>Feature sequence001 >Feature sequence002 >Feature sequence003 >Feature sequence004 >Feature sequence005 >Feature sequence006 >Feature sequence007 >Feature sequence008 >Feature sequence009 >Feature sequence010 >Feature sequence011 7036 4619 gene locus_tag LOCUS_00010 gene lon 7036 4619 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193454.1 protein_id gnl|my_center|LOCUS_00010 8553 7288 gene locus_tag LOCUS_00020 gene clpX 8553 7288 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521258.1 protein_id gnl|my_center|LOCUS_00020 9424 8798 gene locus_tag LOCUS_00030 gene clpP 9424 8798 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812508.1 protein_id gnl|my_center|LOCUS_00030 10790 9441 gene locus_tag LOCUS_00040 gene tig 10790 9441 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193941.1 protein_id gnl|my_center|LOCUS_00040 10905 10819 gene locus_tag LOCUS_t00010 10905 10819 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 14288 11193 gene locus_tag LOCUS_00050 gene mexK 14288 11193 CDS product multidrug efflux RND transporter permease subunit MexK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092464.1 protein_id gnl|my_center|LOCUS_00050 15472 14285 gene locus_tag LOCUS_00060 15472 14285 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085209.1 protein_id gnl|my_center|LOCUS_00060 15490 15672 gene locus_tag LOCUS_00070 15490 15672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 15922 16791 gene locus_tag LOCUS_00080 gene hpnC 15922 16791 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810490.1 protein_id gnl|my_center|LOCUS_00080 17013 17381 gene locus_tag LOCUS_00090 17013 17381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 17412 18143 gene locus_tag LOCUS_00100 17412 18143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 19107 18325 gene locus_tag LOCUS_00110 19107 18325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 19536 20369 gene locus_tag LOCUS_00120 gene hpnD 19536 20369 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818612.1 protein_id gnl|my_center|LOCUS_00120 20362 21729 gene locus_tag LOCUS_00130 gene hpnE 20362 21729 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930255.1 protein_id gnl|my_center|LOCUS_00130 23154 21736 gene locus_tag LOCUS_00140 gene radA 23154 21736 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193568.1 protein_id gnl|my_center|LOCUS_00140 23333 24595 gene locus_tag LOCUS_00150 gene lplT 23333 24595 CDS product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266648.1 protein_id gnl|my_center|LOCUS_00150 25575 24661 gene locus_tag LOCUS_00160 25575 24661 CDS product DUF1853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004547886.1 protein_id gnl|my_center|LOCUS_00160 26683 25673 gene locus_tag LOCUS_00170 26683 25673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 27174 26683 gene locus_tag LOCUS_00180 gene rimI 27174 26683 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191864.1 protein_id gnl|my_center|LOCUS_00180 27883 27191 gene locus_tag LOCUS_00190 gene tsaB 27883 27191 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199104.1 protein_id gnl|my_center|LOCUS_00190 27968 28378 gene locus_tag LOCUS_00200 27968 28378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 28600 28524 gene locus_tag LOCUS_t00020 28600 28524 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 29095 28847 gene locus_tag LOCUS_00210 29095 28847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 29669 29277 gene locus_tag LOCUS_00220 29669 29277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 30793 30056 gene locus_tag LOCUS_00230 30793 30056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 30826 31029 gene locus_tag LOCUS_00240 30826 31029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 31623 30976 gene locus_tag LOCUS_00250 31623 30976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 34273 31826 gene locus_tag LOCUS_00260 34273 31826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 35730 34321 gene locus_tag LOCUS_00270 35730 34321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 37724 35727 gene locus_tag LOCUS_00280 37724 35727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00280 39050 38974 gene locus_tag LOCUS_t00030 39050 38974 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 40889 39108 gene locus_tag LOCUS_00290 40889 39108 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191791.1 protein_id gnl|my_center|LOCUS_00290 44000 41172 gene locus_tag LOCUS_00300 44000 41172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 46262 44208 gene locus_tag LOCUS_00310 gene paaZ 46262 44208 CDS product phenylacetic acid degradation bifunctional protein PaaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186481.1 protein_id gnl|my_center|LOCUS_00310 46918 46319 gene locus_tag LOCUS_00320 gene caiE 46918 46319 CDS product carnitine operon protein CaiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122894.1 protein_id gnl|my_center|LOCUS_00320 48136 46934 gene locus_tag LOCUS_00330 gene pcaF 48136 46934 CDS product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039581.1 protein_id gnl|my_center|LOCUS_00330 49504 48176 gene locus_tag LOCUS_00340 gene paaF 49504 48176 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931072.1 protein_id gnl|my_center|LOCUS_00340 50047 49565 gene locus_tag LOCUS_00350 gene paaI 50047 49565 CDS product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813284.1 protein_id gnl|my_center|LOCUS_00350 50985 50182 gene locus_tag LOCUS_00360 gene paaG 50985 50182 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064015.1 protein_id gnl|my_center|LOCUS_00360 52062 50986 gene locus_tag LOCUS_00370 gene paaK 52062 50986 CDS product phenylacetate-CoA oxygenase/reductase subunit PaaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813290.1 protein_id gnl|my_center|LOCUS_00370 52626 52096 gene locus_tag LOCUS_00380 gene paaJ 52626 52096 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931075.1 protein_id gnl|my_center|LOCUS_00380 53399 52620 gene locus_tag LOCUS_00390 gene paaC 53399 52620 CDS product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329397.1 protein_id gnl|my_center|LOCUS_00390 53733 53446 gene locus_tag LOCUS_00400 gene paaB 53733 53446 CDS product 1,2-phenylacetyl-CoA epoxidase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813296.1 protein_id gnl|my_center|LOCUS_00400 54738 53749 gene locus_tag LOCUS_00410 gene paaA 54738 53749 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813298.1 protein_id gnl|my_center|LOCUS_00410 54959 55885 gene locus_tag LOCUS_00420 gene paaX 54959 55885 CDS product phenylacetic acid degradation operon negative regulatory protein PaaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931077.1 protein_id gnl|my_center|LOCUS_00420 57567 55981 gene locus_tag LOCUS_00430 gene aceB 57567 55981 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193967.1 protein_id gnl|my_center|LOCUS_00430 58281 57601 gene locus_tag LOCUS_00440 58281 57601 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204015.1 protein_id gnl|my_center|LOCUS_00440 58448 59353 gene locus_tag LOCUS_00450 58448 59353 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266649.1 protein_id gnl|my_center|LOCUS_00450 59782 62370 gene locus_tag LOCUS_00460 59782 62370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 62439 63875 gene locus_tag LOCUS_00470 62439 63875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00470 64114 66531 gene locus_tag LOCUS_00480 64114 66531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 66575 66856 gene locus_tag LOCUS_00490 66575 66856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 67320 68111 gene locus_tag LOCUS_00500 67320 68111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 69050 69487 gene locus_tag LOCUS_00510 69050 69487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 69528 69983 gene locus_tag LOCUS_00520 69528 69983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 70151 70453 gene locus_tag LOCUS_00530 70151 70453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 70482 70664 gene locus_tag LOCUS_00540 70482 70664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 70648 71094 gene locus_tag LOCUS_00550 70648 71094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 71954 72601 gene locus_tag LOCUS_00560 71954 72601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 74237 72954 gene locus_tag LOCUS_00570 74237 72954 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035678.1 protein_id gnl|my_center|LOCUS_00570 74455 74234 gene locus_tag LOCUS_00580 74455 74234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 74496 74963 gene locus_tag LOCUS_00590 74496 74963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 74989 75408 gene locus_tag LOCUS_00600 74989 75408 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082839.1 protein_id gnl|my_center|LOCUS_00600 77293 75581 gene locus_tag LOCUS_00610 77293 75581 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524029.1 protein_id gnl|my_center|LOCUS_00610 77730 77527 gene locus_tag LOCUS_00620 77730 77527 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217533.1 protein_id gnl|my_center|LOCUS_00620 78803 78006 gene locus_tag LOCUS_00630 78803 78006 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930573.1 protein_id gnl|my_center|LOCUS_00630 79341 78862 gene locus_tag LOCUS_00640 79341 78862 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029306122.1 protein_id gnl|my_center|LOCUS_00640 79557 80759 gene locus_tag LOCUS_00650 79557 80759 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087747.1 protein_id gnl|my_center|LOCUS_00650 80784 82937 gene locus_tag LOCUS_00660 80784 82937 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100703.1 protein_id gnl|my_center|LOCUS_00660 83039 83569 gene locus_tag LOCUS_00670 83039 83569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 83566 84573 gene locus_tag LOCUS_00680 83566 84573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 84936 84613 gene locus_tag LOCUS_00690 84936 84613 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818584.1 protein_id gnl|my_center|LOCUS_00690 85060 85398 gene locus_tag LOCUS_00700 85060 85398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 85876 85580 gene locus_tag LOCUS_00710 85876 85580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 86600 85947 gene locus_tag LOCUS_00720 86600 85947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 87396 86593 gene locus_tag LOCUS_00730 87396 86593 CDS product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931500.1 protein_id gnl|my_center|LOCUS_00730 88334 87393 gene locus_tag LOCUS_00740 88334 87393 CDS product CysB family HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193435.1 protein_id gnl|my_center|LOCUS_00740 88668 89093 gene locus_tag LOCUS_00750 88668 89093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00750 89178 90884 gene locus_tag LOCUS_00760 89178 90884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00760 92069 90903 gene locus_tag LOCUS_00770 92069 90903 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812588.1 protein_id gnl|my_center|LOCUS_00770 93115 92129 gene locus_tag LOCUS_00780 93115 92129 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536264.1 protein_id gnl|my_center|LOCUS_00780 93358 95121 gene locus_tag LOCUS_00790 93358 95121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 96298 95204 gene locus_tag LOCUS_00800 96298 95204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943375.1 protein_id gnl|my_center|LOCUS_00800 96850 98601 gene locus_tag LOCUS_00810 96850 98601 CDS product DUF885 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036537.1 protein_id gnl|my_center|LOCUS_00810 98906 99790 gene locus_tag LOCUS_00820 98906 99790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 101760 99871 gene locus_tag LOCUS_00830 gene prpE 101760 99871 CDS product propionate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010226.1 protein_id