS_19040 96768 96956 gene locus_tag LOCUS_19050 96768 96956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 97097 97945 gene locus_tag LOCUS_19060 97097 97945 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525132.1 protein_id gnl|my_center|LOCUS_19060 98795 98562 gene locus_tag LOCUS_19070 98795 98562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 99559 99326 gene locus_tag LOCUS_19080 99559 99326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 99943 101685 gene locus_tag LOCUS_19090 99943 101685 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389044.1 protein_id gnl|my_center|LOCUS_19090 101842 102288 gene locus_tag LOCUS_19100 101842 102288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884048.1 protein_id gnl|my_center|LOCUS_19100 102285 102959 gene locus_tag LOCUS_19110 102285 102959 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226991426.1 protein_id gnl|my_center|LOCUS_19110 102956 104173 gene locus_tag LOCUS_19120 102956 104173 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884049.1 protein_id gnl|my_center|LOCUS_19120 106324 104195 gene locus_tag LOCUS_19130 106324 104195 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612392.1 protein_id gnl|my_center|LOCUS_19130 108210 106381 gene locus_tag LOCUS_19140 108210 106381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 109553 108564 gene locus_tag LOCUS_19150 109553 108564 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223063.1 protein_id gnl|my_center|LOCUS_19150 110248 109550 gene locus_tag LOCUS_19160 gene nagB 110248 109550 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118913.1 protein_id gnl|my_center|LOCUS_19160 111537 110242 gene locus_tag LOCUS_19170 gene licH 111537 110242 CDS product 6-phospho-beta-glucosidase LicH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244285.1 protein_id gnl|my_center|LOCUS_19170 112096 111851 gene locus_tag LOCUS_19180 112096 111851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 112941 112099 gene locus_tag LOCUS_19190 112941 112099 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225189.1 protein_id gnl|my_center|LOCUS_19190 112931 113152 gene locus_tag LOCUS_19200 112931 113152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 113703 113254 gene locus_tag LOCUS_19210 113703 113254 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224535.1 protein_id gnl|my_center|LOCUS_19210 113889 113716 gene locus_tag LOCUS_19220 113889 113716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 113884 114813 gene locus_tag LOCUS_19230 113884 114813 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533429.1 protein_id gnl|my_center|LOCUS_19230 114987 116270 gene locus_tag LOCUS_19240 gene aldO 114987 116270 CDS product alditol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030685.1 protein_id gnl|my_center|LOCUS_19240 116485 117396 gene locus_tag LOCUS_19250 116485 117396 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888257.1 protein_id gnl|my_center|LOCUS_19250 117782 119338 gene locus_tag LOCUS_19260 117782 119338 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084124.1 protein_id gnl|my_center|LOCUS_19260 119524 120336 gene locus_tag LOCUS_19270 119524 120336 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775607.1 protein_id gnl|my_center|LOCUS_19270 120899 120462 gene locus_tag LOCUS_19280 120899 120462 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479949.1 protein_id gnl|my_center|LOCUS_19280 121200 121376 gene locus_tag LOCUS_19290 121200 121376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 121470 121985 gene locus_tag LOCUS_19300 121470 121985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 122612 122160 gene locus_tag LOCUS_19310 122612 122160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 122874 122659 gene locus_tag LOCUS_19320 122874 122659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 123430 123218 gene locus_tag LOCUS_19330 123430 123218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 124139 123513 gene locus_tag LOCUS_19340 124139 123513 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257831.1 protein_id gnl|my_center|LOCUS_19340 125194 126933 gene locus_tag LOCUS_19350 125194 126933 CDS product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928895.1 protein_id gnl|my_center|LOCUS_19350 126959 131284 gene locus_tag LOCUS_19360 126959 131284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19360 131281 132006 gene locus_tag LOCUS_19370 131281 132006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19370 132802 132020 gene locus_tag LOCUS_19380 132802 132020 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229109.1 protein_id gnl|my_center|LOCUS_19380 133220 132954 gene locus_tag LOCUS_19390 133220 132954 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884021.1 protein_id gnl|my_center|LOCUS_19390 134232 133213 gene locus_tag LOCUS_19400 134232 133213 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480401.1 protein_id gnl|my_center|LOCUS_19400 136354 134267 gene locus_tag LOCUS_19410 gene nrdE 136354 134267 CDS product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480402.1 protein_id gnl|my_center|LOCUS_19410 136857 136333 gene locus_tag LOCUS_19420 gene nrdI 136857 136333 CDS product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883964.1 protein_id gnl|my_center|LOCUS_19420 137356 138219 gene locus_tag LOCUS_19430 137356 138219 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064203.1 protein_id gnl|my_center|LOCUS_19430 138216 139139 gene locus_tag LOCUS_19440 138216 139139 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809842.1 protein_id gnl|my_center|LOCUS_19440 139136 140626 gene locus_tag LOCUS_19450 139136 140626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19450 142484 140697 gene locus_tag LOCUS_19460 gene ilvD 142484 140697 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887775.1 protein_id gnl|my_center|LOCUS_19460 144974 142590 gene locus_tag LOCUS_19470 144974 142590 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224401.1 protein_id gnl|my_center|LOCUS_19470 145419 145009 gene locus_tag LOCUS_19480 145419 145009 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974546.1 protein_id gnl|my_center|LOCUS_19480 145873 145427 gene locus_tag LOCUS_19490 145873 145427 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224404.1 protein_id gnl|my_center|LOCUS_19490 146858 145923 gene locus_tag LOCUS_19500 146858 145923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 147226 147534 gene locus_tag LOCUS_19510 147226 147534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 147810 148742 gene locus_tag LOCUS_19520 147810 148742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 149795 148764 gene locus_tag LOCUS_19530 149795 148764 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479751.1 protein_id gnl|my_center|LOCUS_19530 150170 151225 gene locus_tag LOCUS_19540 150170 151225 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393756.1 protein_id gnl|my_center|LOCUS_19540 151337 152884 gene locus_tag LOCUS_19550 151337 152884 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385803.1 protein_id gnl|my_center|LOCUS_19550 153291 154232 gene locus_tag LOCUS_19560 153291 154232 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385804.1 protein_id gnl|my_center|LOCUS_19560 154229 156214 gene locus_tag LOCUS_19570 154229 156214 CDS product dipeptide/oligopeptide/nickel ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385805.1 protein_id gnl|my_center|LOCUS_19570 156211 157281 gene locus_tag LOCUS_19580 156211 157281 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388346.1 protein_id gnl|my_center|LOCUS_19580 157274 158143 gene locus_tag LOCUS_19590 157274 158143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 158226 159254 gene locus_tag LOCUS_19600 158226 159254 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226303.1 protein_id gnl|my_center|LOCUS_19600 159260 160117 gene locus_tag LOCUS_19610 159260 160117 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054256.1 protein_id gnl|my_center|LOCUS_19610 160118 161167 gene locus_tag LOCUS_19620 160118 161167 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869626.1 protein_id gnl|my_center|LOCUS_19620 162207 161434 gene locus_tag LOCUS_19630 162207 161434 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529276.1 protein_id gnl|my_center|LOCUS_19630 163418 162204 gene locus_tag LOCUS_19640 163418 162204 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396013.1 protein_id gnl|my_center|LOCUS_19640 164548 163502 gene locus_tag LOCUS_19650 gene xylF 164548 163502 CDS product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973156.1 protein_id gnl|my_center|LOCUS_19650 165814 164765 gene locus_tag LOCUS_19660 165814 164765 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399798.1 protein_id gnl|my_center|LOCUS_19660 167208 166300 gene locus_tag LOCUS_19670 167208 166300 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349546.1 protein_id gnl|my_center|LOCUS_19670 168815 167526 gene locus_tag LOCUS_19680 168815 167526 CDS product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038431480.1 protein_id gnl|my_center|LOCUS_19680 169951 168878 gene locus_tag LOCUS_19690 169951 168878 CDS product glycoside hydrolase family 76 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989566.1 protein_id gnl|my_center|LOCUS_19690 171920 169971 gene locus_tag LOCUS_19700 171920 169971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 172906 172022 gene locus_tag LOCUS_19710 172906 172022 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989564.1 protein_id gnl|my_center|LOCUS_19710 173848 172919 gene locus_tag LOCUS_19720 173848 172919 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721883.1 protein_id gnl|my_center|LOCUS_19720 175078 173900 gene locus_tag LOCUS_19730 175078 173900 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002302559.1 protein_id gnl|my_center|LOCUS_19730 176189 175107 gene locus_tag LOCUS_19740 176189 175107 CDS product glycoside hydrolase family 76 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989566.1 protein_id gnl|my_center|LOCUS_19740 177748 176186 gene locus_tag LOCUS_19750 177748 176186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 179020 177749 gene locus_tag LOCUS_19760 179020 177749 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989565.1 protein_id gnl|my_center|LOCUS_19760 180715 179381 gene locus_tag LOCUS_19770 180715 179381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 181052 183121 gene locus_tag LOCUS_19780 181052 183121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 183643 183777 gene locus_tag LOCUS_19790 183643 183777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 184660 184079 gene locus_tag LOCUS_19800 184660 184079 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229197.1 protein_id gnl|my_center|LOCUS_19800 184803 185822 gene locus_tag LOCUS_19810 184803 185822 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229198.1 protein_id gnl|my_center|LOCUS_19810 186811 186338 gene locus_tag LOCUS_19820 186811 186338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 187631 187122 gene locus_tag LOCUS_19830 187631 187122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 187724 188203 gene locus_tag LOCUS_19840 187724 188203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 188200 188982 gene locus_tag LOCUS_19850 188200 188982 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887095.1 protein_id gnl|my_center|LOCUS_19850 191254 189689 gene locus_tag LOCUS_19860 191254 189689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 191379 191669 gene locus_tag LOCUS_19870 191379 191669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 194168 191724 gene locus_tag LOCUS_19880 194168 191724 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929325.1 protein_id gnl|my_center|LOCUS_19880 194394 195254 gene locus_tag LOCUS_19890 194394 195254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 195251 195832 gene locus_tag LOCUS_19900 195251 195832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 195829 197430 gene locus_tag LOCUS_19910 195829 197430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 197427 198767 gene locus_tag LOCUS_19920 197427 198767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 198798 199625 gene locus_tag LOCUS_19930 198798 199625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 199991 199629 gene locus_tag LOCUS_19940 199991 199629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 200439 200239 gene locus_tag LOCUS_19950 200439 200239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 201151 200537 gene locus_tag LOCUS_19960 201151 200537 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074680.1 protein_id gnl|my_center|LOCUS_19960 201249 202382 gene locus_tag LOCUS_19970 201249 202382 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038499.1 protein_id gnl|my_center|LOCUS_19970 202395 203543 gene locus_tag LOCUS_19980 gene dpaL 202395 203543 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706020.1 protein_id gnl|my_center|LOCUS_19980 203769 204089 gene locus_tag LOCUS_19990 203769 204089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 204279 205625 gene locus_tag LOCUS_20000 204279 205625 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876537.1 protein_id gnl|my_center|LOCUS_20000 206801 206031 gene locus_tag LOCUS_20010 206801 206031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 208438 206837 gene locus_tag LOCUS_20020 208438 206837 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889250.1 protein_id gnl|my_center|LOCUS_20020 208976 211135 gene locus_tag LOCUS_20030 208976 211135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 212413 211796 gene locus_tag LOCUS_20040 212413 211796 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530052.1 protein_id gnl|my_center|LOCUS_20040 212967 212545 gene locus_tag LOCUS_20050 212967 212545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 213052 213567 gene locus_tag LOCUS_20060 213052 213567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974620.1 protein_id gnl|my_center|LOCUS_20060 214570 213656 gene locus_tag LOCUS_20070 214570 213656 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349445.1 protein_id gnl|my_center|LOCUS_20070 214916 214668 gene locus_tag LOCUS_20080 214916 214668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 215084 215482 gene locus_tag LOCUS_20090 215084 215482 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031500121.1 protein_id gnl|my_center|LOCUS_20090 216701 215958 gene locus_tag LOCUS_20100 gene map 216701 215958 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233698.1 protein_id gnl|my_center|LOCUS_20100 216887 217996 gene locus_tag LOCUS_20110 216887 217996 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618910.1 protein_id gnl|my_center|LOCUS_20110 219692 218160 gene locus_tag LOCUS_20120 219692 218160 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729759.1 protein_id gnl|my_center|LOCUS_20120 220602 219736 gene locus_tag LOCUS_20130 220602 219736 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942082.1 protein_id gnl|my_center|LOCUS_20130 221552 220599 gene locus_tag LOCUS_20140 221552 220599 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836213.1 protein_id gnl|my_center|LOCUS_20140 222165 221629 gene locus_tag LOCUS_20150 222165 221629 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529365.1 protein_id gnl|my_center|LOCUS_20150 222345 222509 gene locus_tag LOCUS_20160 222345 222509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 222596 222901 gene locus_tag LOCUS_20170 222596 222901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 223429 222917 gene locus_tag LOCUS_20180 223429 222917 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056942.1 protein_id gnl|my_center|LOCUS_20180 223715 224428 gene locus_tag LOCUS_20190 223715 224428 CDS product B3/4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366894.1 protein_id gnl|my_center|LOCUS_20190 224445 224627 gene locus_tag LOCUS_20200 224445 224627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 224933 225745 gene locus_tag LOCUS_20210 224933 225745 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268341.1 protein_id gnl|my_center|LOCUS_20210 225901 227043 gene locus_tag LOCUS_20220 225901 227043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 227085 227846 gene locus_tag LOCUS_20230 gene modA 227085 227846 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889429.1 protein_id gnl|my_center|LOCUS_20230 227892 228101 gene locus_tag LOCUS_20240 227892 228101 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071920.1 protein_id gnl|my_center|LOCUS_20240 228468 229313 gene locus_tag LOCUS_20250 228468 229313 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889428.1 protein_id gnl|my_center|LOCUS_20250 229817 229323 gene locus_tag LOCUS_20260 229817 229323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 230094 229924 gene locus_tag LOCUS_20270 230094 229924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 232284 230158 gene locus_tag LOCUS_20280 232284 230158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 232591 232809 gene locus_tag LOCUS_20290 232591 232809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 232889 233803 gene locus_tag LOCUS_20300 232889 233803 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173642.1 protein_id gnl|my_center|LOCUS_20300 234512 233820 gene locus_tag LOCUS_20310 234512 233820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 236788 234575 gene locus_tag LOCUS_20320 236788 234575 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889490.1 protein_id gnl|my_center|LOCUS_20320 237756 236785 gene locus_tag LOCUS_20330 237756 236785 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968216.1 protein_id gnl|my_center|LOCUS_20330 238307 237753 gene locus_tag LOCUS_20340 238307 237753 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889492.1 protein_id gnl|my_center|LOCUS_20340 239552 238476 gene locus_tag LOCUS_20350 239552 238476 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871885.1 protein_id gnl|my_center|LOCUS_20350 240366 239578 gene locus_tag LOCUS_20360 240366 239578 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727458.1 protein_id gnl|my_center|LOCUS_20360 241051 240368 gene locus_tag LOCUS_20370 241051 240368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 242673 241048 gene locus_tag LOCUS_20380 242673 241048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 243830 242670 gene locus_tag LOCUS_20390 243830 242670 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225828.1 protein_id gnl|my_center|LOCUS_20390 244906 243827 gene locus_tag LOCUS_20400 244906 243827 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811401.1 protein_id gnl|my_center|LOCUS_20400 245820 244939 gene locus_tag LOCUS_20410 245820 244939 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942082.1 protein_id gnl|my_center|LOCUS_20410 246766 245813 gene locus_tag LOCUS_20420 246766 245813 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258638.1 protein_id gnl|my_center|LOCUS_20420 248434 246815 gene locus_tag LOCUS_20430 248434 246815 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454209.1 protein_id gnl|my_center|LOCUS_20430 248631 249827 gene locus_tag LOCUS_20440 248631 249827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 249841 250629 gene locus_tag LOCUS_20450 249841 250629 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391955.1 protein_id gnl|my_center|LOCUS_20450 250626 251837 gene locus_tag LOCUS_20460 250626 251837 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384268.1 protein_id gnl|my_center|LOCUS_20460 253310 251880 gene locus_tag LOCUS_20470 253310 251880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 254148 253489 gene locus_tag LOCUS_20480 254148 253489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 254557 254267 gene locus_tag LOCUS_20490 254557 254267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 254982 255401 gene locus_tag LOCUS_20500 254982 255401 CDS product four-helix bundle copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975554.1 protein_id gnl|my_center|LOCUS_20500 255426 256442 gene locus_tag LOCUS_20510 255426 256442 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037184.1 protein_id gnl|my_center|LOCUS_20510 257829 256543 gene locus_tag LOCUS_20520 257829 256543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 258283 261225 gene locus_tag LOCUS_20530 258283 261225 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023457.1 protein_id gnl|my_center|LOCUS_20530 261428 262075 gene locus_tag LOCUS_20540 261428 262075 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526170.1 protein_id gnl|my_center|LOCUS_20540 262068 263381 gene locus_tag LOCUS_20550 262068 263381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20550 263636 263409 gene locus_tag LOCUS_20560 263636 263409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 264701 263913 gene locus_tag LOCUS_20570 264701 263913 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_20570 265590 264718 gene locus_tag LOCUS_20580 265590 264718 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583225.1 protein_id gnl|my_center|LOCUS_20580 266566 265583 gene locus_tag LOCUS_20590 266566 265583 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729760.1 protein_id gnl|my_center|LOCUS_20590 268124 266619 gene locus_tag LOCUS_20600 268124 266619 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729759.1 protein_id gnl|my_center|LOCUS_20600 268621 268121 gene locus_tag LOCUS_20610 268621 268121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 268918 269775 gene locus_tag LOCUS_20620 268918 269775 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391955.1 protein_id gnl|my_center|LOCUS_20620 269786 271360 gene locus_tag LOCUS_20630 269786 271360 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_20630 271407 272354 gene locus_tag LOCUS_20640 271407 272354 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836213.1 protein_id gnl|my_center|LOCUS_20640 272347 273231 gene locus_tag LOCUS_20650 272347 273231 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545272.1 protein_id gnl|my_center|LOCUS_20650 273228 274631 gene locus_tag LOCUS_20660 273228 274631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 274624 275868 gene locus_tag LOCUS_20670 274624 275868 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861718.1 protein_id gnl|my_center|LOCUS_20670 275865 276887 gene locus_tag LOCUS_20680 275865 276887 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384269.1 protein_id gnl|my_center|LOCUS_20680 276809 277912 gene locus_tag LOCUS_20690 gene pepQ 276809 277912 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994025.1 protein_id gnl|my_center|LOCUS_20690 279029 277977 gene locus_tag LOCUS_20700 279029 277977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 280008 279127 gene locus_tag LOCUS_20710 280008 279127 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583225.1 protein_id gnl|my_center|LOCUS_20710 280955 280005 gene locus_tag LOCUS_20720 280955 280005 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383546.1 protein_id gnl|my_center|LOCUS_20720 282489 280975 gene locus_tag LOCUS_20730 gene gsiB 282489 280975 CDS product glutathione ABC transporter substrate-binding protein GsiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090151.1 protein_id gnl|my_center|LOCUS_20730 282722 283888 gene locus_tag LOCUS_20740 282722 283888 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040384667.1 protein_id gnl|my_center|LOCUS_20740 286577 283899 gene locus_tag LOCUS_20750 286577 283899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 286822 287316 gene locus_tag LOCUS_20760 286822 287316 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313899.1 protein_id gnl|my_center|LOCUS_20760 288014 289465 gene locus_tag LOCUS_20770 288014 289465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 289508 289936 gene locus_tag LOCUS_20780 289508 289936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403489.1 protein_id gnl|my_center|LOCUS_20780 290183 291454 gene locus_tag LOCUS_20790 290183 291454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 291459 292712 gene locus_tag LOCUS_20800 291459 292712 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533110.1 protein_id gnl|my_center|LOCUS_20800 292709 293938 gene locus_tag LOCUS_20810 292709 293938 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582956.1 protein_id gnl|my_center|LOCUS_20810 293935 295080 gene locus_tag LOCUS_20820 293935 295080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 295077 296087 gene locus_tag LOCUS_20830 295077 296087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 297355 296084 gene locus_tag LOCUS_20840 297355 296084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 297945 297361 gene locus_tag LOCUS_20850 297945 297361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 298441 297977 gene locus_tag LOCUS_20860 298441 297977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 298587 300260 gene locus_tag LOCUS_20870 298587 300260 CDS product tyrosine-protein kinase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889293.1 protein_id gnl|my_center|LOCUS_20870 301622 300300 gene locus_tag LOCUS_20880 301622 300300 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461043.1 protein_id gnl|my_center|LOCUS_20880 302714 301977 gene locus_tag LOCUS_20890 302714 301977 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975366.1 protein_id gnl|my_center|LOCUS_20890 302869 304464 gene locus_tag LOCUS_20900 gene pxpB 302869 304464 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228353.1 protein_id gnl|my_center|LOCUS_20900 304461 305282 gene locus_tag LOCUS_20910 304461 305282 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391964.1 protein_id gnl|my_center|LOCUS_20910 305279 306400 gene locus_tag LOCUS_20920 305279 306400 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022798454.1 protein_id gnl|my_center|LOCUS_20920 306978 306742 gene locus_tag LOCUS_20930 306978 306742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 307405 307115 gene locus_tag LOCUS_20940 307405 307115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 309745 307667 gene locus_tag LOCUS_20950 309745 307667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 310206 309955 gene locus_tag LOCUS_20960 310206 309955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 310997 310209 gene locus_tag LOCUS_20970 310997 310209 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229158.1 protein_id gnl|my_center|LOCUS_20970 312025 310994 gene locus_tag LOCUS_20980 312025 310994 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385610.1 protein_id gnl|my_center|LOCUS_20980 312886 312026 gene locus_tag LOCUS_20990 312886 312026 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538207.1 protein_id gnl|my_center|LOCUS_20990 313782 312883 gene locus_tag LOCUS_21000 313782 312883 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948769.1 protein_id gnl|my_center|LOCUS_21000 314902 313784 gene locus_tag LOCUS_21010 314902 313784 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385612.1 protein_id gnl|my_center|LOCUS_21010 314997 316316 gene locus_tag LOCUS_21020 314997 316316 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029647.1 protein_id gnl|my_center|LOCUS_21020 316400 318076 gene locus_tag LOCUS_21030 316400 318076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21030 318073 319662 gene locus_tag LOCUS_21040 gene cydC 318073 319662 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929715.1 protein_id gnl|my_center|LOCUS_21040 319659 321074 gene locus_tag LOCUS_21050 319659 321074 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393585.1 protein_id gnl|my_center|LOCUS_21050 321071 322111 gene locus_tag LOCUS_21060 gene cydB 321071 322111 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933479.1 protein_id gnl|my_center|LOCUS_21060 322463 322257 gene locus_tag LOCUS_21070 322463 322257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 322559 323047 gene locus_tag LOCUS_21080 322559 323047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 323044 324090 gene locus_tag LOCUS_21090 323044 324090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225442.1 protein_id gnl|my_center|LOCUS_21090 324388 325218 gene locus_tag LOCUS_21100 324388 325218 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889261.1 protein_id gnl|my_center|LOCUS_21100 325215 326093 gene locus_tag LOCUS_21110 325215 326093 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143340.1 protein_id gnl|my_center|LOCUS_21110 328105 326321 gene locus_tag LOCUS_21120 328105 326321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 329071 328172 gene locus_tag LOCUS_21130 329071 328172 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257156.1 protein_id gnl|my_center|LOCUS_21130 330080 329091 gene locus_tag LOCUS_21140 330080 329091 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775954.1 protein_id gnl|my_center|LOCUS_21140 331329 330100 gene locus_tag LOCUS_21150 331329 330100 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733127.1 protein_id gnl|my_center|LOCUS_21150 332565 331555 gene locus_tag LOCUS_21160 332565 331555 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189263.1 protein_id gnl|my_center|LOCUS_21160 332468 332665 gene locus_tag LOCUS_21170 332468 332665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 332767 335283 gene locus_tag LOCUS_21180 332767 335283 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225596.1 protein_id gnl|my_center|LOCUS_21180 335408 336406 gene locus_tag LOCUS_21190 335408 336406 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583041.1 protein_id gnl|my_center|LOCUS_21190 336668 339607 gene locus_tag LOCUS_21200 336668 339607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 340299 339643 gene locus_tag LOCUS_21210 340299 339643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21210 340755 341366 gene locus_tag LOCUS_21220 340755 341366 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140153.1 protein_id gnl|my_center|LOCUS_21220 341363 341650 gene locus_tag LOCUS_21230 341363 341650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 342649 344004 gene locus_tag LOCUS_21240 342649 344004 CDS product replication initiator protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229172.1 protein_id gnl|my_center|LOCUS_21240 344172 345929 gene locus_tag LOCUS_21250 344172 345929 CDS product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969667.1 protein_id gnl|my_center|LOCUS_21250 346066 346584 gene locus_tag LOCUS_21260 346066 346584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 346904 347308 gene locus_tag LOCUS_21270 346904 347308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 348667 347567 gene locus_tag LOCUS_21280 348667 347567 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036279.1 protein_id gnl|my_center|LOCUS_21280 349703 348762 gene locus_tag LOCUS_21290 349703 348762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 350209 349700 gene locus_tag LOCUS_21300 350209 349700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 350628 350206 gene locus_tag LOCUS_21310 350628 350206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 351537 350635 gene locus_tag LOCUS_21320 351537 350635 CDS product DUF2382 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480014.1 protein_id gnl|my_center|LOCUS_21320 352578 351583 gene locus_tag LOCUS_21330 352578 351583 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479707.1 protein_id gnl|my_center|LOCUS_21330 354047 353274 gene locus_tag LOCUS_21340 354047 353274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 354957 354328 gene locus_tag LOCUS_21350 354957 354328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 357940 355307 gene locus_tag LOCUS_21360 357940 355307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 360376 358244 gene locus_tag LOCUS_21370 360376 358244 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259699.1 protein_id gnl|my_center|LOCUS_21370 362244 360388 gene locus_tag LOCUS_21380 362244 360388 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975036.1 protein_id gnl|my_center|LOCUS_21380 363861 362320 gene locus_tag LOCUS_21390 363861 362320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 365023 363926 gene locus_tag LOCUS_21400 365023 363926 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967719.1 protein_id gnl|my_center|LOCUS_21400 366346 365114 gene locus_tag LOCUS_21410 366346 365114 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967720.1 protein_id gnl|my_center|LOCUS_21410 367359 366403 gene locus_tag LOCUS_21420 367359 366403 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038454.1 protein_id gnl|my_center|LOCUS_21420 367664 367834 gene locus_tag LOCUS_21430 367664 367834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 369438 367861 gene locus_tag LOCUS_21440 369438 367861 CDS product S53 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528841.1 protein_id gnl|my_center|LOCUS_21440 369664 369900 gene locus_tag LOCUS_21450 369664 369900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 >Feature sequence05 965 165 gene locus_tag LOCUS_21460 965 165 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886780.1 protein_id gnl|my_center|LOCUS_21460 2293 962 gene locus_tag LOCUS_21470 2293 962 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986115.1 protein_id gnl|my_center|LOCUS_21470 2362 3567 gene locus_tag LOCUS_21480 2362 3567 CDS product citrate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083014.1 protein_id gnl|my_center|LOCUS_21480 4849 3641 gene locus_tag LOCUS_21490 4849 3641 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480120.1 protein_id gnl|my_center|LOCUS_21490 4925 6001 gene locus_tag LOCUS_21500 4925 6001 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889126.1 protein_id gnl|my_center|LOCUS_21500 7195 6014 gene locus_tag LOCUS_21510 7195 6014 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886984.1 protein_id gnl|my_center|LOCUS_21510 7301 7849 gene locus_tag LOCUS_21520 7301 7849 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529753.1 protein_id gnl|my_center|LOCUS_21520 7887 8120 gene locus_tag LOCUS_21530 7887 8120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 8158 8376 gene locus_tag LOCUS_21540 8158 8376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 8440 9549 gene locus_tag LOCUS_21550 8440 9549 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479977.1 protein_id gnl|my_center|LOCUS_21550 9621 10820 gene locus_tag LOCUS_21560 9621 10820 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037302.1 protein_id gnl|my_center|LOCUS_21560 11183 10863 gene locus_tag LOCUS_21570 gene sugE 11183 10863 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921272.1 protein_id gnl|my_center|LOCUS_21570 11913 11413 gene locus_tag LOCUS_21580 11913 11413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 13201 11972 gene locus_tag LOCUS_21590 13201 11972 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618882.1 protein_id gnl|my_center|LOCUS_21590 13338 14726 gene locus_tag LOCUS_21600 13338 14726 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135229709.1 protein_id gnl|my_center|LOCUS_21600 15501 14794 gene locus_tag LOCUS_21610 15501 14794 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886929.1 protein_id gnl|my_center|LOCUS_21610 16315 15494 gene locus_tag LOCUS_21620 16315 15494 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886928.1 protein_id gnl|my_center|LOCUS_21620 17324 16308 gene locus_tag LOCUS_21630 17324 16308 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886927.1 protein_id gnl|my_center|LOCUS_21630 18181 17321 gene locus_tag LOCUS_21640 18181 17321 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886926.1 protein_id gnl|my_center|LOCUS_21640 19387 18251 gene locus_tag LOCUS_21650 19387 18251 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480285.1 protein_id gnl|my_center|LOCUS_21650 20112 19747 gene locus_tag LOCUS_21660 20112 19747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 20564 20340 gene locus_tag LOCUS_21670 20564 20340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 20932 21357 gene locus_tag LOCUS_21680 20932 21357 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618908.1 protein_id gnl|my_center|LOCUS_21680 21354 21962 gene locus_tag LOCUS_21690 21354 21962 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886923.1 protein_id gnl|my_center|LOCUS_21690 22699 22040 gene locus_tag LOCUS_21700 22699 22040 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809037.1 protein_id gnl|my_center|LOCUS_21700 23220 22696 gene locus_tag LOCUS_21710 23220 22696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 23334 24164 gene locus_tag LOCUS_21720 23334 24164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 24199 24786 gene locus_tag LOCUS_21730 24199 24786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350603.1 protein_id gnl|my_center|LOCUS_21730 24783 25943 gene locus_tag LOCUS_21740 24783 25943 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887040.1 protein_id gnl|my_center|LOCUS_21740 25953 26786 gene locus_tag LOCUS_21750 25953 26786 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886830.1 protein_id gnl|my_center|LOCUS_21750 26833 27441 gene locus_tag LOCUS_21760 26833 27441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 27551 28543 gene locus_tag LOCUS_21770 27551 28543 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886970.1 protein_id gnl|my_center|LOCUS_21770 28696 30717 gene locus_tag LOCUS_21780 28696 30717 CDS product prolyl oligopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889128.1 protein_id gnl|my_center|LOCUS_21780 30793 30877 gene locus_tag LOCUS_t00190 30793 30877 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 32455 31043 gene locus_tag LOCUS_21790 gene argH 32455 31043 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384838.1 protein_id gnl|my_center|LOCUS_21790 32973 32506 gene locus_tag LOCUS_21800 32973 32506 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528290.1 protein_id gnl|my_center|LOCUS_21800 33594 33022 gene locus_tag LOCUS_21810 33594 33022 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172651.1 protein_id gnl|my_center|LOCUS_21810 33763 36696 gene locus_tag LOCUS_21820 gene topA 33763 36696 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480031.1 protein_id gnl|my_center|LOCUS_21820 36701 37009 gene locus_tag LOCUS_21830 36701 37009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 37023 37487 gene locus_tag LOCUS_21840 37023 37487 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193685.1 protein_id gnl|my_center|LOCUS_21840 38040 37489 gene locus_tag LOCUS_21850 38040 37489 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888229.1 protein_id gnl|my_center|LOCUS_21850 38875 38075 gene locus_tag LOCUS_21860 38875 38075 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887846.1 protein_id gnl|my_center|LOCUS_21860 39922 38924 gene locus_tag LOCUS_21870 39922 38924 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887570.1 protein_id gnl|my_center|LOCUS_21870 40568 39930 gene locus_tag LOCUS_21880 40568 39930 CDS product DUF47 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887569.1 protein_id gnl|my_center|LOCUS_21880 43762 40691 gene locus_tag LOCUS_21890 43762 40691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 43887 44171 gene locus_tag LOCUS_21900 43887 44171 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887568.1 protein_id gnl|my_center|LOCUS_21900 45384 44242 gene locus_tag LOCUS_21910 45384 44242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 45493 46734 gene locus_tag LOCUS_21920 45493 46734 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888815.1 protein_id gnl|my_center|LOCUS_21920 46806 46893 gene locus_tag LOCUS_t00200 46806 46893 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 46918 47010 gene locus_tag LOCUS_t00210 46918 47010 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 47026 47102 gene locus_tag LOCUS_t00220 47026 47102 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 47623 47997 gene locus_tag LOCUS_21930 47623 47997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21930 48449 48961 gene locus_tag LOCUS_21940 48449 48961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 49212 49883 gene locus_tag LOCUS_21950 49212 49883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 49947 51149 gene locus_tag LOCUS_21960 49947 51149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 51146 51583 gene locus_tag LOCUS_21970 51146 51583 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140431.1 protein_id gnl|my_center|LOCUS_21970 52214 51750 gene locus_tag LOCUS_21980 52214 51750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 52213 52440 gene locus_tag LOCUS_21990 52213 52440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 52419 53207 gene locus_tag LOCUS_22000 52419 53207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 53204 54667 gene locus_tag LOCUS_22010 53204 54667 CDS product VgrG-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226667.1 protein_id gnl|my_center|LOCUS_22010 54667 55008 gene locus_tag LOCUS_22020 54667 55008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 55005 55448 gene locus_tag LOCUS_22030 55005 55448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 55448 57982 gene locus_tag LOCUS_22040 55448 57982 CDS product putative baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133736098.1 protein_id gnl|my_center|LOCUS_22040 57963 58505 gene locus_tag LOCUS_22050 57963 58505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 58502 59416 gene locus_tag LOCUS_22060 58502 59416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 59595 60539 gene locus_tag LOCUS_22070 59595 60539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 60536 61018 gene locus_tag LOCUS_22080 60536 61018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 61690 61022 gene locus_tag LOCUS_22090 61690 61022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 63667 61712 gene locus_tag LOCUS_22100 63667 61712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 64862 64107 gene locus_tag LOCUS_22110 64862 64107 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405392.1 protein_id gnl|my_center|LOCUS_22110 65638 66885 gene locus_tag LOCUS_22120 65638 66885 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584153.1 protein_id gnl|my_center|LOCUS_22120 66890 67267 gene locus_tag LOCUS_22130 66890 67267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 67291 68229 gene locus_tag LOCUS_22140 67291 68229 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227578.1 protein_id gnl|my_center|LOCUS_22140 68226 69050 gene locus_tag LOCUS_22150 68226 69050 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227577.1 protein_id gnl|my_center|LOCUS_22150 69066 70079 gene locus_tag LOCUS_22160 69066 70079 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705012.1 protein_id gnl|my_center|LOCUS_22160 70072 70449 gene locus_tag LOCUS_22170 70072 70449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 70446 71978 gene locus_tag LOCUS_22180 70446 71978 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227212.1 protein_id gnl|my_center|LOCUS_22180 72058 73080 gene locus_tag LOCUS_22190 gene hpaD 72058 73080 CDS product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528545.1 protein_id gnl|my_center|LOCUS_22190 73083 73844 gene locus_tag LOCUS_22200 73083 73844 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174479.1 protein_id gnl|my_center|LOCUS_22200 73864 74868 gene locus_tag LOCUS_22210 73864 74868 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000674020.1 protein_id gnl|my_center|LOCUS_22210 74876 76033 gene locus_tag LOCUS_22220 74876 76033 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921526.1 protein_id gnl|my_center|LOCUS_22220 76030 77187 gene locus_tag LOCUS_22230 76030 77187 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089165.1 protein_id gnl|my_center|LOCUS_22230 77279 77953 gene locus_tag LOCUS_22240 77279 77953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 78149 79270 gene locus_tag LOCUS_22250 78149 79270 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041669339.1 protein_id gnl|my_center|LOCUS_22250 79267 79854 gene locus_tag LOCUS_22260 79267 79854 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528729.1 protein_id gnl|my_center|LOCUS_22260 79869 82211 gene locus_tag LOCUS_22270 79869 82211 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229028.1 protein_id gnl|my_center|LOCUS_22270 82931 82269 gene locus_tag LOCUS_22280 82931 82269 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392579.1 protein_id gnl|my_center|LOCUS_22280 84183 82996 gene locus_tag LOCUS_22290 84183 82996 CDS product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089160.1 protein_id gnl|my_center|LOCUS_22290 84393 85541 gene locus_tag LOCUS_22300 gene pcaD 84393 85541 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920269.1 protein_id gnl|my_center|LOCUS_22300 85538 86269 gene locus_tag LOCUS_22310 gene pcaH 85538 86269 CDS product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524239.1 protein_id gnl|my_center|LOCUS_22310 86259 86885 gene locus_tag LOCUS_22320 gene pcaG 86259 86885 CDS product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083750.1 protein_id gnl|my_center|LOCUS_22320 86896 88278 gene locus_tag LOCUS_22330 86896 88278 CDS product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765672.1 protein_id gnl|my_center|LOCUS_22330 88275 89567 gene locus_tag LOCUS_22340 88275 89567 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479723.1 protein_id gnl|my_center|LOCUS_22340 89564 90913 gene locus_tag LOCUS_22350 89564 90913 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479724.1 protein_id gnl|my_center|LOCUS_22350 90952 91755 gene locus_tag LOCUS_22360 90952 91755 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257233.1 protein_id gnl|my_center|LOCUS_22360 92054 92659 gene locus_tag LOCUS_22370 92054 92659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 92718 92927 gene locus_tag LOCUS_22380 92718 92927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 93586 92951 gene locus_tag LOCUS_22390 93586 92951 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222801.1 protein_id gnl|my_center|LOCUS_22390 94034 93591 gene locus_tag LOCUS_22400 94034 93591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 94912 94031 gene locus_tag LOCUS_22410 gene qqlR 94912 94031 CDS product N-acyl homoserine lactonase QqlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886818.1 protein_id gnl|my_center|LOCUS_22410 95808 95236 gene locus_tag LOCUS_22420 95808 95236 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641608.1 protein_id gnl|my_center|LOCUS_22420 95980 96426 gene locus_tag LOCUS_22430 95980 96426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22430 96387 96863 gene locus_tag LOCUS_22440 96387 96863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22440 96905 97078 gene locus_tag LOCUS_22450 96905 97078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 97075 97839 gene locus_tag LOCUS_22460 97075 97839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229185.1 protein_id gnl|my_center|LOCUS_22460 99537 97903 gene locus_tag LOCUS_22470 gene araB 99537 97903 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229500.1 protein_id gnl|my_center|LOCUS_22470 99928 100755 gene locus_tag LOCUS_22480 99928 100755 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525366.1 protein_id gnl|my_center|LOCUS_22480 100757 101842 gene locus_tag LOCUS_22490 gene gutB 100757 101842 CDS product sorbitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244156.1 protein_id gnl|my_center|LOCUS_22490 101971 103311 gene locus_tag LOCUS_22500 101971 103311 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582870.1 protein_id gnl|my_center|LOCUS_22500 103453 104031 gene locus_tag LOCUS_22510 103453 104031 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389121.1 protein_id gnl|my_center|LOCUS_22510 104063 104953 gene locus_tag LOCUS_22520 104063 104953 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584089.1 protein_id gnl|my_center|LOCUS_22520 104950 105855 gene locus_tag LOCUS_22530 104950 105855 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173998.1 protein_id gnl|my_center|LOCUS_22530 105989 106891 gene locus_tag LOCUS_22540 105989 106891 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389116.1 protein_id gnl|my_center|LOCUS_22540 107657 106908 gene locus_tag LOCUS_22550 107657 106908 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191609.1 protein_id gnl|my_center|LOCUS_22550 108502 107654 gene locus_tag LOCUS_22560 108502 107654 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975348.1 protein_id gnl|my_center|LOCUS_22560 109081 109242 gene locus_tag LOCUS_22570 109081 109242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 109697 110329 gene locus_tag LOCUS_22580 109697 110329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 113386 110393 gene locus_tag LOCUS_22590 113386 110393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 114736 113954 gene locus_tag LOCUS_22600 114736 113954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 115588 114812 gene locus_tag LOCUS_22610 115588 114812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 115853 116053 gene locus_tag LOCUS_22620 115853 116053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 116116 118182 gene locus_tag LOCUS_22630 116116 118182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 118232 120205 gene locus_tag LOCUS_22640 118232 120205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 121024 120209 gene locus_tag LOCUS_22650 121024 120209 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350289.1 protein_id gnl|my_center|LOCUS_22650 122075 121002 gene locus_tag LOCUS_22660 122075 121002 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529688.1 protein_id gnl|my_center|LOCUS_22660 122913 122143 gene locus_tag LOCUS_22670 122913 122143 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720513.1 protein_id gnl|my_center|LOCUS_22670 123985 123059 gene locus_tag LOCUS_22680 123985 123059 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529194.1 protein_id