gnl|my_center|LOCUS_00830 103188 102004 gene locus_tag LOCUS_00840 gene prpF 103188 102004 CDS product 2-methylaconitate cis-trans isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187247.1 protein_id gnl|my_center|LOCUS_00840 105860 103266 gene locus_tag LOCUS_00850 gene acnD 105860 103266 CDS product Fe/S-dependent 2-methylisocitrate dehydratase AcnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188189.1 protein_id gnl|my_center|LOCUS_00850 106402 105929 gene locus_tag LOCUS_00860 106402 105929 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029305.1 protein_id gnl|my_center|LOCUS_00860 107580 106432 gene locus_tag LOCUS_00870 gene prpC 107580 106432 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187967.1 protein_id gnl|my_center|LOCUS_00870 108567 107677 gene locus_tag LOCUS_00880 gene prpB 108567 107677 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103044.1 protein_id gnl|my_center|LOCUS_00880 108916 110532 gene locus_tag LOCUS_00890 gene prpR 108916 110532 CDS product propionate catabolism operon regulatory protein PrpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205290.1 protein_id gnl|my_center|LOCUS_00890 110702 111067 gene locus_tag LOCUS_00900 110702 111067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 111064 111675 gene locus_tag LOCUS_00910 111064 111675 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359194.1 protein_id gnl|my_center|LOCUS_00910 111675 112706 gene locus_tag LOCUS_00920 111675 112706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 112833 113714 gene locus_tag LOCUS_00930 112833 113714 CDS product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403547.1 protein_id gnl|my_center|LOCUS_00930 113726 114598 gene locus_tag LOCUS_00940 113726 114598 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113154.1 protein_id gnl|my_center|LOCUS_00940 114679 115443 gene locus_tag LOCUS_00950 114679 115443 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103283.1 protein_id gnl|my_center|LOCUS_00950 115440 116243 gene locus_tag LOCUS_00960 gene phnE 115440 116243 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266574.1 protein_id gnl|my_center|LOCUS_00960 116258 116992 gene locus_tag LOCUS_00970 116258 116992 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567984.1 protein_id gnl|my_center|LOCUS_00970 118404 117013 gene locus_tag LOCUS_00980 118404 117013 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889640.1 protein_id gnl|my_center|LOCUS_00980 119545 118418 gene locus_tag LOCUS_00990 119545 118418 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201163.1 protein_id gnl|my_center|LOCUS_00990 119853 120812 gene locus_tag LOCUS_01000 119853 120812 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065125.1 protein_id gnl|my_center|LOCUS_01000 121043 123757 gene locus_tag LOCUS_01010 121043 123757 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114864.1 protein_id gnl|my_center|LOCUS_01010 123927 125171 gene locus_tag LOCUS_01020 123927 125171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 125588 127201 gene locus_tag LOCUS_01030 125588 127201 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543739.1 protein_id gnl|my_center|LOCUS_01030 128802 127216 gene locus_tag LOCUS_01040 128802 127216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 129337 129002 gene locus_tag LOCUS_01050 129337 129002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 129688 130149 gene locus_tag LOCUS_01060 129688 130149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 130365 132482 gene locus_tag LOCUS_01070 130365 132482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 132574 132819 gene locus_tag LOCUS_01080 132574 132819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 135799 132911 gene locus_tag LOCUS_01090 gene gcvP 135799 132911 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195877.1 protein_id gnl|my_center|LOCUS_01090 136297 135920 gene locus_tag LOCUS_01100 gene gcvH 136297 135920 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195879.1 protein_id gnl|my_center|LOCUS_01100 137482 136352 gene locus_tag LOCUS_01110 gene gcvT 137482 136352 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202927.1 protein_id gnl|my_center|LOCUS_01110 138220 139605 gene locus_tag LOCUS_01120 138220 139605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 142139 139737 gene locus_tag LOCUS_01130 gene hacB 142139 139737 CDS product N-acylhomoserine lactone acylase HacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112940.1 protein_id gnl|my_center|LOCUS_01130 143605 142205 gene locus_tag LOCUS_01140 143605 142205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 143866 145683 gene locus_tag LOCUS_01150 143866 145683 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337351.1 protein_id gnl|my_center|LOCUS_01150 146339 145737 gene locus_tag LOCUS_01160 146339 145737 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967995.1 protein_id gnl|my_center|LOCUS_01160 146492 147712 gene locus_tag LOCUS_01170 146492 147712 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037790.1 protein_id gnl|my_center|LOCUS_01170 148267 149658 gene locus_tag LOCUS_01180 148267 149658 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192263.1 protein_id gnl|my_center|LOCUS_01180 151104 149866 gene locus_tag LOCUS_01190 151104 149866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 151718 151290 gene locus_tag LOCUS_01200 151718 151290 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200660.1 protein_id gnl|my_center|LOCUS_01200 152413 151979 gene locus_tag LOCUS_01210 152413 151979 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118000.1 protein_id gnl|my_center|LOCUS_01210 153474 152593 gene locus_tag LOCUS_01220 153474 152593 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206608.1 protein_id gnl|my_center|LOCUS_01220 154301 153630 gene locus_tag LOCUS_01230 154301 153630 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206609.1 protein_id gnl|my_center|LOCUS_01230 155513 157297 gene locus_tag LOCUS_01240 155513 157297 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206612.1 protein_id gnl|my_center|LOCUS_01240 157434 159221 gene locus_tag LOCUS_01250 157434 159221 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206613.1 protein_id gnl|my_center|LOCUS_01250 159272 160210 gene locus_tag LOCUS_01260 159272 160210 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069490.1 protein_id gnl|my_center|LOCUS_01260 160220 161335 gene locus_tag LOCUS_01270 160220 161335 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206615.1 protein_id gnl|my_center|LOCUS_01270 161345 163045 gene locus_tag LOCUS_01280 161345 163045 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206616.1 protein_id gnl|my_center|LOCUS_01280 163125 163667 gene locus_tag LOCUS_01290 163125 163667 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108825999.1 protein_id gnl|my_center|LOCUS_01290 164013 165443 gene locus_tag LOCUS_01300 164013 165443 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187957.1 protein_id gnl|my_center|LOCUS_01300 165443 166765 gene locus_tag LOCUS_01310 165443 166765 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113322.1 protein_id gnl|my_center|LOCUS_01310 167156 167950 gene locus_tag LOCUS_01320 gene fabI 167156 167950 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191586.1 protein_id gnl|my_center|LOCUS_01320 168011 169222 gene locus_tag LOCUS_01330 gene bcsZ 168011 169222 CDS product cellulose synthase complex periplasmic endoglucanase BcsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817393.1 protein_id gnl|my_center|LOCUS_01330 169718 169464 gene locus_tag LOCUS_01340 169718 169464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 169865 171322 gene locus_tag LOCUS_01350 169865 171322 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192408.1 protein_id gnl|my_center|LOCUS_01350 171598 172656 gene locus_tag LOCUS_01360 gene selD 171598 172656 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551284.1 protein_id gnl|my_center|LOCUS_01360 172691 173626 gene locus_tag LOCUS_01370 gene tal 172691 173626 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533671.1 protein_id gnl|my_center|LOCUS_01370 173700 174338 gene locus_tag LOCUS_01380 173700 174338 CDS product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765580.1 protein_id gnl|my_center|LOCUS_01380 174340 175035 gene locus_tag LOCUS_01390 174340 175035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 175072 175764 gene locus_tag LOCUS_01400 175072 175764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 177472 175838 gene locus_tag LOCUS_01410 177472 175838 CDS product FapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941180.1 protein_id gnl|my_center|LOCUS_01410 178353 177655 gene locus_tag LOCUS_01420 178353 177655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 178633 179040 gene locus_tag LOCUS_01430 178633 179040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 180476 179037 gene locus_tag LOCUS_01440 180476 179037 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204929.1 protein_id gnl|my_center|LOCUS_01440 181485 180688 gene locus_tag LOCUS_01450 181485 180688 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086933.1 protein_id gnl|my_center|LOCUS_01450 182414 181497 gene locus_tag LOCUS_01460 182414 181497 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526312.1 protein_id gnl|my_center|LOCUS_01460 183527 182514 gene locus_tag LOCUS_01470 gene cobD 183527 182514 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268580.1 protein_id gnl|my_center|LOCUS_01470 184473 183520 gene locus_tag LOCUS_01480 gene cbiB 184473 183520 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038177.1 protein_id gnl|my_center|LOCUS_01480 185045 184467 gene locus_tag LOCUS_01490 gene cobU 185045 184467 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038175.1 protein_id gnl|my_center|LOCUS_01490 186403 185042 gene locus_tag LOCUS_01500 186403 185042 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082590.1 protein_id gnl|my_center|LOCUS_01500 187023 186397 gene locus_tag LOCUS_01510 gene cobO 187023 186397 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086769.1 protein_id gnl|my_center|LOCUS_01510 187847 187074 gene locus_tag LOCUS_01520 187847 187074 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192006.1 protein_id gnl|my_center|LOCUS_01520 188857 187847 gene locus_tag LOCUS_01530 188857 187847 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192857.1 protein_id gnl|my_center|LOCUS_01530 190958 189069 gene locus_tag LOCUS_01540 190958 189069 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815090.1 protein_id gnl|my_center|LOCUS_01540 191788 191429 gene locus_tag LOCUS_01550 191788 191429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 192383 191829 gene locus_tag LOCUS_01560 gene cobC 192383 191829 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963576.1 protein_id gnl|my_center|LOCUS_01560 193153 192380 gene locus_tag LOCUS_01570 193153 192380 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963577.1 protein_id gnl|my_center|LOCUS_01570 194216 193179 gene locus_tag LOCUS_01580 gene cobT 194216 193179 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193123.1 protein_id gnl|my_center|LOCUS_01580 194622 194224 gene locus_tag LOCUS_01590 194622 194224 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002902.1 protein_id gnl|my_center|LOCUS_01590 194865 195644 gene locus_tag LOCUS_01600 194865 195644 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524720.1 protein_id gnl|my_center|LOCUS_01600 197290 195758 gene locus_tag LOCUS_01610 197290 195758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 198320 197655 gene locus_tag LOCUS_01620 198320 197655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 198960 198412 gene locus_tag LOCUS_01630 198960 198412 CDS product DUF3313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084032.1 protein_id gnl|my_center|LOCUS_01630 199283 199900 gene locus_tag LOCUS_01640 199283 