gnl|my_center|LOCUS_22680 125234 124161 gene locus_tag LOCUS_22690 125234 124161 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529193.1 protein_id gnl|my_center|LOCUS_22690 126081 125248 gene locus_tag LOCUS_22700 126081 125248 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087316.1 protein_id gnl|my_center|LOCUS_22700 126421 126825 gene locus_tag LOCUS_22710 126421 126825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 126822 127883 gene locus_tag LOCUS_22720 126822 127883 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226781.1 protein_id gnl|my_center|LOCUS_22720 127870 128838 gene locus_tag LOCUS_22730 127870 128838 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407529.1 protein_id gnl|my_center|LOCUS_22730 128835 129833 gene locus_tag LOCUS_22740 128835 129833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 129830 130795 gene locus_tag LOCUS_22750 129830 130795 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407530.1 protein_id gnl|my_center|LOCUS_22750 130869 133763 gene locus_tag LOCUS_22760 130869 133763 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259651.1 protein_id gnl|my_center|LOCUS_22760 134049 137243 gene locus_tag LOCUS_22770 134049 137243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 137780 137304 gene locus_tag LOCUS_22780 137780 137304 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618913.1 protein_id gnl|my_center|LOCUS_22780 137819 138382 gene locus_tag LOCUS_22790 gene rnhA 137819 138382 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887544.1 protein_id gnl|my_center|LOCUS_22790 138379 139032 gene locus_tag LOCUS_22800 gene yqeK 138379 139032 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000882440.1 protein_id gnl|my_center|LOCUS_22800 139402 140748 gene locus_tag LOCUS_22810 139402 140748 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021185.1 protein_id gnl|my_center|LOCUS_22810 140811 142178 gene locus_tag LOCUS_22820 140811 142178 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135257956.1 protein_id gnl|my_center|LOCUS_22820 142246 143274 gene locus_tag LOCUS_22830 142246 143274 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887761.1 protein_id gnl|my_center|LOCUS_22830 146375 143634 gene locus_tag LOCUS_22840 gene sbcC 146375 143634 CDS product exonuclease SbcCD subunit SbcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888557.1 protein_id gnl|my_center|LOCUS_22840 147651 146473 gene locus_tag LOCUS_22850 147651 146473 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479813.1 protein_id gnl|my_center|LOCUS_22850 147811 149031 gene locus_tag LOCUS_22860 147811 149031 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031615.1 protein_id gnl|my_center|LOCUS_22860 149668 149006 gene locus_tag LOCUS_22870 149668 149006 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888933.1 protein_id gnl|my_center|LOCUS_22870 149765 150469 gene locus_tag LOCUS_22880 149765 150469 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216585.1 protein_id gnl|my_center|LOCUS_22880 150580 152712 gene locus_tag LOCUS_22890 150580 152712 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888537.1 protein_id gnl|my_center|LOCUS_22890 152812 154878 gene locus_tag LOCUS_22900 152812 154878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 154875 155336 gene locus_tag LOCUS_22910 154875 155336 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887875.1 protein_id gnl|my_center|LOCUS_22910 155320 155769 gene locus_tag LOCUS_22920 155320 155769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 155766 156599 gene locus_tag LOCUS_22930 155766 156599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 156726 158390 gene locus_tag LOCUS_22940 156726 158390 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888212.1 protein_id gnl|my_center|LOCUS_22940 159020 158394 gene locus_tag LOCUS_22950 gene coaE 159020 158394 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888527.1 protein_id gnl|my_center|LOCUS_22950 159241 160059 gene locus_tag LOCUS_22960 159241 160059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 160411 161595 gene locus_tag LOCUS_22970 160411 161595 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350047.1 protein_id gnl|my_center|LOCUS_22970 162365 161658 gene locus_tag LOCUS_22980 162365 161658 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888749.1 protein_id gnl|my_center|LOCUS_22980 163134 162367 gene locus_tag LOCUS_22990 163134 162367 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618819.1 protein_id gnl|my_center|LOCUS_22990 164057 163131 gene locus_tag LOCUS_23000 164057 163131 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888751.1 protein_id gnl|my_center|LOCUS_23000 165033 164059 gene locus_tag LOCUS_23010 165033 164059 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479942.1 protein_id gnl|my_center|LOCUS_23010 166307 165153 gene locus_tag LOCUS_23020 166307 165153 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888753.1 protein_id gnl|my_center|LOCUS_23020 168189 166483 gene locus_tag LOCUS_23030 168189 166483 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887112.1 protein_id gnl|my_center|LOCUS_23030 169037 168252 gene locus_tag LOCUS_23040 169037 168252 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887115.1 protein_id gnl|my_center|LOCUS_23040 169139 169474 gene locus_tag LOCUS_23050 169139 169474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 169471 169830 gene locus_tag LOCUS_23060 169471 169830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 170061 171119 gene locus_tag LOCUS_23070 170061 171119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 172111 171167 gene locus_tag LOCUS_23080 172111 171167 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886783.1 protein_id gnl|my_center|LOCUS_23080 173240 172185 gene locus_tag LOCUS_23090 173240 172185 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404687.1 protein_id gnl|my_center|LOCUS_23090 173490 173414 gene locus_tag LOCUS_t00230 173490 173414 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 173604 173531 gene locus_tag LOCUS_t00240 173604 173531 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 173714 173638 gene locus_tag LOCUS_t00250 173714 173638 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 173757 174707 gene locus_tag LOCUS_23100 gene ubiA 173757 174707 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479699.1 protein_id gnl|my_center|LOCUS_23100 174689 174991 gene locus_tag LOCUS_23110 174689 174991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887496.1 protein_id gnl|my_center|LOCUS_23110 175071 175526 gene locus_tag LOCUS_23120 175071 175526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349654.1 protein_id gnl|my_center|LOCUS_23120 175651 176247 gene locus_tag LOCUS_23130 175651 176247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 176293 176970 gene locus_tag LOCUS_23140 176293 176970 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887388.1 protein_id gnl|my_center|LOCUS_23140 177064 178635 gene locus_tag LOCUS_23150 177064 178635 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618826.1 protein_id gnl|my_center|LOCUS_23150 179174 178695 gene locus_tag LOCUS_23160 gene argR 179174 178695 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479994.1 protein_id gnl|my_center|LOCUS_23160 180576 179281 gene locus_tag LOCUS_23170 180576 179281 CDS product DUF2254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119919.1 protein_id gnl|my_center|LOCUS_23170 182089 180851 gene locus_tag LOCUS_23180 gene coaBC 182089 180851 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887224.1 protein_id gnl|my_center|LOCUS_23180 182693 182115 gene locus_tag LOCUS_23190 182693 182115 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886722.1 protein_id gnl|my_center|LOCUS_23190 182822 185701 gene locus_tag LOCUS_23200 182822 185701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 187450 185726 gene locus_tag LOCUS_23210 187450 185726 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197480519.1 protein_id gnl|my_center|LOCUS_23210 188202 187447 gene locus_tag LOCUS_23220 gene allE 188202 187447 CDS product (S)-ureidoglycine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887795.1 protein_id gnl|my_center|LOCUS_23220 189639 188287 gene locus_tag LOCUS_23230 189639 188287 CDS product allantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887796.1 protein_id gnl|my_center|LOCUS_23230 190883 189636 gene locus_tag LOCUS_23240 190883 189636 CDS product allantoate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887797.1 protein_id gnl|my_center|LOCUS_23240 192280 190880 gene locus_tag LOCUS_23250 192280 190880 CDS product malate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887798.1 protein_id gnl|my_center|LOCUS_23250 193100 192324 gene locus_tag LOCUS_23260 193100 192324 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887799.1 protein_id gnl|my_center|LOCUS_23260 194682 193102 gene locus_tag LOCUS_23270 gene aceB 194682 193102 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889536.1 protein_id gnl|my_center|LOCUS_23270 196002 194803 gene locus_tag LOCUS_23280 196002 194803 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886673.1 protein_id gnl|my_center|LOCUS_23280 196566 196087 gene locus_tag LOCUS_23290 196566 196087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23290 198168 196924 gene locus_tag LOCUS_23300 198168 196924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 199014 198232 gene locus_tag LOCUS_23310 199014 198232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 199161 199694 gene locus_tag LOCUS_23320 gene uraD 199161 199694 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887801.1 protein_id gnl|my_center|LOCUS_23320 199691 200554 gene locus_tag LOCUS_23330 gene pucL 199691 200554 CDS product urate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887803.1 protein_id gnl|my_center|LOCUS_23330 200551 200913 gene locus_tag LOCUS_23340 gene uraH 200551 200913 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887804.1 protein_id gnl|my_center|LOCUS_23340 200931 202316 gene locus_tag LOCUS_23350 200931 202316 CDS product ethanolamine ammonia-lyase subunit EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388787.1 protein_id gnl|my_center|LOCUS_23350 202313 203101 gene locus_tag LOCUS_23360 gene eutC 202313 203101 CDS product ethanolamine ammonia-lyase subunit EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195860.1 protein_id gnl|my_center|LOCUS_23360 203176 204474 gene locus_tag LOCUS_23370 gene gabT 203176 204474 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103055.1 protein_id gnl|my_center|LOCUS_23370 204571 206019 gene locus_tag LOCUS_23380 204571 206019 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889263.1 protein_id gnl|my_center|LOCUS_23380 206302 206445 gene locus_tag LOCUS_23390 gene rpmH 206302 206445 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888783.1 protein_id gnl|my_center|LOCUS_23390 206519 206956 gene locus_tag LOCUS_23400 206519 206956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 206953 207213 gene locus_tag LOCUS_23410 gene yidD 206953 207213 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888781.1 protein_id gnl|my_center|LOCUS_23410 207210 208832 gene locus_tag LOCUS_23420 207210 208832 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479933.1 protein_id gnl|my_center|LOCUS_23420 209649 208885 gene locus_tag LOCUS_23430 209649 208885 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030618.1 protein_id gnl|my_center|LOCUS_23430 210937 209696 gene locus_tag LOCUS_23440 210937 209696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 212011 211010 gene locus_tag LOCUS_23450 212011 211010 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228309.1 protein_id gnl|my_center|LOCUS_23450 213141 212008 gene locus_tag LOCUS_23460 gene pdhA 213141 212008 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228310.1 protein_id gnl|my_center|LOCUS_23460 213757 213854 gene locus_tag LOCUS_t00260 213757 213854 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 214120 215028 gene locus_tag LOCUS_23470 214120 215028 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887392.1 protein_id gnl|my_center|LOCUS_23470 215239 215006 gene locus_tag LOCUS_23480 215239 215006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479993.1 protein_id gnl|my_center|LOCUS_23480 216379 215312 gene locus_tag LOCUS_23490 216379 215312 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887390.1 protein_id gnl|my_center|LOCUS_23490 216451 216921 gene locus_tag LOCUS_23500 216451 216921 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887211.1 protein_id gnl|my_center|LOCUS_23500 216905 217417 gene locus_tag LOCUS_23510 216905 217417 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173509797.1 protein_id gnl|my_center|LOCUS_23510 217848 220133 gene locus_tag LOCUS_23520 217848 220133 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479827.1 protein_id gnl|my_center|LOCUS_23520 220261 221223 gene locus_tag LOCUS_23530 220261 221223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 221263 221820 gene locus_tag LOCUS_23540 221263 221820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 221954 222490 gene locus_tag LOCUS_23550 221954 222490 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888144.1 protein_id gnl|my_center|LOCUS_23550 222478 223182 gene locus_tag LOCUS_23560 222478 223182 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888143.1 protein_id gnl|my_center|LOCUS_23560 223238 224536 gene locus_tag LOCUS_23570 gene nuoD 223238 224536 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888142.1 protein_id gnl|my_center|LOCUS_23570 224536 225354 gene locus_tag LOCUS_23580 224536 225354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 225351 225980 gene locus_tag LOCUS_23590 gene nuoE 225351 225980 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888140.1 protein_id gnl|my_center|LOCUS_23590 225977 227317 gene locus_tag LOCUS_23600 gene nuoF 225977 227317 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888139.1 protein_id gnl|my_center|LOCUS_23600 227314 229485 gene locus_tag LOCUS_23610 gene nuoG 227314 229485 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888138.1 protein_id gnl|my_center|LOCUS_23610 229485 230657 gene locus_tag LOCUS_23620 gene nuoH 229485 230657 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888137.1 protein_id gnl|my_center|LOCUS_23620 230691 231245 gene locus_tag LOCUS_23630 gene nuoI 230691 231245 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888136.1 protein_id gnl|my_center|LOCUS_23630 231319 231912 gene locus_tag LOCUS_23640 231319 231912 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888135.1 protein_id gnl|my_center|LOCUS_23640 231912 232214 gene locus_tag LOCUS_23650 gene nuoK 231912 232214 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480224.1 protein_id gnl|my_center|LOCUS_23650 232215 234149 gene locus_tag LOCUS_23660 gene nuoL 232215 234149 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025566951.1 protein_id gnl|my_center|LOCUS_23660 234146 235597 gene locus_tag LOCUS_23670 234146 235597 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888132.1 protein_id gnl|my_center|LOCUS_23670 235600 237105 gene locus_tag LOCUS_23680 235600 237105 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888131.1 protein_id gnl|my_center|LOCUS_23680 237495 237178 gene locus_tag LOCUS_23690 237495 237178 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888922.1 protein_id gnl|my_center|LOCUS_23690 237605 238048 gene locus_tag LOCUS_23700 237605 238048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350722.1 protein_id gnl|my_center|LOCUS_23700 238138 238995 gene locus_tag LOCUS_23710 gene accD 238138 238995 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887858.1 protein_id gnl|my_center|LOCUS_23710 238992 239933 gene locus_tag LOCUS_23720 238992 239933 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887857.1 protein_id gnl|my_center|LOCUS_23720 240434 241321 gene locus_tag LOCUS_23730 240434 241321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228187.1 protein_id gnl|my_center|LOCUS_23730 241475 242293 gene locus_tag LOCUS_23740 241475 242293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228189.1 protein_id gnl|my_center|LOCUS_23740 242290 242814 gene locus_tag LOCUS_23750 242290 242814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 242816 246103 gene locus_tag LOCUS_23760 242816 246103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 246654 248876 gene locus_tag LOCUS_23770 246654 248876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 249334 249089 gene locus_tag LOCUS_23780 249334 249089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 249216 250676 gene locus_tag LOCUS_23790 249216 250676 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886980.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23790 251680 250739 gene locus_tag LOCUS_23800 251680 250739 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889308.1 protein_id gnl|my_center|LOCUS_23800 252590 251742 gene locus_tag LOCUS_23810 252590 251742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 255391 252587 gene locus_tag LOCUS_23820 255391 252587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 255445 256851 gene locus_tag LOCUS_23830 255445 256851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 258160 256826 gene locus_tag LOCUS_23840 258160 256826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 259116 258157 gene locus_tag LOCUS_23850 259116 258157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 262244 259113 gene locus_tag LOCUS_23860 262244 259113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 262662 262252 gene locus_tag LOCUS_23870 262662 262252 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056419.1 protein_id gnl|my_center|LOCUS_23870 263044 262727 gene locus_tag LOCUS_23880 263044 262727 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057408.1 protein_id gnl|my_center|LOCUS_23880 264691 263081 gene locus_tag LOCUS_23890 264691 263081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 265031 264678 gene locus_tag LOCUS_23900 265031 264678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 266992 265028 gene locus_tag LOCUS_23910 266992 265028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 268133 266979 gene locus_tag LOCUS_23920 268133 266979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 269142 268339 gene locus_tag LOCUS_23930 gene pprA 269142 268339 CDS product DNA repair protein PprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889605.1 protein_id gnl|my_center|LOCUS_23930 269384 270034 gene locus_tag LOCUS_23940 269384 270034 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888994.1 protein_id gnl|my_center|LOCUS_23940 270076 271095 gene locus_tag LOCUS_23950 270076 271095 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177617.1 protein_id gnl|my_center|LOCUS_23950 272280 271102 gene locus_tag LOCUS_23960 272280 271102 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088694.1 protein_id gnl|my_center|LOCUS_23960 272406 272957 gene locus_tag LOCUS_23970 272406 272957 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888246.1 protein_id gnl|my_center|LOCUS_23970 273165 272971 gene locus_tag LOCUS_23980 273165 272971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 273286 274005 gene locus_tag LOCUS_23990 gene trmH 273286 274005 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888841.1 protein_id gnl|my_center|LOCUS_23990 274103 274918 gene locus_tag LOCUS_24000 274103 274918 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228451.1 protein_id gnl|my_center|LOCUS_24000 275072 275644 gene locus_tag LOCUS_24010 275072 275644 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328266.1 protein_id gnl|my_center|LOCUS_24010 275730 276962 gene locus_tag LOCUS_24020 275730 276962 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888856.1 protein_id gnl|my_center|LOCUS_24020 278784 277396 gene locus_tag LOCUS_24030 278784 277396 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888650.1 protein_id gnl|my_center|LOCUS_24030 279763 278795 gene locus_tag LOCUS_24040 279763 278795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 279807 280334 gene locus_tag LOCUS_24050 279807 280334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 281316 280324 gene locus_tag LOCUS_24060 gene galE 281316 280324 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479915.1 protein_id gnl|my_center|LOCUS_24060 282484 281399 gene locus_tag LOCUS_24070 282484 281399 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887146.1 protein_id gnl|my_center|LOCUS_24070 282975 282520 gene locus_tag LOCUS_24080 282975 282520 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479949.1 protein_id gnl|my_center|LOCUS_24080 283683 283093 gene locus_tag LOCUS_24090 283683 283093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 283814 284788 gene locus_tag LOCUS_24100 283814 284788 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177598.1 protein_id gnl|my_center|LOCUS_24100 285108 286352 gene locus_tag LOCUS_24110 285108 286352 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228780.1 protein_id gnl|my_center|LOCUS_24110 286462 287784 gene locus_tag LOCUS_24120 286462 287784 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811716.1 protein_id gnl|my_center|LOCUS_24120 288093 288587 gene locus_tag LOCUS_24130 288093 288587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 289492 288671 gene locus_tag LOCUS_24140 gene panB 289492 288671 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889239.1 protein_id gnl|my_center|LOCUS_24140 290800 289541 gene locus_tag LOCUS_24150 290800 289541 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037397.1 protein_id gnl|my_center|LOCUS_24150 291314 290838 gene locus_tag LOCUS_24160 291314 290838 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034358328.1 protein_id gnl|my_center|LOCUS_24160 291451 292440 gene locus_tag LOCUS_24170 291451 292440 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618901.1 protein_id gnl|my_center|LOCUS_24170 292437 293393 gene locus_tag LOCUS_24180 292437 293393 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889242.1 protein_id gnl|my_center|LOCUS_24180 293569 294795 gene locus_tag LOCUS_24190 gene coxB 293569 294795 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161617907.1 protein_id gnl|my_center|LOCUS_24190 294792 297254 gene locus_tag LOCUS_24200 294792 297254 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889244.1 protein_id gnl|my_center|LOCUS_24200 297414 298064 gene locus_tag LOCUS_24210 297414 298064 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887242.1 protein_id gnl|my_center|LOCUS_24210 298897 298127 gene locus_tag LOCUS_24220 298897 298127 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113379.1 protein_id gnl|my_center|LOCUS_24220 299103 300107 gene locus_tag LOCUS_24230 gene ruvB 299103 300107 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887241.1 protein_id gnl|my_center|LOCUS_24230 301208 300174 gene locus_tag LOCUS_24240 gene ada 301208 300174 CDS product bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553740.1 protein_id gnl|my_center|LOCUS_24240 301526 301218 gene locus_tag LOCUS_24250 301526 301218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 301431 301790 gene locus_tag LOCUS_24260 301431 301790 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480298.1 protein_id gnl|my_center|LOCUS_24260 302678 301794 gene locus_tag LOCUS_24270 302678 301794 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889194.1 protein_id gnl|my_center|LOCUS_24270 303814 302714 gene locus_tag LOCUS_24280 303814 302714 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177656.1 protein_id gnl|my_center|LOCUS_24280 303929 304339 gene locus_tag LOCUS_24290 303929 304339 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266264.1 protein_id gnl|my_center|LOCUS_24290 305094 304348 gene locus_tag LOCUS_24300 305094 304348 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115022.1 protein_id gnl|my_center|LOCUS_24300 305517 305098 gene locus_tag LOCUS_24310 305517 305098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 307543 305510 gene locus_tag LOCUS_24320 307543 305510 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479574.1 protein_id gnl|my_center|LOCUS_24320 308732 307623 gene locus_tag LOCUS_24330 308732 307623 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727261.1 protein_id gnl|my_center|LOCUS_24330 309482 308856 gene locus_tag LOCUS_24340 309482 308856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 309898 309479 gene locus_tag LOCUS_24350 309898 309479 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106807.1 protein_id gnl|my_center|LOCUS_24350 310313 309912 gene locus_tag LOCUS_24360 310313 309912 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976576.1 protein_id gnl|my_center|LOCUS_24360 310756 310310 gene locus_tag LOCUS_24370 310756 310310 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039237.1 protein_id gnl|my_center|LOCUS_24370 311519 310767 gene locus_tag LOCUS_24380 311519 310767 CDS product DUF899 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730220.1 protein_id gnl|my_center|LOCUS_24380 312349 311516 gene locus_tag LOCUS_24390 312349 311516 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532089.1 protein_id gnl|my_center|LOCUS_24390 312891 312346 gene locus_tag LOCUS_24400 312891 312346 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230676.1 protein_id gnl|my_center|LOCUS_24400 314366 312894 gene locus_tag LOCUS_24410 314366 312894 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803913.1 protein_id gnl|my_center|LOCUS_24410 314761 314363 gene locus_tag LOCUS_24420 314761 314363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 315349 314780 gene locus_tag LOCUS_24430 315349 314780 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970075.1 protein_id gnl|my_center|LOCUS_24430 315894 315346 gene locus_tag LOCUS_24440 315894 315346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 316189 315899 gene locus_tag LOCUS_24450 316189 315899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24450 316398 316096 gene locus_tag LOCUS_24460 316398 316096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 316955 316413 gene locus_tag LOCUS_24470 316955 316413 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529753.1 protein_id gnl|my_center|LOCUS_24470 317532 316957 gene locus_tag LOCUS_24480 317532 316957 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971475.1 protein_id gnl|my_center|LOCUS_24480 317425 317646 gene locus_tag LOCUS_24490 317425 317646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 317662 318348 gene locus_tag LOCUS_24500 317662 318348 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930032.1 protein_id gnl|my_center|LOCUS_24500 319880 318444 gene locus_tag LOCUS_24510 319880 318444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 320256 323993 gene locus_tag LOCUS_24520 320256 323993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 325142 324000 gene locus_tag LOCUS_24530 325142 324000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 325392 325316 gene locus_tag LOCUS_t00270 325392 325316 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 325477 326259 gene locus_tag LOCUS_24540 325477 326259 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887013.1 protein_id gnl|my_center|LOCUS_24540 326446 327795 gene locus_tag LOCUS_24550 326446 327795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 327864 328790 gene locus_tag LOCUS_24560 327864 328790 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228102.1 protein_id gnl|my_center|LOCUS_24560 329034 329645 gene locus_tag LOCUS_24570 329034 329645 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889321.1 protein_id gnl|my_center|LOCUS_24570 330582 329593 gene locus_tag LOCUS_24580 330582 329593 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889322.1 protein_id gnl|my_center|LOCUS_24580 331222 330749 gene locus_tag LOCUS_24590 331222 330749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 332666 331332 gene locus_tag LOCUS_24600 332666 331332 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888244.1 protein_id gnl|my_center|LOCUS_24600 333374 332706 gene locus_tag LOCUS_24610 333374 332706 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479875.1 protein_id gnl|my_center|LOCUS_24610 333436 333837 gene locus_tag LOCUS_24620 333436 333837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 333925 335130 gene locus_tag LOCUS_24630 333925 335130 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480158.1 protein_id gnl|my_center|LOCUS_24630 336051 335143 gene locus_tag LOCUS_24640 gene thrB 336051 335143 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889016.1 protein_id gnl|my_center|LOCUS_24640 336463 336732 gene locus_tag LOCUS_24650 336463 336732 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480068.1 protein_id gnl|my_center|LOCUS_24650 336948 337166 gene locus_tag LOCUS_24660 336948 337166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 337700 337236 gene locus_tag LOCUS_24670 gene lspA 337700 337236 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889014.1 protein_id gnl|my_center|LOCUS_24670 337874 338359 gene locus_tag LOCUS_24680 337874 338359 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480069.1 protein_id gnl|my_center|LOCUS_24680 >Feature sequence06 1008 1511 gene locus_tag LOCUS_24690 1008 1511 CDS product DUF4384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887664.1 protein_id gnl|my_center|LOCUS_24690 1811 2179 gene locus_tag LOCUS_24700 1811 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 2246 2764 gene locus_tag LOCUS_24710 2246 2764 CDS product putative metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887487.1 protein_id gnl|my_center|LOCUS_24710 2774 3277 gene locus_tag LOCUS_24720 2774 3277 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887668.1 protein_id gnl|my_center|LOCUS_24720 4220 3291 gene locus_tag LOCUS_24730 gene era 4220 3291 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887291.1 protein_id gnl|my_center|LOCUS_24730 4329 4955 gene locus_tag LOCUS_24740 4329 4955 CDS product YIP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888627.1 protein_id gnl|my_center|LOCUS_24740 5849 5025 gene locus_tag LOCUS_24750 5849 5025 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888626.1 protein_id gnl|my_center|LOCUS_24750 6900 5944 gene locus_tag LOCUS_24760 6900 5944 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888673.1 protein_id gnl|my_center|LOCUS_24760 8727 6901 gene locus_tag LOCUS_24770 8727 6901 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034351206.1 protein_id gnl|my_center|LOCUS_24770 9918 8887 gene locus_tag LOCUS_24780 gene galK 9918 8887 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011381253.1 protein_id gnl|my_center|LOCUS_24780 11018 9915 gene locus_tag LOCUS_24790 gene galT 11018 9915 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229184.1 protein_id gnl|my_center|LOCUS_24790 12344 11160 gene locus_tag LOCUS_24800 12344 11160 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887206.1 protein_id gnl|my_center|LOCUS_24800 13529 12390 gene locus_tag LOCUS_24810 13529 12390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 15508 13526 gene locus_tag LOCUS_24820 15508 13526 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080133.1 protein_id gnl|my_center|LOCUS_24820 15857 16939 gene locus_tag LOCUS_24830 gene lacI 15857 16939 CDS product DNA-binding transcriptional repressor LacI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011378570.1 protein_id gnl|my_center|LOCUS_24830 18484 17003 gene locus_tag LOCUS_24840 18484 17003 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229183.1 protein_id gnl|my_center|LOCUS_24840 20480 18477 gene locus_tag LOCUS_24850 20480 18477 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080133.1 protein_id gnl|my_center|LOCUS_24850 20955 20599 gene locus_tag LOCUS_24860 20955 20599 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479796.1 protein_id gnl|my_center|LOCUS_24860 21029 21619 gene locus_tag LOCUS_24870 gene lepB 21029 21619 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887963.1 protein_id gnl|my_center|LOCUS_24870 21660 22169 gene locus_tag LOCUS_24880 21660 22169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350427.1 protein_id gnl|my_center|LOCUS_24880 22223 22912 gene locus_tag LOCUS_24890 22223 22912 CDS product DUF2259 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152423607.1 protein_id gnl|my_center|LOCUS_24890 23435 22920 gene locus_tag LOCUS_24900 23435 22920 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141820.1 protein_id gnl|my_center|LOCUS_24900 25018 23726 gene locus_tag LOCUS_24910 25018 23726 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479867.1 protein_id gnl|my_center|LOCUS_24910 25186 25755 gene locus_tag LOCUS_24920 25186 25755 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888217.1 protein_id gnl|my_center|LOCUS_24920 25739 26815 gene locus_tag LOCUS_24930 gene queA 25739 26815 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888216.1 protein_id gnl|my_center|LOCUS_24930 27901 26819 gene locus_tag LOCUS_24940 27901 26819 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349608.1 protein_id gnl|my_center|LOCUS_24940 27936 29969 gene locus_tag LOCUS_24950 27936 29969 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888294.1 protein_id gnl|my_center|LOCUS_24950 30040 30525 gene locus_tag LOCUS_24960 30040 30525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 31372 30572 gene locus_tag LOCUS_24970 31372 30572 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258808.1 protein_id gnl|my_center|LOCUS_24970 34430 31380 gene locus_tag LOCUS_24980 34430 31380 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162015902.1 protein_id gnl|my_center|LOCUS_24980 34658 35809 gene locus_tag LOCUS_24990 34658 35809 CDS product heparan-alpha-glucosaminide N-acetyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888240.1 protein_id gnl|my_center|LOCUS_24990 35842 36906 gene locus_tag LOCUS_25000 35842 36906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350166.1 protein_id gnl|my_center|LOCUS_25000 36957 38150 gene locus_tag LOCUS_25010 36957 38150 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618799.1 protein_id gnl|my_center|LOCUS_25010 38943 38200 gene locus_tag LOCUS_25020 38943 38200 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103312601.1 protein_id gnl|my_center|LOCUS_25020 39832 39086 gene locus_tag LOCUS_25030 39832 39086 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085709.1 protein_id gnl|my_center|LOCUS_25030 40806 39829 gene locus_tag LOCUS_25040 40806 39829 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809683.1 protein_id gnl|my_center|LOCUS_25040 41737 40877 gene locus_tag LOCUS_25050 41737 40877 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 protein_id gnl|my_center|LOCUS_25050 42835 41738 gene locus_tag LOCUS_25060 42835 41738 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259465.1 protein_id gnl|my_center|LOCUS_25060 44076 42916 gene locus_tag LOCUS_25070 44076 42916 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931408.1 protein_id gnl|my_center|LOCUS_25070 44171 45259 gene locus_tag LOCUS_25080 44171 45259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 45252 45995 gene locus_tag LOCUS_25090 45252 45995 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259466.1 protein_id gnl|my_center|LOCUS_25090 46018 46713 gene locus_tag LOCUS_25100 46018 46713 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889327.1 protein_id gnl|my_center|LOCUS_25100 46734 47342 gene locus_tag LOCUS_25110 46734 47342 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889326.1 protein_id gnl|my_center|LOCUS_25110 48061 47438 gene locus_tag LOCUS_25120 48061 47438 CDS product CBS and ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887633.1 protein_id gnl|my_center|LOCUS_25120 48162 48653 gene locus_tag LOCUS_25130 48162 48653 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479660.1 protein_id gnl|my_center|LOCUS_25130 48695 49165 gene locus_tag LOCUS_25140 48695 49165 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479660.1 protein_id gnl|my_center|LOCUS_25140 49714 49220 gene locus_tag LOCUS_25150 49714 49220 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869958.1 protein_id gnl|my_center|LOCUS_25150 51066 49828 gene locus_tag LOCUS_25160 51066 49828 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618783.1 protein_id gnl|my_center|LOCUS_25160 51442 51137 gene locus_tag LOCUS_25170 51442 51137 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618878.1 protein_id gnl|my_center|LOCUS_25170 53670 51439 gene locus_tag LOCUS_25180 gene feoB 53670 51439 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887862.1 protein_id gnl|my_center|LOCUS_25180 53897 53667 gene locus_tag LOCUS_25190 53897 53667 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887863.1 protein_id gnl|my_center|LOCUS_25190 54725 53973 gene locus_tag LOCUS_25200 54725 53973 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017868968.1 protein_id gnl|my_center|LOCUS_25200 55291 54713 gene locus_tag LOCUS_25210 55291 54713 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479672.1 protein_id gnl|my_center|LOCUS_25210 56398 55331 gene locus_tag LOCUS_25220 56398 55331 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886836.1 protein_id gnl|my_center|LOCUS_25220 57570 56398 gene locus_tag LOCUS_25230 57570 56398 CDS product DUF898 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869788.1 protein_id gnl|my_center|LOCUS_25230 58022 57747 gene locus_tag LOCUS_25240 58022 57747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 58320 58874 gene locus_tag LOCUS_25250 58320 58874 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479952.1 protein_id gnl|my_center|LOCUS_25250 58871 59770 gene locus_tag LOCUS_25260 58871 59770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 60629 59796 gene locus_tag LOCUS_25270 60629 59796 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479910.1 protein_id gnl|my_center|LOCUS_25270 60983 63265 gene locus_tag LOCUS_25280 60983 63265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 63626 63273 gene locus_tag LOCUS_25290 63626 63273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 65965 63626 gene locus_tag LOCUS_25300 gene recG 65965 63626 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479810.1 protein_id gnl|my_center|LOCUS_25300 67771 66368 gene locus_tag LOCUS_25310 67771 66368 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887969.1 protein_id gnl|my_center|LOCUS_25310 66548 66641 gene locus_tag LOCUS_t00280 66548 66641 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 67849 68844 gene locus_tag LOCUS_25320 67849 68844 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397112.1 protein_id gnl|my_center|LOCUS_25320 68917 70047 gene locus_tag LOCUS_25330 gene dgt 68917 70047 CDS product dNTP triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887649.1 protein_id gnl|my_center|LOCUS_25330 70131 70207 gene locus_tag LOCUS_t00290 70131 70207 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 71821 70367 gene locus_tag LOCUS_25340 71821 70367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095757.1 protein_id gnl|my_center|LOCUS_25340 73254 72082 gene locus_tag LOCUS_25350 73254 72082 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929074.1 protein_id gnl|my_center|LOCUS_25350 73484 74083 gene locus_tag LOCUS_25360 73484 74083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 75081 74080 gene locus_tag LOCUS_25370 gene lipA 75081 74080 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887411.1 protein_id gnl|my_center|LOCUS_25370 75810 75088 gene locus_tag LOCUS_25380 gene lipB 75810 75088 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161617926.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25380 76003 76530 gene locus_tag LOCUS_25390 76003 76530 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479987.1 protein_id gnl|my_center|LOCUS_25390 77350 76562 gene locus_tag LOCUS_25400 77350 76562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 77557 78018 gene locus_tag LOCUS_25410 gene rplS 77557 78018 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887401.1 protein_id gnl|my_center|LOCUS_25410 78136 78963 gene locus_tag LOCUS_25420 78136 78963 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350289.1 protein_id gnl|my_center|LOCUS_25420 79034 79447 gene locus_tag LOCUS_25430 79034 79447 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227734.1 protein_id gnl|my_center|LOCUS_25430 79521 80393 gene locus_tag LOCUS_25440 79521 80393 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886659.1 protein_id gnl|my_center|LOCUS_25440 81123 80461 gene locus_tag LOCUS_25450 81123 80461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 82529 81120 gene locus_tag LOCUS_25460 82529 81120 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479935.1 protein_id gnl|my_center|LOCUS_25460 82572 83132 gene locus_tag LOCUS_25470 82572 83132 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888775.1 protein_id gnl|my_center|LOCUS_25470 83164 84084 gene locus_tag LOCUS_25480 83164 84084 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888774.1 protein_id gnl|my_center|LOCUS_25480 84089 84580 gene locus_tag LOCUS_25490 84089 84580 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888773.1 protein_id gnl|my_center|LOCUS_25490 85050 84649 gene locus_tag LOCUS_25500 gene rpsI 85050 84649 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886821.1 protein_id gnl|my_center|LOCUS_25500 85478 85053 gene locus_tag LOCUS_25510 gene rplM 85478 85053 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886820.1 protein_id gnl|my_center|LOCUS_25510 86164 85637 gene locus_tag LOCUS_25520 86164 85637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 89194 86174 gene locus_tag LOCUS_25530 89194 86174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 89909 89481 gene locus_tag LOCUS_25540 gene aroQ 89909 89481 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887424.1 protein_id gnl|my_center|LOCUS_25540 90998 89952 gene locus_tag LOCUS_25550 gene aroB 90998 89952 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887423.1 protein_id gnl|my_center|LOCUS_25550 91725 90985 gene locus_tag LOCUS_25560 91725 90985 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350371.1 protein_id gnl|my_center|LOCUS_25560 92876 91728 gene locus_tag LOCUS_25570 gene aroC 92876 91728 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887421.1 protein_id gnl|my_center|LOCUS_25570 95209 93014 gene locus_tag LOCUS_25580 95209 93014 CDS product secretin N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034358732.1 protein_id gnl|my_center|LOCUS_25580 96535 95213 gene locus_tag LOCUS_25590 96535 95213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 97173 96532 gene locus_tag LOCUS_25600 97173 96532 CDS product type II secretion system protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887418.1 protein_id gnl|my_center|LOCUS_25600 97906 97163 gene locus_tag LOCUS_25610 97906 97163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887417.1 protein_id gnl|my_center|LOCUS_25610 99077 97899 gene locus_tag LOCUS_25620 gene pilM 99077 97899 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887416.1 protein_id gnl|my_center|LOCUS_25620 100279 99476 gene locus_tag LOCUS_25630 100279 99476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887415.1 protein_id gnl|my_center|LOCUS_25630 101549 100254 gene locus_tag LOCUS_25640 101549 100254 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887414.1 protein_id gnl|my_center|LOCUS_25640 101667 103418 gene locus_tag LOCUS_25650 101667 103418 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887150.1 protein_id gnl|my_center|LOCUS_25650 103480 104463 gene locus_tag LOCUS_25660 103480 104463 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339158.1 protein_id gnl|my_center|LOCUS_25660 106161 104515 gene locus_tag LOCUS_25670 106161 104515 CDS product TROVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887905.1 protein_id gnl|my_center|LOCUS_25670 106326 106251 gene locus_tag LOCUS_t00300 106326 106251 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 106405 106331 gene locus_tag LOCUS_t00310 106405 106331 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 106536 106462 gene locus_tag LOCUS_t00320 106536 106462 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 106669 106595 gene locus_tag LOCUS_t00330 106669 106595 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 106815 106741 gene locus_tag LOCUS_t00340 106815 106741 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 106895 106820 gene locus_tag LOCUS_t00350 106895 106820 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 107855 107778 gene locus_tag LOCUS_t00360 107855 107778 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 108052 107978 gene locus_tag LOCUS_t00370 108052 107978 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 108392 108318 gene locus_tag LOCUS_t00380 108392 108318 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 108485 108411 gene locus_tag LOCUS_t00390 108485 108411 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 110338 108710 gene locus_tag LOCUS_25680 110338 108710 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349557.1 protein_id gnl|my_center|LOCUS_25680 110663 110331 gene locus_tag LOCUS_25690 110663 110331 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887034.1 protein_id gnl|my_center|LOCUS_25690 110795 112171 gene locus_tag LOCUS_25700 110795 112171 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480002.1 protein_id gnl|my_center|LOCUS_25700 113090 112218 gene locus_tag LOCUS_25710 113090 112218 CDS product DUF4032 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228784.1 protein_id gnl|my_center|LOCUS_25710 113146 113382 gene locus_tag LOCUS_25720 113146 113382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 113386 113985 gene locus_tag LOCUS_25730 113386 113985 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887361.1 protein_id gnl|my_center|LOCUS_25730 113990 114556 gene locus_tag LOCUS_25740 113990 114556 CDS product mismatch-specific DNA-glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887360.1 protein_id gnl|my_center|LOCUS_25740 114621 116420 gene locus_tag LOCUS_25750 114621 116420 CDS product HSP90 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018463.1 protein_id gnl|my_center|LOCUS_25750 116435 117535 gene locus_tag LOCUS_25760 116435 117535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570093.1 protein_id gnl|my_center|LOCUS_25760 117596 118366 gene locus_tag LOCUS_25770 117596 118366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887359.1 protein_id gnl|my_center|LOCUS_25770 118471 119952 gene locus_tag LOCUS_25780 118471 119952 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926110.1 protein_id gnl|my_center|LOCUS_25780 121497 120043 gene locus_tag LOCUS_25790 121497 120043 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941860.1 protein_id gnl|my_center|LOCUS_25790 121907 121587 gene locus_tag LOCUS_25800 121907 121587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 122230 124368 gene locus_tag LOCUS_25810 122230 124368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 125277 124579 gene locus_tag LOCUS_25820 125277 124579 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430452.1 protein_id gnl|my_center|LOCUS_25820 125624 127108 gene locus_tag LOCUS_25830 125624 127108 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941860.1 protein_id gnl|my_center|LOCUS_25830 127904 129475 gene locus_tag LOCUS_25840 127904 129475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 129475 129945 gene locus_tag LOCUS_25850 129475 129945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 129949 130407 gene locus_tag LOCUS_25860 129949 130407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 130404 131090 gene locus_tag LOCUS_25870 130404 131090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 131521 131204 gene locus_tag LOCUS_25880 131521 131204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 132227 132153 gene locus_tag LOCUS_t00400 132227 132153 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 132322 132247 gene locus_tag LOCUS_t00410 132322 132247 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 132424 133782 gene locus_tag LOCUS_25890 132424 133782 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479518.1 protein_id gnl|my_center|LOCUS_25890 133775 134605 gene locus_tag LOCUS_25900 133775 134605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479520.1 protein_id gnl|my_center|LOCUS_25900 134734 135492 gene locus_tag LOCUS_25910 134734 135492 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887221.1 protein_id gnl|my_center|LOCUS_25910 135604 137334 gene locus_tag LOCUS_25920 135604 137334 CDS product GAF domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025567123.1 protein_id gnl|my_center|LOCUS_25920 137752 137354 gene locus_tag LOCUS_25930 gene apaG 137752 137354 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886874.1 protein_id gnl|my_center|LOCUS_25930 137791 138858 gene locus_tag LOCUS_25940 137791 138858 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480164.1 protein_id gnl|my_center|LOCUS_25940 139939 138914 gene locus_tag LOCUS_25950 gene dusA 139939 138914 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888333.1 protein_id gnl|my_center|LOCUS_25950 140195 139965 gene locus_tag LOCUS_25960 140195 139965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479909.1 protein_id gnl|my_center|LOCUS_25960 141214 140252 gene locus_tag LOCUS_25970 141214 140252 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034351104.1 protein_id gnl|my_center|LOCUS_25970 141690 141211 gene locus_tag LOCUS_25980 141690 141211 CDS product DUF6194 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480128.1 protein_id gnl|my_center|LOCUS_25980 142311 141817 gene locus_tag LOCUS_25990 142311 141817 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079901.1 protein_id gnl|my_center|LOCUS_25990 144128 142308 gene locus_tag LOCUS_26000 144128 142308 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349776.1 protein_id