199900 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403787.1 protein_id gnl|my_center|LOCUS_01640 200463 200002 gene locus_tag LOCUS_01650 200463 200002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 201047 200628 gene locus_tag LOCUS_01660 201047 200628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 203461 201296 gene locus_tag LOCUS_01670 203461 201296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 204421 203741 gene locus_tag LOCUS_01680 gene lepB 204421 203741 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072829.1 protein_id gnl|my_center|LOCUS_01680 205563 204550 gene locus_tag LOCUS_01690 gene gap 205563 204550 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194065.1 protein_id gnl|my_center|LOCUS_01690 206369 205770 gene locus_tag LOCUS_01700 206369 205770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 208351 206384 gene locus_tag LOCUS_01710 gene tkt 208351 206384 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522066.1 protein_id gnl|my_center|LOCUS_01710 208574 211981 gene locus_tag LOCUS_01720 208574 211981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 211992 213281 gene locus_tag LOCUS_01730 211992 213281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 213295 213789 gene locus_tag LOCUS_01740 213295 213789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 213789 214922 gene locus_tag LOCUS_01750 213789 214922 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098746.1 protein_id gnl|my_center|LOCUS_01750 214931 215338 gene locus_tag LOCUS_01760 214931 215338 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483612.1 protein_id gnl|my_center|LOCUS_01760 215536 216261 gene locus_tag LOCUS_01770 215536 216261 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194189.1 protein_id gnl|my_center|LOCUS_01770 216611 217042 gene locus_tag LOCUS_01780 216611 217042 CDS product YidB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192851.1 protein_id gnl|my_center|LOCUS_01780 218858 217140 gene locus_tag LOCUS_01790 218858 217140 CDS product AIPR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929046.1 protein_id gnl|my_center|LOCUS_01790 219660 219019 gene locus_tag LOCUS_01800 219660 219019 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390717.1 protein_id gnl|my_center|LOCUS_01800 220586 219684 gene locus_tag LOCUS_01810 220586 219684 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973213.1 protein_id gnl|my_center|LOCUS_01810 221300 220692 gene locus_tag LOCUS_01820 221300 220692 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001891245.1 protein_id gnl|my_center|LOCUS_01820 221476 222024 gene locus_tag LOCUS_01830 221476 222024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 225108 222289 gene locus_tag LOCUS_01840 225108 222289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 225827 227464 gene locus_tag LOCUS_01850 225827 227464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 228624 227602 gene locus_tag LOCUS_01860 228624 227602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 229487 229735 gene locus_tag LOCUS_01870 229487 229735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 230156 230072 gene locus_tag LOCUS_t00040 230156 230072 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 230360 230276 gene locus_tag LOCUS_t00050 230360 230276 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 231888 230611 gene locus_tag LOCUS_01880 231888 230611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 232181 231993 gene locus_tag LOCUS_01890 232181 231993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 232609 232525 gene locus_tag LOCUS_t00060 232609 232525 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 232750 232662 gene locus_tag LOCUS_t00070 232750 232662 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 232944 232860 gene locus_tag LOCUS_t00080 232944 232860 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 233181 233097 gene locus_tag LOCUS_t00090 233181 233097 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 233283 233209 gene locus_tag LOCUS_t00100 233283 233209 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 233451 233376 gene locus_tag LOCUS_t00110 233451 233376 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 233544 233468 gene locus_tag LOCUS_t00120 233544 233468 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 233927 233688 gene locus_tag LOCUS_01900 233927 233688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 236146 234359 gene locus_tag LOCUS_01910 236146 234359 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072522.1 protein_id gnl|my_center|LOCUS_01910 236482 237630 gene locus_tag LOCUS_01920 236482 237630 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535007.1 protein_id gnl|my_center|LOCUS_01920 237909 237679 gene locus_tag LOCUS_01930 237909 237679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 237931 238350 gene locus_tag LOCUS_01940 237931 238350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 238495 239472 gene locus_tag LOCUS_01950 238495 239472 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535897.1 protein_id gnl|my_center|LOCUS_01950 239544 242408 gene locus_tag LOCUS_01960 gene ileS 239544 242408 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185348.1 protein_id gnl|my_center|LOCUS_01960 242659 243192 gene locus_tag LOCUS_01970 gene lspA 242659 243192 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186086.1 protein_id gnl|my_center|LOCUS_01970 243204 244424 gene locus_tag LOCUS_01980 gene coaBC 243204 244424 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186216.1 protein_id gnl|my_center|LOCUS_01980 244471 244932 gene locus_tag LOCUS_01990 gene dut 244471 244932 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812576.1 protein_id gnl|my_center|LOCUS_01990 >Feature sequence012 1140 1829 gene locus_tag LOCUS_02000 gene aqpZ 1140 1829 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705214.1 protein_id gnl|my_center|LOCUS_02000 1965 2531 gene locus_tag LOCUS_02010 1965 2531 CDS product DUF1415 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527819.1 protein_id gnl|my_center|LOCUS_02010 3022 4236 gene locus_tag LOCUS_02020 3022 4236 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191166.1 protein_id gnl|my_center|LOCUS_02020 4339 4430 gene locus_tag LOCUS_t00130 4339 4430 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5694 4585 gene locus_tag LOCUS_02030 5694 4585 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075901854.1 protein_id gnl|my_center|LOCUS_02030 6212 8305 gene locus_tag LOCUS_02040 gene cyaB 6212 8305 CDS product cyclolysin T1SS permease/ATPase CyaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929996.1 protein_id gnl|my_center|LOCUS_02040 8355 9203 gene locus_tag LOCUS_02050 8355 9203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 9435 10004 gene locus_tag LOCUS_02060 9435 10004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 10290 10060 gene locus_tag LOCUS_02070 10290 10060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 10892 22369 gene locus_tag LOCUS_02080 10892 22369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 22533 23912 gene locus_tag LOCUS_02090 22533 23912 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816283.1 protein_id gnl|my_center|LOCUS_02090 23930 25273 gene locus_tag LOCUS_02100 23930 25273 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815100.1 protein_id gnl|my_center|LOCUS_02100 25510 25989 gene locus_tag LOCUS_02110 25510 25989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 25999 26532 gene locus_tag LOCUS_02120 25999 26532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 26529 27602 gene locus_tag LOCUS_02130 26529 27602 CDS product PilW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946367.1 protein_id gnl|my_center|LOCUS_02130 27602 28186 gene locus_tag LOCUS_02140 27602 28186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 28197 31550 gene locus_tag LOCUS_02150 28197 31550 CDS product PilC/PilY family type IV pilus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704651.1 protein_id gnl|my_center|LOCUS_02150 31562 31906 gene locus_tag LOCUS_02160 31562 31906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 31918 32343 gene locus_tag LOCUS_02170 31918 32343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 32551 33492 gene locus_tag LOCUS_02180 32551 33492 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388962.1 protein_id gnl|my_center|LOCUS_02180 34319 33603 gene locus_tag LOCUS_02190 34319 33603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 34583 35269 gene locus_tag LOCUS_02200 gene bprR 34583 35269 CDS product two-component system response regulator BprR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523775.1 protein_id gnl|my_center|LOCUS_02200 35295 36629 gene locus_tag LOCUS_02210 gene bprS 35295 36629 CDS product two-component system sensor histidine kinase BprS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527959.1 protein_id gnl|my_center|LOCUS_02210 36830 37867 gene locus_tag LOCUS_02220 gene gmd 36830 37867 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414986.1 protein_id gnl|my_center|LOCUS_02220 37926 39053 gene locus_tag LOCUS_02230 gene wbpZ 37926 39053 CDS product D-rhamnosyltransferase WbpZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114105.1 protein_id gnl|my_center|LOCUS_02230 39187 39981 gene locus_tag LOCUS_02240 39187 39981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 39997 40749 gene locus_tag LOCUS_02250 39997 40749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 41031 40852 gene locus_tag LOCUS_02260 41031 40852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 41301 43514 gene locus_tag LOCUS_02270 gene cirA 41301 43514 CDS product catecholate siderophore receptor CirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489254.1 protein_id gnl|my_center|LOCUS_02270 44149 43658 gene locus_tag LOCUS_02280 44149 43658 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038213.1 protein_id gnl|my_center|LOCUS_02280 44449 45042 gene locus_tag LOCUS_02290 gene pnuC 44449 45042 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108279.1 protein_id gnl|my_center|LOCUS_02290 45030 45554 gene locus_tag LOCUS_02300 45030 45554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 48298 45656 gene locus_tag LOCUS_02310 48298 45656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 48974 49642 gene locus_tag LOCUS_02320 48974 49642 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556719.1 protein_id gnl|my_center|LOCUS_02320 49664 51019 gene locus_tag LOCUS_02330 49664 51019 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266474.1 protein_id gnl|my_center|LOCUS_02330 51635 52147 gene locus_tag LOCUS_02340 51635 52147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 52337 53098 gene locus_tag LOCUS_02350 52337 53098 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266561.1 protein_id gnl|my_center|LOCUS_02350 53104 53967 gene locus_tag LOCUS_02360 53104 53967 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196438.1 protein_id gnl|my_center|LOCUS_02360 54827 53964 gene locus_tag LOCUS_02370 54827 53964 CDS product O-acetylserine/cysteine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011216362.1 protein_id gnl|my_center|LOCUS_02370 55435 54956 gene locus_tag LOCUS_02380 gene sixA 55435 54956 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197673.1 protein_id gnl|my_center|LOCUS_02380 57664 55448 gene locus_tag LOCUS_02390 gene ppk1 57664 55448 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039238.1 protein_id gnl|my_center|LOCUS_02390 57771 58907 gene locus_tag LOCUS_02400 gene pstS 57771 58907 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930170.1 protein_id gnl|my_center|LOCUS_02400 58997 60043 gene locus_tag LOCUS_02410 gene pstC 58997 60043 CDS product phosphate ABC transporter permease PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193912.1 protein_id gnl|my_center|LOCUS_02410 60043 60915 gene locus_tag LOCUS_02420 gene pstA 