gnl|my_center|LOCUS_26000 145242 144205 gene locus_tag LOCUS_26010 145242 144205 CDS product DNA double-strand break repair nuclease NurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887482.1 protein_id gnl|my_center|LOCUS_26010 145999 145343 gene locus_tag LOCUS_26020 145999 145343 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887480.1 protein_id gnl|my_center|LOCUS_26020 147033 146128 gene locus_tag LOCUS_26030 147033 146128 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887479.1 protein_id gnl|my_center|LOCUS_26030 147395 147219 gene locus_tag LOCUS_26040 147395 147219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 147771 149210 gene locus_tag LOCUS_26050 147771 149210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 149215 150186 gene locus_tag LOCUS_26060 gene tgmB 149215 150186 CDS product ATP-grasp ribosomal peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228560.1 protein_id gnl|my_center|LOCUS_26060 150183 150518 gene locus_tag LOCUS_26070 150183 150518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 151126 150572 gene locus_tag LOCUS_26080 151126 150572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 151246 152553 gene locus_tag LOCUS_26090 gene purB 151246 152553 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888809.1 protein_id gnl|my_center|LOCUS_26090 152563 153516 gene locus_tag LOCUS_26100 152563 153516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 153610 153978 gene locus_tag LOCUS_26110 153610 153978 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887808.1 protein_id gnl|my_center|LOCUS_26110 153975 154928 gene locus_tag LOCUS_26120 gene panC 153975 154928 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887807.1 protein_id gnl|my_center|LOCUS_26120 154925 156001 gene locus_tag LOCUS_26130 154925 156001 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887806.1 protein_id gnl|my_center|LOCUS_26130 156240 157415 gene locus_tag LOCUS_26140 156240 157415 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869840.1 protein_id gnl|my_center|LOCUS_26140 157653 157402 gene locus_tag LOCUS_26150 157653 157402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 157550 158314 gene locus_tag LOCUS_26160 157550 158314 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479931.1 protein_id gnl|my_center|LOCUS_26160 158467 159258 gene locus_tag LOCUS_26170 158467 159258 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479930.1 protein_id gnl|my_center|LOCUS_26170 159925 159260 gene locus_tag LOCUS_26180 159925 159260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 160072 161583 gene locus_tag LOCUS_26190 gene malQ 160072 161583 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479885.1 protein_id gnl|my_center|LOCUS_26190 161667 162239 gene locus_tag LOCUS_26200 161667 162239 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888275.1 protein_id gnl|my_center|LOCUS_26200 163444 162284 gene locus_tag LOCUS_26210 163444 162284 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084987.1 protein_id gnl|my_center|LOCUS_26210 163818 163441 gene locus_tag LOCUS_26220 163818 163441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 164896 163862 gene locus_tag LOCUS_26230 164896 163862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26230 165357 165824 gene locus_tag LOCUS_26240 165357 165824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 165821 166429 gene locus_tag LOCUS_26250 165821 166429 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010430079.1 protein_id gnl|my_center|LOCUS_26250 166426 167304 gene locus_tag LOCUS_26260 166426 167304 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192732.1 protein_id gnl|my_center|LOCUS_26260 167386 168645 gene locus_tag LOCUS_26270 167386 168645 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350363.1 protein_id gnl|my_center|LOCUS_26270 168777 170474 gene locus_tag LOCUS_26280 168777 170474 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479876.1 protein_id gnl|my_center|LOCUS_26280 171509 170535 gene locus_tag LOCUS_26290 171509 170535 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226355.1 protein_id gnl|my_center|LOCUS_26290 171760 173379 gene locus_tag LOCUS_26300 171760 173379 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467774.1 protein_id gnl|my_center|LOCUS_26300 173519 174505 gene locus_tag LOCUS_26310 173519 174505 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230099.1 protein_id gnl|my_center|LOCUS_26310 174502 176400 gene locus_tag LOCUS_26320 174502 176400 CDS product dipeptide/oligopeptide/nickel ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225594.1 protein_id gnl|my_center|LOCUS_26320 176387 177418 gene locus_tag LOCUS_26330 176387 177418 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191306915.1 protein_id gnl|my_center|LOCUS_26330 177516 180002 gene locus_tag LOCUS_26340 177516 180002 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040114033.1 protein_id gnl|my_center|LOCUS_26340 179999 180796 gene locus_tag LOCUS_26350 179999 180796 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227640.1 protein_id gnl|my_center|LOCUS_26350 180787 181905 gene locus_tag LOCUS_26360 180787 181905 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125082658.1 protein_id gnl|my_center|LOCUS_26360 181995 183002 gene locus_tag LOCUS_26370 181995 183002 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333876.1 protein_id gnl|my_center|LOCUS_26370 182999 184168 gene locus_tag LOCUS_26380 182999 184168 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839857.1 protein_id gnl|my_center|LOCUS_26380 184316 184894 gene locus_tag LOCUS_26390 184316 184894 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889413.1 protein_id gnl|my_center|LOCUS_26390 185594 184896 gene locus_tag LOCUS_26400 gene ygeA 185594 184896 CDS product amino acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848664.1 protein_id gnl|my_center|LOCUS_26400 185971 185591 gene locus_tag LOCUS_26410 185971 185591 CDS product low molecular weight protein tyrosine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528628.1 protein_id gnl|my_center|LOCUS_26410 186666 185944 gene locus_tag LOCUS_26420 186666 185944 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889384.1 protein_id gnl|my_center|LOCUS_26420 186956 186663 gene locus_tag LOCUS_26430 186956 186663 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084050946.1 protein_id gnl|my_center|LOCUS_26430 187513 186953 gene locus_tag LOCUS_26440 187513 186953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 189137 187578 gene locus_tag LOCUS_26450 189137 187578 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480228.1 protein_id gnl|my_center|LOCUS_26450 190385 189375 gene locus_tag LOCUS_26460 gene ilvC 190385 189375 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480217.1 protein_id gnl|my_center|LOCUS_26460 191095 190493 gene locus_tag LOCUS_26470 gene ilvN 191095 190493 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480219.1 protein_id gnl|my_center|LOCUS_26470 192935 191229 gene locus_tag LOCUS_26480 gene ilvB 192935 191229 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177759.1 protein_id gnl|my_center|LOCUS_26480 193706 193230 gene locus_tag LOCUS_26490 193706 193230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 195659 193869 gene locus_tag LOCUS_26500 195659 193869 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479878.1 protein_id gnl|my_center|LOCUS_26500 197154 195898 gene locus_tag LOCUS_26510 197154 195898 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888077.1 protein_id gnl|my_center|LOCUS_26510 197498 200521 gene locus_tag LOCUS_26520 gene uvrA 197498 200521 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888406.1 protein_id gnl|my_center|LOCUS_26520 200518 201177 gene locus_tag LOCUS_26530 200518 201177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26530 201296 202000 gene locus_tag LOCUS_26540 201296 202000 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479991.1 protein_id gnl|my_center|LOCUS_26540 202086 202517 gene locus_tag LOCUS_26550 202086 202517 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887400.1 protein_id gnl|my_center|LOCUS_26550 203783 202563 gene locus_tag LOCUS_26560 203783 202563 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887543.1 protein_id gnl|my_center|LOCUS_26560 205991 203862 gene locus_tag LOCUS_26570 205991 203862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 207043 206075 gene locus_tag LOCUS_26580 207043 206075 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888286.1 protein_id gnl|my_center|LOCUS_26580 207189 207956 gene locus_tag LOCUS_26590 207189 207956 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888285.1 protein_id gnl|my_center|LOCUS_26590 208164 208793 gene locus_tag LOCUS_26600 208164 208793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 210112 208880 gene locus_tag LOCUS_26610 210112 208880 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926086.1 protein_id gnl|my_center|LOCUS_26610 211868 210228 gene locus_tag LOCUS_26620 211868 210228 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888387.1 protein_id gnl|my_center|LOCUS_26620 212028 212651 gene locus_tag LOCUS_26630 gene sodA 212028 212651 CDS product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887922.1 protein_id gnl|my_center|LOCUS_26630 214010 212715 gene locus_tag LOCUS_26640 214010 212715 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257389.1 protein_id gnl|my_center|LOCUS_26640 214749 214114 gene locus_tag LOCUS_26650 214749 214114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 214661 214909 gene locus_tag LOCUS_26660 214661 214909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 214937 216607 gene locus_tag LOCUS_26670 214937 216607 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888181.1 protein_id gnl|my_center|LOCUS_26670 216709 217917 gene locus_tag LOCUS_26680 216709 217917 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479853.1 protein_id gnl|my_center|LOCUS_26680 217933 218964 gene locus_tag LOCUS_26690 217933 218964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 219924 218971 gene locus_tag LOCUS_26700 219924 218971 CDS product DUF1152 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084641995.1 protein_id gnl|my_center|LOCUS_26700 219957 220628 gene locus_tag LOCUS_26710 219957 220628 CDS product peptidoglycan recognition family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929263.1 protein_id gnl|my_center|LOCUS_26710 222416 220680 gene locus_tag LOCUS_26720 222416 220680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 222520 223203 gene locus_tag LOCUS_26730 222520 223203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 224088 223210 gene locus_tag LOCUS_26740 224088 223210 CDS product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404376.1 protein_id gnl|my_center|LOCUS_26740 225070 224117 gene locus_tag LOCUS_26750 225070 224117 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887048.1 protein_id gnl|my_center|LOCUS_26750 225366 227666 gene locus_tag LOCUS_26760 225366 227666 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025567519.1 protein_id gnl|my_center|LOCUS_26760 227663 228640 gene locus_tag LOCUS_26770 227663 228640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480209.1 protein_id gnl|my_center|LOCUS_26770 229354 228650 gene locus_tag LOCUS_26780 229354 228650 CDS product DUF2071 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399111.1 protein_id gnl|my_center|LOCUS_26780 229519 229971 gene locus_tag LOCUS_26790 229519 229971 CDS product PA2169 family four-helix-bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314059.1 protein_id gnl|my_center|LOCUS_26790 230410 230009 gene locus_tag LOCUS_26800 230410 230009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 230497 231873 gene locus_tag LOCUS_26810 230497 231873 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152423524.1 protein_id gnl|my_center|LOCUS_26810 232212 231949 gene locus_tag LOCUS_26820 232212 231949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 233396 232287 gene locus_tag LOCUS_26830 233396 232287 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479799.1 protein_id gnl|my_center|LOCUS_26830 234154 233393 gene locus_tag LOCUS_26840 234154 233393 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350041.1 protein_id gnl|my_center|LOCUS_26840 234048 234287 gene locus_tag LOCUS_26850 234048 234287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 234284 234415 gene locus_tag LOCUS_26860 234284 234415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 234453 236069 gene locus_tag LOCUS_26870 234453 236069 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887539.1 protein_id gnl|my_center|LOCUS_26870 236103 237335 gene locus_tag LOCUS_26880 236103 237335 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886797.1 protein_id gnl|my_center|LOCUS_26880 237360 237932 gene locus_tag LOCUS_26890 237360 237932 CDS product biliverdin-producing heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177622.1 protein_id gnl|my_center|LOCUS_26890 237929 240211 gene locus_tag LOCUS_26900 237929 240211 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971984.1 protein_id gnl|my_center|LOCUS_26900 240213 240647 gene locus_tag LOCUS_26910 240213 240647 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389344.1 protein_id gnl|my_center|LOCUS_26910 240644 242617 gene locus_tag LOCUS_26920 240644 242617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 243487 242642 gene locus_tag LOCUS_26930 gene pyrF 243487 242642 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479917.1 protein_id gnl|my_center|LOCUS_26930 244002 243484 gene locus_tag LOCUS_26940 244002 243484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26940 244184 245065 gene locus_tag LOCUS_26950 244184 245065 CDS product DUF1028 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228982.1 protein_id gnl|my_center|LOCUS_26950 245098 245565 gene locus_tag LOCUS_26960 245098 245565 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888831.1 protein_id gnl|my_center|LOCUS_26960 246222 245581 gene locus_tag LOCUS_26970 246222 245581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888027.1 protein_id gnl|my_center|LOCUS_26970 246379 247533 gene locus_tag LOCUS_26980 246379 247533 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888026.1 protein_id gnl|my_center|LOCUS_26980 247653 247578 gene locus_tag LOCUS_t00420 247653 247578 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 248327 247743 gene locus_tag LOCUS_26990 248327 247743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 249552 248362 gene locus_tag LOCUS_27000 249552 248362 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349521.1 protein_id gnl|my_center|LOCUS_27000 249611 250156 gene locus_tag LOCUS_27010 gene purE 249611 250156 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886671.1 protein_id gnl|my_center|LOCUS_27010 250153 251268 gene locus_tag LOCUS_27020 gene purK 250153 251268 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886672.1 protein_id gnl|my_center|LOCUS_27020 251378 252532 gene locus_tag LOCUS_27030 251378 252532 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886673.1 protein_id gnl|my_center|LOCUS_27030 252545 253114 gene locus_tag LOCUS_27040 252545 253114 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889068.1 protein_id gnl|my_center|LOCUS_27040 253874 253125 gene locus_tag LOCUS_27050 gene argB 253874 253125 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889067.1 protein_id gnl|my_center|LOCUS_27050 255032 253956 gene locus_tag LOCUS_27060 255032 253956 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887087.1 protein_id gnl|my_center|LOCUS_27060 255769 255170 gene locus_tag LOCUS_27070 255769 255170 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618767.1 protein_id gnl|my_center|LOCUS_27070 256402 255812 gene locus_tag LOCUS_27080 256402 255812 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227762.1 protein_id gnl|my_center|LOCUS_27080 256473 256958 gene locus_tag LOCUS_27090 256473 256958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 256987 257892 gene locus_tag LOCUS_27100 256987 257892 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034351062.1 protein_id gnl|my_center|LOCUS_27100 257885 258400 gene locus_tag LOCUS_27110 257885 258400 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889057.1 protein_id gnl|my_center|LOCUS_27110 258456 259208 gene locus_tag LOCUS_27120 258456 259208 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888957.1 protein_id gnl|my_center|LOCUS_27120 259213 260163 gene locus_tag LOCUS_27130 259213 260163 CDS product DNA polymerase III subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888958.1 protein_id gnl|my_center|LOCUS_27130 260942 260172 gene locus_tag LOCUS_27140 260942 260172 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887202.1 protein_id gnl|my_center|LOCUS_27140 261960 260962 gene locus_tag LOCUS_27150 gene trpS 261960 260962 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887203.1 protein_id gnl|my_center|LOCUS_27150 263981 262071 gene locus_tag LOCUS_27160 263981 262071 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350791.1 protein_id gnl|my_center|LOCUS_27160 264040 264116 gene locus_tag LOCUS_t00430 264040 264116 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 264322 265326 gene locus_tag LOCUS_27170 264322 265326 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350037.1 protein_id gnl|my_center|LOCUS_27170 265783 265379 gene locus_tag LOCUS_27180 265783 265379 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888657.1 protein_id gnl|my_center|LOCUS_27180 266029 265811 gene locus_tag LOCUS_27190 266029 265811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 266392 268287 gene locus_tag LOCUS_27200 266392 268287 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227076.1 protein_id gnl|my_center|LOCUS_27200 268837 268340 gene locus_tag LOCUS_27210 268837 268340 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888035.1 protein_id gnl|my_center|LOCUS_27210 269426 268866 gene locus_tag LOCUS_27220 gene dcd 269426 268866 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174218.1 protein_id gnl|my_center|LOCUS_27220 269478 270209 gene locus_tag LOCUS_27230 269478 270209 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887903.1 protein_id gnl|my_center|LOCUS_27230 270233 271327 gene locus_tag LOCUS_27240 270233 271327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 272092 271406 gene locus_tag LOCUS_27250 272092 271406 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887538.1 protein_id gnl|my_center|LOCUS_27250 275014 272156 gene locus_tag LOCUS_27260 gene treY 275014 272156 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479556.1 protein_id gnl|my_center|LOCUS_27260 276822 275011 gene locus_tag LOCUS_27270 gene treZ 276822 275011 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887109.1 protein_id gnl|my_center|LOCUS_27270 279043 276908 gene locus_tag LOCUS_27280 gene glgX 279043 276908 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886909.1 protein_id gnl|my_center|LOCUS_27280 280032 279223 gene locus_tag LOCUS_27290 280032 279223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479908.1 protein_id gnl|my_center|LOCUS_27290 281088 280114 gene locus_tag LOCUS_27300 281088 280114 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479894.1 protein_id gnl|my_center|LOCUS_27300 281677 281177 gene locus_tag LOCUS_27310 281677 281177 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480196.1 protein_id gnl|my_center|LOCUS_27310 282003 281707 gene locus_tag LOCUS_27320 282003 281707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 283535 282045 gene locus_tag LOCUS_27330 gene proS 283535 282045 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887909.1 protein_id gnl|my_center|LOCUS_27330 283647 283913 gene locus_tag LOCUS_27340 283647 283913 CDS product DUF2171 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887904.1 protein_id gnl|my_center|LOCUS_27340 284125 284961 gene locus_tag LOCUS_27350 284125 284961 CDS product bromoperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074319.1 protein_id gnl|my_center|LOCUS_27350 285029 286969 gene locus_tag LOCUS_27360 285029 286969 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887578.1 protein_id gnl|my_center|LOCUS_27360 286966 287151 gene locus_tag LOCUS_27370 286966 287151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 287360 288190 gene locus_tag LOCUS_27380 287360 288190 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887908.1 protein_id gnl|my_center|LOCUS_27380 288329 288529 gene locus_tag LOCUS_27390 gene rpmI 288329 288529 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888638.1 protein_id gnl|my_center|LOCUS_27390 288535 288888 gene locus_tag LOCUS_27400 gene rplT 288535 288888 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888637.1 protein_id gnl|my_center|LOCUS_27400 289662 288970 gene locus_tag LOCUS_27410 289662 288970 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480290.1 protein_id gnl|my_center|LOCUS_27410 290895 289792 gene locus_tag LOCUS_27420 gene moaA 290895 289792 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166466103.1 protein_id gnl|my_center|LOCUS_27420 291116 291415 gene locus_tag LOCUS_27430 291116 291415 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887121.1 protein_id gnl|my_center|LOCUS_27430 291412 293007 gene locus_tag LOCUS_27440 291412 293007 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887122.1 protein_id gnl|my_center|LOCUS_27440 293208 295157 gene locus_tag LOCUS_27450 gene acs 293208 295157 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889096.1 protein_id gnl|my_center|LOCUS_27450 295684 295241 gene locus_tag LOCUS_27460 295684 295241 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889463.1 protein_id gnl|my_center|LOCUS_27460 296961 295795 gene locus_tag LOCUS_27470 296961 295795 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888896.1 protein_id gnl|my_center|LOCUS_27470 297092 298222 gene locus_tag LOCUS_27480 gene nagA 297092 298222 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889325.1 protein_id gnl|my_center|LOCUS_27480 298219 299247 gene locus_tag LOCUS_27490 298219 299247 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889414.1 protein_id gnl|my_center|LOCUS_27490 299714 299316 gene locus_tag LOCUS_27500 299714 299316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 299915 300421 gene locus_tag LOCUS_27510 299915 300421 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479688.1 protein_id gnl|my_center|LOCUS_27510 305162 300501 gene locus_tag LOCUS_27520 gene rpoC 305162 300501 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887556.1 protein_id gnl|my_center|LOCUS_27520 308774 305301 gene locus_tag LOCUS_27530 308774 305301 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479684.1 protein_id gnl|my_center|LOCUS_27530 310223 309063 gene locus_tag LOCUS_27540 310223 309063 CDS product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275270.1 protein_id gnl|my_center|LOCUS_27540 310300 311190 gene locus_tag LOCUS_27550 310300 311190 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521379.1 protein_id gnl|my_center|LOCUS_27550 311305 312096 gene locus_tag LOCUS_27560 311305 312096 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918371.1 protein_id gnl|my_center|LOCUS_27560 312715 312089 gene locus_tag LOCUS_27570 312715 312089 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480073.1 protein_id gnl|my_center|LOCUS_27570 312819 313388 gene locus_tag LOCUS_27580 312819 313388 CDS product DUF2239 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886693.1 protein_id gnl|my_center|LOCUS_27580 313385 313702 gene locus_tag LOCUS_27590 313385 313702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 313693 314298 gene locus_tag LOCUS_27600 313693 314298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350803.1 protein_id gnl|my_center|LOCUS_27600 314902 314537 gene locus_tag LOCUS_27610 gene rplL 314902 314537 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888675.1 protein_id gnl|my_center|LOCUS_27610 315460 314963 gene locus_tag LOCUS_27620 gene rplJ 315460 314963 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888676.1 protein_id gnl|my_center|LOCUS_27620 316375 315674 gene locus_tag LOCUS_27630 gene rplA 316375 315674 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888677.1 protein_id gnl|my_center|LOCUS_27630 316802 316368 gene locus_tag LOCUS_27640 gene rplK 316802 316368 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888678.1 protein_id gnl|my_center|LOCUS_27640 317539 316967 gene locus_tag LOCUS_27650 gene nusG 317539 316967 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888679.1 protein_id gnl|my_center|LOCUS_27650 317727 317536 gene locus_tag LOCUS_27660 gene secE 317727 317536 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888680.1 protein_id gnl|my_center|LOCUS_27660 317965 317798 gene locus_tag LOCUS_27670 gene rpmG 317965 317798 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888681.1 protein_id gnl|my_center|LOCUS_27670 318706 318104 gene locus_tag LOCUS_27680 318706 318104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350803.1 protein_id gnl|my_center|LOCUS_27680 319354 318794 gene locus_tag LOCUS_27690 319354 318794 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087442.1 protein_id gnl|my_center|LOCUS_27690 >Feature sequence07 1022 153 gene locus_tag LOCUS_27700 1022 153 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480304.1 protein_id gnl|my_center|LOCUS_27700 1846 1106 gene locus_tag LOCUS_27710 1846 1106 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886762.1 protein_id gnl|my_center|LOCUS_27710 2059 3612 gene locus_tag LOCUS_27720 2059 3612 CDS product CHASE3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889464.1 protein_id gnl|my_center|LOCUS_27720 3609 4043 gene locus_tag LOCUS_27730 3609 4043 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889463.1 protein_id gnl|my_center|LOCUS_27730 4111 4893 gene locus_tag LOCUS_27740 gene lptB 4111 4893 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888765.1 protein_id gnl|my_center|LOCUS_27740 4914 6719 gene locus_tag LOCUS_27750 4914 6719 CDS product DUF3084 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479938.1 protein_id gnl|my_center|LOCUS_27750 6770 7960 gene locus_tag LOCUS_27760 6770 7960 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229029.1 protein_id gnl|my_center|LOCUS_27760 8204 8644 gene locus_tag LOCUS_27770 8204 8644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350190.1 protein_id gnl|my_center|LOCUS_27770 9316 8657 gene locus_tag LOCUS_27780 9316 8657 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479898.1 protein_id gnl|my_center|LOCUS_27780 10688 9360 gene locus_tag LOCUS_27790 10688 9360 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177674.1 protein_id gnl|my_center|LOCUS_27790 10829 11938 gene locus_tag LOCUS_27800 10829 11938 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888304.1 protein_id gnl|my_center|LOCUS_27800 11945 12226 gene locus_tag LOCUS_27810 11945 12226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 12337 12816 gene locus_tag LOCUS_27820 12337 12816 CDS product DUF2243 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311089.1 protein_id gnl|my_center|LOCUS_27820 12840 13826 gene locus_tag LOCUS_27830 12840 13826 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974270.1 protein_id gnl|my_center|LOCUS_27830 14241 13843 gene locus_tag LOCUS_27840 14241 13843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 16385 14238 gene locus_tag LOCUS_27850 16385 14238 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888489.1 protein_id gnl|my_center|LOCUS_27850 16816 16439 gene locus_tag LOCUS_27860 16816 16439 CDS product ComEA family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888490.1 protein_id gnl|my_center|LOCUS_27860 16946 17107 gene locus_tag LOCUS_27870 16946 17107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 18463 17174 gene locus_tag LOCUS_27880 18463 17174 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888533.1 protein_id gnl|my_center|LOCUS_27880 18548 18829 gene locus_tag LOCUS_27890 18548 18829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 18861 20069 gene locus_tag LOCUS_27900 18861 20069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104479.1 protein_id gnl|my_center|LOCUS_27900 20081 22036 gene locus_tag LOCUS_27910 gene rqkA 20081 22036 CDS product DNA damage-responsive serine/threonine-protein kinase RqkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889143.1 protein_id gnl|my_center|LOCUS_27910 22154 22459 gene locus_tag LOCUS_27920 22154 22459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 22469 23404 gene locus_tag LOCUS_27930 22469 23404 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888715.1 protein_id gnl|my_center|LOCUS_27930 23433 24458 gene locus_tag LOCUS_27940 23433 24458 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888652.1 protein_id gnl|my_center|LOCUS_27940 26459 24510 gene locus_tag LOCUS_27950 gene thrS 26459 24510 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888712.1 protein_id gnl|my_center|LOCUS_27950 26727 27734 gene locus_tag LOCUS_27960 26727 27734 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229391.1 protein_id gnl|my_center|LOCUS_27960 28182 27721 gene locus_tag LOCUS_27970 28182 27721 CDS product DUF3291 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228440.1 protein_id gnl|my_center|LOCUS_27970 28705 28256 gene locus_tag LOCUS_27980 28705 28256 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036362.1 protein_id gnl|my_center|LOCUS_27980 28802 29824 gene locus_tag LOCUS_27990 28802 29824 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797170.1 protein_id gnl|my_center|LOCUS_27990 30067 32685 gene locus_tag LOCUS_28000 30067 32685 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177697.1 protein_id gnl|my_center|LOCUS_28000 33126 32782 gene locus_tag LOCUS_28010 33126 32782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 34925 33180 gene locus_tag LOCUS_28020 34925 33180 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888050.1 protein_id gnl|my_center|LOCUS_28020 36021 34948 gene locus_tag LOCUS_28030 36021 34948 CDS product [LysW]-lysine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888052.1 protein_id gnl|my_center|LOCUS_28030 37129 36011 gene locus_tag LOCUS_28040 37129 36011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28040 37230 37496 gene locus_tag LOCUS_28050 37230 37496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888071.1 protein_id gnl|my_center|LOCUS_28050 39026 37527 gene locus_tag LOCUS_28060 39026 37527 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479895.1 protein_id gnl|my_center|LOCUS_28060 39920 39126 gene locus_tag LOCUS_28070 39920 39126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 40150 40223 gene locus_tag LOCUS_t00440 40150 40223 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 40237 40311 gene locus_tag LOCUS_t00450 40237 40311 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 40744 40367 gene locus_tag LOCUS_28080 40744 40367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 40632 40895 gene locus_tag LOCUS_28090 40632 40895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 41245 41628 gene locus_tag LOCUS_28100 41245 41628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 41705 42082 gene locus_tag LOCUS_28110 41705 42082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 42929 43627 gene locus_tag LOCUS_28120 42929 43627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 43680 44060 gene locus_tag LOCUS_28130 43680 44060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 44665 44931 gene locus_tag LOCUS_28140 44665 44931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 46119 44944 gene locus_tag LOCUS_28150 46119 44944 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887216.1 protein_id gnl|my_center|LOCUS_28150 46231 47439 gene locus_tag LOCUS_28160 46231 47439 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887217.1 protein_id gnl|my_center|LOCUS_28160 47436 50534 gene locus_tag LOCUS_28170 47436 50534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 50569 51648 gene locus_tag LOCUS_28180 50569 51648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887219.1 protein_id gnl|my_center|LOCUS_28180 52683 51664 gene locus_tag LOCUS_28190 52683 51664 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887406.1 protein_id gnl|my_center|LOCUS_28190 52806 53198 gene locus_tag LOCUS_28200 52806 53198 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338309.1 protein_id gnl|my_center|LOCUS_28200 54161 53202 gene locus_tag LOCUS_28210 54161 53202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 54889 54158 gene locus_tag LOCUS_28220 54889 54158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 55047 55122 gene locus_tag LOCUS_t00460 55047 55122 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 55196 57247 gene locus_tag LOCUS_28230 gene speA 55196 57247 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480160.1 protein_id gnl|my_center|LOCUS_28230 57454 57308 gene locus_tag LOCUS_28240 57454 57308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 58376 57567 gene locus_tag LOCUS_28250 58376 57567 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886940.1 protein_id gnl|my_center|LOCUS_28250 58648 58373 gene locus_tag LOCUS_28260 58648 58373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886941.1 protein_id gnl|my_center|LOCUS_28260 58740 59648 gene locus_tag LOCUS_28270 58740 59648 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888971.1 protein_id gnl|my_center|LOCUS_28270 59984 64825 gene locus_tag LOCUS_28280 59984 64825 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350708.1 protein_id gnl|my_center|LOCUS_28280 64901 66367 gene locus_tag LOCUS_28290 64901 66367 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886828.1 protein_id gnl|my_center|LOCUS_28290 66850 66422 gene locus_tag LOCUS_28300 66850 66422 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225462.1 protein_id gnl|my_center|LOCUS_28300 68013 66949 gene locus_tag LOCUS_28310 68013 66949 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618910.1 protein_id gnl|my_center|LOCUS_28310 69358 68105 gene locus_tag LOCUS_28320 69358 68105 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927940.1 protein_id gnl|my_center|LOCUS_28320 71735 69435 gene locus_tag LOCUS_28330 71735 69435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 73258 71798 gene locus_tag LOCUS_28340 73258 71798 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941860.1 protein_id gnl|my_center|LOCUS_28340 73516 74535 gene locus_tag LOCUS_28350 gene pheS 73516 74535 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888980.1 protein_id gnl|my_center|LOCUS_28350 74612 75061 gene locus_tag LOCUS_28360 74612 75061 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888982.1 protein_id gnl|my_center|LOCUS_28360 75130 77589 gene locus_tag LOCUS_28370 75130 77589 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888983.1 protein_id gnl|my_center|LOCUS_28370 78600 77614 gene locus_tag LOCUS_28380 78600 77614 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350843.1 protein_id gnl|my_center|LOCUS_28380 78634 79353 gene locus_tag LOCUS_28390 78634 79353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 79452 80978 gene locus_tag LOCUS_28400 79452 80978 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889146.1 protein_id gnl|my_center|LOCUS_28400 81015 81236 gene locus_tag LOCUS_28410 81015 81236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 81321 81396 gene locus_tag LOCUS_t00470 81321 81396 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 83993 81726 gene locus_tag LOCUS_28420 83993 81726 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258859.1 protein_id gnl|my_center|LOCUS_28420 84214 85389 gene locus_tag LOCUS_28430 84214 85389 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051056494.1 protein_id gnl|my_center|LOCUS_28430 85518 86534 gene locus_tag LOCUS_28440 85518 86534 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162150140.1 protein_id gnl|my_center|LOCUS_28440 86628 88673 gene locus_tag LOCUS_28450 86628 88673 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225251.1 protein_id gnl|my_center|LOCUS_28450 88798 90234 gene locus_tag LOCUS_28460 88798 90234 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889170.1 protein_id gnl|my_center|LOCUS_28460 91065 90502 gene locus_tag LOCUS_28470 91065 90502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531332.1 protein_id gnl|my_center|LOCUS_28470 91975 91067 gene locus_tag LOCUS_28480 91975 91067 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888924.1 protein_id gnl|my_center|LOCUS_28480 92389 92090 gene locus_tag LOCUS_28490 92389 92090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888925.1 protein_id gnl|my_center|LOCUS_28490 92829 92386 gene locus_tag LOCUS_28500 92829 92386 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350530.1 protein_id gnl|my_center|LOCUS_28500 92879 93262 gene locus_tag LOCUS_28510 92879 93262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026138824.1 protein_id gnl|my_center|LOCUS_28510 93760 93272 gene locus_tag LOCUS_28520 93760 93272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889183.1 protein_id gnl|my_center|LOCUS_28520 93914 94384 gene locus_tag LOCUS_28530 93914 94384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 94780 94388 gene locus_tag LOCUS_28540 94780 94388 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887982.1 protein_id gnl|my_center|LOCUS_28540 95088 97505 gene locus_tag LOCUS_28550 95088 97505 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121001.1 protein_id gnl|my_center|LOCUS_28550 98590 97592 gene locus_tag LOCUS_28560 98590 97592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 99368 98679 gene locus_tag LOCUS_28570 99368 98679 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480180.1 protein_id gnl|my_center|LOCUS_28570 99367 99747 gene locus_tag LOCUS_28580 99367 99747 CDS product FUN14 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886839.1 protein_id gnl|my_center|LOCUS_28580 99777 100262 gene locus_tag LOCUS_28590 99777 100262 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480322.1 protein_id gnl|my_center|LOCUS_28590 100282 100554 gene locus_tag LOCUS_28600 100282 100554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889083.1 protein_id gnl|my_center|LOCUS_28600 100608 101342 gene locus_tag LOCUS_28610 100608 101342 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480361.1 protein_id gnl|my_center|LOCUS_28610 102205 101402 gene locus_tag LOCUS_28620 102205 101402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888861.1 protein_id gnl|my_center|LOCUS_28620 102313 103209 gene locus_tag LOCUS_28630 102313 103209 CDS product carbohydrate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229247.1 protein_id gnl|my_center|LOCUS_28630 103222 103929 gene locus_tag LOCUS_28640 103222 103929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888968.1 protein_id gnl|my_center|LOCUS_28640 104140 103964 gene locus_tag LOCUS_28650 104140 103964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 104282 104938 gene locus_tag LOCUS_28660 104282 104938 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888969.1 protein_id gnl|my_center|LOCUS_28660 105020 105589 gene locus_tag LOCUS_28670 105020 105589 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889035.1 protein_id gnl|my_center|LOCUS_28670 106520 105648 gene locus_tag LOCUS_28680 106520 105648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 106815 107375 gene locus_tag LOCUS_28690 106815 107375 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480058.1 protein_id gnl|my_center|LOCUS_28690 107481 108023 gene locus_tag LOCUS_28700 107481 108023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 108628 108173 gene locus_tag LOCUS_28710 108628 108173 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889046.1 protein_id gnl|my_center|LOCUS_28710 110885 108621 gene locus_tag LOCUS_28720 110885 108621 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889045.1 protein_id gnl|my_center|LOCUS_28720 111572 110895 gene locus_tag LOCUS_28730 111572 110895 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480059.1 protein_id gnl|my_center|LOCUS_28730 113177 111624 gene locus_tag LOCUS_28740 gene ilvA 113177 111624 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871374.1 protein_id gnl|my_center|LOCUS_28740 113908 114417 gene locus_tag LOCUS_28750 113908 114417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034351155.1 protein_id gnl|my_center|LOCUS_28750 114934 114440 gene locus_tag LOCUS_28760 114934 114440 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888278.1 protein_id gnl|my_center|LOCUS_28760 115084 116016 gene locus_tag LOCUS_28770 115084 116016 CDS product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887939.1 protein_id gnl|my_center|LOCUS_28770 116021 116575 gene locus_tag LOCUS_28780 116021 116575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 118033 116600 gene locus_tag LOCUS_28790 118033 116600 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878083.1 protein_id gnl|my_center|LOCUS_28790 118140 119336 gene locus_tag LOCUS_28800 118140 119336 CDS product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618909.1 protein_id gnl|my_center|LOCUS_28800 119880 119347 gene locus_tag LOCUS_28810 119880 119347 CDS product chloramphenicol phosphotransferase CPT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899406.1 protein_id gnl|my_center|LOCUS_28810 119991 121556 gene locus_tag LOCUS_28820 119991 121556 CDS product acyl--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479594.1 protein_id gnl|my_center|LOCUS_28820 121831 122394 gene locus_tag LOCUS_28830 121831 122394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 122917 122408 gene locus_tag LOCUS_28840 122917 122408 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389004.1 protein_id gnl|my_center|LOCUS_28840 123548 122940 gene locus_tag LOCUS_28850 123548 122940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 124581 123589 gene locus_tag LOCUS_28860 124581 123589 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027420.1 protein_id gnl|my_center|LOCUS_28860 124576 124968 gene locus_tag LOCUS_28870 124576 124968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 126019 125000 gene locus_tag LOCUS_28880 126019 125000 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887256.1 protein_id gnl|my_center|LOCUS_28880 126142 126792 gene locus_tag LOCUS_28890 126142 126792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 128511 126865 gene locus_tag LOCUS_28900 gene groL 128511 126865 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887252.1 protein_id gnl|my_center|LOCUS_28900 128853 128566 gene locus_tag LOCUS_28910 gene groES 128853 128566 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887251.1 protein_id gnl|my_center|LOCUS_28910 129129 129737 gene locus_tag LOCUS_28920 129129 129737 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479514.1 protein_id gnl|my_center|LOCUS_28920 129734 130138 gene locus_tag LOCUS_28930 129734 130138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 130171 130770 gene locus_tag LOCUS_28940 130171 130770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 132204 130789 gene locus_tag LOCUS_28950 132204 130789 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535402.1 protein_id gnl|my_center|LOCUS_28950 132895 132233 gene locus_tag LOCUS_28960 132895 132233 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888933.1 protein_id gnl|my_center|LOCUS_28960 132970 134160 gene locus_tag LOCUS_28970 132970 134160 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028035.1 protein_id gnl|my_center|LOCUS_28970 134921 134256 gene locus_tag LOCUS_28980 134921 134256 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004438834.1 protein_id gnl|my_center|LOCUS_28980 136728 135121 gene locus_tag LOCUS_28990 136728 135121 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918873.1 protein_id gnl|my_center|LOCUS_28990 138110 136725 gene locus_tag LOCUS_29000 138110 136725 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093457391.1 protein_id gnl|my_center|LOCUS_29000 139393 138107 gene locus_tag LOCUS_29010 139393 138107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 140312 139395 gene locus_tag LOCUS_29020 140312 139395 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389896.1 protein_id gnl|my_center|LOCUS_29020 141405 140458 gene locus_tag LOCUS_29030 141405 140458 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083605764.1 protein_id gnl|my_center|LOCUS_29030 142725 141481 gene locus_tag LOCUS_29040 142725 141481 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227019.1 protein_id gnl|my_center|LOCUS_29040 142616 142912 gene locus_tag LOCUS_29050 142616 142912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 143867 142827 gene locus_tag LOCUS_29060 143867 142827 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229210.1 protein_id gnl|my_center|LOCUS_29060 144284 145498 gene locus_tag LOCUS_29070 144284 145498 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977660.1 protein_id gnl|my_center|LOCUS_29070 145495 146991 gene locus_tag LOCUS_29080 gene xylB 145495 146991 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_29080 147063 148229 gene locus_tag LOCUS_29090 gene xylA 147063 148229 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977662.1 protein_id gnl|my_center|LOCUS_29090 148234 149325 gene locus_tag LOCUS_29100 148234 149325 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245976.1 protein_id gnl|my_center|LOCUS_29100 149380 150390 gene locus_tag LOCUS_29110 149380 150390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 150409 150987 gene locus_tag LOCUS_29120 150409 150987 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887249.1 protein_id gnl|my_center|LOCUS_29120 151471 150956 gene locus_tag LOCUS_29130 151471 150956 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479516.1 protein_id gnl|my_center|LOCUS_29130 152840 151653 gene locus_tag LOCUS_29140 152840 151653 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887206.1 protein_id gnl|my_center|LOCUS_29140 153966 152956 gene locus_tag LOCUS_29150 153966 152956 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228214.1 protein_id gnl|my_center|LOCUS_29150 154212 155501 gene locus_tag LOCUS_29160 154212 155501 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480115.1 protein_id gnl|my_center|LOCUS_29160 155494 156726 gene locus_tag LOCUS_29170 155494 156726 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480116.1 protein_id gnl|my_center|LOCUS_29170 157588 156734 gene locus_tag LOCUS_29180 157588 156734 CDS product menaquinone biosynthetic enzyme MqnA/MqnD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887015.1 protein_id gnl|my_center|LOCUS_29180 157976 157659 gene locus_tag LOCUS_29190 157976 157659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 159145 158003 gene locus_tag LOCUS_29200 gene mqnE 159145 158003 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887011.1 protein_id gnl|my_center|LOCUS_29200 159256 159885 gene locus_tag LOCUS_29210 159256 159885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 161245 159893 gene locus_tag LOCUS_29220 161245 159893 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898040.1 protein_id gnl|my_center|LOCUS_29220 162687 161242 gene locus_tag LOCUS_29230 162687 161242 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891177.1 protein_id gnl|my_center|LOCUS_29230 162901 163902 gene locus_tag LOCUS_29240 162901 163902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 164813 163914 gene locus_tag LOCUS_29250 164813 163914 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479905.1 protein_id gnl|my_center|LOCUS_29250 165037 164810 gene locus_tag LOCUS_29260 165037 164810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 164925 165536 gene locus_tag LOCUS_29270 164925 165536 CDS product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479904.1 protein_id gnl|my_center|LOCUS_29270 165583 166341 gene locus_tag LOCUS_29280 165583 166341 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350256.1 protein_id gnl|my_center|LOCUS_29280 166338 167312 gene locus_tag LOCUS_29290 166338 167312 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888315.1 protein_id gnl|my_center|LOCUS_29290 167704 167306 gene locus_tag LOCUS_29300 167704 167306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 167881 168177 gene locus_tag LOCUS_29310 167881 168177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 168232 169161 gene locus_tag LOCUS_29320 168232 169161 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888311.1 protein_id gnl|my_center|LOCUS_29320 169233 169709 gene locus_tag LOCUS_29330 169233 169709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 171099 169762 gene locus_tag LOCUS_29340 171099 169762 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027550.1 protein_id gnl|my_center|LOCUS_29340 171860 171216 gene locus_tag LOCUS_29350 gene phoU 171860 171216 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888872.1 protein_id gnl|my_center|LOCUS_29350 172969 171965 gene locus_tag LOCUS_29360 172969 171965 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227733.1 protein_id gnl|my_center|LOCUS_29360 173640 172951 gene locus_tag LOCUS_29370 173640 172951 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888874.1 protein_id gnl|my_center|LOCUS_29370 173882 175093 gene locus_tag LOCUS_29380 gene metK 173882 175093 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887285.1 protein_id gnl|my_center|LOCUS_29380 175231 176766 gene locus_tag LOCUS_29390 175231 176766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 177425 176763 gene locus_tag LOCUS_29400 177425 176763 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976169.1 protein_id gnl|my_center|LOCUS_29400 178851 177418 gene locus_tag LOCUS_29410 178851 177418 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528673.1 protein_id gnl|my_center|LOCUS_29410 179442 178912 gene locus_tag LOCUS_29420 gene coaD 179442 178912 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887287.1 protein_id gnl|my_center|LOCUS_29420 180017 179439 gene locus_tag LOCUS_29430 180017 179439 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479504.1 protein_id gnl|my_center|LOCUS_29430 180321 180028 gene locus_tag LOCUS_29440 180321 180028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887295.1 protein_id gnl|my_center|LOCUS_29440 180366 180635 gene locus_tag LOCUS_29450 180366 180635 CDS product DUF3248 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888640.1 protein_id gnl|my_center|LOCUS_29450 180663 181154 gene locus_tag LOCUS_29460 180663 181154 CDS product DUF3809 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888639.1 protein_id gnl|my_center|LOCUS_29460 181583 181182 gene locus_tag LOCUS_29470 gene rsfS 181583 181182 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889204.1 protein_id gnl|my_center|LOCUS_29470 182830 181580 gene locus_tag LOCUS_29480 182830 181580 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889205.1 protein_id gnl|my_center|LOCUS_29480 183462 182827 gene locus_tag LOCUS_29490 gene yqeK 183462 182827 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618898.1 protein_id gnl|my_center|LOCUS_29490 184664 183654 gene locus_tag LOCUS_29500 184664 183654 CDS product CdaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886656.1 protein_id gnl|my_center|LOCUS_29500 185479 184661 gene locus_tag LOCUS_29510 gene cdaA 185479 184661 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177770.1 protein_id gnl|my_center|LOCUS_29510 185629 186309 gene locus_tag LOCUS_29520 185629 186309 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480256.1 protein_id gnl|my_center|LOCUS_29520 187269 186361 gene locus_tag LOCUS_29530 187269 186361 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479524.1 protein_id gnl|my_center|LOCUS_29530 187348 189042 gene locus_tag LOCUS_29540 187348 189042 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480202.1 protein_id gnl|my_center|LOCUS_29540 189409 190152 gene locus_tag LOCUS_29550 189409 190152 CDS product trehalose utilization protein ThuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731916.1 protein_id gnl|my_center|LOCUS_29550 190149 191192 gene locus_tag LOCUS_29560 190149 191192 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527783.1 protein_id gnl|my_center|LOCUS_29560 191873 191256 gene locus_tag LOCUS_29570 191873 191256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 191957 192376 gene locus_tag LOCUS_29580 191957 192376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 193107 192391 gene locus_tag LOCUS_29590 193107 192391 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887860.1 protein_id gnl|my_center|LOCUS_29590 193188 193577 gene locus_tag LOCUS_29600 193188 193577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 194631 193588 gene locus_tag LOCUS_29610 194631 193588 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887591.1 protein_id gnl|my_center|LOCUS_29610 195644 194859 gene locus_tag LOCUS_29620 195644 194859 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888600.1 protein_id gnl|my_center|LOCUS_29620 195770 196525 gene locus_tag LOCUS_29630 gene pgeF 195770 196525 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888599.1 protein_id gnl|my_center|LOCUS_29630 196522 197028 gene locus_tag LOCUS_29640 196522 197028 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888598.1 protein_id gnl|my_center|LOCUS_29640 197136 199820 gene locus_tag LOCUS_29650 197136 199820 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479822.1 protein_id gnl|my_center|LOCUS_29650 199849 201087 gene locus_tag LOCUS_29660 199849 201087 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350111.1 protein_id gnl|my_center|LOCUS_29660 203661 201226 gene locus_tag LOCUS_29670 gene lon 203661 201226 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888607.1 protein_id gnl|my_center|LOCUS_29670 205028 203820 gene locus_tag LOCUS_29680 gene clpX 205028 203820 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888606.1 protein_id gnl|my_center|LOCUS_29680 205636 205025 gene locus_tag LOCUS_29690 gene clpP 205636 205025 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888605.1 protein_id gnl|my_center|LOCUS_29690 205796 206863 gene locus_tag LOCUS_29700 205796 206863 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531761.1 protein_id gnl|my_center|LOCUS_29700 208589 206913 gene locus_tag LOCUS_29710 208589 206913 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480060.1 protein_id gnl|my_center|LOCUS_29710 209254 209180 gene locus_tag LOCUS_t00480 209254 209180 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 209506 211767 gene locus_tag LOCUS_29720 gene dnaX 209506 211767 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480062.1 protein_id gnl|my_center|LOCUS_29720 211823 213370 gene locus_tag LOCUS_29730 211823 213370 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152524824.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29730 214408 213401 gene locus_tag LOCUS_29740 214408 213401 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869626.1 protein_id gnl|my_center|LOCUS_29740 214538 215035 gene locus_tag LOCUS_29750 214538 215035 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888520.1 protein_id gnl|my_center|LOCUS_29750 215040 215696 gene locus_tag LOCUS_29760 215040 215696 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479802.1 protein_id gnl|my_center|LOCUS_29760 215693 216532 gene locus_tag LOCUS_29770 215693 216532 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479803.1 protein_id gnl|my_center|LOCUS_29770 216565 217500 gene locus_tag LOCUS_29780 216565 217500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480038.1 protein_id gnl|my_center|LOCUS_29780 217529 218110 gene locus_tag LOCUS_29790 gene xpt 217529 218110 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888255.1 protein_id gnl|my_center|LOCUS_29790 219302 218118 gene locus_tag LOCUS_29800 219302 218118 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258527.1 protein_id gnl|my_center|LOCUS_29800 219406 220968 gene locus_tag LOCUS_29810 219406 220968 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887958.1 protein_id gnl|my_center|LOCUS_29810 221319 222239 gene locus_tag LOCUS_29820 221319 222239 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978080.1 protein_id gnl|my_center|LOCUS_29820 223433 222252 gene locus_tag LOCUS_29830 223433 222252 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029132.1 protein_id gnl|my_center|LOCUS_29830 223484 223981 gene locus_tag LOCUS_29840 223484 223981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 223978 225204 gene locus_tag LOCUS_29850 223978 225204 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479765.1 protein_id gnl|my_center|LOCUS_29850 226101 225259 gene locus_tag LOCUS_29860 226101 225259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 226760 226200 gene locus_tag LOCUS_29870 gene tsaB 226760 226200 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887402.1 protein_id gnl|my_center|LOCUS_29870 226859 227992 gene locus_tag LOCUS_29880 226859 227992 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479989.1 protein_id gnl|my_center|LOCUS_29880 228525 228061 gene locus_tag LOCUS_29890 228525 228061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479955.1 protein_id gnl|my_center|LOCUS_29890 229593 228601 gene locus_tag LOCUS_29900 229593 228601 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350308.1 protein_id gnl|my_center|LOCUS_29900 230084 229626 gene locus_tag LOCUS_29910 230084 229626 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176993958.1 protein_id gnl|my_center|LOCUS_29910 231016 230108 gene locus_tag LOCUS_29920 231016 230108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 231720 231178 gene locus_tag LOCUS_29930 231720 231178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 231833 233653 gene locus_tag LOCUS_29940 231833 233653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 234024 233731 gene locus_tag LOCUS_29950 234024 233731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 235920 234157 gene locus_tag LOCUS_29960 235920 234157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 236149 235925 gene locus_tag LOCUS_29970 236149 235925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 237638 236343 gene locus_tag LOCUS_29980 237638 236343 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080298.1 protein_id gnl|my_center|LOCUS_29980 237882 237807 gene locus_tag LOCUS_t00490 237882 237807 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 238004 239509 gene locus_tag LOCUS_29990 gene guaB 238004 239509 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888513.1 protein_id gnl|my_center|LOCUS_29990 239563 240528 gene locus_tag LOCUS_30000 239563 240528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 240639 241283 gene locus_tag LOCUS_30010 240639 241283 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888515.1 protein_id gnl|my_center|LOCUS_30010 241953 241342 gene locus_tag LOCUS_30020 241953 241342 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887625.1 protein_id gnl|my_center|LOCUS_30020 243084 241984 gene locus_tag LOCUS_30030 243084 241984 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887626.1 protein_id gnl|my_center|LOCUS_30030 244366 243107 gene locus_tag LOCUS_30040 244366 243107 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888391.1 protein_id gnl|my_center|LOCUS_30040 244494 245510 gene locus_tag LOCUS_30050 244494 245510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 246425 245514 gene locus_tag LOCUS_30060 gene hslO 246425 245514 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479663.1 protein_id gnl|my_center|LOCUS_30060 246693 248441 gene locus_tag LOCUS_30070 246693 248441 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029732948.1 protein_id gnl|my_center|LOCUS_30070 248498 249220 gene locus_tag LOCUS_30080 248498 249220 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479661.1 protein_id gnl|my_center|LOCUS_30080 249345 252221 gene locus_tag LOCUS_30090 249345 252221 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480204.1 protein_id gnl|my_center|LOCUS_30090 252288 253427 gene locus_tag LOCUS_30100 252288 253427 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618904.1 protein_id gnl|my_center|LOCUS_30100 253567 254034 gene locus_tag LOCUS_30110 253567 254034 CDS product GreA/GreB family elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888603.1 protein_id gnl|my_center|LOCUS_30110 254168 255721 gene locus_tag LOCUS_30120 gene lysS 254168 255721 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887017.1 protein_id gnl|my_center|LOCUS_30120 255975 257342 gene locus_tag LOCUS_30130 255975 257342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 257339 258574 gene locus_tag LOCUS_30140 257339 258574 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926040.1 protein_id gnl|my_center|LOCUS_30140 258672 259796 gene locus_tag LOCUS_30150 258672 259796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 259793 260656 gene locus_tag LOCUS_30160 259793 260656 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172776.1 protein_id gnl|my_center|LOCUS_30160 260769 261920 gene locus_tag LOCUS_30170 260769 261920 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887506.1 protein_id gnl|my_center|LOCUS_30170 262540 262737 gene locus_tag LOCUS_30180 262540 262737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 263884 262868 gene locus_tag LOCUS_30190 263884 262868 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349826.1 protein_id gnl|my_center|LOCUS_30190 263947 264504 gene locus_tag LOCUS_30200 263947 264504 CDS product DUF99 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889427.1 protein_id gnl|my_center|LOCUS_30200 264645 265085 gene locus_tag LOCUS_30210 264645 265085 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227819.1 protein_id gnl|my_center|LOCUS_30210 265082 266050 gene locus_tag LOCUS_30220 265082 266050 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257482.1 protein_id gnl|my_center|LOCUS_30220 266067 267032 gene locus_tag LOCUS_30230 266067 267032 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969975.1 protein_id gnl|my_center|LOCUS_30230 267096 267692 gene locus_tag LOCUS_30240 267096 267692 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086030.1 protein_id gnl|my_center|LOCUS_30240 >Feature sequence08 444 1415 gene locus_tag LOCUS_30250 gene argF 444 1415 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177765.1 protein_id gnl|my_center|LOCUS_30250 1640 3601 gene locus_tag LOCUS_30260 1640 3601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345469.1 protein_id gnl|my_center|LOCUS_30260 3712 4635 gene locus_tag LOCUS_30270 gene argC 3712 4635 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886726.1 protein_id gnl|my_center|LOCUS_30270 4632 5450 gene locus_tag LOCUS_30280 4632 5450 CDS product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886725.1 protein_id gnl|my_center|LOCUS_30280 5505 5825 gene locus_tag LOCUS_30290 5505 5825 CDS product YegP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807743.1 protein_id gnl|my_center|LOCUS_30290 5932 6504 gene locus_tag LOCUS_30300 5932 6504 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889182.1 protein_id gnl|my_center|LOCUS_30300 6591 7265 gene locus_tag LOCUS_30310 6591 7265 CDS product DUF2270 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480307.1 protein_id gnl|my_center|LOCUS_30310 8002 7244 gene locus_tag LOCUS_30320 8002 7244 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227952.1 protein_id gnl|my_center|LOCUS_30320 8424 8062 gene locus_tag LOCUS_30330 8424 8062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886716.1 protein_id gnl|my_center|LOCUS_30330 9302 8421 gene locus_tag LOCUS_30340 9302 8421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886715.1 protein_id gnl|my_center|LOCUS_30340 10014 9340 gene locus_tag LOCUS_30350 10014 9340 CDS product YqhA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888514.1 protein_id gnl|my_center|LOCUS_30350 10085 10864 gene locus_tag LOCUS_30360 10085 10864 CDS product aminoglycoside 3'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480238.1 protein_id gnl|my_center|LOCUS_30360 11009 13351 gene locus_tag LOCUS_30370 11009 13351 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480306.1 protein_id gnl|my_center|LOCUS_30370 13979 13362 gene locus_tag LOCUS_30380 13979 13362 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889236.1 protein_id gnl|my_center|LOCUS_30380 14070 14732 gene locus_tag LOCUS_30390 14070 14732 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480266.1 protein_id gnl|my_center|LOCUS_30390 14785 15843 gene locus_tag LOCUS_30400 14785 15843 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529392.1 protein_id gnl|my_center|LOCUS_30400 16000 16299 gene locus_tag LOCUS_30410 16000 16299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889116.1 protein_id gnl|my_center|LOCUS_30410 17006 16320 gene locus_tag LOCUS_30420 17006 16320 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017870755.1 protein_id gnl|my_center|LOCUS_30420 17099 18109 gene locus_tag LOCUS_30430 17099 18109 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977097.1 protein_id gnl|my_center|LOCUS_30430 18106 19074 gene locus_tag LOCUS_30440 18106 19074 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349608.1 protein_id gnl|my_center|LOCUS_30440 19071 20027 gene locus_tag LOCUS_30450 19071 20027 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258012.1 protein_id gnl|my_center|LOCUS_30450 20029 20748 gene locus_tag LOCUS_30460 20029 20748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887853.1 protein_id gnl|my_center|LOCUS_30460 20782 21297 gene locus_tag LOCUS_30470 20782 21297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081608220.1 protein_id gnl|my_center|LOCUS_30470 21389 21943 gene locus_tag LOCUS_30480 21389 21943 CDS product VUT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479579.1 protein_id gnl|my_center|LOCUS_30480 22421 21960 gene locus_tag LOCUS_30490 22421 21960 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886877.1 protein_id gnl|my_center|LOCUS_30490 23140 22418 gene locus_tag LOCUS_30500 23140 22418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 23631 23137 gene locus_tag LOCUS_30510 gene ispF 23631 23137 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886876.1 protein_id gnl|my_center|LOCUS_30510 23763 24557 gene locus_tag LOCUS_30520 23763 24557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 24617 25057 gene locus_tag LOCUS_30530 24617 25057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 25103 25615 gene locus_tag LOCUS_30540 25103 25615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 28435 25619 gene locus_tag LOCUS_30550 28435 25619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 28811 28503 gene locus_tag LOCUS_30560 28811 28503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30560 29123 28818 gene locus_tag LOCUS_30570 29123 28818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30570 29760 29146 gene locus_tag LOCUS_30580 29760 29146 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888834.1 protein_id gnl|my_center|LOCUS_30580 31188 29770 gene locus_tag LOCUS_30590 31188 29770 CDS product DUF4403 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350859.1 protein_id gnl|my_center|LOCUS_30590 31357 32223 gene locus_tag LOCUS_30600 31357 32223 CDS product intradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257435.1 protein_id gnl|my_center|LOCUS_30600 32267 32905 gene locus_tag LOCUS_30610 32267 32905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 33659 32949 gene locus_tag LOCUS_30620 33659 32949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30620 34843 33797 gene locus_tag LOCUS_30630 34843 33797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 35294 35013 gene locus_tag LOCUS_30640 35294 35013 CDS product DUF1905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084855.1 protein_id gnl|my_center|LOCUS_30640 36231 35422 gene locus_tag LOCUS_30650 gene dkgB 36231 35422 CDS product 2,5-didehydrogluconate reductase DkgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035524.1 protein_id gnl|my_center|LOCUS_30650 36399 38540 gene locus_tag LOCUS_30660 gene pnp 36399 38540 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479957.1 protein_id gnl|my_center|LOCUS_30660 45080 38601 gene locus_tag LOCUS_30670 45080 38601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 49852 45077 gene locus_tag LOCUS_30680 49852 45077 CDS product DUF11 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887332.1 protein_id gnl|my_center|LOCUS_30680 52643 49854 gene locus_tag LOCUS_30690 52643 49854 CDS product DUF11 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480374.1 protein_id gnl|my_center|LOCUS_30690 55124 52788 gene locus_tag LOCUS_30700 55124 52788 CDS product DUF11 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884044.1 protein_id gnl|my_center|LOCUS_30700 55694 55197 gene locus_tag LOCUS_30710 55694 55197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211246942.1 protein_id gnl|my_center|LOCUS_30710 58503 56011 gene locus_tag LOCUS_30720 58503 56011 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618777.1 protein_id gnl|my_center|LOCUS_30720 58707 59237 gene locus_tag LOCUS_30730 58707 59237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 59234 61369 gene locus_tag LOCUS_30740 59234 61369 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889506.1 protein_id gnl|my_center|LOCUS_30740 61496 62356 gene locus_tag LOCUS_30750 gene ttcA 61496 62356 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887125.1 protein_id gnl|my_center|LOCUS_30750 62989 62360 gene locus_tag LOCUS_30760 62989 62360 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974610.1 protein_id gnl|my_center|LOCUS_30760 63746 63063 gene locus_tag LOCUS_30770 63746 63063 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887188.1 protein_id gnl|my_center|LOCUS_30770 65002 63773 gene locus_tag LOCUS_30780 65002 63773 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479553.1 protein_id gnl|my_center|LOCUS_30780 65295 67124 gene locus_tag LOCUS_30790 65295 67124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 67858 67187 gene locus_tag LOCUS_30800 67858 67187 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887210.1 protein_id gnl|my_center|LOCUS_30800 68697 67936 gene locus_tag LOCUS_30810 68697 67936 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887209.1 protein_id gnl|my_center|LOCUS_30810 70076 68802 gene locus_tag LOCUS_30820 70076 68802 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883969.1 protein_id gnl|my_center|LOCUS_30820 70292 72130 gene locus_tag LOCUS_30830 70292 72130 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479596.1 protein_id gnl|my_center|LOCUS_30830 72551 72144 gene locus_tag LOCUS_30840 72551 72144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 73187 72615 gene locus_tag LOCUS_30850 73187 72615 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887290.1 protein_id gnl|my_center|LOCUS_30850 73428 73877 gene locus_tag LOCUS_30860 73428 73877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887289.1 protein_id gnl|my_center|LOCUS_30860 75095 73941 gene locus_tag LOCUS_30870 75095 73941 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888696.1 protein_id gnl|my_center|LOCUS_30870 77023 75542 gene locus_tag LOCUS_30880 gene rimO 77023 75542 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889448.1 protein_id gnl|my_center|LOCUS_30880 77344 77123 gene locus_tag LOCUS_30890 77344 77123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 77423 78721 gene locus_tag LOCUS_30900 77423 78721 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259655.1 protein_id gnl|my_center|LOCUS_30900 78769 79569 gene locus_tag LOCUS_30910 gene minD 78769 79569 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479992.1 protein_id gnl|my_center|LOCUS_30910 79571 79822 gene locus_tag LOCUS_30920 gene minE 79571 79822 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887397.1 protein_id gnl|my_center|LOCUS_30920 79899 80966 gene locus_tag LOCUS_30930 gene rodA 79899 80966 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228544.1 protein_id gnl|my_center|LOCUS_30930 81075 81629 gene locus_tag LOCUS_30940 81075 81629 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887439.1 protein_id gnl|my_center|LOCUS_30940 81634 82245 gene locus_tag LOCUS_30950 81634 82245 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_30950 82242 82664 gene locus_tag LOCUS_30960 82242 82664 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337528.1 protein_id gnl|my_center|LOCUS_30960 82668 83450 gene locus_tag LOCUS_30970 82668 83450 CDS product DUF429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257299.1 protein_id gnl|my_center|LOCUS_30970 83504 84451 gene locus_tag LOCUS_30980 83504 84451 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888945.1 protein_id gnl|my_center|LOCUS_30980 84572 85546 gene locus_tag LOCUS_30990 84572 85546 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888944.1 protein_id gnl|my_center|LOCUS_30990 85539 86411 gene locus_tag LOCUS_31000 85539 86411 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888943.1 protein_id gnl|my_center|LOCUS_31000 86846 86448 gene locus_tag LOCUS_31010 86846 86448 CDS product DUF4260 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088113.1 protein_id gnl|my_center|LOCUS_31010 88449 87187 gene locus_tag LOCUS_31020 88449 87187 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256669.1 protein_id gnl|my_center|LOCUS_31020 89351 88446 gene locus_tag LOCUS_31030 89351 88446 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256872.1 protein_id gnl|my_center|LOCUS_31030 89577 89894 gene locus_tag LOCUS_31040 89577 89894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 90023 90637 gene locus_tag LOCUS_31050 90023 90637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888814.1 protein_id gnl|my_center|LOCUS_31050 91128 90664 gene locus_tag LOCUS_31060 91128 90664 CDS product CoxG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480365.1 protein_id gnl|my_center|LOCUS_31060 91391 91125 gene locus_tag LOCUS_31070 91391 91125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 91278 91889 gene locus_tag LOCUS_31080 91278 91889 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889264.1 protein_id gnl|my_center|LOCUS_31080 91913 93682 gene locus_tag LOCUS_31090 91913 93682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 94766 93831 gene locus_tag LOCUS_31100 94766 93831 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391305.1 protein_id gnl|my_center|LOCUS_31100 95225 96409 gene locus_tag LOCUS_31110 gene carA 95225 96409 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887329.1 protein_id gnl|my_center|LOCUS_31110 96450 97022 gene locus_tag LOCUS_31120 96450 97022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211246942.1 protein_id gnl|my_center|LOCUS_31120 97096 99369 gene locus_tag LOCUS_31130 97096 99369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 99339 100403 gene locus_tag LOCUS_31140 99339 100403 CDS product DNA topoisomerase IB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887335.1 protein_id gnl|my_center|LOCUS_31140 100432 100956 gene locus_tag LOCUS_31150 100432 100956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 101407 100934 gene locus_tag LOCUS_31160 101407 100934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 101496 102398 gene locus_tag LOCUS_31170 101496 102398 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031688.1 protein_id gnl|my_center|LOCUS_31170 102408 102773 gene locus_tag LOCUS_31180 102408 102773 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030864690.1 protein_id gnl|my_center|LOCUS_31180 103455 102760 gene locus_tag LOCUS_31190 103455 102760 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939817.1 protein_id gnl|my_center|LOCUS_31190 103700 103467 gene locus_tag LOCUS_31200 103700 103467 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480082.1 protein_id gnl|my_center|LOCUS_31200 103828 104331 gene locus_tag LOCUS_31210 103828 104331 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257245.1 protein_id gnl|my_center|LOCUS_31210 104386 104793 gene locus_tag LOCUS_31220 104386 104793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888999.1 protein_id gnl|my_center|LOCUS_31220 104794 105447 gene locus_tag LOCUS_31230 gene pth 104794 105447 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888998.1 protein_id gnl|my_center|LOCUS_31230 105453 106508 gene locus_tag LOCUS_31240 105453 106508 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867759.1 protein_id gnl|my_center|LOCUS_31240 106584 107144 gene locus_tag LOCUS_31250 106584 107144 CDS product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888997.1 protein_id gnl|my_center|LOCUS_31250 107413 107784 gene locus_tag LOCUS_31260 107413 107784 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480008.1 protein_id gnl|my_center|LOCUS_31260 107802 109130 gene locus_tag LOCUS_31270 107802 109130 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092263432.1 protein_id gnl|my_center|LOCUS_31270 109359 109736 gene locus_tag LOCUS_31280 109359 109736 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480008.1 protein_id gnl|my_center|LOCUS_31280 109733 111046 gene locus_tag LOCUS_31290 109733 111046 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092263432.1 protein_id gnl|my_center|LOCUS_31290 112066 111059 gene locus_tag LOCUS_31300 112066 111059 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889138.1 protein_id gnl|my_center|LOCUS_31300 112854 112312 gene locus_tag LOCUS_31310 112854 112312 CDS product DUF1684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888029.1 protein_id gnl|my_center|LOCUS_31310 113054 112851 gene locus_tag LOCUS_31320 113054 112851 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480037.1 protein_id gnl|my_center|LOCUS_31320 113766 113080 gene locus_tag LOCUS_31330 113766 113080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 114242 113763 gene locus_tag LOCUS_31340 114242 113763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888045.1 protein_id gnl|my_center|LOCUS_31340 115186 114239 gene locus_tag LOCUS_31350 115186 114239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 115318 118230 gene locus_tag LOCUS_31360 115318 118230 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479509.1 protein_id gnl|my_center|LOCUS_31360 118656 118261 gene locus_tag LOCUS_31370 118656 118261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 119465 118602 gene locus_tag LOCUS_31380 119465 118602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 119735 121045 gene locus_tag LOCUS_31390 119735 121045 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028328044.1 protein_id gnl|my_center|LOCUS_31390 121051 123159 gene locus_tag LOCUS_31400 121051 123159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 124250 123171 gene locus_tag LOCUS_31410 124250 123171 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226239.1 protein_id gnl|my_center|LOCUS_31410 125237 124356 gene locus_tag LOCUS_31420 125237 124356 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434537.1 protein_id gnl|my_center|LOCUS_31420 126144 125239 gene locus_tag LOCUS_31430 126144 125239 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975883.1 protein_id gnl|my_center|LOCUS_31430 127521 126229 gene locus_tag LOCUS_31440 127521 126229 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975884.1 protein_id gnl|my_center|LOCUS_31440 129226 127691 gene locus_tag LOCUS_31450 129226 127691 CDS product alpha-N-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975886.1 protein_id gnl|my_center|LOCUS_31450 129159 129335 gene locus_tag LOCUS_31460 129159 129335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 129635 131281 gene locus_tag LOCUS_31470 gene araB 129635 131281 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226245.1 protein_id gnl|my_center|LOCUS_31470 131278 131949 gene locus_tag LOCUS_31480 131278 131949 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226246.1 protein_id gnl|my_center|LOCUS_31480 131990 133498 gene locus_tag LOCUS_31490 gene araA 131990 133498 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368279.1 protein_id gnl|my_center|LOCUS_31490 133498 134496 gene locus_tag LOCUS_31500 133498 134496 CDS product arabinan endo-1,5-alpha-L-arabinosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225533.1 protein_id gnl|my_center|LOCUS_31500 134498 135532 gene locus_tag LOCUS_31510 gene gutB 134498 135532 CDS product sorbitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244156.1 protein_id gnl|my_center|LOCUS_31510 135529 137430 gene locus_tag LOCUS_31520 135529 137430 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530523.1 protein_id gnl|my_center|LOCUS_31520 137450 139273 gene locus_tag LOCUS_31530 137450 139273 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229244.1 protein_id gnl|my_center|LOCUS_31530 139895 139338 gene locus_tag LOCUS_31540 139895 139338 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034351055.1 protein_id gnl|my_center|LOCUS_31540 141541 140087 gene locus_tag LOCUS_31550 141541 140087 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392514.1 protein_id gnl|my_center|LOCUS_31550 141999 141538 gene locus_tag LOCUS_31560 141999 141538 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142755.1 protein_id gnl|my_center|LOCUS_31560 142198 143454 gene locus_tag LOCUS_31570 142198 143454 CDS product S53 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186205.1 protein_id gnl|my_center|LOCUS_31570 143664 144164 gene locus_tag LOCUS_31580 143664 144164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 144166 144576 gene locus_tag LOCUS_31590 gene queD 144166 144576 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005663812.1 protein_id gnl|my_center|LOCUS_31590 144581 145279 gene locus_tag LOCUS_31600 144581 145279 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964290.1 protein_id gnl|my_center|LOCUS_31600 145282 145983 gene locus_tag LOCUS_31610 gene queC 145282 145983 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126004.1 protein_id gnl|my_center|LOCUS_31610 146137 147390 gene locus_tag LOCUS_31620 146137 147390 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968416.1 protein_id gnl|my_center|LOCUS_31620 147470 148402 gene locus_tag LOCUS_31630 147470 148402 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330567.1 protein_id gnl|my_center|LOCUS_31630 148399 149280 gene locus_tag LOCUS_31640 148399 149280 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528572.1 protein_id gnl|my_center|LOCUS_31640 149294 150265 gene locus_tag LOCUS_31650 149294 150265 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803698.1 protein_id gnl|my_center|LOCUS_31650 150262 151263 gene locus_tag LOCUS_31660 150262 151263 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803699.1 protein_id gnl|my_center|LOCUS_31660 151644 151273 gene locus_tag LOCUS_31670 gene paaI 151644 151273 CDS product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480085.1 protein_id gnl|my_center|LOCUS_31670 152536 151682 gene locus_tag LOCUS_31680 152536 151682 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889073.1 protein_id gnl|my_center|LOCUS_31680 152641 153321 gene locus_tag LOCUS_31690 152641 153321 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887187.1 protein_id gnl|my_center|LOCUS_31690 153400 154692 gene locus_tag LOCUS_31700 153400 154692 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080298.1 protein_id gnl|my_center|LOCUS_31700 154831 155763 gene locus_tag LOCUS_31710 154831 155763 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080296.1 protein_id gnl|my_center|LOCUS_31710 155769 156632 gene locus_tag LOCUS_31720 155769 156632 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014683564.1 protein_id gnl|my_center|LOCUS_31720 159281 156777 gene locus_tag LOCUS_31730 159281 156777 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889078.1 protein_id gnl|my_center|LOCUS_31730 159412 159633 gene locus_tag LOCUS_31740 159412 159633 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889077.1 protein_id gnl|my_center|LOCUS_31740 159630 160217 gene locus_tag LOCUS_31750 159630 160217 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889076.1 protein_id gnl|my_center|LOCUS_31750 160214 160525 gene locus_tag LOCUS_31760 160214 160525 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889074.1 protein_id gnl|my_center|LOCUS_31760 160661 161086 gene locus_tag LOCUS_31770 gene trxC 160661 161086 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889424.1 protein_id gnl|my_center|LOCUS_31770 161426 161148 gene locus_tag LOCUS_31780 161426 161148 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349861.1 protein_id gnl|my_center|LOCUS_31780 161626 163005 gene locus_tag LOCUS_31790 161626 163005 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480140.1 protein_id gnl|my_center|LOCUS_31790 163708 163034 gene locus_tag LOCUS_31800 gene hisIE 163708 163034 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887378.1 protein_id gnl|my_center|LOCUS_31800 164496 163705 gene locus_tag LOCUS_31810 gene hisF 164496 163705 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480000.1 protein_id gnl|my_center|LOCUS_31810 164711 165151 gene locus_tag LOCUS_31820 164711 165151 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887376.1 protein_id gnl|my_center|LOCUS_31820 165216 166043 gene locus_tag LOCUS_31830 165216 166043 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887404.1 protein_id gnl|my_center|LOCUS_31830 167095 166259 gene locus_tag LOCUS_31840 167095 166259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 167448 167074 gene locus_tag LOCUS_31850 gene nirD 167448 167074 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197730.1 protein_id gnl|my_center|LOCUS_31850 170091 167536 gene locus_tag LOCUS_31860 gene nirB 170091 167536 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197731.1 protein_id gnl|my_center|LOCUS_31860 170322 172427 gene locus_tag LOCUS_31870 170322 172427 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223026.1 protein_id gnl|my_center|LOCUS_31870 172505 173746 gene locus_tag LOCUS_31880 172505 173746 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123927512.1 protein_id gnl|my_center|LOCUS_31880 173841 174551 gene locus_tag LOCUS_31890 173841 174551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 174572 175393 gene locus_tag LOCUS_31900 gene pcaD 174572 175393 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088414.1 protein_id gnl|my_center|LOCUS_31900 176930 175665 gene locus_tag LOCUS_31910 176930 175665 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887749.1 protein_id gnl|my_center|LOCUS_31910 177880 176939 gene locus_tag LOCUS_31920 177880 176939 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887752.1 protein_id gnl|my_center|LOCUS_31920 178425 177877 gene locus_tag LOCUS_31930 gene pyrR 178425 177877 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887753.1 protein_id gnl|my_center|LOCUS_31930 178766 179260 gene locus_tag LOCUS_31940 178766 179260 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618785.1 protein_id gnl|my_center|LOCUS_31940 180246 179320 gene locus_tag LOCUS_31950 180246 179320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479623.1 protein_id gnl|my_center|LOCUS_31950 181060 180389 gene locus_tag LOCUS_31960 181060 180389 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479866.1 protein_id gnl|my_center|LOCUS_31960 181845 181168 gene locus_tag LOCUS_31970 181845 181168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 182371 181889 gene locus_tag LOCUS_31980 182371 181889 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479805.1 protein_id gnl|my_center|LOCUS_31980 182520 183626 gene locus_tag LOCUS_31990 gene ald 182520 183626 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479806.1 protein_id gnl|my_center|LOCUS_31990 183680 185500 gene locus_tag LOCUS_32000 183680 185500 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889608.1 protein_id gnl|my_center|LOCUS_32000 185497 186417 gene locus_tag LOCUS_32010 185497 186417 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086853184.1 protein_id gnl|my_center|LOCUS_32010 187904 186627 gene locus_tag LOCUS_32020 gene murA 187904 186627 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887766.1 protein_id gnl|my_center|LOCUS_32020 188192 188416 gene locus_tag LOCUS_32030 188192 188416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888507.1 protein_id gnl|my_center|LOCUS_32030 189427 188423 gene locus_tag LOCUS_32040 189427 188423 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887967.1 protein_id gnl|my_center|LOCUS_32040 189624 190931 gene locus_tag LOCUS_32050 189624 190931 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887966.1 protein_id gnl|my_center|LOCUS_32050 191004 191933 gene locus_tag LOCUS_32060 gene hemC 191004 191933 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888978.1 protein_id gnl|my_center|LOCUS_32060 191944 192909 gene locus_tag LOCUS_32070 191944 192909 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350512.1 protein_id gnl|my_center|LOCUS_32070 193770 193048 gene locus_tag LOCUS_32080 193770 193048 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480283.1 protein_id gnl|my_center|LOCUS_32080 194528 193854 gene locus_tag LOCUS_32090 gene nth 194528 193854 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886934.1 protein_id gnl|my_center|LOCUS_32090 194673 195056 gene locus_tag LOCUS_32100 gene mscL 194673 195056 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889048.1 protein_id gnl|my_center|LOCUS_32100 195167 196417 gene locus_tag LOCUS_32110 195167 196417 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888817.1 protein_id gnl|my_center|LOCUS_32110 197293 196505 gene locus_tag LOCUS_32120 197293 196505 CDS product TM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164993988.1 protein_id gnl|my_center|LOCUS_32120 198177 197356 gene locus_tag LOCUS_32130 198177 197356 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886674.1 protein_id gnl|my_center|LOCUS_32130 201247 198206 gene locus_tag LOCUS_32140 201247 198206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 201993 201511 gene locus_tag LOCUS_32150 201993 201511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 203032 202040 gene locus_tag LOCUS_32160 203032 202040 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401213.1 protein_id gnl|my_center|LOCUS_32160 203555 203025 gene locus_tag LOCUS_32170 203555 203025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 204055 203612 gene locus_tag LOCUS_32180 gene ybiA 204055 203612 CDS product N-glycosidase YbiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145128.1 protein_id gnl|my_center|LOCUS_32180 204529 204059 gene locus_tag LOCUS_32190 204529 204059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 205196 204519 gene locus_tag LOCUS_32200 205196 204519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 206584 205193 gene locus_tag LOCUS_32210 206584 205193 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886939.1 protein_id gnl|my_center|LOCUS_32210 206736 209231 gene locus_tag LOCUS_32220 206736 209231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 209410 210726 gene locus_tag LOCUS_32230 209410 210726 CDS product vanadium-dependent haloperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225610.1 protein_id gnl|my_center|LOCUS_32230 >Feature sequence09 250 930 gene locus_tag LOCUS_32240 gene moaD 250 930 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889231.1 protein_id gnl|my_center|LOCUS_32240 1661 957 gene locus_tag LOCUS_32250 1661 957 CDS product PrsW family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479560.1 protein_id gnl|my_center|LOCUS_32250 2174 1665 gene locus_tag LOCUS_32260 gene ruvC 2174 1665 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887085.1 protein_id gnl|my_center|LOCUS_32260 2866 2444 gene locus_tag LOCUS_32270 2866 2444 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887084.1 protein_id gnl|my_center|LOCUS_32270 3003 3269 gene locus_tag LOCUS_32280 3003 3269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 3532 3338 gene locus_tag LOCUS_32290 3532 3338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 4934 3603 gene locus_tag LOCUS_32300 4934 3603 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887081.1 protein_id gnl|my_center|LOCUS_32300 5596 4931 gene locus_tag LOCUS_32310 5596 4931 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887080.1 protein_id gnl|my_center|LOCUS_32310 6476 5634 gene locus_tag LOCUS_32320 6476 5634 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177183020.1 protein_id gnl|my_center|LOCUS_32320 7522 6662 gene locus_tag LOCUS_32330 7522 6662 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349500.1 protein_id gnl|my_center|LOCUS_32330 7749 7525 gene locus_tag LOCUS_32340 7749 7525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 8408 7764 gene locus_tag LOCUS_32350 8408 7764 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887077.1 protein_id gnl|my_center|LOCUS_32350 8458 10002 gene locus_tag LOCUS_32360 8458 10002 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889049.1 protein_id gnl|my_center|LOCUS_32360 10193 10624 gene locus_tag LOCUS_32370 10193 10624 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228878.1 protein_id gnl|my_center|LOCUS_32370 10935 11999 gene locus_tag LOCUS_32380 10935 11999 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582798.1 protein_id gnl|my_center|LOCUS_32380 12011 13021 gene locus_tag LOCUS_32390 12011 13021 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531511.1 protein_id gnl|my_center|LOCUS_32390 13363 13079 gene locus_tag LOCUS_32400 13363 13079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 13254 14234 gene locus_tag LOCUS_32410 13254 14234 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974316.1 protein_id gnl|my_center|LOCUS_32410 14231 15067 gene locus_tag LOCUS_32420 14231 15067 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731543.1 protein_id gnl|my_center|LOCUS_32420 15604 15128 gene locus_tag LOCUS_32430 15604 15128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886730.1 protein_id gnl|my_center|LOCUS_32430 15503 15697 gene locus_tag LOCUS_32440 15503 15697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 16970 15720 gene locus_tag LOCUS_32450 gene odhB 16970 15720 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886731.1 protein_id gnl|my_center|LOCUS_32450 17957 17049 gene locus_tag LOCUS_32460 gene rbsK 17957 17049 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113483.1 protein_id gnl|my_center|LOCUS_32460 18040 18729 gene locus_tag LOCUS_32470 18040 18729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 21598 18746 gene locus_tag LOCUS_32480 21598 18746 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886932.1 protein_id gnl|my_center|LOCUS_32480 21760 22638 gene locus_tag LOCUS_32490 21760 22638 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886922.1 protein_id gnl|my_center|LOCUS_32490 22664 22903 gene locus_tag LOCUS_32500 22664 22903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889184.1 protein_id gnl|my_center|LOCUS_32500 23242 22913 gene locus_tag LOCUS_32510 23242 22913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 24014 23307 gene locus_tag LOCUS_32520 24014 23307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 25768 24185 gene locus_tag LOCUS_32530 25768 24185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 26410 25943 gene locus_tag LOCUS_32540 26410 25943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 26754 26461 gene locus_tag LOCUS_32550 26754 26461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889185.1 protein_id gnl|my_center|LOCUS_32550 27048 26857 gene locus_tag LOCUS_32560 27048 26857 CDS product YwbE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889186.1 protein_id gnl|my_center|LOCUS_32560 27969 27367 gene locus_tag LOCUS_32570 27969 27367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256711.1 protein_id gnl|my_center|LOCUS_32570 29270 27969 gene locus_tag LOCUS_32580 29270 27969 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256710.1 protein_id gnl|my_center|LOCUS_32580 30657 29239 gene locus_tag LOCUS_32590 gene purF 30657 29239 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886866.1 protein_id gnl|my_center|LOCUS_32590 32932 30689 gene locus_tag LOCUS_32600 gene purL 32932 30689 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886868.1 protein_id gnl|my_center|LOCUS_32600 33462 32986 gene locus_tag LOCUS_32610 33462 32986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 34136 33459 gene locus_tag LOCUS_32620 gene purQ 34136 33459 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480167.1 protein_id gnl|my_center|LOCUS_32620 34632 34264 gene locus_tag LOCUS_32630 34632 34264 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462150.1 protein_id gnl|my_center|LOCUS_32630 34880 34629 gene locus_tag LOCUS_32640 gene purS 34880 34629 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886870.1 protein_id gnl|my_center|LOCUS_32640 35656 34958 gene locus_tag LOCUS_32650 35656 34958 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480166.1 protein_id gnl|my_center|LOCUS_32650 37407 35995 gene locus_tag LOCUS_32660 37407 35995 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889272.1 protein_id gnl|my_center|LOCUS_32660 37618 38049 gene locus_tag LOCUS_32670 37618 38049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888869.1 protein_id gnl|my_center|LOCUS_32670 38159 39244 gene locus_tag LOCUS_32680 38159 39244 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480363.1 protein_id gnl|my_center|LOCUS_32680 39349 40710 gene locus_tag LOCUS_32690 39349 40710 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887950.1 protein_id gnl|my_center|LOCUS_32690 41207 40725 gene locus_tag LOCUS_32700 41207 40725 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769671.1 protein_id gnl|my_center|LOCUS_32700 41529 41218 gene locus_tag LOCUS_32710 41529 41218 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074197.1 protein_id gnl|my_center|LOCUS_32710 41694 44261 gene locus_tag LOCUS_32720 gene mutS 41694 44261 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029732769.1 protein_id gnl|my_center|LOCUS_32720 45341 44268 gene locus_tag LOCUS_32730 45341 44268 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887674.1 protein_id gnl|my_center|LOCUS_32730 46485 45328 gene locus_tag LOCUS_32740 46485 45328 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887673.1 protein_id gnl|my_center|LOCUS_32740 47450 46482 gene locus_tag LOCUS_32750 47450 46482 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339577.1 protein_id gnl|my_center|LOCUS_32750 48213 47473 gene locus_tag LOCUS_32760 48213 47473 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228477.1 protein_id gnl|my_center|LOCUS_32760 48801 48223 gene locus_tag LOCUS_32770 48801 48223 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479655.1 protein_id gnl|my_center|LOCUS_32770 49448 48798 gene locus_tag LOCUS_32780 49448 48798 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887671.1 protein_id gnl|my_center|LOCUS_32780 50347 49604 gene locus_tag LOCUS_32790 50347 49604 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479656.1 protein_id gnl|my_center|LOCUS_32790 50500 51867 gene locus_tag LOCUS_32800 50500 51867 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887669.1 protein_id gnl|my_center|LOCUS_32800 52014 53498 gene locus_tag LOCUS_32810 52014 53498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 53561 55222 gene locus_tag LOCUS_32820 gene mutL 53561 55222 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888331.1 protein_id gnl|my_center|LOCUS_32820 56396 55236 gene locus_tag LOCUS_32830 56396 55236 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888346.1 protein_id gnl|my_center|LOCUS_32830 58317 56521 gene locus_tag LOCUS_32840 58317 56521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 61131 58522 gene locus_tag LOCUS_32850 gene secA 61131 58522 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887220.1 protein_id gnl|my_center|LOCUS_32850 61302 61775 gene locus_tag