60043 60915 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521821.1 protein_id gnl|my_center|LOCUS_02420 60929 61708 gene locus_tag LOCUS_02430 gene pstB 60929 61708 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930167.1 protein_id gnl|my_center|LOCUS_02430 61846 62523 gene locus_tag LOCUS_02440 gene phoU 61846 62523 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071865.1 protein_id gnl|my_center|LOCUS_02440 62533 63219 gene locus_tag LOCUS_02450 gene phoB 62533 63219 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815113.1 protein_id gnl|my_center|LOCUS_02450 63554 64846 gene locus_tag LOCUS_02460 gene phoR 63554 64846 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197666.1 protein_id gnl|my_center|LOCUS_02460 65180 66670 gene locus_tag LOCUS_02470 65180 66670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 67009 66767 gene locus_tag LOCUS_02480 67009 66767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 68870 67047 gene locus_tag LOCUS_02490 68870 67047 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527809.1 protein_id gnl|my_center|LOCUS_02490 69546 69067 gene locus_tag LOCUS_02500 69546 69067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 71643 69571 gene locus_tag LOCUS_02510 gene metG 71643 69571 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039014.1 protein_id gnl|my_center|LOCUS_02510 72878 71784 gene locus_tag LOCUS_02520 72878 71784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 73423 76347 gene locus_tag LOCUS_02530 73423 76347 CDS product DUF4982 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108444.1 protein_id gnl|my_center|LOCUS_02530 77488 76412 gene locus_tag LOCUS_02540 77488 76412 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981551.1 protein_id gnl|my_center|LOCUS_02540 77992 77522 gene locus_tag LOCUS_02550 77992 77522 CDS product DUF2269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920736.1 protein_id gnl|my_center|LOCUS_02550 79290 77989 gene locus_tag LOCUS_02560 79290 77989 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947032.1 protein_id gnl|my_center|LOCUS_02560 79737 79300 gene locus_tag LOCUS_02570 79737 79300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 80428 79892 gene locus_tag LOCUS_02580 80428 79892 CDS product GbsR/MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815169.1 protein_id gnl|my_center|LOCUS_02580 80531 81142 gene locus_tag LOCUS_02590 80531 81142 CDS product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706410.1 protein_id gnl|my_center|LOCUS_02590 82504 81191 gene locus_tag LOCUS_02600 82504 81191 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267912.1 protein_id gnl|my_center|LOCUS_02600 83962 82604 gene locus_tag LOCUS_02610 gene gudD 83962 82604 CDS product glucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268234.1 protein_id gnl|my_center|LOCUS_02610 84409 85980 gene locus_tag LOCUS_02620 84409 85980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 86728 86036 gene locus_tag LOCUS_02630 86728 86036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 86910 87998 gene locus_tag LOCUS_02640 gene apbC 86910 87998 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567450.1 protein_id gnl|my_center|LOCUS_02640 88012 89124 gene locus_tag LOCUS_02650 gene ribD 88012 89124 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527563.1 protein_id gnl|my_center|LOCUS_02650 89267 89191 gene locus_tag LOCUS_t00140 89267 89191 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 89447 89371 gene locus_tag LOCUS_t00150 89447 89371 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 90415 89531 gene locus_tag LOCUS_02660 90415 89531 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003696870.1 protein_id gnl|my_center|LOCUS_02660 90332 90550 gene locus_tag LOCUS_02670 90332 90550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 90607 92019 gene locus_tag LOCUS_02680 gene gltX 90607 92019 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814917.1 protein_id gnl|my_center|LOCUS_02680 92085 92160 gene locus_tag LOCUS_t00160 92085 92160 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 92192 92267 gene locus_tag LOCUS_t00170 92192 92267 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 92328 92403 gene locus_tag LOCUS_t00180 92328 92403 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 93608 92553 gene locus_tag LOCUS_02690 93608 92553 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522973.1 protein_id gnl|my_center|LOCUS_02690 93859 95418 gene locus_tag LOCUS_02700 93859 95418 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552290.1 protein_id gnl|my_center|LOCUS_02700 97119 95542 gene locus_tag LOCUS_02710 97119 95542 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267761.1 protein_id gnl|my_center|LOCUS_02710 97411 97172 gene locus_tag LOCUS_02720 97411 97172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 97472 99055 gene locus_tag LOCUS_02730 97472 99055 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144201.1 protein_id gnl|my_center|LOCUS_02730 99121 100374 gene locus_tag LOCUS_02740 99121 100374 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929473.1 protein_id gnl|my_center|LOCUS_02740 100809 100507 gene locus_tag LOCUS_02750 100809 100507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 101070 102107 gene locus_tag LOCUS_02760 101070 102107 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038713.1 protein_id gnl|my_center|LOCUS_02760 102107 102766 gene locus_tag LOCUS_02770 102107 102766 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097004.1 protein_id gnl|my_center|LOCUS_02770 102797 103609 gene locus_tag LOCUS_02780 102797 103609 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768450.1 protein_id gnl|my_center|LOCUS_02780 104213 103695 gene locus_tag LOCUS_02790 gene efp 104213 103695 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193484.1 protein_id gnl|my_center|LOCUS_02790 105605 104385 gene locus_tag LOCUS_02800 gene earP 105605 104385 CDS product elongation factor P maturation arginine rhamnosyltransferase EarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203004.1 protein_id gnl|my_center|LOCUS_02800 106405 105623 gene locus_tag LOCUS_02810 gene gloB 106405 105623 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927090.1 protein_id gnl|my_center|LOCUS_02810 106414 107187 gene locus_tag LOCUS_02820 106414 107187 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192921.1 protein_id gnl|my_center|LOCUS_02820 107180 107614 gene locus_tag LOCUS_02830 gene rnhA 107180 107614 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921194.1 protein_id gnl|my_center|LOCUS_02830 107626 108525 gene locus_tag LOCUS_02840 107626 108525 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095315.1 protein_id gnl|my_center|LOCUS_02840 108631 109572 gene locus_tag LOCUS_02850 108631 109572 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350569.1 protein_id gnl|my_center|LOCUS_02850 110463 109663 gene locus_tag LOCUS_02860 110463 109663 CDS product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096744.1 protein_id gnl|my_center|LOCUS_02860 111122 112156 gene locus_tag LOCUS_02870 111122 112156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 112175 113857 gene locus_tag LOCUS_02880 112175 113857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 113862 114404 gene locus_tag LOCUS_02890 113862 114404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 114408 115676 gene locus_tag LOCUS_02900 114408 115676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 115673 115897 gene locus_tag LOCUS_02910 115673 115897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 115931 116428 gene locus_tag LOCUS_02920 115931 116428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 117015 116509 gene locus_tag LOCUS_02930 117015 116509 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088503.1 protein_id gnl|my_center|LOCUS_02930 117514 117083 gene locus_tag LOCUS_02940 117514 117083 CDS product glyoxalase/bleomycin resistance/dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035582.1 protein_id gnl|my_center|LOCUS_02940 117720 118589 gene locus_tag LOCUS_02950 117720 118589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 118596 119882 gene locus_tag LOCUS_02960 gene tolB 118596 119882 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931417.1 protein_id gnl|my_center|LOCUS_02960 119926 120456 gene locus_tag LOCUS_02970 gene pal 119926 120456 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186227.1 protein_id gnl|my_center|LOCUS_02970 120560 121321 gene locus_tag LOCUS_02980 gene ybgF 120560 121321 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186614.1 protein_id gnl|my_center|LOCUS_02980 121401 121476 gene locus_tag LOCUS_t00190 121401 121476 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 121532 121607 gene locus_tag LOCUS_t00200 121532 121607 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 123752 121995 gene locus_tag LOCUS_02990 123752 121995 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073617.1 protein_id gnl|my_center|LOCUS_02990 124167 123937 gene locus_tag LOCUS_03000 124167 123937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 124338 124583 gene locus_tag LOCUS_03010 124338 124583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 125341 124823 gene locus_tag LOCUS_03020 125341 124823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 125800 126672 gene locus_tag LOCUS_03030 125800 126672 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198065.1 protein_id gnl|my_center|LOCUS_03030 126817 128274 gene locus_tag LOCUS_03040 gene ppx 126817 128274 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809631.1 protein_id gnl|my_center|LOCUS_03040 128871 128362 gene locus_tag LOCUS_03050 128871 128362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 131423 129303 gene locus_tag LOCUS_03060 131423 129303 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268635.1 protein_id gnl|my_center|LOCUS_03060 131787 132311 gene locus_tag LOCUS_03070 131787 132311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 133290 132394 gene locus_tag LOCUS_03080 gene rarD 133290 132394 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256111.1 protein_id gnl|my_center|LOCUS_03080 134315 133395 gene locus_tag LOCUS_03090 134315 133395 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526312.1 protein_id gnl|my_center|LOCUS_03090 135154 134315 gene locus_tag LOCUS_03100 gene panC 135154 134315 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192993.1 protein_id gnl|my_center|LOCUS_03100 136089 135232 gene locus_tag LOCUS_03110 136089 135232 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192594.1 protein_id gnl|my_center|LOCUS_03110 136353 136144 gene locus_tag LOCUS_03120 136353 136144 CDS product DUF3460 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193782.1 protein_id gnl|my_center|LOCUS_03120 137066 136473 gene locus_tag LOCUS_03130 137066 136473 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185518.1 protein_id gnl|my_center|LOCUS_03130 137734 137063 gene locus_tag LOCUS_03140 137734 137063 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203514.1 protein_id gnl|my_center|LOCUS_03140 138315 137797 gene locus_tag LOCUS_03150 138315 137797 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065147.1 protein_id gnl|my_center|LOCUS_03150 139066 138320 gene locus_tag LOCUS_03160 139066 138320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 139485 139069 gene locus_tag LOCUS_03170 139485 139069 CDS product DUF3619 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204965.1 protein_id gnl|my_center|LOCUS_03170 140054 139482 gene locus_tag LOCUS_03180 140054 139482 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186304.1 protein_id gnl|my_center|LOCUS_03180 140597 142312 gene locus_tag LOCUS_03190 140597 142312 CDS product acetolactate synthase 3 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814007.1 protein_id gnl|my_center|LOCUS_03190 142312 142803 gene locus_tag