LOCUS_32860 61302 61775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 63177 62017 gene locus_tag LOCUS_32870 63177 62017 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618821.1 protein_id gnl|my_center|LOCUS_32870 64094 63210 gene locus_tag LOCUS_32880 64094 63210 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887469.1 protein_id gnl|my_center|LOCUS_32880 64213 64830 gene locus_tag LOCUS_32890 64213 64830 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480040.1 protein_id gnl|my_center|LOCUS_32890 65002 66441 gene locus_tag LOCUS_32900 65002 66441 CDS product 2-phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350737.1 protein_id gnl|my_center|LOCUS_32900 67010 66594 gene locus_tag LOCUS_32910 67010 66594 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888492.1 protein_id gnl|my_center|LOCUS_32910 67732 67088 gene locus_tag LOCUS_32920 gene pdxH 67732 67088 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887140.1 protein_id gnl|my_center|LOCUS_32920 68562 67729 gene locus_tag LOCUS_32930 68562 67729 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479550.1 protein_id gnl|my_center|LOCUS_32930 68585 69274 gene locus_tag LOCUS_32940 68585 69274 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887135.1 protein_id gnl|my_center|LOCUS_32940 69561 69271 gene locus_tag LOCUS_32950 69561 69271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 69952 69563 gene locus_tag LOCUS_32960 69952 69563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888635.1 protein_id gnl|my_center|LOCUS_32960 70457 69963 gene locus_tag LOCUS_32970 70457 69963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 73354 70496 gene locus_tag LOCUS_32980 73354 70496 CDS product transglutaminaseTgpA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349466.1 protein_id gnl|my_center|LOCUS_32980 74373 73423 gene locus_tag LOCUS_32990 74373 73423 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887266.1 protein_id gnl|my_center|LOCUS_32990 74758 74384 gene locus_tag LOCUS_33000 74758 74384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 75174 74755 gene locus_tag LOCUS_33010 75174 74755 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888655.1 protein_id gnl|my_center|LOCUS_33010 75709 75209 gene locus_tag LOCUS_33020 75709 75209 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888662.1 protein_id gnl|my_center|LOCUS_33020 76380 75817 gene locus_tag LOCUS_33030 76380 75817 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888661.1 protein_id gnl|my_center|LOCUS_33030 76964 76377 gene locus_tag LOCUS_33040 76964 76377 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350124.1 protein_id gnl|my_center|LOCUS_33040 78333 76975 gene locus_tag LOCUS_33050 78333 76975 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888658.1 protein_id gnl|my_center|LOCUS_33050 78486 79205 gene locus_tag LOCUS_33060 78486 79205 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349631.1 protein_id gnl|my_center|LOCUS_33060 79202 80041 gene locus_tag LOCUS_33070 79202 80041 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164993974.1 protein_id gnl|my_center|LOCUS_33070 82025 80130 gene locus_tag LOCUS_33080 82025 80130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 82215 82412 gene locus_tag LOCUS_33090 82215 82412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 82415 83068 gene locus_tag LOCUS_33100 82415 83068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 83447 83163 gene locus_tag LOCUS_33110 83447 83163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 83575 84519 gene locus_tag LOCUS_33120 83575 84519 CDS product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014757.1 protein_id gnl|my_center|LOCUS_33120 84648 86159 gene locus_tag LOCUS_33130 gene cysS 84648 86159 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479901.1 protein_id gnl|my_center|LOCUS_33130 86429 87010 gene locus_tag LOCUS_33140 86429 87010 CDS product YcjF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888688.1 protein_id gnl|my_center|LOCUS_33140 88111 87038 gene locus_tag LOCUS_33150 gene alr 88111 87038 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479629.1 protein_id gnl|my_center|LOCUS_33150 88235 90163 gene locus_tag LOCUS_33160 88235 90163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 90223 90666 gene locus_tag LOCUS_33170 90223 90666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888085.1 protein_id gnl|my_center|LOCUS_33170 91206 90691 gene locus_tag LOCUS_33180 91206 90691 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479831.1 protein_id gnl|my_center|LOCUS_33180 91325 92329 gene locus_tag LOCUS_33190 gene glpX 91325 92329 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479842.1 protein_id gnl|my_center|LOCUS_33190 93201 92482 gene locus_tag LOCUS_33200 gene hisA 93201 92482 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889120.1 protein_id gnl|my_center|LOCUS_33200 93243 94406 gene locus_tag LOCUS_33210 93243 94406 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887089.1 protein_id gnl|my_center|LOCUS_33210 96095 94500 gene locus_tag LOCUS_33220 gene murJ 96095 94500 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177570.1 protein_id gnl|my_center|LOCUS_33220 96657 96214 gene locus_tag LOCUS_33230 96657 96214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 98434 96800 gene locus_tag LOCUS_33240 gene pgm 98434 96800 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480279.1 protein_id gnl|my_center|LOCUS_33240 98679 99221 gene locus_tag LOCUS_33250 98679 99221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 100238 99252 gene locus_tag LOCUS_33260 gene trxB 100238 99252 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888615.1 protein_id gnl|my_center|LOCUS_33260 100478 101551 gene locus_tag LOCUS_33270 100478 101551 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109725.1 protein_id gnl|my_center|LOCUS_33270 101548 101793 gene locus_tag LOCUS_33280 gene rpmB 101548 101793 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889149.1 protein_id gnl|my_center|LOCUS_33280 101968 102852 gene locus_tag LOCUS_33290 101968 102852 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017870495.1 protein_id gnl|my_center|LOCUS_33290 103673 102873 gene locus_tag LOCUS_33300 103673 102873 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479811.1 protein_id gnl|my_center|LOCUS_33300 103709 104431 gene locus_tag LOCUS_33310 103709 104431 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888912.1 protein_id gnl|my_center|LOCUS_33310 104498 105310 gene locus_tag LOCUS_33320 104498 105310 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888911.1 protein_id gnl|my_center|LOCUS_33320 106212 105307 gene locus_tag LOCUS_33330 106212 105307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 106725 106228 gene locus_tag LOCUS_33340 106725 106228 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977146.1 protein_id gnl|my_center|LOCUS_33340 107652 106747 gene locus_tag LOCUS_33350 107652 106747 CDS product DUF2268 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000688524.1 protein_id gnl|my_center|LOCUS_33350 107869 109479 gene locus_tag LOCUS_33360 107869 109479 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349485.1 protein_id gnl|my_center|LOCUS_33360 109476 109913 gene locus_tag LOCUS_33370 109476 109913 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948047.1 protein_id gnl|my_center|LOCUS_33370 110895 109918 gene locus_tag LOCUS_33380 110895 109918 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644043.1 protein_id gnl|my_center|LOCUS_33380 111643 110999 gene locus_tag LOCUS_33390 111643 110999 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479823.1 protein_id gnl|my_center|LOCUS_33390 111721 112068 gene locus_tag LOCUS_33400 111721 112068 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479824.1 protein_id gnl|my_center|LOCUS_33400 112111 112365 gene locus_tag LOCUS_33410 112111 112365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 112408 112953 gene locus_tag LOCUS_33420 112408 112953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140870.1 protein_id gnl|my_center|LOCUS_33420 114004 113006 gene locus_tag LOCUS_33430 114004 113006 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705178.1 protein_id gnl|my_center|LOCUS_33430 114804 114001 gene locus_tag LOCUS_33440 114804 114001 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836413.1 protein_id gnl|my_center|LOCUS_33440 115083 116630 gene locus_tag LOCUS_33450 gene purH 115083 116630 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479694.1 protein_id gnl|my_center|LOCUS_33450 116630 117508 gene locus_tag LOCUS_33460 116630 117508 CDS product bifunctional 5,10-methylenetetrahydrofolate dehydrogenase/5,10-methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887513.1 protein_id gnl|my_center|LOCUS_33460 118941 117610 gene locus_tag LOCUS_33470 118941 117610 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356675.1 protein_id gnl|my_center|LOCUS_33470 119021 120466 gene locus_tag LOCUS_33480 gene gltX 119021 120466 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479551.1 protein_id gnl|my_center|LOCUS_33480 120477 120830 gene locus_tag LOCUS_33490 120477 120830 CDS product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537677.1 protein_id gnl|my_center|LOCUS_33490 121250 120834 gene locus_tag LOCUS_33500 121250 120834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 121344 121745 gene locus_tag LOCUS_33510 121344 121745 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888664.1 protein_id gnl|my_center|LOCUS_33510 121742 122929 gene locus_tag LOCUS_33520 121742 122929 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480378.1 protein_id gnl|my_center|LOCUS_33520 123897 123124 gene locus_tag LOCUS_33530 gene pstB 123897 123124 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889420.1 protein_id gnl|my_center|LOCUS_33530 124873 124007 gene locus_tag LOCUS_33540 gene pstA 124873 124007 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889419.1 protein_id gnl|my_center|LOCUS_33540 125877 124870 gene locus_tag LOCUS_33550 gene pstC 125877 124870 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479754.1 protein_id gnl|my_center|LOCUS_33550 127019 126009 gene locus_tag LOCUS_33560 gene pstS 127019 126009 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479753.1 protein_id gnl|my_center|LOCUS_33560 128439 127195 gene locus_tag LOCUS_33570 128439 127195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 128617 128528 gene locus_tag LOCUS_t00500 128617 128528 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 128710 129306 gene locus_tag LOCUS_33580 gene plsY 128710 129306 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888654.1 protein_id gnl|my_center|LOCUS_33580 129413 129721 gene locus_tag LOCUS_33590 129413 129721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479845.1 protein_id gnl|my_center|LOCUS_33590 130012 131031 gene locus_tag LOCUS_33600 130012 131031 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888641.1 protein_id gnl|my_center|LOCUS_33600 131271 132212 gene locus_tag LOCUS_33610 131271 132212 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729157.1 protein_id gnl|my_center|LOCUS_33610 132433 134235 gene locus_tag LOCUS_33620 132433 134235 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129119821.1 protein_id gnl|my_center|LOCUS_33620 134443 136233 gene locus_tag LOCUS_33630 134443 136233 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056620.1 protein_id gnl|my_center|LOCUS_33630 137394 136462 gene locus_tag LOCUS_33640 137394 136462 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090157.1 protein_id gnl|my_center|LOCUS_33640 137470 138126 gene locus_tag LOCUS_33650 137470 138126 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028328056.1 protein_id gnl|my_center|LOCUS_33650 138724 138116 gene locus_tag LOCUS_33660 138724 138116 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888647.1 protein_id gnl|my_center|LOCUS_33660 140045 138780 gene locus_tag LOCUS_33670 140045 138780 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888648.1 protein_id gnl|my_center|LOCUS_33670 141752 140121 gene locus_tag LOCUS_33680 141752 140121 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886903.1 protein_id gnl|my_center|LOCUS_33680 142234 141749 gene locus_tag LOCUS_33690 142234 141749 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618907.1 protein_id gnl|my_center|LOCUS_33690 142868 142419 gene locus_tag LOCUS_33700 142868 142419 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618905.1 protein_id gnl|my_center|LOCUS_33700 144058 142865 gene locus_tag LOCUS_33710 144058 142865 CDS product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886905.1 protein_id gnl|my_center|LOCUS_33710 144315 145349 gene locus_tag LOCUS_33720 144315 145349 CDS product thiamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886907.1 protein_id gnl|my_center|LOCUS_33720 145660 147198 gene locus_tag LOCUS_33730 145660 147198 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889113.1 protein_id gnl|my_center|LOCUS_33730 147195 148187 gene locus_tag LOCUS_33740 147195 148187 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886710.1 protein_id gnl|my_center|LOCUS_33740 148334 148675 gene locus_tag LOCUS_33750 148334 148675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 148855 149490 gene locus_tag LOCUS_33760 148855 149490 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887197.1 protein_id gnl|my_center|LOCUS_33760 149576 150181 gene locus_tag LOCUS_33770 149576 150181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025567615.1 protein_id gnl|my_center|LOCUS_33770 150252 151637 gene locus_tag LOCUS_33780 gene hemL 150252 151637 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479528.1 protein_id gnl|my_center|LOCUS_33780 151634 152056 gene locus_tag LOCUS_33790 151634 152056 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887201.1 protein_id gnl|my_center|LOCUS_33790 152079 152507 gene locus_tag LOCUS_33800 152079 152507 CDS product DUF3197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349644.1 protein_id gnl|my_center|LOCUS_33800 152801 152556 gene locus_tag LOCUS_33810 152801 152556 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888716.1 protein_id gnl|my_center|LOCUS_33810 153558 152947 gene locus_tag LOCUS_33820 gene infC 153558 152947 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888718.1 protein_id gnl|my_center|LOCUS_33820 153778 154455 gene locus_tag LOCUS_33830 153778 154455 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886838.1 protein_id gnl|my_center|LOCUS_33830 157610 154524 gene locus_tag LOCUS_33840 157610 154524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 157920 158210 gene locus_tag LOCUS_33850 157920 158210 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886845.1 protein_id gnl|my_center|LOCUS_33850 158218 158823 gene locus_tag LOCUS_33860 gene recR 158218 158823 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886844.1 protein_id gnl|my_center|LOCUS_33860 159302 158919 gene locus_tag LOCUS_33870 159302 158919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 160091 159381 gene locus_tag LOCUS_33880 160091 159381 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887865.1 protein_id gnl|my_center|LOCUS_33880 161358 160099 gene locus_tag LOCUS_33890 161358 160099 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887866.1 protein_id gnl|my_center|LOCUS_33890 161412 162110 gene locus_tag LOCUS_33900 161412 162110 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350721.1 protein_id gnl|my_center|LOCUS_33900 163233 162046 gene locus_tag LOCUS_33910 163233 162046 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887868.1 protein_id gnl|my_center|LOCUS_33910 163386 164420 gene locus_tag LOCUS_33920 163386 164420 CDS product Sectered polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152423712.1 protein_id gnl|my_center|LOCUS_33920 165233 164433 gene locus_tag LOCUS_33930 gene hpaI 165233 164433 CDS product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889550.1 protein_id gnl|my_center|LOCUS_33930 166047 165241 gene locus_tag LOCUS_33940 gene hpaH 166047 165241 CDS product 2-oxo-hepta-3-ene-1,7-dioic acid hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889382.1 protein_id gnl|my_center|LOCUS_33940 166439 166044 gene locus_tag LOCUS_33950 166439 166044 CDS product 5-carboxymethyl-2-hydroxymuconate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194671.1 protein_id gnl|my_center|LOCUS_33950 167224 166439 gene locus_tag LOCUS_33960 167224 166439 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889485.1 protein_id gnl|my_center|LOCUS_33960 168209 167244 gene locus_tag LOCUS_33970 gene hpaD 168209 167244 CDS product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479777.1 protein_id gnl|my_center|LOCUS_33970 169738 168272 gene locus_tag LOCUS_33980 gene hpaB 169738 168272 CDS product 4-hydroxyphenylacetate 3-monooxygenase, oxygenase component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889482.1 protein_id gnl|my_center|LOCUS_33980 170561 169740 gene locus_tag LOCUS_33990 170561 169740 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889481.1 protein_id gnl|my_center|LOCUS_33990 171126 170554 gene locus_tag LOCUS_34000 171126 170554 CDS product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889480.1 protein_id gnl|my_center|LOCUS_34000 172649 171123 gene locus_tag LOCUS_34010 gene hpaE 172649 171123 CDS product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889479.1 protein_id gnl|my_center|LOCUS_34010 172762 173958 gene locus_tag LOCUS_34020 172762 173958 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177634.1 protein_id gnl|my_center|LOCUS_34020 175132 173969 gene locus_tag LOCUS_34030 175132 173969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 176022 175348 gene locus_tag LOCUS_34040 176022 175348 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887347.1 protein_id gnl|my_center|LOCUS_34040 177545 176130 gene locus_tag LOCUS_34050 177545 176130 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887346.1 protein_id gnl|my_center|LOCUS_34050 179290 177542 gene locus_tag LOCUS_34060 179290 177542 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887345.1 protein_id gnl|my_center|LOCUS_34060 179730 179404 gene locus_tag LOCUS_34070 179730 179404 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887344.1 protein_id gnl|my_center|LOCUS_34070 180703 179723 gene locus_tag LOCUS_34080 180703 179723 CDS product V-type ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480006.1 protein_id gnl|my_center|LOCUS_34080 181286 180714 gene locus_tag LOCUS_34090 181286 180714 CDS product V-type ATP synthase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887342.1 protein_id gnl|my_center|LOCUS_34090 181628 181296 gene locus_tag LOCUS_34100 181628 181296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 183669 181648 gene locus_tag LOCUS_34110 183669 181648 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887340.1 protein_id gnl|my_center|LOCUS_34110 183983 183666 gene locus_tag LOCUS_34120 183983 183666 CDS product V-type ATPase subunit subunit G family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887339.1 protein_id gnl|my_center|LOCUS_34120 184333 184710 gene locus_tag LOCUS_34130 184333 184710 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889137.1 protein_id gnl|my_center|LOCUS_34130 184810 185679 gene locus_tag LOCUS_34140 184810 185679 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618886.1 protein_id gnl|my_center|LOCUS_34140 185723 187447 gene locus_tag LOCUS_34150 185723 187447 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479769.1 protein_id gnl|my_center|LOCUS_34150 >Feature sequence10 1589 696 gene locus_tag LOCUS_34160 1589 696 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 protein_id gnl|my_center|LOCUS_34160 2497 1586 gene locus_tag LOCUS_34170 2497 1586 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286787.1 protein_id gnl|my_center|LOCUS_34170 2703 3716 gene locus_tag LOCUS_34180 2703 3716 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081773.1 protein_id gnl|my_center|LOCUS_34180 3713 4318 gene locus_tag LOCUS_34190 3713 4318 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219976.1 protein_id gnl|my_center|LOCUS_34190 4315 6786 gene locus_tag LOCUS_34200 4315 6786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 8166 6916 gene locus_tag LOCUS_34210 8166 6916 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286788.1 protein_id gnl|my_center|LOCUS_34210 9462 8218 gene locus_tag LOCUS_34220 9462 8218 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584031.1 protein_id gnl|my_center|LOCUS_34220 9621 11498 gene locus_tag LOCUS_34230 9621 11498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 11488 12168 gene locus_tag LOCUS_34240 11488 12168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 12165 13067 gene locus_tag LOCUS_34250 12165 13067 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887373.1 protein_id gnl|my_center|LOCUS_34250 14469 13090 gene locus_tag LOCUS_34260 14469 13090 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804146.1 protein_id gnl|my_center|LOCUS_34260 17012 14466 gene locus_tag LOCUS_34270 17012 14466 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928424.1 protein_id gnl|my_center|LOCUS_34270 17130 20009 gene locus_tag LOCUS_34280 17130 20009 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906004.1 protein_id gnl|my_center|LOCUS_34280 20006 20704 gene locus_tag LOCUS_34290 20006 20704 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393497.1 protein_id gnl|my_center|LOCUS_34290 20697 21605 gene locus_tag LOCUS_34300 gene fba 20697 21605 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392146.1 protein_id gnl|my_center|LOCUS_34300 21675 24185 gene locus_tag LOCUS_34310 21675 24185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 24182 24388 gene locus_tag LOCUS_34320 24182 24388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 24385 25200 gene locus_tag LOCUS_34330 24385 25200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 25197 26279 gene locus_tag LOCUS_34340 25197 26279 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067163.1 protein_id gnl|my_center|LOCUS_34340 26276 26491 gene locus_tag LOCUS_34350 26276 26491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 26488 28224 gene locus_tag LOCUS_34360 26488 28224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 28241 29617 gene locus_tag LOCUS_34370 28241 29617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 29614 30942 gene locus_tag LOCUS_34380 29614 30942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 30939 31634 gene locus_tag LOCUS_34390 30939 31634 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251082.1 protein_id gnl|my_center|LOCUS_34390 31631 32962 gene locus_tag LOCUS_34400 31631 32962 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243011.1 protein_id gnl|my_center|LOCUS_34400 33744 33331 gene locus_tag LOCUS_34410 33744 33331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 35289 33850 gene locus_tag LOCUS_34420 35289 33850 CDS product replication initiator protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229172.1 protein_id gnl|my_center|LOCUS_34420 37083 36634 gene locus_tag LOCUS_34430 37083 36634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 38584 39192 gene locus_tag LOCUS_34440 38584 39192 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140153.1 protein_id gnl|my_center|LOCUS_34440 39189 39467 gene locus_tag LOCUS_34450 39189 39467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 39641 40207 gene locus_tag LOCUS_34460 39641 40207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 41001 40171 gene locus_tag LOCUS_34470 41001 40171 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037349.1 protein_id gnl|my_center|LOCUS_34470 41849 40998 gene locus_tag LOCUS_34480 41849 40998 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775954.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34480 43242 41950 gene locus_tag LOCUS_34490 43242 41950 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530183.1 protein_id gnl|my_center|LOCUS_34490 43674 44702 gene locus_tag LOCUS_34500 43674 44702 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229210.1 protein_id gnl|my_center|LOCUS_34500 44789 46843 gene locus_tag LOCUS_34510 44789 46843 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080133.1 protein_id gnl|my_center|LOCUS_34510 47541 47753 gene locus_tag LOCUS_34520 47541 47753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 48369 48106 gene locus_tag LOCUS_34530 48369 48106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 48829 52341 gene locus_tag LOCUS_34540 48829 52341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 52986 52558 gene locus_tag LOCUS_34550 52986 52558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 53952 53038 gene locus_tag LOCUS_34560 53952 53038 CDS product DUF2382 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480014.1 protein_id gnl|my_center|LOCUS_34560 54617 54342 gene locus_tag LOCUS_34570 54617 54342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 55586 55191 gene locus_tag LOCUS_34580 55586 55191 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063653087.1 protein_id gnl|my_center|LOCUS_34580 56628 56299 gene locus_tag LOCUS_34590 56628 56299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 56662 57447 gene locus_tag LOCUS_34600 56662 57447 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067189.1 protein_id gnl|my_center|LOCUS_34600 57554 58228 gene locus_tag LOCUS_34610 57554 58228 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067190.1 protein_id gnl|my_center|LOCUS_34610 58262 59509 gene locus_tag LOCUS_34620 58262 59509 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142595.1 protein_id gnl|my_center|LOCUS_34620 59527 60903 gene locus_tag LOCUS_34630 gene hydA 59527 60903 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228420.1 protein_id gnl|my_center|LOCUS_34630 61448 61206 gene locus_tag LOCUS_34640 61448 61206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 62537 61524 gene locus_tag LOCUS_34650 62537 61524 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175050168.1 protein_id gnl|my_center|LOCUS_34650 64123 62534 gene locus_tag LOCUS_34660 64123 62534 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389092.1 protein_id gnl|my_center|LOCUS_34660 65207 64206 gene locus_tag LOCUS_34670 65207 64206 CDS product autoinducer 2 ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389091.1 protein_id gnl|my_center|LOCUS_34670 66258 65239 gene locus_tag LOCUS_34680 66258 65239 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389090.1 protein_id gnl|my_center|LOCUS_34680 66483 67490 gene locus_tag LOCUS_34690 66483 67490 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674237.1 protein_id gnl|my_center|LOCUS_34690 67487 68179 gene locus_tag LOCUS_34700 67487 68179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34700 68256 69338 gene locus_tag LOCUS_34710 68256 69338 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723784.1 protein_id gnl|my_center|LOCUS_34710 71632 69662 gene locus_tag LOCUS_34720 71632 69662 CDS product bifunctional aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066909.1 protein_id gnl|my_center|LOCUS_34720 72678 71629 gene locus_tag LOCUS_34730 gene mtnA 72678 71629 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392224.1 protein_id gnl|my_center|LOCUS_34730 73916 72675 gene locus_tag LOCUS_34740 gene mtnK 73916 72675 CDS product S-methyl-5-thioribose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097617.1 protein_id gnl|my_center|LOCUS_34740 74605 74015 gene locus_tag LOCUS_34750 74605 74015 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061253.1 protein_id gnl|my_center|LOCUS_34750 74642 75115 gene locus_tag LOCUS_34760 74642 75115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 75644 75964 gene locus_tag LOCUS_34770 75644 75964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 76048 77016 gene locus_tag LOCUS_34780 76048 77016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 77575 77213 gene locus_tag LOCUS_34790 77575 77213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 79137 77572 gene locus_tag LOCUS_34800 79137 77572 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203086395.1 protein_id gnl|my_center|LOCUS_34800 79923 79207 gene locus_tag LOCUS_34810 79923 79207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 80980 79958 gene locus_tag LOCUS_34820 80980 79958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484522.1 protein_id gnl|my_center|LOCUS_34820 81085 81678 gene locus_tag LOCUS_34830 81085 81678 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086809.1 protein_id gnl|my_center|LOCUS_34830 82441 82827 gene locus_tag LOCUS_34840 82441 82827 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228480.1 protein_id gnl|my_center|LOCUS_34840 82824 83378 gene locus_tag LOCUS_34850 82824 83378 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097615831.1 protein_id gnl|my_center|LOCUS_34850 84742 85887 gene locus_tag LOCUS_34860 84742 85887 CDS product L-dopachrome tautomerase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888425.1 protein_id gnl|my_center|LOCUS_34860 85918 86805 gene locus_tag LOCUS_34870 85918 86805 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479980.1 protein_id gnl|my_center|LOCUS_34870 89589 87112 gene locus_tag LOCUS_34880 89589 87112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 89746 90924 gene locus_tag LOCUS_34890 89746 90924 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097689.1 protein_id gnl|my_center|LOCUS_34890 90921 92051 gene locus_tag LOCUS_34900 90921 92051 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097689.1 protein_id gnl|my_center|LOCUS_34900 92166 92990 gene locus_tag LOCUS_34910 gene iolE 92166 92990 CDS product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919177.1 protein_id gnl|my_center|LOCUS_34910 93034 94143 gene locus_tag LOCUS_34920 93034 94143 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243020.1 protein_id gnl|my_center|LOCUS_34920 94217 95428 gene locus_tag LOCUS_34930 94217 95428 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161951924.1 protein_id gnl|my_center|LOCUS_34930 95477 97033 gene locus_tag LOCUS_34940 95477 97033 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082910117.1 protein_id gnl|my_center|LOCUS_34940 97017 97976 gene locus_tag LOCUS_34950 97017 97976 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707197.1 protein_id gnl|my_center|LOCUS_34950 98006 98305 gene locus_tag LOCUS_34960 98006 98305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 99862 98630 gene locus_tag LOCUS_34970 99862 98630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 101365 100196 gene locus_tag LOCUS_34980 101365 100196 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037159.1 protein_id gnl|my_center|LOCUS_34980 102207 101536 gene locus_tag LOCUS_34990 102207 101536 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026138672.1 protein_id gnl|my_center|LOCUS_34990 103409 102963 gene locus_tag LOCUS_35000 103409 102963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35000 104960 103848 gene locus_tag LOCUS_35010 104960 103848 CDS product L-dopachrome tautomerase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228342.1 protein_id gnl|my_center|LOCUS_35010 106184 105042 gene locus_tag LOCUS_35020 106184 105042 CDS product glutathione-independent formaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405501.1 protein_id gnl|my_center|LOCUS_35020 106886 106752 gene locus_tag LOCUS_35030 106886 106752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 106875 107207 gene locus_tag LOCUS_35040 106875 107207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 108749 107562 gene locus_tag LOCUS_35050 108749 107562 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140737.1 protein_id gnl|my_center|LOCUS_35050 109828 108770 gene locus_tag LOCUS_35060 109828 108770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 110386 110000 gene locus_tag LOCUS_35070 110386 110000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 111632 110709 gene locus_tag LOCUS_35080 111632 110709 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767181.1 protein_id gnl|my_center|LOCUS_35080 112642 111629 gene locus_tag LOCUS_35090 112642 111629 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103129516.1 protein_id gnl|my_center|LOCUS_35090 113916 112639 gene locus_tag LOCUS_35100 113916 112639 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142001.1 protein_id gnl|my_center|LOCUS_35100 114815 113913 gene locus_tag LOCUS_35110 114815 113913 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722710.1 protein_id gnl|my_center|LOCUS_35110 115747 114812 gene locus_tag LOCUS_35120 115747 114812 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776897.1 protein_id gnl|my_center|LOCUS_35120 117080 115785 gene locus_tag LOCUS_35130 117080 115785 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528982.1 protein_id gnl|my_center|LOCUS_35130 117974 119080 gene locus_tag LOCUS_35140 117974 119080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 120662 119415 gene locus_tag LOCUS_35150 120662 119415 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816831.1 protein_id gnl|my_center|LOCUS_35150 121962 120979 gene locus_tag LOCUS_35160 121962 120979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 122435 121956 gene locus_tag LOCUS_35170 122435 121956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 123747 122848 gene locus_tag LOCUS_35180 123747 122848 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143349.1 protein_id gnl|my_center|LOCUS_35180 123977 124384 gene locus_tag LOCUS_35190 123977 124384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 124384 124848 gene locus_tag LOCUS_35200 124384 124848 CDS product DUF1772 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140486.1 protein_id gnl|my_center|LOCUS_35200 126265 125144 gene locus_tag LOCUS_35210 126265 125144 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887733.1 protein_id gnl|my_center|LOCUS_35210 127168 126677 gene locus_tag LOCUS_35220 127168 126677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 127769 127527 gene locus_tag LOCUS_35230 127769 127527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 130882 128228 gene locus_tag LOCUS_35240 130882 128228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 134559 131245 gene locus_tag LOCUS_35250 134559 131245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 134641 134838 gene locus_tag LOCUS_35260 134641 134838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 134928 135137 gene locus_tag LOCUS_35270 134928 135137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 136796 135375 gene locus_tag LOCUS_35280 136796 135375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 137617 136793 gene locus_tag LOCUS_35290 137617 136793 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396365.1 protein_id gnl|my_center|LOCUS_35290 138548 137625 gene locus_tag LOCUS_35300 138548 137625 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180942201.1 protein_id gnl|my_center|LOCUS_35300 139921 138614 gene locus_tag LOCUS_35310 139921 138614 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396358.1 protein_id gnl|my_center|LOCUS_35310 140989 139955 gene locus_tag LOCUS_35320 140989 139955 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_35320 141891 141598 gene locus_tag LOCUS_35330 141891 141598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_35330 145139 141996 gene locus_tag LOCUS_35340 145139 141996 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284781.1 protein_id gnl|my_center|LOCUS_35340 145384 145139 gene locus_tag LOCUS_35350 145384 145139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 146637 145381 gene locus_tag LOCUS_35360 146637 145381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 147272 146643 gene locus_tag LOCUS_35370 gene lexA 147272 146643 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479703.1 protein_id gnl|my_center|LOCUS_35370 147362 147796 gene locus_tag LOCUS_35380 147362 147796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 147793 148128 gene locus_tag LOCUS_35390 147793 148128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 149070 148444 gene locus_tag LOCUS_35400 149070 148444 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480183.1 protein_id gnl|my_center|LOCUS_35400 149147 149965 gene locus_tag LOCUS_35410 gene qqlR 149147 149965 CDS product N-acyl homoserine lactonase QqlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886818.1 protein_id gnl|my_center|LOCUS_35410 150287 151297 gene locus_tag LOCUS_35420 150287 151297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 151725 151937 gene locus_tag LOCUS_35430 151725 151937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 152217 154007 gene locus_tag LOCUS_35440 152217 154007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 154273 154070 gene locus_tag LOCUS_35450 154273 154070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 154471 154773 gene locus_tag LOCUS_35460 154471 154773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 155755 155444 gene locus_tag LOCUS_35470 155755 155444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 155822 156268 gene locus_tag LOCUS_35480 155822 156268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 156341 157348 gene locus_tag LOCUS_35490 156341 157348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 157690 158229 gene locus_tag LOCUS_35500 157690 158229 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325826.1 protein_id gnl|my_center|LOCUS_35500 158226 159713 gene locus_tag LOCUS_35510 158226 159713 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029391.1 protein_id gnl|my_center|LOCUS_35510 160036 160341 gene locus_tag LOCUS_35520 160036 160341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 160875 161807 gene locus_tag LOCUS_35530 160875 161807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 161950 162186 gene locus_tag LOCUS_35540 161950 162186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 162613 162200 gene locus_tag LOCUS_35550 162613 162200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 162834 163811 gene locus_tag LOCUS_35560 162834 163811 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258874.1 protein_id gnl|my_center|LOCUS_35560 166432 164222 gene locus_tag LOCUS_35570 166432 164222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 167387 166671 gene locus_tag LOCUS_35580 167387 166671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 168888 167572 gene locus_tag LOCUS_35590 168888 167572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 169897 169160 gene locus_tag LOCUS_35600 169897 169160 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008948140.1 protein_id gnl|my_center|LOCUS_35600 170728 171276 gene locus_tag LOCUS_35610 170728 171276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 171248 171763 gene locus_tag LOCUS_35620 171248 171763 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092308.1 protein_id gnl|my_center|LOCUS_35620 172068 172280 gene locus_tag LOCUS_35630 172068 172280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 172391 172645 gene locus_tag LOCUS_35640 172391 172645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 173048 173848 gene locus_tag LOCUS_35650 173048 173848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 174338 173937 gene locus_tag LOCUS_35660 174338 173937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 175067 174900 gene locus_tag LOCUS_35670 175067 174900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 175322 176830 gene locus_tag LOCUS_35680 175322 176830 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183635.1 protein_id gnl|my_center|LOCUS_35680 177044 178225 gene locus_tag LOCUS_35690 177044 178225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 178649 178482 gene locus_tag LOCUS_35700 178649 178482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 178928 179491 gene locus_tag LOCUS_35710 178928 179491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 179737 180882 gene locus_tag LOCUS_35720 179737 180882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 182641 181025 gene locus_tag LOCUS_35730 182641 181025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 184930 182765 gene locus_tag LOCUS_35740 184930 182765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 185128 185358 gene locus_tag LOCUS_35750 185128 185358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 186356 186045 gene locus_tag LOCUS_35760 186356 186045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 >Feature sequence11 319 245 gene locus_tag LOCUS_t00510 319 245 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 400 328 gene locus_tag LOCUS_t00520 400 328 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 507 422 gene locus_tag LOCUS_t00530 507 422 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 592 517 gene locus_tag LOCUS_t00540 592 517 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 829 2769 gene locus_tag LOCUS_35770 829 2769 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618939.1 protein_id gnl|my_center|LOCUS_35770 2766 4631 gene locus_tag LOCUS_35780 2766 4631 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888683.1 protein_id gnl|my_center|LOCUS_35780 4767 5228 gene locus_tag LOCUS_35790 gene msrB 4767 5228 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888019.1 protein_id gnl|my_center|LOCUS_35790 5892 5365 gene locus_tag LOCUS_35800 5892 5365 CDS product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888187.1 protein_id gnl|my_center|LOCUS_35800 7960 5999 gene locus_tag LOCUS_35810 7960 5999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 7959 8102 gene locus_tag LOCUS_35820 7959 8102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 8204 8689 gene locus_tag LOCUS_35830 8204 8689 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887500.1 protein_id gnl|my_center|LOCUS_35830 8742 9332 gene locus_tag LOCUS_35840 8742 9332 CDS product ADP-ribosylation factor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887499.1 protein_id gnl|my_center|LOCUS_35840 10724 9405 gene locus_tag LOCUS_35850 gene mnmE 10724 9405 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887659.1 protein_id gnl|my_center|LOCUS_35850 11457 10798 gene locus_tag LOCUS_35860 11457 10798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 11713 12579 gene locus_tag LOCUS_35870 11713 12579 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350701.1 protein_id gnl|my_center|LOCUS_35870 12635 13156 gene locus_tag LOCUS_35880 12635 13156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 13814 13170 gene locus_tag LOCUS_35890 13814 13170 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887742.1 protein_id gnl|my_center|LOCUS_35890 13860 14663 gene locus_tag LOCUS_35900 13860 14663 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886856.1 protein_id gnl|my_center|LOCUS_35900 15189 16607 gene locus_tag LOCUS_35910 gene trmFO 15189 16607 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350703.1 protein_id gnl|my_center|LOCUS_35910 16645 16908 gene locus_tag LOCUS_35920 16645 16908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 16986 18299 gene locus_tag LOCUS_35930 gene murD 16986 18299 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889121.1 protein_id gnl|my_center|LOCUS_35930 18296 19408 gene locus_tag LOCUS_35940 18296 19408 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889122.1 protein_id gnl|my_center|LOCUS_35940 20924 19419 gene locus_tag LOCUS_35950 20924 19419 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203086395.1 protein_id gnl|my_center|LOCUS_35950 21647 20964 gene locus_tag LOCUS_35960 21647 20964 CDS product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775665.1 protein_id gnl|my_center|LOCUS_35960 22951 21854 gene locus_tag LOCUS_35970 gene ychF 22951 21854 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888025.1 protein_id gnl|my_center|LOCUS_35970 23262 24080 gene locus_tag LOCUS_35980 23262 24080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 24690 24433 gene locus_tag LOCUS_35990 24690 24433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 24832 25389 gene locus_tag LOCUS_36000 24832 25389 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948547.1 protein_id gnl|my_center|LOCUS_36000 26953 25397 gene locus_tag LOCUS_36010 26953 25397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 28560 26950 gene locus_tag LOCUS_36020 28560 26950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 30238 28706 gene locus_tag LOCUS_36030 gene guaA 30238 28706 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888509.1 protein_id gnl|my_center|LOCUS_36030 32214 30334 gene locus_tag LOCUS_36040 32214 30334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888508.1 protein_id gnl|my_center|LOCUS_36040 32318 33382 gene locus_tag LOCUS_36050 32318 33382 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887641.1 protein_id gnl|my_center|LOCUS_36050 33462 34151 gene locus_tag LOCUS_36060 33462 34151 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887642.1 protein_id gnl|my_center|LOCUS_36060 34171 34767 gene locus_tag LOCUS_36070 34171 34767 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349616.1 protein_id gnl|my_center|LOCUS_36070 34897 36681 gene locus_tag LOCUS_36080 34897 36681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 36678 37121 gene locus_tag LOCUS_36090 36678 37121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 37136 37543 gene locus_tag LOCUS_36100 37136 37543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 37540 38262 gene locus_tag LOCUS_36110 37540 38262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 39432 38320 gene locus_tag LOCUS_36120 39432 38320 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349615.1 protein_id gnl|my_center|LOCUS_36120 40055 39651 gene locus_tag LOCUS_36130 40055 39651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887645.1 protein_id gnl|my_center|LOCUS_36130 40899 40126 gene locus_tag LOCUS_36140 40899 40126 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887656.1 protein_id gnl|my_center|LOCUS_36140 41896 40952 gene locus_tag LOCUS_36150 41896 40952 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887655.1 protein_id gnl|my_center|LOCUS_36150 43472 42054 gene locus_tag LOCUS_36160 43472 42054 CDS product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479767.1 protein_id gnl|my_center|LOCUS_36160 44727 43474 gene locus_tag LOCUS_36170 44727 43474 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479768.1 protein_id gnl|my_center|LOCUS_36170 45716 44820 gene locus_tag LOCUS_36180 45716 44820 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479980.1 protein_id gnl|my_center|LOCUS_36180 46817 45960 gene locus_tag LOCUS_36190 46817 45960 CDS product 1,4-dihydroxy-6-naphthoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887654.1 protein_id gnl|my_center|LOCUS_36190 46929 47165 gene locus_tag LOCUS_36200 46929 47165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 47365 47901 gene locus_tag LOCUS_36210 47365 47901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 48816 47905 gene locus_tag LOCUS_36220 gene ribF 48816 47905 CDS product riboflavin biosynthesis protein RibF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887651.1 protein_id gnl|my_center|LOCUS_36220 49313 48813 gene locus_tag LOCUS_36230 49313 48813 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887650.1 protein_id gnl|my_center|LOCUS_36230 49939 49346 gene locus_tag LOCUS_36240 49939 49346 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081838.1 protein_id gnl|my_center|LOCUS_36240 50316 51491 gene locus_tag LOCUS_36250 50316 51491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 51623 53026 gene locus_tag LOCUS_36260 51623 53026 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402863.1 protein_id gnl|my_center|LOCUS_36260 53081 54058 gene locus_tag LOCUS_36270 53081 54058 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765598.1 protein_id gnl|my_center|LOCUS_36270 54647 55522 gene locus_tag LOCUS_36280 54647 55522 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918723.1 protein_id gnl|my_center|LOCUS_36280 55519 56403 gene locus_tag LOCUS_36290 55519 56403 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250978.1 protein_id gnl|my_center|LOCUS_36290 56451 57182 gene locus_tag LOCUS_36300 56451 57182 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964695.1 protein_id gnl|my_center|LOCUS_36300 57652 57179 gene locus_tag LOCUS_36310 57652 57179 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887882.1 protein_id gnl|my_center|LOCUS_36310 58509 57649 gene locus_tag LOCUS_36320 58509 57649 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887883.1 protein_id gnl|my_center|LOCUS_36320 59233 58595 gene locus_tag LOCUS_36330 59233 58595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 59467 59946 gene locus_tag LOCUS_36340 gene greA 59467 59946 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172708.1 protein_id gnl|my_center|LOCUS_36340 60125 61474 gene locus_tag LOCUS_36350 gene aspS 60125 61474 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887698.1 protein_id gnl|my_center|LOCUS_36350 62133 61534 gene locus_tag LOCUS_36360 62133 61534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 62708 62232 gene locus_tag LOCUS_36370 62708 62232 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889089.1 protein_id gnl|my_center|LOCUS_36370 63898 62816 gene locus_tag LOCUS_36380 63898 62816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 63960 65159 gene locus_tag LOCUS_36390 63960 65159 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886724.1 protein_id gnl|my_center|LOCUS_36390 65429 66790 gene locus_tag LOCUS_36400 65429 66790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 66874 67149 gene locus_tag LOCUS_36410 66874 67149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 67239 67622 gene locus_tag LOCUS_36420 67239 67622 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350540.1 protein_id gnl|my_center|LOCUS_36420 67631 68167 gene locus_tag LOCUS_36430 67631 68167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888310.1 