LOCUS_03200 gene ilvN 142312 142803 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186134.1 protein_id gnl|my_center|LOCUS_03200 142863 143879 gene locus_tag LOCUS_03210 gene ilvC 142863 143879 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185539.1 protein_id gnl|my_center|LOCUS_03210 144316 145179 gene locus_tag LOCUS_03220 gene pssA 144316 145179 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186682.1 protein_id gnl|my_center|LOCUS_03220 145564 147102 gene locus_tag LOCUS_03230 145564 147102 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522419.1 protein_id gnl|my_center|LOCUS_03230 147246 147515 gene locus_tag LOCUS_03240 gene rpsO 147246 147515 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185828.1 protein_id gnl|my_center|LOCUS_03240 147731 149872 gene locus_tag LOCUS_03250 gene pnp 147731 149872 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821234.1 protein_id gnl|my_center|LOCUS_03250 150033 151031 gene locus_tag LOCUS_03260 150033 151031 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196428.1 protein_id gnl|my_center|LOCUS_03260 151239 151949 gene locus_tag LOCUS_03270 gene tpiA 151239 151949 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186004.1 protein_id gnl|my_center|LOCUS_03270 152164 152550 gene locus_tag LOCUS_03280 gene secG 152164 152550 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185627.1 protein_id gnl|my_center|LOCUS_03280 152636 152720 gene locus_tag LOCUS_t00210 152636 152720 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 152836 153195 gene locus_tag LOCUS_03290 152836 153195 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186624.1 protein_id gnl|my_center|LOCUS_03290 153202 153678 gene locus_tag LOCUS_03300 153202 153678 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186402.1 protein_id gnl|my_center|LOCUS_03300 153708 154304 gene locus_tag LOCUS_03310 153708 154304 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186121.1 protein_id gnl|my_center|LOCUS_03310 154304 155557 gene locus_tag LOCUS_03320 154304 155557 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185833.1 protein_id gnl|my_center|LOCUS_03320 155595 156083 gene locus_tag LOCUS_03330 gene nuoE 155595 156083 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813932.1 protein_id gnl|my_center|LOCUS_03330 156083 157378 gene locus_tag LOCUS_03340 gene nuoF 156083 157378 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522413.1 protein_id gnl|my_center|LOCUS_03340 157411 159717 gene locus_tag LOCUS_03350 gene nuoG 157411 159717 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186393.1 protein_id gnl|my_center|LOCUS_03350 159717 160781 gene locus_tag LOCUS_03360 gene nuoH 159717 160781 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813926.1 protein_id gnl|my_center|LOCUS_03360 160794 161282 gene locus_tag LOCUS_03370 gene nuoI 160794 161282 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813924.1 protein_id gnl|my_center|LOCUS_03370 161266 161946 gene locus_tag LOCUS_03380 161266 161946 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813921.1 protein_id gnl|my_center|LOCUS_03380 161947 162261 gene locus_tag LOCUS_03390 gene nuoK 161947 162261 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185739.1 protein_id gnl|my_center|LOCUS_03390 162349 164451 gene locus_tag LOCUS_03400 gene nuoL 162349 164451 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208277753.1 protein_id gnl|my_center|LOCUS_03400 164478 165971 gene locus_tag LOCUS_03410 164478 165971 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813918.1 protein_id gnl|my_center|LOCUS_03410 166052 167527 gene locus_tag LOCUS_03420 gene nuoN 166052 167527 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813916.1 protein_id gnl|my_center|LOCUS_03420 167530 167841 gene locus_tag LOCUS_03430 167530 167841 CDS product DUF2818 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185355.1 protein_id gnl|my_center|LOCUS_03430 167834 168400 gene locus_tag LOCUS_03440 167834 168400 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185716.1 protein_id gnl|my_center|LOCUS_03440 170287 168623 gene locus_tag LOCUS_03450 170287 168623 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193882.1 protein_id gnl|my_center|LOCUS_03450 171022 171798 gene locus_tag LOCUS_03460 171022 171798 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192152.1 protein_id gnl|my_center|LOCUS_03460 171795 172241 gene locus_tag LOCUS_03470 171795 172241 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191805.1 protein_id gnl|my_center|LOCUS_03470 172915 172286 gene locus_tag LOCUS_03480 172915 172286 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191840.1 protein_id gnl|my_center|LOCUS_03480 173017 173718 gene locus_tag LOCUS_03490 173017 173718 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065123.1 protein_id gnl|my_center|LOCUS_03490 173738 174379 gene locus_tag LOCUS_03500 173738 174379 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191181.1 protein_id gnl|my_center|LOCUS_03500 175022 174498 gene locus_tag LOCUS_03510 175022 174498 CDS product DUF3617 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401328.1 protein_id gnl|my_center|LOCUS_03510 175941 175147 gene locus_tag LOCUS_03520 175941 175147 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366937.1 protein_id gnl|my_center|LOCUS_03520 176218 177087 gene locus_tag LOCUS_03530 176218 177087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 177096 177446 gene locus_tag LOCUS_03540 177096 177446 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526838.1 protein_id gnl|my_center|LOCUS_03540 177452 179689 gene locus_tag LOCUS_03550 177452 179689 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521683.1 protein_id gnl|my_center|LOCUS_03550 180671 179739 gene locus_tag LOCUS_03560 180671 179739 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957524.1 protein_id gnl|my_center|LOCUS_03560 180886 180962 gene locus_tag LOCUS_t00220 180886 180962 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 181199 183106 gene locus_tag LOCUS_03570 gene thrS 181199 183106 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191232.1 protein_id gnl|my_center|LOCUS_03570 183160 183696 gene locus_tag LOCUS_03580 gene infC 183160 183696 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071810680.1 protein_id gnl|my_center|LOCUS_03580 183876 184073 gene locus_tag LOCUS_03590 gene rpmI 183876 184073 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812834.1 protein_id gnl|my_center|LOCUS_03590 184102 184461 gene locus_tag LOCUS_03600 gene rplT 184102 184461 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192938.1 protein_id gnl|my_center|LOCUS_03600 184589 185605 gene locus_tag LOCUS_03610 gene pheS 184589 185605 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926359.1 protein_id gnl|my_center|LOCUS_03610 185680 188106 gene locus_tag LOCUS_03620 gene pheT 185680 188106 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193113.1 protein_id gnl|my_center|LOCUS_03620 188148 188561 gene locus_tag LOCUS_03630 188148 188561 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197408.1 protein_id gnl|my_center|LOCUS_03630 188570 188938 gene locus_tag LOCUS_03640 188570 188938 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161056164.1 protein_id gnl|my_center|LOCUS_03640 191066 189081 gene locus_tag LOCUS_03650 191066 189081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 191354 192136 gene locus_tag LOCUS_03660 191354 192136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 192145 193644 gene locus_tag LOCUS_03670 192145 193644 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267829.1 protein_id gnl|my_center|LOCUS_03670 193675 194925 gene locus_tag LOCUS_03680 193675 194925 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267830.1 protein_id gnl|my_center|LOCUS_03680 194935 198084 gene locus_tag LOCUS_03690 194935 198084 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267831.1 protein_id gnl|my_center|LOCUS_03690 198421 199185 gene locus_tag LOCUS_03700 198421 199185 CDS product beta-ketoacyl synthase chain length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765435.1 protein_id gnl|my_center|LOCUS_03700 199178 199951 gene locus_tag LOCUS_03710 199178 199951 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765436.1 protein_id gnl|my_center|LOCUS_03710 199944 200198 gene locus_tag LOCUS_03720 199944 200198 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067033.1 protein_id gnl|my_center|LOCUS_03720 200209 200472 gene locus_tag LOCUS_03730 200209 200472 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001987856.1 protein_id gnl|my_center|LOCUS_03730 200544 201032 gene locus_tag LOCUS_03740 200544 201032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 201025 202767 gene locus_tag LOCUS_03750 201025 202767 CDS product acyl-CoA synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765442.1 protein_id gnl|my_center|LOCUS_03750 202761 203840 gene locus_tag LOCUS_03760 202761 203840 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072813.1 protein_id gnl|my_center|LOCUS_03760 204174 203821 gene locus_tag LOCUS_03770 204174 203821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 204058 204588 gene locus_tag LOCUS_03780 204058 204588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 204585 205541 gene locus_tag LOCUS_03790 204585 205541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03790 205528 207111 gene locus_tag LOCUS_03800 205528 207111 CDS product aromatic amino acid ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707155.1 protein_id gnl|my_center|LOCUS_03800 207104 207538 gene locus_tag LOCUS_03810 207104 207538 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765450.1 protein_id gnl|my_center|LOCUS_03810 207535 208149 gene locus_tag LOCUS_03820 207535 208149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 208225 210618 gene locus_tag LOCUS_03830 208225 210618 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479011.1 protein_id gnl|my_center|LOCUS_03830 210596 211159 gene locus_tag LOCUS_03840 210596 211159 CDS product DUF3261 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815695.1 protein_id gnl|my_center|LOCUS_03840 211173 212363 gene locus_tag LOCUS_03850 211173 212363 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266391.1 protein_id gnl|my_center|LOCUS_03850 212360 212842 gene locus_tag LOCUS_03860 212360 212842 CDS product hotdog family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346295.1 protein_id gnl|my_center|LOCUS_03860 212845 213576 gene locus_tag LOCUS_03870 gene fabG 212845 213576 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222115.1 protein_id gnl|my_center|LOCUS_03870 213573 214829 gene locus_tag LOCUS_03880 213573 214829 CDS product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074037.1 protein_id gnl|my_center|LOCUS_03880 214876 215325 gene locus_tag LOCUS_03890 214876 215325 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208362.1 protein_id gnl|my_center|LOCUS_03890 215471 216073 gene locus_tag LOCUS_03900 215471 216073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 216110 216745 gene locus_tag LOCUS_03910 216110 216745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 217585 216734 gene locus_tag LOCUS_03920 217585 216734 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267748.1 protein_id gnl|my_center|LOCUS_03920 >Feature sequence013 143 1195 gene locus_tag LOCUS_03930 143 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03930 2646 2323 gene locus_tag LOCUS_03940 2646 2323 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189842.1 protein_id gnl|my_center|LOCUS_03940 3389 2643 gene locus_tag LOCUS_03950 3389 2643 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522683.1 protein_id gnl|my_center|LOCUS_03950 3695 3898 gene locus_tag LOCUS_03960 3695 3898 CDS product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197553.1 protein_id gnl|my_center|LOCUS_03960 3911 4342 gene locus_tag LOCUS_03970 3911 4342 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814197.1 protein_id gnl|my_center|LOCUS_03970 4394 5350 gene locus_tag LOCUS_03980 4394 5350 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189905.1 protein_id gnl|my_center|LOCUS_03980 5350 5973 gene locus_tag LOCUS_03990 5350 5973 CDS product DUF2946 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189390.1 protein_id gnl|my_center|LOCUS_03990 7560 5998 gene locus_tag LOCUS_04000 7560 5998 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189765.1 protein_id gnl|my_center|LOCUS_04000 7606 8109 gene locus_tag LOCUS_04010 gene moaC 7606 8109 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535462.1 protein_id gnl|my_center|LOCUS_04010 9904 8162 gene locus_tag LOCUS_04020 9904 8162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 10252 10692 gene locus_tag LOCUS_04030 10252 10692 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038214.1 protein_id gnl|my_center|LOCUS_04030 10827 11015 gene locus_tag LOCUS_04040 10827 11015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 11006 11395 gene locus_tag LOCUS_04050 11006 11395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 11379 11846 gene locus_tag LOCUS_04060 11379 11846 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038213.1 protein_id gnl|my_center|LOCUS_04060 11909 13831 gene locus_tag LOCUS_04070 11909 13831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 13863 14738 gene locus_tag LOCUS_04080 13863 14738 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259484.1 protein_id gnl|my_center|LOCUS_04080 14719 15855 gene locus_tag LOCUS_04090 14719 15855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 15852 16778 gene locus_tag LOCUS_04100 15852 16778 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331295.1 protein_id gnl|my_center|LOCUS_04100 16786 17820 gene locus_tag LOCUS_04110 16786 17820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 19578 17845 gene locus_tag LOCUS_04120 19578 17845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 19945 20547 gene locus_tag LOCUS_04130 19945 20547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 20572 21510 gene locus_tag LOCUS_04140 20572 21510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 21585 22217 gene locus_tag LOCUS_04150 21585 22217 CDS product Vat family streptogramin A O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078927652.1 protein_id gnl|my_center|LOCUS_04150 22338 22667 gene locus_tag LOCUS_04160 22338 22667 CDS product DHCW motif cupin fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809460.1 protein_id gnl|my_center|LOCUS_04160 22742 23650 gene locus_tag LOCUS_04170 22742 23650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 23740 24603 gene locus_tag LOCUS_04180 23740 24603 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109433.1 protein_id gnl|my_center|LOCUS_04180 26070 24745 gene locus_tag LOCUS_04190 26070 24745 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815100.1 protein_id gnl|my_center|LOCUS_04190 26418 26095 gene locus_tag LOCUS_04200 26418 26095 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522276.1 protein_id gnl|my_center|LOCUS_04200 27106 26456 gene locus_tag LOCUS_04210 27106 26456 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522277.1 protein_id gnl|my_center|LOCUS_04210 30349 27149 gene locus_tag LOCUS_04220 30349 27149 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207561.1 protein_id gnl|my_center|LOCUS_04220 31509 30352 gene locus_tag LOCUS_04230 31509 30352 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539146.1 protein_id gnl|my_center|LOCUS_04230 32372 31746 gene locus_tag LOCUS_04240 32372 31746 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174863573.1 protein_id gnl|my_center|LOCUS_04240 34554 32779 gene locus_tag LOCUS_04250 34554 32779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 36048 35059 gene locus_tag LOCUS_04260 36048 35059 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229210.1 protein_id gnl|my_center|LOCUS_04260 38031 36430 gene locus_tag LOCUS_04270 38031 36430 CDS product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073349.1 protein_id gnl|my_center|LOCUS_04270 38394 40808 gene locus_tag LOCUS_04280 38394 40808 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265529.1 protein_id gnl|my_center|LOCUS_04280 42707 41373 gene locus_tag LOCUS_04290 42707 41373 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584145.1 protein_id gnl|my_center|LOCUS_04290 42858 43103 gene locus_tag LOCUS_04300 42858 43103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 43637 44971 gene locus_tag LOCUS_04310 43637 44971 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786054.1 protein_id gnl|my_center|LOCUS_04310 45331 46707 gene locus_tag LOCUS_04320 45331 46707 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100955.1 protein_id gnl|my_center|LOCUS_04320 46704 47897 gene locus_tag LOCUS_04330 46704 47897 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100953.1 protein_id gnl|my_center|LOCUS_04330 50221 48038 gene locus_tag LOCUS_04340 50221 48038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 50480 51076 gene locus_tag LOCUS_04350 50480 51076 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964443.1 protein_id gnl|my_center|LOCUS_04350 52039 51161 gene locus_tag LOCUS_04360 52039 51161 CDS product proteasome-type protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174271.1 protein_id gnl|my_center|LOCUS_04360 53063 52257 gene locus_tag LOCUS_04370 53063 52257 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378608.1 protein_id gnl|my_center|LOCUS_04370 54030 53080 gene locus_tag LOCUS_04380 54030 53080 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391136.1 protein_id gnl|my_center|LOCUS_04380 55561 54119 gene locus_tag LOCUS_04390 55561 54119 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003371557.1 protein_id gnl|my_center|LOCUS_04390 56880 55942 gene locus_tag LOCUS_04400 gene purM 56880 55942 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194386.1 protein_id gnl|my_center|LOCUS_04400 57140 58225 gene locus_tag LOCUS_04410 57140 58225 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404282.1 protein_id gnl|my_center|LOCUS_04410 58222 58917 gene locus_tag LOCUS_04420 gene hda 58222 58917 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196484.1 protein_id gnl|my_center|LOCUS_04420 58919 59608 gene locus_tag LOCUS_04430 58919 59608 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194213.1 protein_id gnl|my_center|LOCUS_04430 59605 60966 gene locus_tag LOCUS_04440 gene pcnB 59605 60966 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194112.1 protein_id gnl|my_center|LOCUS_04440 60963 61448 gene locus_tag LOCUS_04450 60963 61448 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065009.1 protein_id gnl|my_center|LOCUS_04450 61500 61847 gene locus_tag LOCUS_04460 61500 61847 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071582.1 protein_id gnl|my_center|LOCUS_04460 62384 63196 gene locus_tag LOCUS_04470 gene panB 62384 63196 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194137.1 protein_id gnl|my_center|LOCUS_04470 63503 63691 gene locus_tag LOCUS_04480 63503 63691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 64996 63923 gene locus_tag LOCUS_04490 64996 63923 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074216.1 protein_id gnl|my_center|LOCUS_04490 65194 65817 gene locus_tag LOCUS_04500 65194 65817 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403760.1 protein_id gnl|my_center|LOCUS_04500 66641 68344 gene locus_tag LOCUS_04510 66641 68344 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528767.1 protein_id gnl|my_center|LOCUS_04510 68465 69178 gene locus_tag LOCUS_04520 68465 69178 CDS product YukJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172949.1 protein_id gnl|my_center|LOCUS_04520 69680 70372 gene locus_tag LOCUS_04530 gene kdpE 69680 70372 CDS product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185947.1 protein_id gnl|my_center|LOCUS_04530 70665 70417 gene locus_tag LOCUS_04540 70665 70417 CDS product TIGR02450 family Trp-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406940.1 protein_id gnl|my_center|LOCUS_04540 71165 70662 gene locus_tag LOCUS_04550 71165 70662 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369894.1 protein_id gnl|my_center|LOCUS_04550 71370 72251 gene locus_tag LOCUS_04560 71370 72251 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703345.1 protein_id gnl|my_center|LOCUS_04560 73892 72345 gene locus_tag LOCUS_04570 73892 72345 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036476.1 protein_id gnl|my_center|LOCUS_04570 74909 74220 gene locus_tag LOCUS_04580 gene can 74909 74220 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036740.1 protein_id gnl|my_center|LOCUS_04580 75829 75122 gene locus_tag LOCUS_04590 75829 75122 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526980.1 protein_id gnl|my_center|LOCUS_04590 75993 78155 gene locus_tag LOCUS_04600 75993 78155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 79013 78201 gene locus_tag LOCUS_04610 79013 78201 CDS product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190826.1 protein_id gnl|my_center|LOCUS_04610 79559 79020 gene locus_tag LOCUS_04620 79559 79020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 80182 79637 gene locus_tag LOCUS_04630 80182 79637 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933413.1 protein_id gnl|my_center|LOCUS_04630 80890 80228 gene locus_tag LOCUS_04640 80890 80228 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190506.1 protein_id gnl|my_center|LOCUS_04640 81576 80896 gene locus_tag LOCUS_04650 gene modB 81576 80896 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190258.1 protein_id gnl|my_center|LOCUS_04650 82344 81586 gene locus_tag LOCUS_04660 gene modA 82344 81586 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195689.1 protein_id gnl|my_center|LOCUS_04660 83122 82520 gene locus_tag LOCUS_04670 83122 82520 CDS product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942957.1 protein_id gnl|my_center|LOCUS_04670 86120 83196 gene locus_tag LOCUS_04680 86120 83196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 87488 86370 gene locus_tag LOCUS_04690 gene dnaJ 87488 86370 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821186.1 protein_id gnl|my_center|LOCUS_04690 89538 87598 gene locus_tag LOCUS_04700 gene dnaK 89538 87598 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039219.1 protein_id gnl|my_center|LOCUS_04700 90262 89690 gene locus_tag LOCUS_04710 gene grpE 90262 89690 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194243.1 protein_id gnl|my_center|LOCUS_04710 90801 91871 gene locus_tag LOCUS_04720 gene rfbB 90801 91871 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522250.1 protein_id gnl|my_center|LOCUS_04720 91868 92761 gene locus_tag LOCUS_04730 gene rfbA 91868 92761 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105518.1 protein_id gnl|my_center|LOCUS_04730 92765 93310 gene locus_tag LOCUS_04740 gene rfbC 92765 93310 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096184.1 protein_id gnl|my_center|LOCUS_04740 93307 94227 gene locus_tag LOCUS_04750 gene rfbD 93307 94227 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266715.1 protein_id gnl|my_center|LOCUS_04750 94297 95610 gene locus_tag LOCUS_04760 gene wzx 94297 95610 CDS product O13/O129/O135 family O-antigen flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022479.1 protein_id gnl|my_center|LOCUS_04760 95679 96569 gene locus_tag LOCUS_04770 95679 96569 CDS product rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592106.1 protein_id gnl|my_center|LOCUS_04770 97115 97849 gene locus_tag LOCUS_04780 gene wbbL 97115 97849 CDS product N-acetylglucosaminyl-diphospho-decaprenol L-rhamnosyltransferase WbbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262539.1 protein_id gnl|my_center|LOCUS_04780 97853 98806 gene locus_tag LOCUS_04790 97853 98806 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433078.1 