protein_id gnl|my_center|LOCUS_36430 68364 68768 gene locus_tag LOCUS_36440 68364 68768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 68771 73657 gene locus_tag LOCUS_36450 68771 73657 CDS product DUF4132 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889426.1 protein_id gnl|my_center|LOCUS_36450 75112 73727 gene locus_tag LOCUS_36460 75112 73727 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967518.1 protein_id gnl|my_center|LOCUS_36460 77914 75242 gene locus_tag LOCUS_36470 gene alaS 77914 75242 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888928.1 protein_id gnl|my_center|LOCUS_36470 79329 78295 gene locus_tag LOCUS_36480 79329 78295 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889181.1 protein_id gnl|my_center|LOCUS_36480 79433 80932 gene locus_tag LOCUS_36490 79433 80932 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889165.1 protein_id gnl|my_center|LOCUS_36490 81524 80937 gene locus_tag LOCUS_36500 81524 80937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 84056 81576 gene locus_tag LOCUS_36510 gene leuS 84056 81576 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479923.1 protein_id gnl|my_center|LOCUS_36510 85501 84224 gene locus_tag LOCUS_36520 gene arsB 85501 84224 CDS product arsenite/antimonite:H(+) antiporter ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602564.1 protein_id gnl|my_center|LOCUS_36520 85625 86719 gene locus_tag LOCUS_36530 85625 86719 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918237.1 protein_id gnl|my_center|LOCUS_36530 87277 86750 gene locus_tag LOCUS_36540 gene hpt 87277 86750 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888017.1 protein_id gnl|my_center|LOCUS_36540 87295 88131 gene locus_tag LOCUS_36550 gene trpC 87295 88131 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888065.1 protein_id gnl|my_center|LOCUS_36550 88213 88923 gene locus_tag LOCUS_36560 88213 88923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 88976 90031 gene locus_tag LOCUS_36570 gene purM 88976 90031 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177712.1 protein_id gnl|my_center|LOCUS_36570 90028 90741 gene locus_tag LOCUS_36580 90028 90741 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888032.1 protein_id gnl|my_center|LOCUS_36580 90738 91682 gene locus_tag LOCUS_36590 gene meaB 90738 91682 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888382.1 protein_id gnl|my_center|LOCUS_36590 91679 92209 gene locus_tag LOCUS_36600 91679 92209 CDS product isoprenylcysteine carboxyl methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618916.1 protein_id gnl|my_center|LOCUS_36600 92649 92200 gene locus_tag LOCUS_36610 92649 92200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888379.1 protein_id gnl|my_center|LOCUS_36610 92797 93972 gene locus_tag LOCUS_36620 92797 93972 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166479973.1 protein_id gnl|my_center|LOCUS_36620 94024 94593 gene locus_tag LOCUS_36630 94024 94593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 95659 94607 gene locus_tag LOCUS_36640 95659 94607 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084237.1 protein_id gnl|my_center|LOCUS_36640 96569 95724 gene locus_tag LOCUS_36650 96569 95724 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967090.1 protein_id gnl|my_center|LOCUS_36650 96617 97894 gene locus_tag LOCUS_36660 gene glcF 96617 97894 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888365.1 protein_id gnl|my_center|LOCUS_36660 98010 99449 gene locus_tag LOCUS_36670 98010 99449 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888366.1 protein_id gnl|my_center|LOCUS_36670 99519 100178 gene locus_tag LOCUS_36680 99519 100178 CDS product DUF5639 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618917.1 protein_id gnl|my_center|LOCUS_36680 100938 100246 gene locus_tag LOCUS_36690 100938 100246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 101675 100935 gene locus_tag LOCUS_36700 101675 100935 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479631.1 protein_id gnl|my_center|LOCUS_36700 102903 101695 gene locus_tag LOCUS_36710 102903 101695 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887720.1 protein_id gnl|my_center|LOCUS_36710 104024 102900 gene locus_tag LOCUS_36720 104024 102900 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349606.1 protein_id gnl|my_center|LOCUS_36720 105166 104021 gene locus_tag LOCUS_36730 105166 104021 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479632.1 protein_id gnl|my_center|LOCUS_36730 105730 105302 gene locus_tag LOCUS_36740 gene fabZ 105730 105302 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479633.1 protein_id gnl|my_center|LOCUS_36740 106863 105823 gene locus_tag LOCUS_36750 106863 105823 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173840.1 protein_id gnl|my_center|LOCUS_36750 107212 106958 gene locus_tag LOCUS_36760 107212 106958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 107320 107577 gene locus_tag LOCUS_36770 107320 107577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 107600 108775 gene locus_tag LOCUS_36780 107600 108775 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887898.1 protein_id gnl|my_center|LOCUS_36780 108843 109859 gene locus_tag LOCUS_36790 108843 109859 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618837.1 protein_id gnl|my_center|LOCUS_36790 109931 110362 gene locus_tag LOCUS_36800 109931 110362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 110897 110364 gene locus_tag LOCUS_36810 110897 110364 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529609.1 protein_id gnl|my_center|LOCUS_36810 111805 110894 gene locus_tag LOCUS_36820 111805 110894 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887232.1 protein_id gnl|my_center|LOCUS_36820 113586 111895 gene locus_tag LOCUS_36830 gene ilvD 113586 111895 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258705.1 protein_id gnl|my_center|LOCUS_36830 113846 115081 gene locus_tag LOCUS_36840 113846 115081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 115972 115154 gene locus_tag LOCUS_36850 115972 115154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 117219 116110 gene locus_tag LOCUS_36860 117219 116110 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349607.1 protein_id gnl|my_center|LOCUS_36860 117291 118355 gene locus_tag LOCUS_36870 117291 118355 CDS product lipid II:glycine glycyltransferase FemX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479637.1 protein_id gnl|my_center|LOCUS_36870 118976 118365 gene locus_tag LOCUS_36880 118976 118365 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350278.1 protein_id gnl|my_center|LOCUS_36880 119842 119036 gene locus_tag LOCUS_36890 gene trmD 119842 119036 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888644.1 protein_id gnl|my_center|LOCUS_36890 120382 119843 gene locus_tag LOCUS_36900 gene rimM 120382 119843 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888643.1 protein_id gnl|my_center|LOCUS_36900 120627 120379 gene locus_tag LOCUS_36910 120627 120379 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479840.1 protein_id gnl|my_center|LOCUS_36910 120950 120705 gene locus_tag LOCUS_36920 gene rpsP 120950 120705 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887937.1 protein_id gnl|my_center|LOCUS_36920 122505 121099 gene locus_tag LOCUS_36930 122505 121099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 123365 122502 gene locus_tag LOCUS_36940 123365 122502 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479855.1 protein_id gnl|my_center|LOCUS_36940 124180 123362 gene locus_tag LOCUS_36950 gene ftsE 124180 123362 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173352.1 protein_id gnl|my_center|LOCUS_36950 124172 125536 gene locus_tag LOCUS_36960 124172 125536 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479857.1 protein_id gnl|my_center|LOCUS_36960 126606 125608 gene locus_tag LOCUS_36970 126606 125608 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888309.1 protein_id gnl|my_center|LOCUS_36970 127636 126650 gene locus_tag LOCUS_36980 127636 126650 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869575.1 protein_id gnl|my_center|LOCUS_36980 128304 127633 gene locus_tag LOCUS_36990 gene mnmD 128304 127633 CDS product tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479902.1 protein_id gnl|my_center|LOCUS_36990 128368 129387 gene locus_tag LOCUS_37000 gene tsaD 128368 129387 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479578.1 protein_id gnl|my_center|LOCUS_37000 131442 129730 gene locus_tag LOCUS_37010 131442 129730 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888327.1 protein_id gnl|my_center|LOCUS_37010 131647 132135 gene locus_tag LOCUS_37020 131647 132135 CDS product DUF1999 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887837.1 protein_id gnl|my_center|LOCUS_37020 132185 132400 gene locus_tag LOCUS_37030 132185 132400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888118.1 protein_id gnl|my_center|LOCUS_37030 132403 132735 gene locus_tag LOCUS_37040 132403 132735 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888117.1 protein_id gnl|my_center|LOCUS_37040 133582 132797 gene locus_tag LOCUS_37050 gene lepB 133582 132797 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350452.1 protein_id gnl|my_center|LOCUS_37050 133699 134451 gene locus_tag LOCUS_37060 133699 134451 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888486.1 protein_id gnl|my_center|LOCUS_37060 136065 134458 gene locus_tag LOCUS_37070 136065 134458 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480032.1 protein_id gnl|my_center|LOCUS_37070 137273 136149 gene locus_tag LOCUS_37080 137273 136149 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888127.1 protein_id gnl|my_center|LOCUS_37080 139802 137589 gene locus_tag LOCUS_37090 139802 137589 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887233.1 protein_id gnl|my_center|LOCUS_37090 140247 139930 gene locus_tag LOCUS_37100 gene clpS 140247 139930 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479522.1 protein_id gnl|my_center|LOCUS_37100 140789 140298 gene locus_tag LOCUS_37110 140789 140298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 141707 140877 gene locus_tag LOCUS_37120 141707 140877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37120 141872 142900 gene locus_tag LOCUS_37130 141872 142900 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888220.1 protein_id gnl|my_center|LOCUS_37130 142897 143712 gene locus_tag LOCUS_37140 142897 143712 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888221.1 protein_id gnl|my_center|LOCUS_37140 143709 144497 gene locus_tag LOCUS_37150 143709 144497 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888222.1 protein_id gnl|my_center|LOCUS_37150 144499 145047 gene locus_tag LOCUS_37160 144499 145047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 145125 146210 gene locus_tag LOCUS_37170 145125 146210 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888821.1 protein_id gnl|my_center|LOCUS_37170 146924 146235 gene locus_tag LOCUS_37180 146924 146235 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888822.1 protein_id gnl|my_center|LOCUS_37180 147001 147699 gene locus_tag LOCUS_37190 147001 147699 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228681.1 protein_id gnl|my_center|LOCUS_37190 147726 148478 gene locus_tag LOCUS_37200 147726 148478 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888247.1 protein_id gnl|my_center|LOCUS_37200 148483 149271 gene locus_tag LOCUS_37210 148483 149271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 150417 149281 gene locus_tag LOCUS_37220 150417 149281 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480016.1 protein_id gnl|my_center|LOCUS_37220 151416 150514 gene locus_tag LOCUS_37230 gene holA 151416 150514 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887887.1 protein_id gnl|my_center|LOCUS_37230 152234 151407 gene locus_tag LOCUS_37240 152234 151407 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887886.1 protein_id gnl|my_center|LOCUS_37240 152925 152353 gene locus_tag LOCUS_37250 152925 152353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887885.1 protein_id gnl|my_center|LOCUS_37250 154769 152967 gene locus_tag LOCUS_37260 154769 152967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480240.1 protein_id gnl|my_center|LOCUS_37260 155005 157101 gene locus_tag LOCUS_37270 155005 157101 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886706.1 protein_id gnl|my_center|LOCUS_37270 157112 157366 gene locus_tag LOCUS_37280 157112 157366 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886705.1 protein_id gnl|my_center|LOCUS_37280 157443 158399 gene locus_tag LOCUS_37290 gene ftsY 157443 158399 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888888.1 protein_id gnl|my_center|LOCUS_37290 159971 158415 gene locus_tag LOCUS_37300 gene bshC 159971 158415 CDS product bacillithiol biosynthesis cysteine-adding enzyme BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479890.1 protein_id gnl|my_center|LOCUS_37300 160786 160055 gene locus_tag LOCUS_37310 160786 160055 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479889.1 protein_id gnl|my_center|LOCUS_37310 160802 161551 gene locus_tag LOCUS_37320 160802 161551 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888282.1 protein_id gnl|my_center|LOCUS_37320 162847 161555 gene locus_tag LOCUS_37330 162847 161555 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889381.1 protein_id gnl|my_center|LOCUS_37330 163363 162893 gene locus_tag LOCUS_37340 163363 162893 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888279.1 protein_id gnl|my_center|LOCUS_37340 163869 163357 gene locus_tag LOCUS_37350 163869 163357 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888278.1 protein_id gnl|my_center|LOCUS_37350 163908 164258 gene locus_tag LOCUS_37360 163908 164258 CDS product DUF4180 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350809.1 protein_id gnl|my_center|LOCUS_37360 165843 164266 gene locus_tag LOCUS_37370 165843 164266 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889290.1 protein_id gnl|my_center|LOCUS_37370 166065 166283 gene locus_tag LOCUS_37380 166065 166283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 167175 166285 gene locus_tag LOCUS_37390 gene nanK 167175 166285 CDS product N-acetylmannosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153624.1 protein_id gnl|my_center|LOCUS_37390 168680 167172 gene locus_tag LOCUS_37400 168680 167172 CDS product DUF4127 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256992.1 protein_id gnl|my_center|LOCUS_37400 168896 168753 gene locus_tag LOCUS_37410 168896 168753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 170244 168904 gene locus_tag LOCUS_37420 170244 168904 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028328044.1 protein_id gnl|my_center|LOCUS_37420 171898 170531 gene locus_tag LOCUS_37430 171898 170531 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227779.1 protein_id gnl|my_center|LOCUS_37430 172215 171901 gene locus_tag LOCUS_37440 172215 171901 CDS product proton-translocating transhydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227778.1 protein_id gnl|my_center|LOCUS_37440 173370 172243 gene locus_tag LOCUS_37450 173370 172243 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174136.1 protein_id gnl|my_center|LOCUS_37450 174401 173466 gene locus_tag LOCUS_37460 gene truB 174401 173466 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887965.1 protein_id gnl|my_center|LOCUS_37460 174478 174849 gene locus_tag LOCUS_37470 174478 174849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887540.1 protein_id gnl|my_center|LOCUS_37470 174846 175604 gene locus_tag LOCUS_37480 174846 175604 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887541.1 protein_id gnl|my_center|LOCUS_37480 176443 176078 gene locus_tag LOCUS_37490 176443 176078 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888499.1 protein_id gnl|my_center|LOCUS_37490 176824 177252 gene locus_tag LOCUS_37500 gene mraZ 176824 177252 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888500.1 protein_id gnl|my_center|LOCUS_37500 177255 178148 gene locus_tag LOCUS_37510 gene rsmH 177255 178148 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888501.1 protein_id gnl|my_center|LOCUS_37510 178145 178534 gene locus_tag LOCUS_37520 178145 178534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888502.1 protein_id gnl|my_center|LOCUS_37520 178558 179874 gene locus_tag LOCUS_37530 178558 179874 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888503.1 protein_id gnl|my_center|LOCUS_37530 180388 180948 gene locus_tag LOCUS_37540 180388 180948 CDS product 3D domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887133.1 protein_id gnl|my_center|LOCUS_37540 181053 182240 gene locus_tag LOCUS_37550 181053 182240 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887132.1 protein_id gnl|my_center|LOCUS_37550 >Feature sequence12 185 916 gene locus_tag LOCUS_37560 185 916 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480270.1 protein_id gnl|my_center|LOCUS_37560 3078 1021 gene locus_tag LOCUS_37570 3078 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 3685 3230 gene locus_tag LOCUS_37580 3685 3230 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886757.1 protein_id gnl|my_center|LOCUS_37580 4762 3749 gene locus_tag LOCUS_37590 4762 3749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 5087 4851 gene locus_tag LOCUS_37600 5087 4851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350508.1 protein_id gnl|my_center|LOCUS_37600 7184 5091 gene locus_tag LOCUS_37610 gene paaZ 7184 5091 CDS product phenylacetic acid degradation bifunctional protein PaaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889007.1 protein_id gnl|my_center|LOCUS_37610 7580 7227 gene locus_tag LOCUS_37620 7580 7227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37620 8097 7600 gene locus_tag LOCUS_37630 gene paaJ 8097 7600 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618854.1 protein_id gnl|my_center|LOCUS_37630 8876 8097 gene locus_tag LOCUS_37640 gene paaC 8876 8097 CDS product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889010.1 protein_id gnl|my_center|LOCUS_37640 9511 8873 gene locus_tag LOCUS_37650 9511 8873 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618855.1 protein_id gnl|my_center|LOCUS_37650 10518 9556 gene locus_tag LOCUS_37660 gene paaG 10518 9556 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889012.1 protein_id gnl|my_center|LOCUS_37660 10668 12236 gene locus_tag LOCUS_37670 10668 12236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479598.1 protein_id gnl|my_center|LOCUS_37670 12260 12643 gene locus_tag LOCUS_37680 12260 12643 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480246.1 protein_id gnl|my_center|LOCUS_37680 13762 12779 gene locus_tag LOCUS_37690 13762 12779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37690 13875 14927 gene locus_tag LOCUS_37700 13875 14927 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618875.1 protein_id gnl|my_center|LOCUS_37700 15024 15698 gene locus_tag LOCUS_37710 gene lexA 15024 15698 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479703.1 protein_id gnl|my_center|LOCUS_37710 15709 16914 gene locus_tag LOCUS_37720 15709 16914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 16923 17168 gene locus_tag LOCUS_37730 16923 17168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 17189 20314 gene locus_tag LOCUS_37740 17189 20314 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284781.1 protein_id gnl|my_center|LOCUS_37740 20356 21501 gene locus_tag LOCUS_37750 gene cax 20356 21501 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887018.1 protein_id gnl|my_center|LOCUS_37750 22270 21491 gene locus_tag LOCUS_37760 22270 21491 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886894.1 protein_id gnl|my_center|LOCUS_37760 22250 22633 gene locus_tag LOCUS_37770 22250 22633 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886893.1 protein_id gnl|my_center|LOCUS_37770 23018 23827 gene locus_tag LOCUS_37780 23018 23827 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480161.1 protein_id gnl|my_center|LOCUS_37780 23903 24388 gene locus_tag LOCUS_37790 23903 24388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 24787 24392 gene locus_tag LOCUS_37800 24787 24392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886885.1 protein_id gnl|my_center|LOCUS_37800 26097 24865 gene locus_tag LOCUS_37810 26097 24865 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480162.1 protein_id gnl|my_center|LOCUS_37810 26195 26890 gene locus_tag LOCUS_37820 26195 26890 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258299.1 protein_id gnl|my_center|LOCUS_37820 26887 28329 gene locus_tag LOCUS_37830 26887 28329 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029388.1 protein_id gnl|my_center|LOCUS_37830 28585 29319 gene locus_tag LOCUS_37840 28585 29319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 29919 29389 gene locus_tag LOCUS_37850 29919 29389 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887328.1 protein_id gnl|my_center|LOCUS_37850 30403 29945 gene locus_tag LOCUS_37860 30403 29945 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479494.1 protein_id gnl|my_center|LOCUS_37860 31009 30518 gene locus_tag LOCUS_37870 31009 30518 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887326.1 protein_id gnl|my_center|LOCUS_37870 32457 31057 gene locus_tag LOCUS_37880 gene argH 32457 31057 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479496.1 protein_id gnl|my_center|LOCUS_37880 32927 32454 gene locus_tag LOCUS_37890 32927 32454 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618762.1 protein_id gnl|my_center|LOCUS_37890 33472 32954 gene locus_tag LOCUS_37900 33472 32954 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887321.1 protein_id gnl|my_center|LOCUS_37900 33873 33433 gene locus_tag LOCUS_37910 33873 33433 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108259.1 protein_id gnl|my_center|LOCUS_37910 35143 33875 gene locus_tag LOCUS_37920 35143 33875 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887319.1 protein_id gnl|my_center|LOCUS_37920 35970 35428 gene locus_tag LOCUS_37930 35970 35428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 37107 35971 gene locus_tag LOCUS_37940 37107 35971 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479498.1 protein_id gnl|my_center|LOCUS_37940 37253 37561 gene locus_tag LOCUS_37950 37253 37561 CDS product EthD family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083228.1 protein_id gnl|my_center|LOCUS_37950 38619 37588 gene locus_tag LOCUS_37960 38619 37588 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618818.1 protein_id gnl|my_center|LOCUS_37960 39899 38658 gene locus_tag LOCUS_37970 39899 38658 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259659.1 protein_id gnl|my_center|LOCUS_37970 40224 43295 gene locus_tag LOCUS_37980 gene carB 40224 43295 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887313.1 protein_id gnl|my_center|LOCUS_37980 43872 43306 gene locus_tag LOCUS_37990 43872 43306 CDS product SLATT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039060.1 protein_id gnl|my_center|LOCUS_37990 44725 43850 gene locus_tag LOCUS_38000 44725 43850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 44931 45143 gene locus_tag LOCUS_38010 44931 45143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 45225 46115 gene locus_tag LOCUS_38020 45225 46115 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142351.1 protein_id gnl|my_center|LOCUS_38020 46224 46739 gene locus_tag LOCUS_38030 46224 46739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 47987 46761 gene locus_tag LOCUS_38040 47987 46761 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480367.1 protein_id gnl|my_center|LOCUS_38040 48071 49645 gene locus_tag LOCUS_38050 48071 49645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886982.1 protein_id gnl|my_center|LOCUS_38050 50419 49649 gene locus_tag LOCUS_38060 50419 49649 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122379.1 protein_id gnl|my_center|LOCUS_38060 51353 50472 gene locus_tag LOCUS_38070 51353 50472 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122378.1 protein_id gnl|my_center|LOCUS_38070 51517 53097 gene locus_tag LOCUS_38080 51517 53097 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536336.1 protein_id gnl|my_center|LOCUS_38080 53191 54198 gene locus_tag LOCUS_38090 53191 54198 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810095.1 protein_id gnl|my_center|LOCUS_38090 54195 55061 gene locus_tag LOCUS_38100 54195 55061 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583225.1 protein_id gnl|my_center|LOCUS_38100 55861 55178 gene locus_tag LOCUS_38110 55861 55178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530791.1 protein_id gnl|my_center|LOCUS_38110 55928 56848 gene locus_tag LOCUS_38120 55928 56848 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082266.1 protein_id gnl|my_center|LOCUS_38120 56910 57269 gene locus_tag LOCUS_38130 56910 57269 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385272.1 protein_id gnl|my_center|LOCUS_38130 59147 57303 gene locus_tag LOCUS_38140 59147 57303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 60567 60163 gene locus_tag LOCUS_38150 60567 60163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 60683 61036 gene locus_tag LOCUS_38160 60683 61036 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223051.1 protein_id gnl|my_center|LOCUS_38160 61033 61938 gene locus_tag LOCUS_38170 61033 61938 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023142.1 protein_id gnl|my_center|LOCUS_38170 61935 62330 gene locus_tag LOCUS_38180 61935 62330 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730888.1 protein_id gnl|my_center|LOCUS_38180 62614 63486 gene locus_tag LOCUS_38190 62614 63486 CDS product metalloenzyme domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480300.1 protein_id gnl|my_center|LOCUS_38190 64294 63668 gene locus_tag LOCUS_38200 64294 63668 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886771.1 protein_id gnl|my_center|LOCUS_38200 64530 64291 gene locus_tag LOCUS_38210 64530 64291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886772.1 protein_id gnl|my_center|LOCUS_38210 65004 64600 gene locus_tag LOCUS_38220 65004 64600 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971206.1 protein_id gnl|my_center|LOCUS_38220 65109 66383 gene locus_tag LOCUS_38230 65109 66383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 67128 66394 gene locus_tag LOCUS_38240 67128 66394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 67802 67125 gene locus_tag LOCUS_38250 67802 67125 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889164.1 protein_id gnl|my_center|LOCUS_38250 67838 68917 gene locus_tag LOCUS_38260 67838 68917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480131.1 protein_id gnl|my_center|LOCUS_38260 68970 69518 gene locus_tag LOCUS_38270 gene sigM 68970 69518 CDS product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029295.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38270 69515 69784 gene locus_tag LOCUS_38280 69515 69784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38280 69781 70560 gene locus_tag LOCUS_38290 69781 70560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38290 70557 71822 gene locus_tag LOCUS_38300 70557 71822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 71937 73109 gene locus_tag LOCUS_38310 71937 73109 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225440.1 protein_id gnl|my_center|LOCUS_38310 73097 73576 gene locus_tag LOCUS_38320 73097 73576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 74656 73604 gene locus_tag LOCUS_38330 74656 73604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38330 75637 74699 gene locus_tag LOCUS_38340 75637 74699 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888882.1 protein_id gnl|my_center|LOCUS_38340 75974 76414 gene locus_tag LOCUS_38350 75974 76414 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222929.1 protein_id gnl|my_center|LOCUS_38350 76457 78430 gene locus_tag LOCUS_38360 gene tkt 76457 78430 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888884.1 protein_id gnl|my_center|LOCUS_38360 78560 78484 gene locus_tag LOCUS_t00550 78560 78484 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 78719 79444 gene locus_tag LOCUS_38370 78719 79444 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480078.1 protein_id gnl|my_center|LOCUS_38370 79441 81036 gene locus_tag LOCUS_38380 79441 81036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888974.1 protein_id gnl|my_center|LOCUS_38380 81033 83006 gene locus_tag LOCUS_38390 81033 83006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 83063 83506 gene locus_tag LOCUS_38400 gene tsaE 83063 83506 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888977.1 protein_id gnl|my_center|LOCUS_38400 83534 84715 gene locus_tag LOCUS_38410 83534 84715 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889226.1 protein_id gnl|my_center|LOCUS_38410 84738 86876 gene locus_tag LOCUS_38420 gene pta 84738 86876 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480235.1 protein_id gnl|my_center|LOCUS_38420 88257 86851 gene locus_tag LOCUS_38430 88257 86851 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888818.1 protein_id gnl|my_center|LOCUS_38430 89478 88366 gene locus_tag LOCUS_38440 89478 88366 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480328.1 protein_id gnl|my_center|LOCUS_38440 90538 89489 gene locus_tag LOCUS_38450 90538 89489 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025567746.1 protein_id gnl|my_center|LOCUS_38450 91310 90615 gene locus_tag LOCUS_38460 91310 90615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 92064 92384 gene locus_tag LOCUS_38470 92064 92384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 92843 92376 gene locus_tag LOCUS_38480 92843 92376 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530569.1 protein_id gnl|my_center|LOCUS_38480 93190 92840 gene locus_tag LOCUS_38490 93190 92840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889028.1 protein_id gnl|my_center|LOCUS_38490 93283 93981 gene locus_tag LOCUS_38500 93283 93981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 95432 94038 gene locus_tag LOCUS_38510 gene fumC 95432 94038 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889251.1 protein_id gnl|my_center|LOCUS_38510 95522 96424 gene locus_tag LOCUS_38520 95522 96424 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223929.1 protein_id gnl|my_center|LOCUS_38520 96486 97721 gene locus_tag LOCUS_38530 96486 97721 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816831.1 protein_id gnl|my_center|LOCUS_38530 97828 98712 gene locus_tag LOCUS_38540 97828 98712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 98728 99774 gene locus_tag LOCUS_38550 98728 99774 CDS product YpdA family putative bacillithiol disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889247.1 protein_id gnl|my_center|LOCUS_38550 99826 101223 gene locus_tag LOCUS_38560 99826 101223 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886657.1 protein_id gnl|my_center|LOCUS_38560 102126 101290 gene locus_tag LOCUS_38570 gene parB 102126 101290 CDS product ParB/RepB/Spo0J family partition protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886660.1 protein_id gnl|my_center|LOCUS_38570 102859 102110 gene locus_tag LOCUS_38580 102859 102110 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480253.1 protein_id gnl|my_center|LOCUS_38580 103607 102870 gene locus_tag LOCUS_38590 gene rsmG 103607 102870 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886662.1 protein_id gnl|my_center|LOCUS_38590 103924 103604 gene locus_tag LOCUS_38600 103924 103604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480251.1 protein_id gnl|my_center|LOCUS_38600 105803 103998 gene locus_tag LOCUS_38610 gene mnmG 105803 103998 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886675.1 protein_id gnl|my_center|LOCUS_38610 106028 107137 gene locus_tag LOCUS_38620 106028 107137 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480247.1 protein_id gnl|my_center|LOCUS_38620 107134 108153 gene locus_tag LOCUS_38630 107134 108153 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886678.1 protein_id gnl|my_center|LOCUS_38630 108201 108434 gene locus_tag LOCUS_38640 108201 108434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886679.1 protein_id gnl|my_center|LOCUS_38640 108446 110014 gene locus_tag LOCUS_38650 108446 110014 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886680.1 protein_id gnl|my_center|LOCUS_38650 110180 110629 gene locus_tag LOCUS_38660 110180 110629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 110670 111329 gene locus_tag LOCUS_38670 110670 111329 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480061.1 protein_id gnl|my_center|LOCUS_38670 111364 112764 gene locus_tag LOCUS_38680 111364 112764 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889042.1 protein_id gnl|my_center|LOCUS_38680 112786 113877 gene locus_tag LOCUS_38690 gene dprA 112786 113877 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886768.1 protein_id gnl|my_center|LOCUS_38690 114205 113885 gene locus_tag LOCUS_38700 114205 113885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 114198 115163 gene locus_tag LOCUS_38710 114198 115163 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697701.1 protein_id gnl|my_center|LOCUS_38710 115257 116648 gene locus_tag LOCUS_38720 gene dnaA 115257 116648 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480258.1 protein_id gnl|my_center|LOCUS_38720 117010 118092 gene locus_tag LOCUS_38730 gene dnaN 117010 118092 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480259.1 protein_id gnl|my_center|LOCUS_38730 118395 119666 gene locus_tag LOCUS_38740 gene eno 118395 119666 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889260.1 protein_id gnl|my_center|LOCUS_38740 119773 121221 gene locus_tag LOCUS_38750 gene pyk 119773 121221 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889259.1 protein_id gnl|my_center|LOCUS_38750 122774 121506 gene locus_tag LOCUS_38760 gene tyrS 122774 121506 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480260.1 protein_id gnl|my_center|LOCUS_38760 123805 122951 gene locus_tag LOCUS_38770 123805 122951 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618902.1 protein_id gnl|my_center|LOCUS_38770 124158 123823 gene locus_tag LOCUS_38780 124158 123823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 125516 124155 gene locus_tag LOCUS_38790 125516 124155 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259685.1 protein_id gnl|my_center|LOCUS_38790 126205 125516 gene locus_tag LOCUS_38800 126205 125516 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485328.1 protein_id gnl|my_center|LOCUS_38800 126286 127131 gene locus_tag LOCUS_38810 126286 127131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 127149 127706 gene locus_tag LOCUS_38820 127149 127706 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350905.1 protein_id gnl|my_center|LOCUS_38820 127801 128373 gene locus_tag LOCUS_38830 127801 128373 CDS product YqhA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886920.1 protein_id gnl|my_center|LOCUS_38830 128360 129061 gene locus_tag LOCUS_38840 128360 129061 CDS product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886921.1 protein_id gnl|my_center|LOCUS_38840 131258 129561 gene locus_tag LOCUS_38850 gene rny 131258 129561 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889087.1 protein_id gnl|my_center|LOCUS_38850 132216 131482 gene locus_tag LOCUS_38860 132216 131482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 132813 132373 gene locus_tag LOCUS_38870 gene rplI 132813 132373 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886750.1 protein_id gnl|my_center|LOCUS_38870 133100 132825 gene locus_tag LOCUS_38880 gene rpsR 133100 132825 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886749.1 protein_id gnl|my_center|LOCUS_38880 134125 133223 gene locus_tag LOCUS_38890 134125 133223 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480308.1 protein_id gnl|my_center|LOCUS_38890 134568 134260 gene locus_tag LOCUS_38900 gene rpsF 134568 134260 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886746.1 protein_id gnl|my_center|LOCUS_38900 134708 135202 gene locus_tag LOCUS_38910 134708 135202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888930.1 protein_id gnl|my_center|LOCUS_38910 136201 135209 gene locus_tag LOCUS_38920 136201 135209 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026138770.1 protein_id gnl|my_center|LOCUS_38920 137502 136360 gene locus_tag LOCUS_38930 gene prfB 137502 136360 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149357985.1 protein_id gnl|my_center|LOCUS_38930 >Feature sequence13 486 1274 gene locus_tag LOCUS_38940 gene istB 486 1274 CDS product IS21-like element IS21 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544830.1 protein_id gnl|my_center|LOCUS_38940 1633 1331 gene locus_tag LOCUS_38950 1633 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 2739 1630 gene locus_tag LOCUS_38960 2739 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 4149 2851 gene locus_tag LOCUS_38970 4149 2851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 6128 4875 gene locus_tag LOCUS_38980 6128 4875 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228367.1 protein_id gnl|my_center|LOCUS_38980 6817 6125 gene locus_tag LOCUS_38990 6817 6125 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118816.1 protein_id gnl|my_center|LOCUS_38990 6981 7298 gene locus_tag LOCUS_39000 6981 7298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39000 7507 7845 gene locus_tag LOCUS_39010 7507 7845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 7884 8255 gene locus_tag LOCUS_39020 7884 8255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 8475 9194 gene locus_tag LOCUS_39030 8475 9194 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962918.1 protein_id gnl|my_center|LOCUS_39030 9609 9818 gene locus_tag LOCUS_39040 9609 9818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 10619 9924 gene locus_tag LOCUS_39050 10619 9924 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036955.1 protein_id gnl|my_center|LOCUS_39050 10630 11934 gene locus_tag LOCUS_39060 10630 11934 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618799.1 protein_id gnl|my_center|LOCUS_39060 12025 12387 gene locus_tag LOCUS_39070 12025 12387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 12392 13051 gene locus_tag LOCUS_39080 12392 13051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 14444 13095 gene locus_tag LOCUS_39090 14444 13095 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392987.1 protein_id gnl|my_center|LOCUS_39090 15127 14441 gene locus_tag LOCUS_39100 15127 14441 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479875.1 protein_id gnl|my_center|LOCUS_39100 15631 15251 gene locus_tag LOCUS_39110 15631 15251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39110 15777 16619 gene locus_tag LOCUS_39120 15777 16619 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030868.1 protein_id gnl|my_center|LOCUS_39120 19315 16670 gene locus_tag LOCUS_39130 19315 16670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 20034 19312 gene locus_tag LOCUS_39140 20034 19312 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030863.1 protein_id gnl|my_center|LOCUS_39140 20692 20027 gene locus_tag LOCUS_39150 20692 20027 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061915636.1 protein_id gnl|my_center|LOCUS_39150 21264 20698 gene locus_tag LOCUS_39160 21264 20698 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030865.1 protein_id gnl|my_center|LOCUS_39160 22067 21399 gene locus_tag LOCUS_39170 22067 21399 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887810.1 protein_id gnl|my_center|LOCUS_39170 22899 22093 gene locus_tag LOCUS_39180 22899 22093 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030868.1 protein_id gnl|my_center|LOCUS_39180 23077 23832 gene locus_tag LOCUS_39190 23077 23832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 23829 24023 gene locus_tag LOCUS_39200 23829 24023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 24093 24503 gene locus_tag LOCUS_39210 24093 24503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 24618 25442 gene locus_tag LOCUS_39220 24618 25442 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185904.1 protein_id gnl|my_center|LOCUS_39220 26426 25479 gene locus_tag LOCUS_39230 26426 25479 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888570.1 protein_id gnl|my_center|LOCUS_39230 27443 26502 gene locus_tag LOCUS_39240 27443 26502 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889322.1 protein_id gnl|my_center|LOCUS_39240 28108 27440 gene locus_tag LOCUS_39250 28108 27440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225444.1 protein_id gnl|my_center|LOCUS_39250 29400 28105 gene locus_tag LOCUS_39260 29400 28105 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228622.1 protein_id gnl|my_center|LOCUS_39260 30068 29397 gene locus_tag LOCUS_39270 30068 29397 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479875.1 protein_id gnl|my_center|LOCUS_39270 30730 30068 gene locus_tag LOCUS_39280 30730 30068 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036955.1 protein_id gnl|my_center|LOCUS_39280 32364 31006 gene locus_tag LOCUS_39290 32364 31006 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888503.1 protein_id gnl|my_center|LOCUS_39290 32590 34014 gene locus_tag LOCUS_39300 gene lnt 32590 34014 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024119347.1 protein_id gnl|my_center|LOCUS_39300 35290 34166 gene locus_tag LOCUS_39310 35290 34166 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228866.1 protein_id gnl|my_center|LOCUS_39310 35957 35292 gene locus_tag LOCUS_39320 35957 35292 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173744.1 protein_id gnl|my_center|LOCUS_39320 36942 36019 gene locus_tag LOCUS_39330 36942 36019 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350359.1 protein_id gnl|my_center|LOCUS_39330 37219 37782 gene locus_tag LOCUS_39340 37219 37782 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889076.1 protein_id gnl|my_center|LOCUS_39340 37903 38664 gene locus_tag LOCUS_39350 37903 38664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 39669 39280 gene locus_tag LOCUS_39360 39669 39280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_39360 40399 39680 gene locus_tag LOCUS_39370 40399 39680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_39370 40966 40556 gene locus_tag LOCUS_39380 40966 40556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 43595 41091 gene locus_tag LOCUS_39390 43595 41091 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889078.1 protein_id gnl|my_center|LOCUS_39390 43746 43949 gene locus_tag LOCUS_39400 43746 43949 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889077.1 protein_id gnl|my_center|LOCUS_39400 43951 44259 gene locus_tag LOCUS_39410 43951 44259 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889074.1 protein_id gnl|my_center|LOCUS_39410 44956 44363 gene locus_tag LOCUS_39420 44956 44363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 45375 44953 gene locus_tag LOCUS_39430 45375 44953 CDS product four-helix bundle copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975554.1 protein_id gnl|my_center|LOCUS_39430 45609 46880 gene locus_tag LOCUS_39440 45609 46880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 47114 48100 gene locus_tag LOCUS_39450 47114 48100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39450 48097 49314 gene locus_tag LOCUS_39460 48097 49314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 49301 51376 gene locus_tag LOCUS_39470 49301 51376 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027257.1 protein_id gnl|my_center|LOCUS_39470 51379 51843 gene locus_tag LOCUS_39480 51379 51843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 53799 52663 gene locus_tag LOCUS_39490 53799 52663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39490 54310 54456 gene locus_tag LOCUS_39500 54310 54456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39500 54474 54734 gene locus_tag LOCUS_39510 54474 54734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39510 55144 55389 gene locus_tag LOCUS_39520 55144 55389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39520 56031 55657 gene locus_tag LOCUS_39530 56031 55657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 55927 56583 gene locus_tag LOCUS_39540 55927 56583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39540 57574 56744 gene locus_tag LOCUS_39550 57574 56744 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927928.1 protein_id gnl|my_center|LOCUS_39550 58460 57594 gene locus_tag LOCUS_39560 58460 57594 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228870.1 protein_id gnl|my_center|LOCUS_39560 58961 61432 gene locus_tag LOCUS_39570 58961 61432 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714164.1 protein_id gnl|my_center|LOCUS_39570 61563 61862 gene locus_tag LOCUS_39580 61563 61862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39580 63420 62302 gene locus_tag LOCUS_39590 63420 62302 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888026.1 protein_id gnl|my_center|LOCUS_39590 63748 63473 gene locus_tag LOCUS_39600 63748 63473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 64083 63835 gene locus_tag LOCUS_39610 64083 63835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 65468 64107 gene locus_tag LOCUS_39620 65468 64107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39620 65547 65921 gene locus_tag LOCUS_39630 gene kmtR 65547 65921 CDS product Ni(II)/Co(II)-sensing metalloregulatory transcriptional repressor KmtR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404335.1 protein_id gnl|my_center|LOCUS_39630 65918 67150 gene locus_tag LOCUS_39640 65918 67150 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967861.1 protein_id gnl|my_center|LOCUS_39640 67438 67836 gene locus_tag LOCUS_39650 67438 67836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39650 68100 68297 gene locus_tag LOCUS_39660 68100 68297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660 68413 68916 gene locus_tag LOCUS_39670 68413 68916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39670 72555 69556 gene locus_tag LOCUS_39680 72555 69556 CDS product Tn3-like element Tn3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143760.1 protein_id gnl|my_center|LOCUS_39680 72935 72555 gene locus_tag LOCUS_39690 72935 72555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39690 72930 73142 gene locus_tag LOCUS_39700 72930 73142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39700 73314 73634 gene locus_tag LOCUS_39710 73314 73634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39710 74859 73573 gene locus_tag LOCUS_39720 74859 73573 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727468.1 protein_id gnl|my_center|LOCUS_39720 75371 74805 gene locus_tag LOCUS_39730 75371 74805 CDS product DUF6428 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398911.1 protein_id gnl|my_center|LOCUS_39730 75735 75382 gene locus_tag LOCUS_39740 75735 75382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 75860 76666 gene locus_tag LOCUS_39750 75860 76666 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927097.1 protein_id gnl|my_center|LOCUS_39750 77435 76716 gene locus_tag LOCUS_39760 77435 76716 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889384.1 protein_id gnl|my_center|LOCUS_39760 77881 77432 gene locus_tag LOCUS_39770 77881 77432 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582904.1 protein_id gnl|my_center|LOCUS_39770 78564 77881 gene locus_tag LOCUS_39780 78564 77881 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023173416.1 protein_id gnl|my_center|LOCUS_39780 79026 78565 gene locus_tag LOCUS_39790 79026 78565 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479743.1 protein_id gnl|my_center|LOCUS_39790 79776 79366 gene locus_tag LOCUS_39800 79776 79366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 80553 79897 gene locus_tag LOCUS_39810 80553 79897 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479802.1 protein_id gnl|my_center|LOCUS_39810 81437 80550 gene locus_tag LOCUS_39820 81437 80550 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887745.1 protein_id gnl|my_center|LOCUS_39820 82035 81430 gene locus_tag LOCUS_39830 82035 81430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39830 82526 82032 gene locus_tag LOCUS_39840 82526 82032 CDS product DUF3105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029732672.1 protein_id gnl|my_center|LOCUS_39840 83035 82523 gene locus_tag LOCUS_39850 gene lspA 83035 82523 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295859.1 protein_id gnl|my_center|LOCUS_39850 83739 83143 gene locus_tag LOCUS_39860 83739 83143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39860 84203 83958 gene locus_tag LOCUS_39870 84203 83958 CDS product DUF2171 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887989.1 protein_id gnl|my_center|LOCUS_39870 84326 86608 gene locus_tag LOCUS_39880 84326 86608 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889332.1 protein_id gnl|my_center|LOCUS_39880 86611 86895 gene locus_tag LOCUS_39890 86611 86895 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889331.1 protein_id gnl|my_center|LOCUS_39890 86892 87626 gene locus_tag LOCUS_39900 86892 87626 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948152.1 protein_id gnl|my_center|LOCUS_39900 87623 87877 gene locus_tag LOCUS_39910 87623 87877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39910 87948 89237 gene locus_tag LOCUS_39920 87948 89237 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028150869.1 protein_id gnl|my_center|LOCUS_39920 89433 90965 gene locus_tag LOCUS_39930 gene lnt 89433 90965 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024119347.1 protein_id gnl|my_center|LOCUS_39930 91254 91652 gene locus_tag LOCUS_39940 91254 91652 CDS product copper resistance protein CopC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480143.1 protein_id gnl|my_center|LOCUS_39940 91657 92946 gene locus_tag LOCUS_39950 91657 92946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39950 93208 94074 gene locus_tag LOCUS_39960 93208 94074 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887745.