protein_id gnl|my_center|LOCUS_04790 98819 99382 gene locus_tag LOCUS_04800 98819 99382 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919360.1 protein_id gnl|my_center|LOCUS_04800 99446 101377 gene locus_tag LOCUS_04810 99446 101377 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706692.1 protein_id gnl|my_center|LOCUS_04810 101403 102779 gene locus_tag LOCUS_04820 101403 102779 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522260.1 protein_id gnl|my_center|LOCUS_04820 103013 103960 gene locus_tag LOCUS_04830 gene waaC 103013 103960 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522261.1 protein_id gnl|my_center|LOCUS_04830 104498 104863 gene locus_tag LOCUS_04840 104498 104863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 105341 104883 gene locus_tag LOCUS_04850 105341 104883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 106069 105380 gene locus_tag LOCUS_04860 106069 105380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 106979 106134 gene locus_tag LOCUS_04870 gene kdsA 106979 106134 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096237.1 protein_id gnl|my_center|LOCUS_04870 108075 107077 gene locus_tag LOCUS_04880 108075 107077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 108591 109385 gene locus_tag LOCUS_04890 108591 109385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 109389 110666 gene locus_tag LOCUS_04900 gene waaA 109389 110666 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185503.1 protein_id gnl|my_center|LOCUS_04900 115793 110691 gene locus_tag LOCUS_04910 115793 110691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 116559 119045 gene locus_tag LOCUS_04920 116559 119045 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529996.1 protein_id gnl|my_center|LOCUS_04920 119412 122378 gene locus_tag LOCUS_04930 119412 122378 CDS product beta-glucuronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109137.1 protein_id gnl|my_center|LOCUS_04930 122472 124355 gene locus_tag LOCUS_04940 122472 124355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 126446 124530 gene locus_tag LOCUS_04950 126446 124530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 126911 128215 gene locus_tag LOCUS_04960 gene tviB 126911 128215 CDS product Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172607932.1 protein_id gnl|my_center|LOCUS_04960 128244 129287 gene locus_tag LOCUS_04970 128244 129287 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073076.1 protein_id gnl|my_center|LOCUS_04970 129831 129376 gene locus_tag LOCUS_04980 129831 129376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 130147 129977 gene locus_tag LOCUS_04990 130147 129977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 131570 130272 gene locus_tag LOCUS_05000 131570 130272 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095819.1 protein_id gnl|my_center|LOCUS_05000 131674 132576 gene locus_tag LOCUS_05010 131674 132576 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095817.1 protein_id gnl|my_center|LOCUS_05010 133352 132648 gene locus_tag LOCUS_05020 133352 132648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 133584 134006 gene locus_tag LOCUS_05030 133584 134006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 134694 134116 gene locus_tag LOCUS_05040 134694 134116 CDS product DUF4865 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027533.1 protein_id gnl|my_center|LOCUS_05040 135110 134706 gene locus_tag LOCUS_05050 135110 134706 CDS product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190990.1 protein_id gnl|my_center|LOCUS_05050 135476 135114 gene locus_tag LOCUS_05060 135476 135114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 135581 136447 gene locus_tag LOCUS_05070 135581 136447 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532847.1 protein_id gnl|my_center|LOCUS_05070 137065 136502 gene locus_tag LOCUS_05080 137065 136502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 139005 137509 gene locus_tag LOCUS_05090 139005 137509 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140949.1 protein_id gnl|my_center|LOCUS_05090 139320 139793 gene locus_tag LOCUS_05100 139320 139793 CDS product YbaK/prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705788.1 protein_id gnl|my_center|LOCUS_05100 140974 139832 gene locus_tag LOCUS_05110 140974 139832 CDS product DUF1624 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104094.1 protein_id gnl|my_center|LOCUS_05110 141382 141209 gene locus_tag LOCUS_05120 141382 141209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 142594 141386 gene locus_tag LOCUS_05130 142594 141386 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207588.1 protein_id gnl|my_center|LOCUS_05130 144062 143040 gene locus_tag LOCUS_05140 gene rtcA 144062 143040 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112809.1 protein_id gnl|my_center|LOCUS_05140 145488 144253 gene locus_tag LOCUS_05150 145488 144253 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704030.1 protein_id gnl|my_center|LOCUS_05150 148199 147087 gene locus_tag LOCUS_05160 148199 147087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05160 148657 148196 gene locus_tag LOCUS_05170 148657 148196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05170 149070 150683 gene locus_tag LOCUS_05180 gene rtcR 149070 150683 CDS product RNA repair transcriptional activator RtcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112813.1 protein_id gnl|my_center|LOCUS_05180 151655 150738 gene locus_tag LOCUS_05190 151655 150738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 152070 152807 gene locus_tag LOCUS_05200 152070 152807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 153168 154391 gene locus_tag LOCUS_05210 153168 154391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 154737 157133 gene locus_tag LOCUS_05220 154737 157133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 157626 157186 gene locus_tag LOCUS_05230 157626 157186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 158374 157736 gene locus_tag LOCUS_05240 158374 157736 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072507.1 protein_id gnl|my_center|LOCUS_05240 158558 158430 gene locus_tag LOCUS_05250 158558 158430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 159235 158924 gene locus_tag LOCUS_05260 159235 158924 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370060.1 protein_id gnl|my_center|LOCUS_05260 159860 159318 gene locus_tag LOCUS_05270 159860 159318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 160384 160566 gene locus_tag LOCUS_05280 160384 160566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 160612 161145 gene locus_tag LOCUS_05290 160612 161145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 161233 161529 gene locus_tag LOCUS_05300 161233 161529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 161893 162045 gene locus_tag LOCUS_05310 161893 162045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 162083 162415 gene locus_tag LOCUS_05320 162083 162415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 162657 164054 gene locus_tag LOCUS_05330 162657 164054 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039558.1 protein_id gnl|my_center|LOCUS_05330 164068 164247 gene locus_tag LOCUS_05340 164068 164247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 164398 164222 gene locus_tag LOCUS_05350 164398 164222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 165048 164470 gene locus_tag LOCUS_05360 165048 164470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 165968 165138 gene locus_tag LOCUS_05370 165968 165138 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092499.1 protein_id gnl|my_center|LOCUS_05370 166521 166141 gene locus_tag LOCUS_05380 166521 166141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 166769 166563 gene locus_tag LOCUS_05390 166769 166563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 166938 175610 gene locus_tag LOCUS_05400 166938 175610 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994041.1 protein_id gnl|my_center|LOCUS_05400 176839 176036 gene locus_tag LOCUS_05410 176839 176036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 177633 180833 gene locus_tag LOCUS_05420 177633 180833 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085718.1 protein_id gnl|my_center|LOCUS_05420 180830 181999 gene locus_tag LOCUS_05430 180830 181999 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085719.1 protein_id gnl|my_center|LOCUS_05430 182056 183432 gene locus_tag LOCUS_05440 182056 183432 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927123.1 protein_id gnl|my_center|LOCUS_05440 187543 183557 gene locus_tag LOCUS_05450 187543 183557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 188478 187969 gene locus_tag LOCUS_05460 188478 187969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 >Feature sequence014 <1 4016 gene locus_tag LOCUS_05470 <1 4016 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265658.1:S-layer protein RsaA 4680 4605 gene locus_tag LOCUS_t00230 4680 4605 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 4832 4757 gene locus_tag LOCUS_t00240 4832 4757 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 6106 4892 gene locus_tag LOCUS_05480 6106 4892 CDS product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930567.1 protein_id gnl|my_center|LOCUS_05480 6205 8310 gene locus_tag LOCUS_05490 gene uvrB 6205 8310 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199587.1 protein_id gnl|my_center|LOCUS_05490 8320 8817 gene locus_tag LOCUS_05500 8320 8817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 10183 8870 gene locus_tag LOCUS_05510 10183 8870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 10540 11109 gene locus_tag LOCUS_05520 10540 11109 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930417.1 protein_id gnl|my_center|LOCUS_05520 11165 11512 gene locus_tag LOCUS_05530 11165 11512 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930418.1 protein_id gnl|my_center|LOCUS_05530 14204 11634 gene locus_tag LOCUS_05540 gene cphA 14204 11634 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928938.1 protein_id gnl|my_center|LOCUS_05540 16601 14424 gene locus_tag LOCUS_05550 gene cphA 16601 14424 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447960.1 protein_id gnl|my_center|LOCUS_05550 17052 19322 gene locus_tag LOCUS_05560 17052 19322 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813559.1 protein_id gnl|my_center|LOCUS_05560 19327 19797 gene locus_tag LOCUS_05570 19327 19797 CDS product DUF1854 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930535.1 protein_id gnl|my_center|LOCUS_05570 20358 19837 gene locus_tag LOCUS_05580 20358 19837 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636204.1 protein_id gnl|my_center|LOCUS_05580 20599 21036 gene locus_tag LOCUS_05590 20599 21036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 22057 21284 gene locus_tag LOCUS_05600 gene xth 22057 21284 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193531.1 protein_id gnl|my_center|LOCUS_05600 22715 22521 gene locus_tag LOCUS_05610 22715 22521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 22636 23496 gene locus_tag LOCUS_05620 22636 23496 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114256.1 protein_id gnl|my_center|LOCUS_05620 25217 23709 gene locus_tag LOCUS_05630 25217 23709 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522572.1 protein_id gnl|my_center|LOCUS_05630 25268 26401 gene locus_tag LOCUS_05640 gene lptF 25268 26401 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192178.1 protein_id gnl|my_center|LOCUS_05640 26398 27531 gene locus_tag LOCUS_05650 gene lptG 26398 27531 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552347.1 protein_id gnl|my_center|LOCUS_05650 27531 27902 gene locus_tag LOCUS_05660 27531 27902 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526300.1 protein_id gnl|my_center|LOCUS_05660 27985 28755 gene locus_tag LOCUS_05670 27985 28755 