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39960 94188 94694 gene locus_tag LOCUS_39970 94188 94694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39970 95462 94815 gene locus_tag LOCUS_39980 95462 94815 CDS product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937896.1 protein_id gnl|my_center|LOCUS_39980 96269 96048 gene locus_tag LOCUS_39990 96269 96048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39990 96966 96472 gene locus_tag LOCUS_40000 96966 96472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889401.1 protein_id gnl|my_center|LOCUS_40000 97985 98314 gene locus_tag LOCUS_40010 97985 98314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40010 98840 98409 gene locus_tag LOCUS_40020 98840 98409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 98835 99296 gene locus_tag LOCUS_40030 98835 99296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40030 99997 99353 gene locus_tag LOCUS_40040 99997 99353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 100619 100098 gene locus_tag LOCUS_40050 100619 100098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40050 100515 100712 gene locus_tag LOCUS_40060 100515 100712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40060 100781 100999 gene locus_tag LOCUS_40070 100781 100999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40070 101617 101093 gene locus_tag LOCUS_40080 101617 101093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40080 101753 101926 gene locus_tag LOCUS_40090 101753 101926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40090 102212 101991 gene locus_tag LOCUS_40100 102212 101991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40100 102309 103277 gene locus_tag LOCUS_40110 102309 103277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 103947 103240 gene locus_tag LOCUS_40120 103947 103240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40120 104621 104001 gene locus_tag LOCUS_40130 104621 104001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40130 105153 106259 gene locus_tag LOCUS_40140 105153 106259 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814808.1 protein_id gnl|my_center|LOCUS_40140 106225 108057 gene locus_tag LOCUS_40150 106225 108057 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092685457.1 protein_id gnl|my_center|LOCUS_40150 108050 108586 gene locus_tag LOCUS_40160 108050 108586 CDS product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337189.1 protein_id gnl|my_center|LOCUS_40160 110683 108776 gene locus_tag LOCUS_40170 110683 108776 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189955129.1 protein_id gnl|my_center|LOCUS_40170 111864 110680 gene locus_tag LOCUS_40180 111864 110680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40180 112170 111904 gene locus_tag LOCUS_40190 112170 111904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40190 112643 112948 gene locus_tag LOCUS_40200 112643 112948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40200 114676 113156 gene locus_tag LOCUS_40210 114676 113156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40210 114909 115523 gene locus_tag LOCUS_40220 114909 115523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40220 115524 116507 gene locus_tag LOCUS_40230 115524 116507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40230 118124 116661 gene locus_tag LOCUS_40240 118124 116661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 120382 118598 gene locus_tag LOCUS_40250 120382 118598 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092685457.1 protein_id gnl|my_center|LOCUS_40250 121550 120375 gene locus_tag LOCUS_40260 121550 120375 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814808.1 protein_id gnl|my_center|LOCUS_40260 122297 121851 gene locus_tag LOCUS_40270 122297 121851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889401.1 protein_id gnl|my_center|LOCUS_40270 123057 124523 gene locus_tag LOCUS_40280 123057 124523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40280 124624 125907 gene locus_tag LOCUS_40290 124624 125907 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368422.1 protein_id gnl|my_center|LOCUS_40290 125904 126719 gene locus_tag LOCUS_40300 125904 126719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40300 126719 127897 gene locus_tag LOCUS_40310 126719 127897 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235191056.1 protein_id gnl|my_center|LOCUS_40310 130042 128093 gene locus_tag LOCUS_40320 130042 128093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40320 130587 130039 gene locus_tag LOCUS_40330 130587 130039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40330 131822 130584 gene locus_tag LOCUS_40340 131822 130584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40340 132159 131977 gene locus_tag LOCUS_40350 132159 131977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40350 132124 132999 gene locus_tag LOCUS_40360 132124 132999 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479751.1 protein_id gnl|my_center|LOCUS_40360 133273 133866 gene locus_tag LOCUS_40370 133273 133866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40370 133863 134666 gene locus_tag LOCUS_40380 133863 134666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 134836 135363 gene locus_tag LOCUS_40390 134836 135363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40390 135356 135625 gene locus_tag LOCUS_40400 135356 135625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40400 137009 136539 gene locus_tag LOCUS_40410 137009 136539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40410 >Feature sequence14 28 813 gene locus_tag LOCUS_40420 28 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40420 1805 858 gene locus_tag LOCUS_40430 1805 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40430 2407 1802 gene locus_tag LOCUS_40440 2407 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40440 3001 2414 gene locus_tag LOCUS_40450 3001 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40450 3288 2998 gene locus_tag LOCUS_40460 3288 2998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40460 4067 3807 gene locus_tag LOCUS_40470 4067 3807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 4648 4064 gene locus_tag LOCUS_40480 4648 4064 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884096.1 protein_id gnl|my_center|LOCUS_40480 4746 5057 gene locus_tag LOCUS_40490 4746 5057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40490 5277 6053 gene locus_tag LOCUS_40500 5277 6053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40500 6050 6985 gene locus_tag LOCUS_40510 gene xerC 6050 6985 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275252.1 protein_id gnl|my_center|LOCUS_40510 7866 7030 gene locus_tag LOCUS_40520 7866 7030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 9904 7910 gene locus_tag LOCUS_40530 9904 7910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530 11756 10383 gene locus_tag LOCUS_40540 11756 10383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40540 13747 12365 gene locus_tag LOCUS_40550 13747 12365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 13870 14775 gene locus_tag LOCUS_40560 13870 14775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40560 14978 15721 gene locus_tag LOCUS_40570 14978 15721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 17353 16538 gene locus_tag LOCUS_40580 17353 16538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40580 17588 17983 gene locus_tag LOCUS_40590 17588 17983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 19557 18418 gene locus_tag LOCUS_40600 19557 18418 CDS product glutathione-independent formaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104138.1 protein_id gnl|my_center|LOCUS_40600 20120 19635 gene locus_tag LOCUS_40610 20120 19635 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038765.1 protein_id gnl|my_center|LOCUS_40610 20822 21169 gene locus_tag LOCUS_40620 20822 21169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40620 21477 21166 gene locus_tag LOCUS_40630 21477 21166 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061280.1 protein_id gnl|my_center|LOCUS_40630 21849 22940 gene locus_tag LOCUS_40640 21849 22940 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135260909.1 protein_id gnl|my_center|LOCUS_40640 23567 22956 gene locus_tag LOCUS_40650 23567 22956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40650 23729 23971 gene locus_tag LOCUS_40660 23729 23971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40660 24992 27607 gene locus_tag LOCUS_40670 24992 27607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40670 27604 30492 gene locus_tag LOCUS_40680 27604 30492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40680 31159 30875 gene locus_tag LOCUS_40690 31159 30875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40690 31210 31632 gene locus_tag LOCUS_40700 31210 31632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 32843 31752 gene locus_tag LOCUS_40710 32843 31752 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135260909.1 protein_id gnl|my_center|LOCUS_40710 33691 32990 gene locus_tag LOCUS_40720 33691 32990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40720 34168 33716 gene locus_tag LOCUS_40730 34168 33716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40730 35328 34390 gene locus_tag LOCUS_40740 35328 34390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40740 35585 35851 gene locus_tag LOCUS_40750 35585 35851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40750 35926 36729 gene locus_tag LOCUS_40760 35926 36729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40760 36665 37030 gene locus_tag LOCUS_40770 36665 37030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40770 37128 37844 gene locus_tag LOCUS_40780 37128 37844 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962918.1 protein_id gnl|my_center|LOCUS_40780 38458 37952 gene locus_tag LOCUS_40790 38458 37952 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027547661.1 protein_id gnl|my_center|LOCUS_40790 38743 39648 gene locus_tag LOCUS_40800 38743 39648 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039104.1 protein_id gnl|my_center|LOCUS_40800 39825 41219 gene locus_tag LOCUS_40810 39825 41219 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480140.1 protein_id gnl|my_center|LOCUS_40810 41238 41588 gene locus_tag LOCUS_40820 41238 41588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_40820 41611 41928 gene locus_tag LOCUS_40830 41611 41928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_40830 41925 42743 gene locus_tag LOCUS_40840 41925 42743 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403106.1 protein_id gnl|my_center|LOCUS_40840 42810 43385 gene locus_tag LOCUS_40850 42810 43385 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889422.1 protein_id gnl|my_center|LOCUS_40850 43382 43855 gene locus_tag LOCUS_40860 43382 43855 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889423.1 protein_id gnl|my_center|LOCUS_40860 43908 44411 gene locus_tag LOCUS_40870 43908 44411 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289494.1 protein_id gnl|my_center|LOCUS_40870 45853 44825 gene locus_tag LOCUS_40880 gene pstS 45853 44825 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479753.1 protein_id gnl|my_center|LOCUS_40880 47857 46496 gene locus_tag LOCUS_40890 47857 46496 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888503.1 protein_id gnl|my_center|LOCUS_40890 48244 48552 gene locus_tag LOCUS_40900 48244 48552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40900 48687 49415 gene locus_tag LOCUS_40910 48687 49415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40910 49460 50131 gene locus_tag LOCUS_40920 49460 50131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40920 50197 50541 gene locus_tag LOCUS_40930 50197 50541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40930 51278 52366 gene locus_tag LOCUS_40940 gene ribD 51278 52366 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886799.1 protein_id gnl|my_center|LOCUS_40940 52366 53028 gene locus_tag LOCUS_40950 52366 53028 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886800.1 protein_id gnl|my_center|LOCUS_40950 53025 54230 gene locus_tag LOCUS_40960 53025 54230 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886801.1 protein_id gnl|my_center|LOCUS_40960 54364 54849 gene locus_tag LOCUS_40970 gene ribH 54364 54849 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886802.1 protein_id gnl|my_center|LOCUS_40970 55084 55419 gene locus_tag LOCUS_40980 55084 55419 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027970603.1 protein_id gnl|my_center|LOCUS_40980 56089 57081 gene locus_tag LOCUS_40990 56089 57081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40990 57663 57511 gene locus_tag LOCUS_41000 57663 57511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41000 58498 58025 gene locus_tag LOCUS_41010 58498 58025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41010 58897 59364 gene locus_tag LOCUS_41020 58897 59364 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063653087.1 protein_id gnl|my_center|LOCUS_41020 59608 59426 gene locus_tag LOCUS_41030 59608 59426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41030 59531 59887 gene locus_tag LOCUS_41040 59531 59887 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063653087.1 protein_id gnl|my_center|LOCUS_41040 60263 60111 gene locus_tag LOCUS_41050 60263 60111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41050 61560 61063 gene locus_tag LOCUS_41060 61560 61063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41060 61942 62358 gene locus_tag LOCUS_41070 61942 62358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41070 62685 62951 gene locus_tag LOCUS_41080 62685 62951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41080 62941 63465 gene locus_tag LOCUS_41090 62941 63465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41090 63902 63708 gene locus_tag LOCUS_41100 63902 63708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41100 64241 64411 gene locus_tag LOCUS_41110 64241 64411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41110 64849 64610 gene locus_tag LOCUS_41120 64849 64610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41120 65187 64930 gene locus_tag LOCUS_41130 65187 64930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 65458 65928 gene locus_tag LOCUS_41140 65458 65928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41140 66604 65990 gene locus_tag LOCUS_41150 66604 65990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41150 67000 67164 gene locus_tag LOCUS_41160 67000 67164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41160 67857 67258 gene locus_tag LOCUS_41170 67857 67258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41170 68148 69149 gene locus_tag LOCUS_41180 68148 69149 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106069164.1 protein_id gnl|my_center|LOCUS_41180 69213 70241 gene locus_tag LOCUS_41190 69213 70241 CDS product IS4-like element ISLpn9 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946555.1 protein_id gnl|my_center|LOCUS_41190 70519 71328 gene locus_tag LOCUS_41200 70519 71328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41200 71315 71956 gene locus_tag LOCUS_41210 71315 71956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41210 73079 72405 gene locus_tag LOCUS_41220 73079 72405 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036955.1 protein_id gnl|my_center|LOCUS_41220 73195 74394 gene locus_tag LOCUS_41230 73195 74394 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618799.1 protein_id gnl|my_center|LOCUS_41230 74391 75035 gene locus_tag LOCUS_41240 74391 75035 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889413.1 protein_id gnl|my_center|LOCUS_41240 75040 75681 gene locus_tag LOCUS_41250 75040 75681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41250 75904 76761 gene locus_tag LOCUS_41260 75904 76761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41260 76818 77609 gene locus_tag LOCUS_41270 76818 77609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41270 79202 77865 gene locus_tag LOCUS_41280 79202 77865 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941119.1 protein_id gnl|my_center|LOCUS_41280 79912 79199 gene locus_tag LOCUS_41290 79912 79199 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479875.1 protein_id gnl|my_center|LOCUS_41290 80387 80007 gene locus_tag LOCUS_41300 80387 80007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41300 80976 80722 gene locus_tag LOCUS_41310 80976 80722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41310 83618 80973 gene locus_tag LOCUS_41320 83618 80973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41320 84337 83615 gene locus_tag LOCUS_41330 84337 83615 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030863.1 protein_id gnl|my_center|LOCUS_41330 84995 84330 gene locus_tag LOCUS_41340 84995 84330 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061915636.1 protein_id gnl|my_center|LOCUS_41340 85567 85001 gene locus_tag LOCUS_41350 85567 85001 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030865.1 protein_id gnl|my_center|LOCUS_41350 86294 85701 gene locus_tag LOCUS_41360 86294 85701 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887810.1 protein_id gnl|my_center|LOCUS_41360 87202 86396 gene locus_tag LOCUS_41370 87202 86396 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030868.1 protein_id gnl|my_center|LOCUS_41370 87432 88436 gene locus_tag LOCUS_41380 87432 88436 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902589.1 protein_id gnl|my_center|LOCUS_41380 88441 90237 gene locus_tag LOCUS_41390 88441 90237 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804130.1 protein_id gnl|my_center|LOCUS_41390 90234 91325 gene locus_tag LOCUS_41400 90234 91325 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173056.1 protein_id gnl|my_center|LOCUS_41400 91390 92145 gene locus_tag LOCUS_41410 91390 92145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41410 92142 92336 gene locus_tag LOCUS_41420 92142 92336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41420 92406 92816 gene locus_tag LOCUS_41430 92406 92816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41430 92931 93755 gene locus_tag LOCUS_41440 92931 93755 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389556.1 protein_id gnl|my_center|LOCUS_41440 95046 93760 gene locus_tag LOCUS_41450 95046 93760 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228367.1 protein_id gnl|my_center|LOCUS_41450 95672 95043 gene locus_tag LOCUS_41460 95672 95043 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118816.1 protein_id gnl|my_center|LOCUS_41460 96163 95756 gene locus_tag LOCUS_41470 96163 95756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41470 96424 96900 gene locus_tag LOCUS_41480 96424 96900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41480 98008 97067 gene locus_tag LOCUS_41490 98008 97067 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889322.1 protein_id gnl|my_center|LOCUS_41490 98673 98005 gene locus_tag LOCUS_41500 98673 98005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530791.1 protein_id gnl|my_center|LOCUS_41500 99965 98670 gene locus_tag LOCUS_41510 99965 98670 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230060.1 protein_id gnl|my_center|LOCUS_41510 100633 99962 gene locus_tag LOCUS_41520 100633 99962 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479875.1 protein_id gnl|my_center|LOCUS_41520 101295 100633 gene locus_tag LOCUS_41530 101295 100633 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036955.1 protein_id gnl|my_center|LOCUS_41530 102594 101467 gene locus_tag LOCUS_41540 102594 101467 CDS product type I restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039177.1 protein_id gnl|my_center|LOCUS_41540 103364 102750 gene locus_tag LOCUS_41550 103364 102750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41550 104595 103375 gene locus_tag LOCUS_41560 104595 103375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41560 104758 104925 gene locus_tag LOCUS_41570 104758 104925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552967.1 protein_id gnl|my_center|LOCUS_41570 105038 105772 gene locus_tag LOCUS_41580 105038 105772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41580 105773 106279 gene locus_tag LOCUS_41590 105773 106279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41590 106281 106859 gene locus_tag LOCUS_41600 106281 106859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41600 106846 107652 gene locus_tag LOCUS_41610 106846 107652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41610 >Feature sequence15 286 981 gene locus_tag LOCUS_41620 286 981 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230191.1 protein_id gnl|my_center|LOCUS_41620 1922 1347 gene locus_tag LOCUS_41630 1922 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41630 2499 1993 gene locus_tag LOCUS_41640 2499 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41640 2679 3179 gene locus_tag LOCUS_41650 2679 3179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41650 3245 3631 gene locus_tag LOCUS_41660 3245 3631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41660 3691 4296 gene locus_tag LOCUS_41670 3691 4296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41670 5496 4318 gene locus_tag LOCUS_41680 5496 4318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41680 6986 6018 gene locus_tag LOCUS_41690 6986 6018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41690 8970 8494 gene locus_tag LOCUS_41700 8970 8494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41700 9535 9326 gene locus_tag LOCUS_41710 9535 9326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41710 9965 9540 gene locus_tag LOCUS_41720 9965 9540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41720 10573 9962 gene locus_tag LOCUS_41730 10573 9962 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940717.1 protein_id gnl|my_center|LOCUS_41730 10841 10575 gene locus_tag LOCUS_41740 10841 10575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41740 11285 14590 gene locus_tag LOCUS_41750 11285 14590 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204874017.1 protein_id gnl|my_center|LOCUS_41750 14641 17946 gene locus_tag LOCUS_41760 14641 17946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 17943 18458 gene locus_tag LOCUS_41770 17943 18458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41770 18556 20589 gene locus_tag LOCUS_41780 18556 20589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41780 20586 21923 gene locus_tag LOCUS_41790 20586 21923 CDS product McrC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092265424.1 protein_id gnl|my_center|LOCUS_41790 22739 22248 gene locus_tag LOCUS_41800 22739 22248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41800 23130 22903 gene locus_tag LOCUS_41810 23130 22903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41810 24261 23224 gene locus_tag LOCUS_41820 24261 23224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41820 26334 24490 gene locus_tag LOCUS_41830 26334 24490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41830 27547 26966 gene locus_tag LOCUS_41840 27547 26966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41840 27907 29574 gene locus_tag LOCUS_41850 27907 29574 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479769.1 protein_id gnl|my_center|LOCUS_41850 29771 31426 gene locus_tag LOCUS_41860 29771 31426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41860 31502 32119 gene locus_tag LOCUS_41870 31502 32119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41870 32353 32126 gene locus_tag LOCUS_41880 32353 32126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41880 33017 32385 gene locus_tag LOCUS_41890 33017 32385 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140153.1 protein_id gnl|my_center|LOCUS_41890 34107 33196 gene locus_tag LOCUS_41900 34107 33196 CDS product Fic/DOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969889.1 protein_id gnl|my_center|LOCUS_41900 34350 34114 gene locus_tag LOCUS_41910 34350 34114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41910 34662 35618 gene locus_tag LOCUS_41920 gene xerC 34662 35618 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392542.1 protein_id gnl|my_center|LOCUS_41920 35714 36505 gene locus_tag LOCUS_41930 35714 36505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41930 36586 36951 gene locus_tag LOCUS_41940 36586 36951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41940 37199 37008 gene locus_tag LOCUS_41950 37199 37008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41950 38122 37202 gene locus_tag LOCUS_41960 38122 37202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41960 38445 38119 gene locus_tag LOCUS_41970 38445 38119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41970 38945 38442 gene locus_tag LOCUS_41980 38945 38442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41980 40282 38942 gene locus_tag LOCUS_41990 40282 38942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41990 41316 40282 gene locus_tag LOCUS_42000 41316 40282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42000 43940 41313 gene locus_tag LOCUS_42010 43940 41313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42010 44360 44031 gene locus_tag LOCUS_42020 44360 44031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42020 44822 44379 gene locus_tag LOCUS_42030 44822 44379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42030 44910 46820 gene locus_tag LOCUS_42040 44910 46820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42040 47414 46977 gene locus_tag LOCUS_42050 47414 46977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_42050 47579 47448 gene locus_tag LOCUS_42060 47579 47448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42060 47860 48354 gene locus_tag LOCUS_42070 47860 48354 CDS product arsenate reductase (azurin) small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229170.1 protein_id gnl|my_center|LOCUS_42070 48356 50914 gene locus_tag LOCUS_42080 48356 50914 CDS product arsenate reductase (azurin) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229171.1 protein_id gnl|my_center|LOCUS_42080 50911 51354 gene locus_tag LOCUS_42090 gene cycA 50911 51354 CDS product cytochrome C-552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228671.1 protein_id gnl|my_center|LOCUS_42090 51415 52593 gene locus_tag LOCUS_42100 51415 52593 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886724.1 protein_id gnl|my_center|LOCUS_42100 52617 52937 gene locus_tag LOCUS_42110 52617 52937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42110 54111 52939 gene locus_tag LOCUS_42120 54111 52939 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727468.1 protein_id gnl|my_center|LOCUS_42120 54674 54108 gene locus_tag LOCUS_42130 54674 54108 CDS product DUF6428 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398911.1 protein_id gnl|my_center|LOCUS_42130 55053 54685 gene locus_tag LOCUS_42140 55053 54685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42140 55830 55111 gene locus_tag LOCUS_42150 55830 55111 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889384.1 protein_id gnl|my_center|LOCUS_42150 56288 55827 gene locus_tag LOCUS_42160 56288 55827 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582904.1 protein_id gnl|my_center|LOCUS_42160 56971 56285 gene locus_tag LOCUS_42170 56971 56285 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023173416.1 protein_id gnl|my_center|LOCUS_42170 57433 56972 gene locus_tag LOCUS_42180 57433 56972 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479743.1 protein_id gnl|my_center|LOCUS_42180 59559 57670 gene locus_tag LOCUS_42190 59559 57670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42190 60583 59990 gene locus_tag LOCUS_42200 60583 59990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42200 62198 60594 gene locus_tag LOCUS_42210 62198 60594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42210 63154 62195 gene locus_tag LOCUS_42220 63154 62195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42220 65103 63280 gene locus_tag LOCUS_42230 65103 63280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42230 65581 65153 gene locus_tag LOCUS_42240 65581 65153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42240 66346 65591 gene locus_tag LOCUS_42250 66346 65591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42250 66680 66339 gene locus_tag LOCUS_42260 66680 66339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42260 67546 67148 gene locus_tag LOCUS_42270 67546 67148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42270 67714 68178 gene locus_tag LOCUS_42280 67714 68178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42280 68851 70281 gene locus_tag LOCUS_42290 68851 70281 CDS product replication initiator protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229172.1 protein_id gnl|my_center|LOCUS_42290 70850 72001 gene locus_tag LOCUS_42300 70850 72001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42300 72196 72897 gene locus_tag LOCUS_42310 72196 72897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42310 72894 73736 gene locus_tag LOCUS_42320 72894 73736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42320 73733 74920 gene locus_tag LOCUS_42330 73733 74920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42330 75161 74925 gene locus_tag LOCUS_42340 75161 74925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42340 75806 76069 gene locus_tag LOCUS_42350 75806 76069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42350 76103 76564 gene locus_tag LOCUS_42360 76103 76564 CDS product copper chaperone Copz family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057722.1 protein_id gnl|my_center|LOCUS_42360 76561 76893 gene locus_tag LOCUS_42370 76561 76893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42370 77012 77566 gene locus_tag LOCUS_42380 77012 77566 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229095.1 protein_id gnl|my_center|LOCUS_42380 77563 78267 gene locus_tag LOCUS_42390 77563 78267 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027262.1 protein_id gnl|my_center|LOCUS_42390 78765 78316 gene locus_tag LOCUS_42400 78765 78316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42400 79529 78795 gene locus_tag LOCUS_42410 79529 78795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42410 81178 79541 gene locus_tag LOCUS_42420 81178 79541 CDS product beta-propeller fold lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815226.1 protein_id gnl|my_center|LOCUS_42420 81944 81516 gene locus_tag LOCUS_42430 81944 81516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42430 82733 82026 gene locus_tag LOCUS_42440 82733 82026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42440 84026 82743 gene locus_tag LOCUS_42450 84026 82743 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965461.1 protein_id gnl|my_center|LOCUS_42450 85177 84089 gene locus_tag LOCUS_42460 85177 84089 CDS product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275270.1 protein_id gnl|my_center|LOCUS_42460 85291 86202 gene locus_tag LOCUS_42470 85291 86202 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814552.1 protein_id gnl|my_center|LOCUS_42470 86425 86982 gene locus_tag LOCUS_42480 86425 86982 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905033.1 protein_id gnl|my_center|LOCUS_42480 86987 90010 gene locus_tag LOCUS_42490 86987 90010 CDS product Tn3-like element Tn3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143760.1 protein_id gnl|my_center|LOCUS_42490 90312 89947 gene locus_tag LOCUS_42500 90312 89947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42500 90518 90309 gene locus_tag LOCUS_42510 90518 90309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42510 90971 92374 gene locus_tag LOCUS_42520 90971 92374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42520 93080 92544 gene locus_tag LOCUS_42530 93080 92544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42530 93182 93484 gene locus_tag LOCUS_42540 93182 93484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42540 93496 94098 gene locus_tag LOCUS_42550 gene udk 93496 94098 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403303.1 protein_id gnl|my_center|LOCUS_42550 94213 95133 gene locus_tag LOCUS_42560 94213 95133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42560 95318 95887 gene locus_tag LOCUS_42570 gene pyrE 95318 95887 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420885.1 protein_id gnl|my_center|LOCUS_42570 96956 96003 gene locus_tag LOCUS_42580 96956 96003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42580 97259 97053 gene locus_tag LOCUS_42590 97259 97053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42590 98325 97492 gene locus_tag LOCUS_42600 98325 97492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42600 99215 98322 gene locus_tag LOCUS_42610 99215 98322 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903775.1 protein_id gnl|my_center|LOCUS_42610 99646 99212 gene locus_tag LOCUS_42620 99646 99212 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392689.1 protein_id gnl|my_center|LOCUS_42620 100066 100389 gene locus_tag LOCUS_42630 100066 100389 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888587.1 protein_id gnl|my_center|LOCUS_42630 100393 101568 gene locus_tag LOCUS_42640 100393 101568 CDS product permease prefix domain 1-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888586.1 protein_id gnl|my_center|LOCUS_42640 101658 101978 gene locus_tag LOCUS_42650 101658 101978 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888374.1 protein_id gnl|my_center|LOCUS_42650 101963 103123 gene locus_tag LOCUS_42660 101963 103123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42660 103965 103174 gene locus_tag LOCUS_42670 103965 103174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42670 104149 104475 gene locus_tag LOCUS_42680 104149 104475 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888587.1 protein_id gnl|my_center|LOCUS_42680 104472 105509 gene locus_tag LOCUS_42690 104472 105509 CDS product permease prefix domain 1-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888586.1 protein_id gnl|my_center|LOCUS_42690 >Feature sequence16 <1 929 gene locus_tag LOCUS_42700 <1 929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887228.1:ATP-dependent zinc metalloprotease FtsH 1761 1006 gene locus_tag LOCUS_42710 gene frnE 1761 1006 CDS product protein disulfide isomerase FrnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887304.1 protein_id gnl|my_center|LOCUS_42710 2222 1833 gene locus_tag LOCUS_42720 2222 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42720 5025 2398 gene locus_tag LOCUS_42730 gene vpr 5025 2398 CDS product serine protease Vpr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227419.1 protein_id gnl|my_center|LOCUS_42730 6295 5351 gene locus_tag LOCUS_42740 6295 5351 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480066.1 protein_id gnl|my_center|LOCUS_42740 6328 6702 gene locus_tag LOCUS_42750 6328 6702 CDS product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886831.1 protein_id gnl|my_center|LOCUS_42750 6699 7904 gene locus_tag LOCUS_42760 gene xseA 6699 7904 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886832.1 protein_id gnl|my_center|LOCUS_42760 8387 7911 gene locus_tag LOCUS_42770 8387 7911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42770 9244 8384 gene locus_tag LOCUS_42780 9244 8384 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889156.1 protein_id gnl|my_center|LOCUS_42780 9868 9677 gene locus_tag LOCUS_42790 9868 9677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42790 9867 11192 gene locus_tag LOCUS_42800 gene der 9867 11192 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888936.1 protein_id gnl|my_center|LOCUS_42800 12418 11393 gene locus_tag LOCUS_42810 gene oxyR 12418 11393 CDS product hydrogen peroxide-inducible genes activator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887260.1 protein_id gnl|my_center|LOCUS_42810 12324 13250 gene locus_tag LOCUS_42820 gene yedA 12324 13250 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268946.1 protein_id gnl|my_center|LOCUS_42820 13361 16051 gene locus_tag LOCUS_42830 gene aceE 13361 16051 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480294.1 protein_id gnl|my_center|LOCUS_42830 16157 17878 gene locus_tag LOCUS_42840 gene aceF 16157 17878 CDS product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480295.1 protein_id gnl|my_center|LOCUS_42840 18615 17935 gene locus_tag LOCUS_42850 gene lepB 18615 17935 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888372.1 protein_id gnl|my_center|LOCUS_42850 18977 18639 gene locus_tag LOCUS_42860 18977 18639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927976.1 protein_id gnl|my_center|LOCUS_42860 19300 18971 gene locus_tag LOCUS_42870 19300 18971 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888374.1 protein_id gnl|my_center|LOCUS_42870 19444 20001 gene locus_tag LOCUS_42880 19444 20001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42880 20039 20542 gene locus_tag LOCUS_42890 20039 20542 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903451.1 protein_id gnl|my_center|LOCUS_42890 20693 20523 gene locus_tag LOCUS_42900 20693 20523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42900 21966 20749 gene locus_tag LOCUS_42910 21966 20749 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888570.1 protein_id gnl|my_center|LOCUS_42910 22059 22811 gene locus_tag LOCUS_42920 22059 22811 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350071.1 protein_id gnl|my_center|LOCUS_42920 22825 23946 gene locus_tag LOCUS_42930 22825 23946 CDS product App1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887835.1 protein_id gnl|my_center|LOCUS_42930 27839 24015 gene locus_tag LOCUS_42940 gene rnr 27839 24015 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081608288.1 protein_id gnl|my_center|LOCUS_42940 29010 28246 gene locus_tag LOCUS_42950 29010 28246 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349517.1 protein_id gnl|my_center|LOCUS_42950 29130 29438 gene locus_tag LOCUS_42960 29130 29438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887000.1 protein_id gnl|my_center|LOCUS_42960 29741 31282 gene locus_tag LOCUS_42970 29741 31282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42970 31552 33486 gene locus_tag LOCUS_42980 31552 33486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42980 33540 34664 gene locus_tag LOCUS_42990 33540 34664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42990 34722 35867 gene locus_tag LOCUS_43000 34722 35867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43000 35867 36334 gene locus_tag LOCUS_43010 35867 36334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43010 36331 37734 gene locus_tag LOCUS_43020 36331 37734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43020 38371 37781 gene locus_tag LOCUS_43030 38371 37781 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189011145.1 protein_id gnl|my_center|LOCUS_43030 39824 38478 gene locus_tag LOCUS_43040 gene accC 39824 38478 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886765.1 protein_id gnl|my_center|LOCUS_43040 40432 39917 gene locus_tag LOCUS_43050 40432 39917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43050 41173 40616 gene locus_tag LOCUS_43060 gene efp 41173 40616 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886767.1 protein_id gnl|my_center|LOCUS_43060 41400 42104 gene locus_tag LOCUS_43070 41400 42104 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479566.1 protein_id gnl|my_center|LOCUS_43070 43217 42153 gene locus_tag LOCUS_43080 43217 42153 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118564.1 protein_id gnl|my_center|LOCUS_43080 43300 44805 gene locus_tag LOCUS_43090 gene sthA 43300 44805 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091308313.1 protein_id gnl|my_center|LOCUS_43090 48245 44868 gene locus_tag LOCUS_43100 48245 44868 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887385.1 protein_id gnl|my_center|LOCUS_43100 49852 48242 gene locus_tag LOCUS_43110 49852 48242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43110 50965 50057 gene locus_tag LOCUS_43120 50965 50057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43120 51995 51393 gene locus_tag LOCUS_43130 51995 51393 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530981.1 protein_id gnl|my_center|LOCUS_43130 52070 52528 gene locus_tag LOCUS_43140 52070 52528 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887348.1 protein_id gnl|my_center|LOCUS_43140 52525 53118 gene locus_tag LOCUS_43150 52525 53118 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015235258.1 protein_id gnl|my_center|LOCUS_43150 53205 55049 gene locus_tag LOCUS_43160 53205 55049 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256158.1 protein_id gnl|my_center|LOCUS_43160 55046 56083 gene locus_tag LOCUS_43170 55046 56083 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256159.1 protein_id gnl|my_center|LOCUS_43170 56443 56090 gene locus_tag LOCUS_43180 56443 56090 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888735.1 protein_id gnl|my_center|LOCUS_43180 56588 57004 gene locus_tag LOCUS_43190 56588 57004 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887824.1 protein_id gnl|my_center|LOCUS_43190 57622 57008 gene locus_tag LOCUS_43200 57622 57008 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070651736.1 protein_id gnl|my_center|LOCUS_43200 59207 57855 gene locus_tag LOCUS_43210 gene sufD 59207 57855 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888732.1 protein_id gnl|my_center|LOCUS_43210 60671 59265 gene locus_tag LOCUS_43220 gene sufB 60671 59265 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888737.1 protein_id gnl|my_center|LOCUS_43220 61528 60758 gene locus_tag LOCUS_43230 gene sufC 61528 60758 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888738.1 protein_id gnl|my_center|LOCUS_43230 62352 62446 gene locus_tag LOCUS_t00560 62352 62446 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 62458 62859 gene locus_tag LOCUS_43240 62458 62859 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887102.1 protein_id gnl|my_center|LOCUS_43240 62856 64892 gene locus_tag LOCUS_43250 62856 64892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_43250 64934 65647 gene locus_tag LOCUS_43260 64934 65647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887104.1 protein_id gnl|my_center|LOCUS_43260 65752 66942 gene locus_tag LOCUS_43270 65752 66942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43270 66968 67753 gene locus_tag LOCUS_43280 66968 67753 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887106.1 protein_id gnl|my_center|LOCUS_43280 69630 67810 gene locus_tag LOCUS_43290 gene glmS 69630 67810 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480280.1 protein_id gnl|my_center|LOCUS_43290 70096 70341 gene locus_tag LOCUS_43300 70096 70341 CDS product FmdB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480281.1 protein_id gnl|my_center|LOCUS_43300 70338 71438 gene locus_tag LOCUS_43310 70338 71438 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480282.1 protein_id gnl|my_center|LOCUS_43310 71575 72489 gene locus_tag LOCUS_43320 71575 72489 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459306.1 protein_id gnl|my_center|LOCUS_43320 72499 72696 gene locus_tag LOCUS_43330 72499 72696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036334.1 protein_id gnl|my_center|LOCUS_43330 72818 73429 gene locus_tag LOCUS_43340 72818 73429 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886944.1 protein_id gnl|my_center|LOCUS_43340 73429 74052 gene locus_tag LOCUS_43350 73429 74052 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886943.1 protein_id gnl|my_center|LOCUS_43350 74086 75549 gene locus_tag LOCUS_43360 74086 75549 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886942.1 protein_id gnl|my_center|LOCUS_43360 75684 77084 gene locus_tag LOCUS_43370 75684 77084 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887075.1 protein_id gnl|my_center|LOCUS_43370 >Feature sequence17 100 175 gene locus_tag LOCUS_t00570 100 175 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 260 1432 gene locus_tag LOCUS_43380 gene tgt 260 1432 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350581.1 protein_id gnl|my_center|LOCUS_43380 1765 4947 gene locus_tag LOCUS_43390 1765 4947 CDS product S-layer homology domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889202.1 protein_id gnl|my_center|LOCUS_43390 5059 5997 gene locus_tag LOCUS_43400 5059 5997 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889201.1 protein_id gnl|my_center|LOCUS_43400 6045 7316 gene locus_tag LOCUS_43410 6045 7316 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152423784.1 protein_id gnl|my_center|LOCUS_43410 7381 8856 gene locus_tag LOCUS_43420 7381 8856 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405197.1 protein_id gnl|my_center|LOCUS_43420 9372 9121 gene locus_tag LOCUS_43430 9372 9121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43430 9668 10057 gene locus_tag LOCUS_43440 9668 10057 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480093.1 protein_id gnl|my_center|LOCUS_43440 10314 11645 gene locus_tag LOCUS_43450 gene tig 10314 11645 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888581.1 protein_id gnl|my_center|LOCUS_43450 12191 11811 gene locus_tag LOCUS_43460 12191 11811 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583691.1 protein_id gnl|my_center|LOCUS_43460 12412 13422 gene locus_tag LOCUS_43470 12412 13422 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479820.1 protein_id gnl|my_center|LOCUS_43470 13474 14523 gene locus_tag LOCUS_43480 13474 14523 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888579.1 protein_id gnl|my_center|LOCUS_43480 14520 15440 gene locus_tag LOCUS_43490 gene fabD 14520 15440 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888578.1 protein_id gnl|my_center|LOCUS_43490 15437 15907 gene locus_tag LOCUS_43500 15437 15907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43500 15904 16656 gene locus_tag LOCUS_43510 gene fabG 15904 16656 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888576.1 protein_id gnl|my_center|LOCUS_43510 16790 17020 gene locus_tag LOCUS_43520 gene acpP 16790 17020 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479819.1 protein_id gnl|my_center|LOCUS_43520 17121 18365 gene locus_tag LOCUS_43530 gene fabF 17121 18365 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479818.1 protein_id gnl|my_center|LOCUS_43530 18511 20691 gene locus_tag LOCUS_43540 gene ppk1 18511 20691 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479817.1 protein_id gnl|my_center|LOCUS_43540 20698 21426 gene locus_tag LOCUS_43550 20698 21426 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479583.1 protein_id gnl|my_center|LOCUS_43550 22419 21445 gene locus_tag LOCUS_43560 22419 21445 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257134.1 protein_id gnl|my_center|LOCUS_43560 23276 22419 gene locus_tag LOCUS_43570 23276 22419 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707196.1 protein_id gnl|my_center|LOCUS_43570 25169 23421 gene locus_tag LOCUS_43580 25169 23421 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479832.1 protein_id gnl|my_center|LOCUS_43580 25442 25515 gene locus_tag LOCUS_t00580 25442 25515 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 27488 25563 gene locus_tag LOCUS_43590 27488 25563 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887105.1 protein_id gnl|my_center|LOCUS_43590 28446 27535 gene locus_tag LOCUS_43600 28446 27535 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888399.1 protein_id gnl|my_center|LOCUS_43600 29951 28443 gene locus_tag LOCUS_43610 29951 28443 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528609.1 protein_id gnl|my_center|LOCUS_43610 30310 29978 gene locus_tag LOCUS_43620 30310 29978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43620 30668 30300 gene locus_tag LOCUS_43630 30668 30300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43630 31665 30805 gene locus_tag LOCUS_43640 31665 30805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43640 32114 31827 gene locus_tag LOCUS_43650 32114 31827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43650 32893 32417 gene locus_tag LOCUS_43660 32893 32417 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384944.1 protein_id gnl|my_center|LOCUS_43660 32956 34614 gene locus_tag LOCUS_43670 gene treS 32956 34614 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888668.1 protein_id gnl|my_center|LOCUS_43670 34616 35266 gene locus_tag LOCUS_43680 gene mqnB 34616 35266 CDS product futalosine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028328020.1 protein_id gnl|my_center|LOCUS_43680 35868 35437 gene locus_tag LOCUS_43690 35868 35437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350186.1 protein_id gnl|my_center|LOCUS_43690 36043 35906 gene locus_tag LOCUS_43700 36043 35906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43700 36174 37259 gene locus_tag LOCUS_43710 gene tdh 36174 37259 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888297.1 protein_id gnl|my_center|LOCUS_43710 37403 38524 gene locus_tag LOCUS_43720 gene dnaJ 37403 38524 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927968.1 protein_id gnl|my_center|LOCUS_43720 38786 39781 gene locus_tag LOCUS_43730 38786 39781 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187767767.1 protein_id gnl|my_center|LOCUS_43730 41240 39774 gene locus_tag LOCUS_43740 41240 39774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43740 41394 42257 gene locus_tag LOCUS_43750 41394 42257 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888399.1 protein_id gnl|my_center|LOCUS_43750 42315 43133 gene locus_tag LOCUS_43760 42315 43133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43760 43807 43145 gene locus_tag LOCUS_43770 43807 43145 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222893.1 protein_id gnl|my_center|LOCUS_43770 46331 43800 gene locus_tag LOCUS_43780 46331 43800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43780 47456 46389 gene locus_tag LOCUS_43790 47456 46389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43790 47629 48009 gene locus_tag LOCUS_43800 47629 48009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43800 48042 48368 gene locus_tag LOCUS_43810 48042 48368 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888583.1 protein_id gnl|my_center|LOCUS_43810 48909 48391 gene locus_tag LOCUS_43820 48909 48391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43820 49634 48981 gene locus_tag LOCUS_43830 49634 48981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43830 49714 51417 gene locus_tag LOCUS_43840 gene malL 49714 51417 CDS product oligo-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415207.1 protein_id gnl|my_center|LOCUS_43840 52879 51707 gene locus_tag LOCUS_43850 52879 51707 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888593.1 protein_id gnl|my_center|LOCUS_43850 53440 52949 gene locus_tag LOCUS_43860 53440 52949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43860 55711 53585 gene locus_tag LOCUS_43870 gene recJ 55711 53585 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479621.1 protein_id gnl|my_center|LOCUS_43870 56094 55708 gene locus_tag LOCUS_43880 56094 55708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43880 57377 56193 gene locus_tag LOCUS_43890 57377 56193 CDS product S-layer homology domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887767.1 protein_id gnl|my_center|LOCUS_43890 57760 58515 gene locus_tag LOCUS_43900 57760 58515 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173486.1 protein_id gnl|my_center|LOCUS_43900 58520 59317 gene locus_tag LOCUS_43910 58520 59317 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025568069.1 protein_id gnl|my_center|LOCUS_43910 59326 60402 gene locus_tag LOCUS_43920 59326 60402 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888082.1 protein_id gnl|my_center|LOCUS_43920 60730 60410 gene locus_tag LOCUS_43930 60730 60410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887522.1 protein_id gnl|my_center|LOCUS_43930 60850 61320 gene locus_tag LOCUS_43940 gene greA 60850 61320 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887805.1 protein_id gnl|my_center|LOCUS_43940 61601 61389 gene locus_tag LOCUS_43950 61601 61389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888569.1 protein_id gnl|my_center|LOCUS_43950 61739 62851 gene locus_tag LOCUS_43960 61739 62851 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257106.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43960 62903 63421 gene locus_tag LOCUS_43970 62903 63421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886848.1 protein_id gnl|my_center|LOCUS_43970 64357 63434 gene locus_tag LOCUS_43980 64357 63434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43980 66209 64497 gene locus_tag LOCUS_43990 gene hflX 66209 64497 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480296.1 protein_id gnl|my_center|LOCUS_43990 66522 66983 gene locus_tag LOCUS_44000 66522 66983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44000 68043 66988 gene locus_tag LOCUS_44010 68043 66988 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177724.1 protein_id gnl|my_center|LOCUS_44010 68243 68154 gene locus_tag LOCUS_t00590 68243 68154 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 68583 68996 gene locus_tag LOCUS_44020 gene rpsL 68583 68996 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886950.1 protein_id gnl|my_center|LOCUS_44020 69151 69597 gene locus_tag LOCUS_44030 gene rpsG 69151 69597 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886951.1 protein_id gnl|my_center|LOCUS_44030 69814 71907 gene locus_tag LOCUS_44040 gene fusA 69814 71907 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886952.1 protein_id gnl|my_center|LOCUS_44040 71998 72447 gene locus_tag LOCUS_44050 71998 72447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886953.1 protein_id gnl|my_center|LOCUS_44050 >Feature sequence18 1330 530 gene locus_tag LOCUS_44060 gene fetB 1330 530 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191253.1 protein_id gnl|my_center|LOCUS_44060 1965 1327 gene locus_tag LOCUS_44070 1965 1327 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192911.1 protein_id gnl|my_center|LOCUS_44070 2134 1946 gene locus_tag LOCUS_44080 2134 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44080 2620 2141 gene locus_tag LOCUS_44090 2620 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44090 3031 2699 gene locus_tag LOCUS_44100 3031 2699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44100 3357 3028 gene locus_tag LOCUS_44110 3357 3028 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008634053.1 protein_id gnl|my_center|LOCUS_44110 3749 3354 gene locus_tag LOCUS_44120 gene crcB 3749 3354 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227866.1 protein_id gnl|my_center|LOCUS_44120 4841 3849 gene locus_tag LOCUS_44130 4841 3849 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889322.1 protein_id gnl|my_center|LOCUS_44130 5043 6200 gene locus_tag LOCUS_44140 5043 6200 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618799.1 protein_id gnl|my_center|LOCUS_44140 6886 6281 gene locus_tag LOCUS_44150 6886 6281 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257481.1 protein_id gnl|my_center|LOCUS_44150 7327 6899 gene locus_tag LOCUS_44160 7327 6899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44160 7952 7383 gene locus_tag LOCUS_44170 7952 7383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44170 9253 7961 gene locus_tag LOCUS_44180 9253 7961 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965461.1 protein_id gnl|my_center|LOCUS_44180 10450 9317 gene locus_tag LOCUS_44190 10450 9317 CDS product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105083.1 protein_id gnl|my_center|LOCUS_44190 10531 11445 gene locus_tag LOCUS_44200 10531 11445 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521379.1 protein_id gnl|my_center|LOCUS_44200 12591 11713 gene locus_tag LOCUS_44210 12591 11713 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521379.1 protein_id gnl|my_center|LOCUS_44210 12713 13912 gene locus_tag LOCUS_44220 12713 13912 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259724.1 protein_id gnl|my_center|LOCUS_44220 15077 16456 gene locus_tag LOCUS_44230 15077 16456 CDS product replication initiator protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480407.1 protein_id gnl|my_center|LOCUS_44230 16861 17448 gene locus_tag LOCUS_44240 gene parA 16861 17448 CDS product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368641.1 protein_id gnl|my_center|LOCUS_44240 17445 17759 gene locus_tag LOCUS_44250 17445 17759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44250 18452 17964 gene locus_tag LOCUS_44260 18452 17964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44260 19552 18449 gene locus_tag LOCUS_44270 19552 18449 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225876.1 protein_id gnl|my_center|LOCUS_44270 19772 19981 gene locus_tag LOCUS_44280 19772 19981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44280 20244 20558 gene locus_tag LOCUS_44290 20244 20558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44290 20531 20755 gene locus_tag LOCUS_44300 20531 20755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44300 20755 21183 gene locus_tag LOCUS_44310 20755 21183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44310 21478 22458 gene locus_tag LOCUS_44320 21478 22458 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817250.1 protein_id gnl|my_center|LOCUS_44320 23989 23144 gene locus_tag LOCUS_44330 23989 23144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44330 24995 24093 gene locus_tag LOCUS_44340 24995 24093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44340 25245 25853 gene locus_tag LOCUS_44350 25245 25853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44350 26684 26226 gene locus_tag LOCUS_44360 26684 26226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44360 26599 28701 gene locus_tag LOCUS_44370 26599 28701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44370 29628 31064 gene locus_tag LOCUS_44380 29628 31064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44380 31061 31987 gene locus_tag LOCUS_44390 31061 31987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44390 31984 32709 gene locus_tag LOCUS_44400 31984 32709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44400 33070 32771 gene locus_tag LOCUS_44410 33070 32771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44410 33238 34188 gene locus_tag LOCUS_44420 33238 34188 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479751.1 protein_id gnl|my_center|LOCUS_44420 34364 35371 gene locus_tag LOCUS_44430 34364 35371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44430 35559 36410 gene locus_tag LOCUS_44440 35559 36410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44440 38445 36421 gene locus_tag LOCUS_44450 38445 36421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44450 38618 42256 gene locus_tag LOCUS_44460 38618 42256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44460 42605 42360 gene locus_tag LOCUS_44470 42605 42360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44470 43249 42743 gene locus_tag LOCUS_44480 43249 42743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44480 43498 44103 gene locus_tag LOCUS_44490 43498 44103 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258297.1 protein_id gnl|my_center|LOCUS_44490 44114 44779 gene locus_tag LOCUS_44500 44114 44779 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173744.1 protein_id gnl|my_center|LOCUS_44500 44783 45871 gene locus_tag LOCUS_44510 44783 45871 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228866.1 protein_id gnl|my_center|LOCUS_44510 46425 45874 gene locus_tag LOCUS_44520 46425 45874 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194570.1 protein_id gnl|my_center|LOCUS_44520 46963 46532 gene locus_tag LOCUS_44530 46963 46532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44530 49534 47018 gene locus_tag LOCUS_44540 49534 47018 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889078.1 protein_id gnl|my_center|LOCUS_44540 49696 49908 gene locus_tag LOCUS_44550 49696 49908 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889077.1 protein_id gnl|my_center|LOCUS_44550 49905 50252 gene locus_tag LOCUS_44560 49905 50252 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144033.1 protein_id gnl|my_center|LOCUS_44560 50784 50239 gene locus_tag LOCUS_44570 50784 50239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44570 50785 52782 gene locus_tag LOCUS_44580 50785 52782 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528058.1 protein_id gnl|my_center|LOCUS_44580 55562 52863 gene locus_tag LOCUS_44590 55562 52863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44590 57025 55811 gene locus_tag LOCUS_44600 57025 55811 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244177.1 protein_id gnl|my_center|LOCUS_44600 57480 57022 gene locus_tag LOCUS_44610 57480 57022 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289494.1 protein_id gnl|my_center|LOCUS_44610 58008 57535 gene locus_tag LOCUS_44620 58008 57535 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889423.1 protein_id gnl|my_center|LOCUS_44620 58580 58005 gene locus_tag LOCUS_44630 58580 58005 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889422.1 protein_id gnl|my_center|LOCUS_44630 59464 58649 gene locus_tag LOCUS_44640 59464 58649 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403106.1 protein_id gnl|my_center|LOCUS_44640 59778 59461 gene locus_tag LOCUS_44650 59778 59461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44650 60259 59909 gene locus_tag LOCUS_44660 60259 59909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44660 61672 60278 gene locus_tag LOCUS_44670 61672 60278 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480140.1 protein_id gnl|my_center|LOCUS_44670 61778 62152 gene locus_tag LOCUS_44680 61778 62152 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228235.1 protein_id gnl|my_center|LOCUS_44680 62160 62951 gene locus_tag LOCUS_44690 62160 62951 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089792.1 protein_id gnl|my_center|LOCUS_44690 62948 63217 gene locus_tag LOCUS_44700 62948 63217 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349861.1 protein_id gnl|my_center|LOCUS_44700 63252 63719 gene locus_tag LOCUS_44710 63252 63719 CDS product copper chaperone Copz family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057722.1 protein_id gnl|my_center|LOCUS_44710 63968 64522 gene locus_tag LOCUS_44720 63968 64522 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229095.1 protein_id gnl|my_center|LOCUS_44720 64519 65211 gene locus_tag LOCUS_44730 64519 65211 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229094.1 protein_id gnl|my_center|LOCUS_44730 65754 65305 gene locus_tag LOCUS_44740 65754 65305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44740 66515 65793 gene locus_tag LOCUS_44750 66515 65793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44750 68182 66527 gene locus_tag LOCUS_44760 68182 66527 CDS product beta-propeller fold lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815226.1 protein_id gnl|my_center|LOCUS_44760 >Feature sequence19 99 174 gene locus_tag LOCUS_t00600 99 174 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 499 281 gene locus_tag LOCUS_44770 499 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44770 656 573 gene locus_tag LOCUS_t00610 656 573 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1087 740 gene locus_tag LOCUS_tm00010 1087 740 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 3435 1159 gene locus_tag LOCUS_44780 3435 1159 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943313.1 protein_id gnl|my_center|LOCUS_44780 4379 3522 gene locus_tag LOCUS_44790 4379 3522 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618925.1 protein_id gnl|my_center|LOCUS_44790 5365 4376 gene locus_tag LOCUS_44800 5365 4376 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888863.1 protein_id gnl|my_center|LOCUS_44800 5798 5430 gene locus_tag LOCUS_44810 5798 5430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44810 5833 6720 gene locus_tag LOCUS_44820 5833 6720 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888863.1 protein_id gnl|my_center|LOCUS_44820 6717 7346 gene locus_tag LOCUS_44830 6717 7346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44830 8081 7359 gene locus_tag LOCUS_44840 8081 7359 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256276.1 protein_id gnl|my_center|LOCUS_44840 11109 8182 gene locus_tag LOCUS_44850 11109 8182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44850 14353 11315 gene locus_tag LOCUS_44860 14353 11315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44860 15644 14652 gene locus_tag LOCUS_44870 15644 14652 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889245.1 protein_id gnl|my_center|LOCUS_44870 16393 15629 gene locus_tag LOCUS_44880 16393 15629 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889246.1 protein_id gnl|my_center|LOCUS_44880 16626 17090 gene locus_tag LOCUS_44890 16626 17090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480110.1 protein_id gnl|my_center|LOCUS_44890 17755 17162 gene locus_tag LOCUS_44900 17755 17162 CDS product DUF1802 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480309.1 protein_id gnl|my_center|LOCUS_44900 18097 19443 gene locus_tag LOCUS_44910 gene dnaB 18097 19443 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887194.1 protein_id gnl|my_center|LOCUS_44910 19443 20123 gene locus_tag LOCUS_44920 19443 20123 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887195.1 protein_id gnl|my_center|LOCUS_44920 20270 20473 gene locus_tag LOCUS_44930 20270 20473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44930 20493 21239 gene locus_tag LOCUS_44940 20493 21239 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350944.1 protein_id gnl|my_center|LOCUS_44940 21250 21702 gene locus_tag LOCUS_44950 gene nrdR 21250 21702 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886735.1 protein_id gnl|my_center|LOCUS_44950 22733 21777 gene locus_tag LOCUS_44960 22733 21777 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435245.1 protein_id gnl|my_center|LOCUS_44960 23620 22730 gene locus_tag LOCUS_44970 23620 22730 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813860.1 protein_id gnl|my_center|LOCUS_44970 24967 23753 gene locus_tag LOCUS_44980 24967 23753 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931548.1 protein_id gnl|my_center|LOCUS_44980 25700 24999 gene locus_tag LOCUS_44990 25700 24999 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397984.1 protein_id gnl|my_center|LOCUS_44990 26494 25697 gene locus_tag LOCUS_45000 26494 25697 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067078.1 protein_id gnl|my_center|LOCUS_45000 27229 26609 gene locus_tag LOCUS_45010 27229 26609 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350598.1 protein_id gnl|my_center|LOCUS_45010 28362 27469 gene locus_tag LOCUS_45020 28362 27469 CDS product DUF4384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887028.1 protein_id gnl|my_center|LOCUS_45020 28525 29067 gene locus_tag LOCUS_45030 28525 29067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45030 29064 30323 gene locus_tag LOCUS_45040 29064 30323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45040 30403 31164 gene locus_tag LOCUS_45050 30403 31164 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886690.1 protein_id gnl|my_center|LOCUS_45050 31263 31338 gene locus_tag LOCUS_t00620 31263 31338 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 31362 31437 gene locus_tag LOCUS_t00630 31362 31437 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 31563 32459 gene locus_tag LOCUS_45060 gene xerD 31563 32459 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723602.1 protein_id gnl|my_center|LOCUS_45060 32456 33322 gene locus_tag LOCUS_45070 32456 33322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45070 33666 34220 gene locus_tag LOCUS_45080 33666 34220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45080 34461 35336 gene locus_tag LOCUS_45090 34461 35336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45090 35594 35869 gene locus_tag LOCUS_45100 35594 35869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45100 35997 36473 gene locus_tag LOCUS_45110 35997 36473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45110 36667 36407 gene locus_tag LOCUS_45120 36667 36407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45120 37060 38649 gene locus_tag LOCUS_45130 37060 38649 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968694.1 protein_id gnl|my_center|LOCUS_45130 38630 39937 gene locus_tag LOCUS_45140 38630 39937 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968693.1 protein_id gnl|my_center|LOCUS_45140 39934 42843 gene locus_tag LOCUS_45150 39934 42843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45150 42836 45985 gene locus_tag LOCUS_45160 42836 45985 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968692.1 protein_id gnl|my_center|LOCUS_45160 46025 46360 gene locus_tag LOCUS_45170 46025 46360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45170 46818 47447 gene locus_tag LOCUS_45180 46818 47447 CDS product DUF4433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143359.1 protein_id gnl|my_center|LOCUS_45180 47485 48573 gene locus_tag LOCUS_45190 47485 48573 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143360.1 protein_id gnl|my_center|LOCUS_45190 >Feature sequence20 111 434 gene locus_tag LOCUS_45200 gene rpsJ 111 434 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886955.1 protein_id gnl|my_center|LOCUS_45200 431 1051 gene locus_tag LOCUS_45210 gene rplC 431 1051 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886956.1 protein_id gnl|my_center|LOCUS_45210 1051 1668 gene locus_tag LOCUS_45220 gene rplD 1051 1668 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886957.1 protein_id gnl|my_center|LOCUS_45220 1665 1952 gene locus_tag LOCUS_45230 1665 1952 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886958.1 protein_id gnl|my_center|LOCUS_45230 1966 2799 gene locus_tag LOCUS_45240 gene rplB 1966 2799 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886959.1 protein_id gnl|my_center|LOCUS_45240 2812 3099 gene locus_tag LOCUS_45250 gene rpsS 2812 3099 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886960.1 protein_id gnl|my_center|LOCUS_45250 3096 3521 gene locus_tag LOCUS_45260 gene rplV 3096 3521 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886961.1 protein_id gnl|my_center|LOCUS_45260 3525 4271 gene locus_tag LOCUS_45270 gene rpsC 3525 4271 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886962.1 protein_id gnl|my_center|LOCUS_45270 4271 4696 gene locus_tag LOCUS_45280 gene rplP 4271 4696 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025567820.1 protein_id gnl|my_center|LOCUS_45280 4683 4886 gene locus_tag LOCUS_45290 gene rpmC 4683 4886 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886964.1 protein_id gnl|my_center|LOCUS_45290 4883 5167 gene locus_tag LOCUS_45300 gene rpsQ 4883 5167 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886965.1 protein_id gnl|my_center|LOCUS_45300 5164 5568 gene locus_tag LOCUS_45310 gene rplN 5164 5568 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886966.1 protein_id gnl|my_center|LOCUS_45310 5568 5915 gene locus_tag LOCUS_45320 gene rplX 5568 5915 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871863.1 protein_id gnl|my_center|LOCUS_45320 5991 6533 gene locus_tag LOCUS_45330 gene rplE 5991 6533 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886968.1 protein_id gnl|my_center|LOCUS_45330 6543 6728 gene locus_tag LOCUS_45340 6543 6728 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633399.1 protein_id gnl|my_center|LOCUS_45340 7144 7545 gene locus_tag LOCUS_45350 gene rpsH 7144 7545 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888741.1 protein_id gnl|my_center|LOCUS_45350 7625 8182 gene locus_tag LOCUS_45360 gene rplF 7625 8182 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888742.1 protein_id gnl|my_center|LOCUS_45360 8182 8520 gene locus_tag LOCUS_45370 gene rplR 8182 8520 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888743.1 protein_id gnl|my_center|LOCUS_45370 8510 9022 gene locus_tag LOCUS_45380 gene rpsE 8510 9022 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350334.1 protein_id gnl|my_center|LOCUS_45380 9022 9198 gene locus_tag LOCUS_45390 gene rpmD 9022 9198 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888745.1 protein_id gnl|my_center|LOCUS_45390 9195 9665 gene locus_tag LOCUS_45400 gene rplO 9195 9665 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888746.1 protein_id gnl|my_center|LOCUS_45400 9665 10990 gene locus_tag LOCUS_45410 gene secY 9665 10990 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888747.1 protein_id gnl|my_center|LOCUS_45410 11140 11733 gene locus_tag LOCUS_45420 11140 11733 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888748.1 protein_id gnl|my_center|LOCUS_45420 11889 13208 gene locus_tag LOCUS_45430 11889 13208 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055512687.1 protein_id gnl|my_center|LOCUS_45430 13205 14689 gene locus_tag LOCUS_45440 13205 14689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45440 14686 15777 gene locus_tag LOCUS_45450 14686 15777 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227757.1 protein_id gnl|my_center|LOCUS_45450 15332 15255 gene locus_tag LOCUS_t00640 15332 15255 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 15844 16716 gene locus_tag LOCUS_45460 15844 16716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45460 16869 18902 gene locus_tag LOCUS_45470 16869 18902 CDS product DUF5682 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227758.1 protein_id gnl|my_center|LOCUS_45470 18998 20941 gene locus_tag LOCUS_45480 18998 20941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45480 20991 22181 gene locus_tag LOCUS_45490 20991 22181 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467385.1 protein_id gnl|my_center|LOCUS_45490 22650 22183 gene locus_tag LOCUS_45500 22650 22183 CDS product DUF4188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141249.1 protein_id gnl|my_center|LOCUS_45500 22721 23278 gene locus_tag LOCUS_45510 22721 23278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45510 23365 23622 gene locus_tag LOCUS_45520 gene infA 23365 23622 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479941.1 protein_id gnl|my_center|LOCUS_45520 23841 24221 gene locus_tag LOCUS_45530 gene rpsM 23841 24221 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888756.1 protein_id gnl|my_center|LOCUS_45530 24225 24620 gene locus_tag LOCUS_45540 gene rpsK 24225 24620 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888757.1 protein_id gnl|my_center|LOCUS_45540 24776 25396 gene locus_tag LOCUS_45550 gene rpsD 24776 25396 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888758.1 protein_id gnl|my_center|LOCUS_45550 25410 26414 gene locus_tag LOCUS_45560 25410 26414 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888759.1 protein_id gnl|my_center|LOCUS_45560 26569 26919 gene locus_tag LOCUS_45570 gene rplQ 26569 26919 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888760.1 protein_id gnl|my_center|LOCUS_45570 27019 27591 gene locus_tag LOCUS_45580 27019 27591 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887590.1 protein_id gnl|my_center|LOCUS_45580 28023 27664 gene locus_tag LOCUS_45590 gene trxA 28023 27664 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479673.1 protein_id gnl|my_center|LOCUS_45590 28137 28487 gene locus_tag LOCUS_45600 28137 28487 CDS product DUF309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479674.1 protein_id gnl|my_center|LOCUS_45600 28600 29199 gene locus_tag LOCUS_45610 28600 29199 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888630.1 protein_id gnl|my_center|LOCUS_45610 29189 30250 gene locus_tag LOCUS_45620 gene plsX 29189 30250 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479836.1 protein_id gnl|my_center|LOCUS_45620 30314 31507 gene locus_tag LOCUS_45630 30314 31507 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888628.1 protein_id gnl|my_center|LOCUS_45630 <32164 31517 gene locus_tag LOCUS_45640 <32164 31517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_034349714.1:ATP-dependent zinc metalloprotease FtsH >Feature sequence21 156 1001 gene locus_tag LOCUS_45650 156 1001 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227632.1 protein_id gnl|my_center|LOCUS_45650 1101 1634 gene locus_tag LOCUS_45660 1101 1634 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119799.1 protein_id gnl|my_center|LOCUS_45660 1885 2775 gene locus_tag LOCUS_45670 1885 2775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45670 4233 3688 gene locus_tag LOCUS_45680 4233 3688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45680 4350 4784 gene locus_tag LOCUS_45690 4350 4784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45690 5544 5128 gene locus_tag LOCUS_45700 5544 5128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45700 5776 5555 gene locus_tag LOCUS_45710 5776 5555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45710 5907 6404 gene locus_tag LOCUS_45720 5907 6404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45720 7200 6721 gene locus_tag LOCUS_45730 7200 6721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45730 7325 8239 gene locus_tag LOCUS_45740 7325 8239 CDS product NmrA family NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530656.1 protein_id gnl|my_center|LOCUS_45740 8277 8801 gene locus_tag LOCUS_45750 8277 8801 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086845735.1 protein_id gnl|my_center|LOCUS_45750 8804 9706 gene locus_tag LOCUS_45760 8804 9706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45760 10121 10339 gene locus_tag LOCUS_45770 10121 10339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45770 11146 10463 gene locus_tag LOCUS_45780 11146 10463 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892101.1 protein_id gnl|my_center|LOCUS_45780 11898 11143 gene locus_tag LOCUS_45790 11898 11143 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082427.1 protein_id gnl|my_center|LOCUS_45790 12506 11895 gene locus_tag LOCUS_45800 12506 11895 CDS product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966112.1 protein_id gnl|my_center|LOCUS_45800 13330 12506 gene locus_tag LOCUS_45810 13330 12506 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258834.1 protein_id gnl|my_center|LOCUS_45810 14267 13308 gene locus_tag LOCUS_45820 14267 13308 CDS product alpha-D-ribose 1-methylphosphonate 5-phosphate C-P-lyase PhnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258835.1 protein_id gnl|my_center|LOCUS_45820 15364 14264 gene locus_tag LOCUS_45830 15364 14264 CDS product carbon-phosphorus lyase complex subunit PhnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091786.1 protein_id gnl|my_center|LOCUS_45830 15922 15365 gene locus_tag LOCUS_45840 gene phnH 15922 15365 CDS product phosphonate C-P lyase system protein PhnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535333.1 protein_id gnl|my_center|LOCUS_45840 16383 15922 gene locus_tag LOCUS_45850 16383 15922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45850 16802 16479 gene locus_tag LOCUS_45860 16802 16479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45860 16690 17454 gene locus_tag LOCUS_45870 gene phnC 16690 17454 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939222.1 protein_id gnl|my_center|LOCUS_45870 17545 18408 gene locus_tag LOCUS_45880 gene phnD 17545 18408 CDS product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992010.1 protein_id gnl|my_center|LOCUS_45880 18491 19318 gene locus_tag LOCUS_45890 gene phnE 18491 19318 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302225.1 protein_id gnl|my_center|LOCUS_45890 19315 20493 gene locus_tag LOCUS_45900 19315 20493 CDS product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258832.1 protein_id gnl|my_center|LOCUS_45900 20505 21065 gene locus_tag LOCUS_45910 gene pyrE 20505 21065 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919429.1 protein_id gnl|my_center|LOCUS_45910 21126 21419 gene locus_tag LOCUS_45920 21126 21419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45920 21903 24563 gene locus_tag LOCUS_45930 21903 24563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45930 24896 24657 gene locus_tag LOCUS_45940 24896 24657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45940 24789 25286 gene locus_tag LOCUS_45950 24789 25286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45950 25336 25557 gene locus_tag LOCUS_45960 25336 25557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45960 >Feature sequence22 769 155 gene locus_tag LOCUS_45970 769 155 CDS product IS6 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109866564.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_45970 668 889 gene locus_tag LOCUS_45980 668 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45980 891 1136 gene locus_tag LOCUS_45990 891 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45990 1458 4973 gene locus_tag LOCUS_46000 1458 4973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46000 5498 6847 gene locus_tag LOCUS_46010 5498 6847 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028328044.1 protein_id gnl|my_center|LOCUS_46010 6859 7968 gene locus_tag LOCUS_46020 6859 7968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46020 8300 8578 gene locus_tag LOCUS_46030 8300 8578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46030 9071 8547 gene locus_tag LOCUS_46040 9071 8547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46040 9325 9939 gene locus_tag LOCUS_46050 9325 9939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46050 9974 10129 gene locus_tag LOCUS_46060 9974 10129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46060 10980 10834 gene locus_tag LOCUS_46070 10980 10834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46070 11176 11036 gene locus_tag LOCUS_46080 11176 11036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46080 11515 14439 gene locus_tag LOCUS_46090 11515 14439 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222149.1 protein_id gnl|my_center|LOCUS_46090 17190 14641 gene locus_tag LOCUS_46100 17190 14641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46100 17078 17314 gene locus_tag LOCUS_46110 17078 17314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46110 17829 18200 gene locus_tag LOCUS_46120 17829 18200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_46120 18361 18555 gene locus_tag LOCUS_46130 18361 18555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46130 19802 19410 gene locus_tag LOCUS_46140 19802 19410 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227971.1 protein_id gnl|my_center|LOCUS_46140 20035 19808 gene locus_tag LOCUS_46150 20035 19808 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227972.1 protein_id gnl|my_center|LOCUS_46150 20344 20901 gene locus_tag LOCUS_46160 20344 20901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46160 20898 21512 gene locus_tag LOCUS_46170 20898 21512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46170 21544 22113 gene locus_tag LOCUS_46180 21544 22113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46180 22534 22836 gene locus_tag LOCUS_46190 22534 22836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46190 22902 23234 gene locus_tag LOCUS_46200 22902 23234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46200 23534 23271 gene locus_tag LOCUS_46210 23534 23271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46210 >Feature sequence23 374 739 gene locus_tag LOCUS_46220 374 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46220 736 1173 gene locus_tag LOCUS_46230 736 1173 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177561.1 protein_id gnl|my_center|LOCUS_46230 1166 2974 gene locus_tag LOCUS_46240 1166 2974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46240 3253 5589 gene locus_tag LOCUS_46250 3253 5589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46250 5921 6241 gene locus_tag LOCUS_46260 5921 6241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46260 6238 6717 gene locus_tag LOCUS_46270 6238 6717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46270 7021 6830 gene locus_tag LOCUS_46280 7021 6830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889188.1 protein_id gnl|my_center|LOCUS_46280 7495 7211 gene locus_tag LOCUS_46290 7495 7211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46290 7985 7461 gene locus_tag LOCUS_46300 7985 7461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46300 8395 7970 gene locus_tag LOCUS_46310 8395 7970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46310 9016 8615 gene locus_tag LOCUS_46320 9016 8615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46320 9635 9210 gene locus_tag LOCUS_46330 9635 9210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46330 9729 10331 gene locus_tag LOCUS_46340 9729 10331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46340 10724 10365 gene locus_tag LOCUS_46350 10724 10365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46350 11326 10724 gene locus_tag LOCUS_46360 11326 10724 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888320.1 protein_id gnl|my_center|LOCUS_46360 12050 11574 gene locus_tag LOCUS_46370 12050 11574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46370 17579 12306 gene locus_tag LOCUS_46380 17579 12306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46380 20800 17576 gene locus_tag LOCUS_46390 20800 17576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46390 21267 20851 gene locus_tag LOCUS_46400 21267 20851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46400 21658 21398 gene locus_tag LOCUS_46410 21658 21398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46410 21949 21683 gene locus_tag LOCUS_46420 21949 21683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46420 22278 21946 gene locus_tag LOCUS_46430 22278 21946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46430 22528 22271 gene locus_tag LOCUS_46440 22528 22271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46440 23020 22586 gene locus_tag LOCUS_46450 23020 22586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46450 >Feature sequence24 313 918 gene locus_tag LOCUS_46460 313 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46460 1065 1550 gene locus_tag LOCUS_46470 1065 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46470 1547 2383 gene locus_tag LOCUS_46480 1547 2383 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484721.1 protein_id gnl|my_center|LOCUS_46480 2473 3177 gene locus_tag LOCUS_46490 2473 3177 CDS product IS6 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109866564.1 protein_id gnl|my_center|LOCUS_46490 3300 3569 gene locus_tag LOCUS_46500 3300 3569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46500 3907 3695 gene locus_tag LOCUS_46510 3907 3695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46510 3788 4180 gene locus_tag LOCUS_46520 3788 4180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46520 4226 4549 gene locus_tag LOCUS_46530 4226 4549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46530 4546 4857 gene locus_tag LOCUS_46540 4546 4857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46540 4993 5163 gene locus_tag LOCUS_46550 4993 5163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46550 5163 5363 gene locus_tag LOCUS_46560 5163 5363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46560 5537 6094 gene locus_tag LOCUS_46570 5537 6094 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262936.1 protein_id gnl|my_center|LOCUS_46570 6408 6061 gene locus_tag LOCUS_46580 6408 6061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46580 6325 7029 gene locus_tag LOCUS_46590 6325 7029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46590 7046 8260 gene locus_tag LOCUS_46600 7046 8260 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236074023.1 protein_id gnl|my_center|LOCUS_46600 8257 9114 gene locus_tag LOCUS_46610 8257 9114 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028996.1 protein_id gnl|my_center|LOCUS_46610 9188 9970 gene locus_tag LOCUS_46620 9188 9970 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028995.1 protein_id gnl|my_center|LOCUS_46620 9967 11001 gene locus_tag LOCUS_46630 9967 11001 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228819.1 protein_id gnl|my_center|LOCUS_46630 11754 11002 gene locus_tag LOCUS_46640 11754 11002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227869.1 protein_id gnl|my_center|LOCUS_46640 12814 11741 gene locus_tag LOCUS_46650 12814 11741 CDS product ArsO family NAD(P)H-dependent flavin-containing monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031223.1 protein_id gnl|my_center|LOCUS_46650 14334 12811 gene locus_tag LOCUS_46660 14334 12811 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211039795.1 protein_id gnl|my_center|LOCUS_46660 14690 14331 gene locus_tag LOCUS_46670 14690 14331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46670 14927 15199 gene locus_tag LOCUS_46680 14927 15199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46680 15363 15830 gene locus_tag LOCUS_46690 15363 15830 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973561.1 protein_id gnl|my_center|LOCUS_46690 15866 16351 gene locus_tag LOCUS_46700 15866 16351 CDS product copper chaperone Copz family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057722.1 protein_id gnl|my_center|LOCUS_46700 16348 16524 gene locus_tag LOCUS_46710 16348 16524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46710 17393 16635 gene locus_tag LOCUS_46720 17393 16635 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546542.1 protein_id gnl|my_center|LOCUS_46720 17890 17567 gene locus_tag LOCUS_46730 17890 17567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46730 18107 18409 gene locus_tag LOCUS_46740 18107 18409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46740 18471 18992 gene locus_tag LOCUS_46750 18471 18992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46750 19010 19813 gene locus_tag LOCUS_46760 19010 19813 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729131.1 protein_id gnl|my_center|LOCUS_46760 20500 19820 gene locus_tag LOCUS_46770 20500 19820 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227425.1 protein_id gnl|my_center|LOCUS_46770 21086 20643 gene locus_tag LOCUS_46780 21086 20643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46780 22234 21314 gene locus_tag LOCUS_46790 22234 21314 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107136145.1 protein_id gnl|my_center|LOCUS_46790 22994 22374 gene locus_tag LOCUS_46800 22994 22374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46800 >Feature sequence25 150 416 gene locus_tag LOCUS_46810 150 416 CDS product acyl-CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886812.1 protein_id gnl|my_center|LOCUS_46810 470 1321 gene locus_tag LOCUS_46820 gene irrE 470 1321 CDS product metallo-endopeptidase IrrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886813.1 protein_id gnl|my_center|LOCUS_46820 1318 2208 gene locus_tag LOCUS_46830 gene folP 1318 2208 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886814.1 protein_id gnl|my_center|LOCUS_46830 2205 2576 gene locus_tag LOCUS_46840 gene folB 2205 2576 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886815.1 protein_id gnl|my_center|LOCUS_46840 2579 3085 gene locus_tag LOCUS_46850 gene folK 2579 3085 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886816.1 protein_id gnl|my_center|LOCUS_46850 3099 3626 gene locus_tag LOCUS_46860 3099 3626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887855.1 protein_id gnl|my_center|LOCUS_46860 3988 3674 gene locus_tag LOCUS_46870 3988 3674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480244.1 protein_id gnl|my_center|LOCUS_46870 4088 5371 gene locus_tag LOCUS_46880 4088 5371 CDS product hydroxyacid-oxoacid transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222287.1 protein_id gnl|my_center|LOCUS_46880 5720 5376 gene locus_tag LOCUS_46890 5720 5376 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888910.1 protein_id gnl|my_center|LOCUS_46890 6437 5739 gene locus_tag LOCUS_46900 6437 5739 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927183.1 protein_id gnl|my_center|LOCUS_46900 6825 6418 gene locus_tag LOCUS_46910 6825 6418 CDS product putative dsRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480332.1 protein_id gnl|my_center|LOCUS_46910 6870 7349 gene locus_tag LOCUS_46920 6870 7349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46920 9218 7356 gene locus_tag LOCUS_46930 9218 7356 CDS product serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889593.1 protein_id gnl|my_center|LOCUS_46930 9976 9218 gene locus_tag LOCUS_46940 9976 9218 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889592.1 protein_id gnl|my_center|LOCUS_46940 11608 10019 gene locus_tag LOCUS_46950 11608 10019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46950 12998 11616 gene locus_tag LOCUS_46960 12998 11616 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480136.1 protein_id gnl|my_center|LOCUS_46960 13592 13071 gene locus_tag LOCUS_46970 13592 13071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46970 14879 13644 gene locus_tag LOCUS_46980 14879 13644 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618922.1 protein_id gnl|my_center|LOCUS_46980 15089 16633 gene locus_tag LOCUS_46990 15089 16633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46990 18665 16650 gene locus_tag LOCUS_47000 gene uvrB 18665 16650 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480336.1 protein_id gnl|my_center|LOCUS_47000 18797 20026 gene locus_tag LOCUS_47010 18797 20026 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349486.1 protein_id gnl|my_center|LOCUS_47010 21794 20040 gene locus_tag LOCUS_47020 21794 20040 CDS product copper amine oxidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177726.1 protein_id gnl|my_center|LOCUS_47020 >Feature sequence26 700 575 gene locus_tag LOCUS_47030 700 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47030 1785 823 gene locus_tag LOCUS_47040 1785 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47040 1885 2106 gene locus_tag LOCUS_47050 1885 2106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47050 2467 2249 gene locus_tag LOCUS_47060 2467 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47060 2544 3056 gene locus_tag LOCUS_47070 2544 3056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47070 3873 3139 gene locus_tag LOCUS_47080 3873 3139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47080 4898 3870 gene locus_tag LOCUS_47090 4898 3870 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533238.1 protein_id gnl|my_center|LOCUS_47090 5298 4906 gene locus_tag LOCUS_47100 5298 4906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47100 5761 5363 gene locus_tag LOCUS_47110 gene acpS 5761 5363 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174182.1 protein_id gnl|my_center|LOCUS_47110 6801 5761 gene locus_tag LOCUS_47120 6801 5761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47120 7645 6794 gene locus_tag LOCUS_47130 7645 6794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47130 7945 7646 gene locus_tag LOCUS_47140 7945 7646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47140 8678 8040 gene locus_tag LOCUS_47150 gene udg 8678 8040 CDS product type-4 uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053779.1 protein_id gnl|my_center|LOCUS_47150 9322 8675 gene locus_tag LOCUS_47160 gene tmk 9322 8675 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391590.1 protein_id gnl|my_center|LOCUS_47160 9784 9536 gene locus_tag LOCUS_47170 9784 9536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47170 9980 10480 gene locus_tag LOCUS_47180 9980 10480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889401.1 protein_id gnl|my_center|LOCUS_47180 10693 10914 gene locus_tag LOCUS_47190 10693 10914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47190 >Feature sequence27 123 416 gene locus_tag LOCUS_47200 123 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47200 833 1222 gene locus_tag LOCUS_47210 833 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47210 2308 1349 gene locus_tag LOCUS_47220 2308 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47220 2488 3900 gene locus_tag LOCUS_47230 2488 3900 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349804.1 protein_id gnl|my_center|LOCUS_47230 4097 4864 gene locus_tag LOCUS_47240 4097 4864 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026138672.1 protein_id gnl|my_center|LOCUS_47240 4861 6039 gene locus_tag LOCUS_47250 4861 6039 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889265.1 protein_id gnl|my_center|LOCUS_47250 6106 8265 gene locus_tag LOCUS_47260 6106 8265 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350677.1 protein_id gnl|my_center|LOCUS_47260 8365 8685 gene locus_tag LOCUS_47270 8365 8685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47270 >Feature sequence28 88 450 gene locus_tag LOCUS_47280 88 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47280 955 722 gene locus_tag LOCUS_47290 955 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47290 1595 1861 gene locus_tag LOCUS_47300 1595 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47300 1890 3437 gene locus_tag LOCUS_47310 1890 3437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47310 3434 3730 gene locus_tag LOCUS_47320 3434 3730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47320 3718 4239 gene locus_tag LOCUS_47330 3718 4239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47330 5899 5072 gene locus_tag LOCUS_47340 5899 5072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47340 6038 6388 gene locus_tag LOCUS_47350 6038 6388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47350 6907 6392 gene locus_tag LOCUS_47360 6907 6392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47360 7238 6930 gene locus_tag LOCUS_47370 7238 6930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47370 7705 7403 gene locus_tag LOCUS_47380 7705 7403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47380 >Feature sequence29 120 14 gene locus_tag LOCUS_r00010 120 14 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3101 226 gene locus_tag LOCUS_r00020 3101 226 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence30 <1 1038 gene locus_tag LOCUS_47390 <1 1038 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_040383028.1:sorbosone dehydrogenase family protein 1149 2285 gene locus_tag LOCUS_47400 1149 2285 CDS product type III polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480137.1 protein_id gnl|my_center|LOCUS_47400 >Feature sequence31 143 658 gene locus_tag LOCUS_47410 143 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47410 762 1220 gene locus_tag LOCUS_47420 762 1220 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063653087.1 protein_id gnl|my_center|LOCUS_47420 1789 1259 gene locus_tag LOCUS_47430 1789 1259 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227517.1 protein_id gnl|my_center|LOCUS_47430 >Feature sequence32 1573 728 gene locus_tag LOCUS_47440 1573 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47440 1833 1567 gene locus_tag LOCUS_47450 1833 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47450 >Feature sequence33 1613 30 gene locus_tag LOCUS_47460 1613 30 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029096096.1 protein_id gnl|my_center|LOCUS_47460 >Feature sequence34 >Feature sequence35 841 317 gene locus_tag LOCUS_47470 841 317 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227517.1 protein_id gnl|my_center|LOCUS_47470 >Feature sequence36 >Feature sequence37 546 235 gene locus_tag LOCUS_47480 546 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47480 1105 800 gene locus_tag LOCUS_47490 1105 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47490