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071686.1 protein_id gnl|my_center|LOCUS_05670 29497 28781 gene locus_tag LOCUS_05680 gene cobA 29497 28781 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192678.1 protein_id gnl|my_center|LOCUS_05680 30865 29549 gene locus_tag LOCUS_05690 30865 29549 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928137.1 protein_id gnl|my_center|LOCUS_05690 31800 30865 gene locus_tag LOCUS_05700 gene cysD 31800 30865 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813323.1 protein_id gnl|my_center|LOCUS_05700 32526 31813 gene locus_tag LOCUS_05710 32526 31813 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192841.1 protein_id gnl|my_center|LOCUS_05710 33044 32523 gene locus_tag LOCUS_05720 33044 32523 CDS product DUF934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191986.1 protein_id gnl|my_center|LOCUS_05720 34768 33062 gene locus_tag LOCUS_05730 34768 33062 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192117.1 protein_id gnl|my_center|LOCUS_05730 35591 34818 gene locus_tag LOCUS_05740 35591 34818 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194827.1 protein_id gnl|my_center|LOCUS_05740 36460 37140 gene locus_tag LOCUS_05750 gene ribB 36460 37140 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205945.1 protein_id gnl|my_center|LOCUS_05750 37204 37398 gene locus_tag LOCUS_05760 37204 37398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 37702 38625 gene locus_tag LOCUS_05770 37702 38625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 39191 38733 gene locus_tag LOCUS_05780 39191 38733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 39688 39248 gene locus_tag LOCUS_05790 gene yiaA 39688 39248 CDS product inner membrane protein YiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038893.1 protein_id gnl|my_center|LOCUS_05790 39952 40896 gene locus_tag LOCUS_05800 39952 40896 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037755.1 protein_id gnl|my_center|LOCUS_05800 41336 40995 gene locus_tag LOCUS_05810 41336 40995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 42527 41484 gene locus_tag LOCUS_05820 42527 41484 CDS product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930118.1 protein_id gnl|my_center|LOCUS_05820 43593 42547 gene locus_tag LOCUS_05830 43593 42547 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193208.1 protein_id gnl|my_center|LOCUS_05830 44411 43680 gene locus_tag LOCUS_05840 44411 43680 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192823.1 protein_id gnl|my_center|LOCUS_05840 45124 44408 gene locus_tag LOCUS_05850 gene aat 45124 44408 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814164.1 protein_id gnl|my_center|LOCUS_05850 45313 46515 gene locus_tag LOCUS_05860 45313 46515 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119782.1 protein_id gnl|my_center|LOCUS_05860 47399 46593 gene locus_tag LOCUS_05870 47399 46593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 47293 47369 gene locus_tag LOCUS_t00250 47293 47369 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 48184 47507 gene locus_tag LOCUS_05880 48184 47507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 48871 48395 gene locus_tag LOCUS_05890 48871 48395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 49852 49097 gene locus_tag LOCUS_05900 gene istB 49852 49097 CDS product IS21-like element ISPsy14 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104225.1 protein_id gnl|my_center|LOCUS_05900 51417 49852 gene locus_tag LOCUS_05910 gene istA 51417 49852 CDS product IS21-like element ISPsy14 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666649.1 protein_id gnl|my_center|LOCUS_05910 52099 51710 gene locus_tag LOCUS_05920 52099 51710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 53735 52497 gene locus_tag LOCUS_05930 53735 52497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 54985 53906 gene locus_tag LOCUS_05940 54985 53906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 57228 55264 gene locus_tag LOCUS_05950 57228 55264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 57938 58477 gene locus_tag LOCUS_05960 57938 58477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 58497 58694 gene locus_tag LOCUS_05970 58497 58694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 59212 59580 gene locus_tag LOCUS_05980 59212 59580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 59834 62047 gene locus_tag LOCUS_05990 59834 62047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 62604 63245 gene locus_tag LOCUS_06000 62604 63245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 63581 63775 gene locus_tag LOCUS_06010 63581 63775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 64544 64356 gene locus_tag LOCUS_06020 64544 64356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 65199 64528 gene locus_tag LOCUS_06030 65199 64528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 65699 65256 gene locus_tag LOCUS_06040 65699 65256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 66708 66235 gene locus_tag LOCUS_06050 66708 66235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 66992 66819 gene locus_tag LOCUS_06060 66992 66819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 67553 67065 gene locus_tag LOCUS_06070 67553 67065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 68406 67609 gene locus_tag LOCUS_06080 68406 67609 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204885.1 protein_id gnl|my_center|LOCUS_06080 68508 68981 gene locus_tag LOCUS_06090 68508 68981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 69516 69010 gene locus_tag LOCUS_06100 69516 69010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 70128 69538 gene locus_tag LOCUS_06110 70128 69538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 70955 70197 gene locus_tag LOCUS_06120 70955 70197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 71030 71272 gene locus_tag LOCUS_06130 71030 71272 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038251.1 protein_id gnl|my_center|LOCUS_06130 72357 73373 gene locus_tag LOCUS_06140 72357 73373 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093492.1 protein_id gnl|my_center|LOCUS_06140 73476 73736 gene locus_tag LOCUS_06150 73476 73736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 73934 75121 gene locus_tag LOCUS_06160 73934 75121 CDS product XyeB family radical SAM/SPASM peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162928747.1 protein_id gnl|my_center|LOCUS_06160 75118 76809 gene locus_tag LOCUS_06170 75118 76809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 77489 78985 gene locus_tag LOCUS_06180 77489 78985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 79102 79902 gene locus_tag LOCUS_06190 79102 79902 CDS product TIGR02391 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483178.1 protein_id gnl|my_center|LOCUS_06190 80338 79985 gene locus_tag LOCUS_06200 80338 79985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 80542 84903 gene locus_tag LOCUS_06210 80542 84903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 84900 86345 gene locus_tag LOCUS_06220 84900 86345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 86386 86667 gene locus_tag LOCUS_06230 86386 86667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 86936 86715 gene locus_tag LOCUS_06240 86936 86715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 87396 86974 gene locus_tag LOCUS_06250 87396 86974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 89360 87696 gene locus_tag LOCUS_06260 89360 87696 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205414.1 protein_id gnl|my_center|LOCUS_06260 89915 90547 gene locus_tag LOCUS_06270 89915 90547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 90705 91088 gene locus_tag LOCUS_06280 90705 91088 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529398.1 protein_id gnl|my_center|LOCUS_06280 91524 91090 gene locus_tag LOCUS_06290 91524 91090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 92109 93266 gene locus_tag LOCUS_06300 92109 93266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 93256 95097 gene locus_tag LOCUS_06310 93256 95097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 95408 95893 gene locus_tag LOCUS_06320 gene rimP 95408 95893 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193908.1 protein_id gnl|my_center|LOCUS_06320 95890 97449 gene locus_tag LOCUS_06330 gene nusA 95890 97449 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193517.1 protein_id gnl|my_center|LOCUS_06330 97497 100373 gene locus_tag LOCUS_06340 gene infB 97497 100373 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526850.1 protein_id gnl|my_center|LOCUS_06340 100431 100820 gene locus_tag LOCUS_06350 gene rbfA 100431 100820 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199441.1 protein_id gnl|my_center|LOCUS_06350 100907 101809 gene locus_tag LOCUS_06360 gene truB 100907 101809 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203915.1 protein_id gnl|my_center|LOCUS_06360 101933 103765 gene locus_tag LOCUS_06370 gene typA 101933 103765 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810554.1 protein_id gnl|my_center|LOCUS_06370 103874 104749 gene locus_tag LOCUS_06380 103874 104749 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530247.1 protein_id gnl|my_center|LOCUS_06380 104838 106226 gene locus_tag LOCUS_06390 gene yegQ 104838 106226 CDS product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222142.1 protein_id gnl|my_center|LOCUS_06390 106309 106605 gene locus_tag LOCUS_06400 106309 106605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 106697 107080 gene locus_tag LOCUS_06410 106697 107080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 107128 107799 gene locus_tag LOCUS_06420 107128 107799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 109026 108040 gene locus_tag LOCUS_06430 109026 108040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 109195 109743 gene locus_tag LOCUS_06440 109195 109743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 110128 109844 gene locus_tag LOCUS_06450 110128 109844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 111232 111053 gene locus_tag LOCUS_06460 111232 111053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 111322 111669 gene locus_tag LOCUS_06470 111322 111669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 112032 112406 gene locus_tag LOCUS_06480 112032 112406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 112629 112554 gene locus_tag LOCUS_t00260 112629 112554 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 113303 112737 gene locus_tag LOCUS_06490 113303 112737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 114606 113611 gene locus_tag LOCUS_06500 gene dusA 114606 113611 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009920631.1 protein_id gnl|my_center|LOCUS_06500 114964 115683 gene locus_tag LOCUS_06510 114964 115683 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072508.1 protein_id gnl|my_center|LOCUS_06510 115908 116702 gene locus_tag LOCUS_06520 115908 116702 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072508.1 protein_id gnl|my_center|LOCUS_06520 117083 117886 gene locus_tag LOCUS_06530 117083 117886 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072508.1 protein_id gnl|my_center|LOCUS_06530 118015 118836 gene locus_tag LOCUS_06540 118015 118836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 118958 120244 gene locus_tag LOCUS_06550 118958 120244 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967584.1 protein_id gnl|my_center|LOCUS_06550 121066 120302 gene locus_tag LOCUS_06560 121066 120302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 123260 121179 gene locus_tag LOCUS_06570 123260 121179 CDS product bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536127.1 protein_id gnl|my_center|LOCUS_06570 123753 124649 gene locus_tag LOCUS_06580 123753 124649 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192881.1 protein_id gnl|my_center|LOCUS_06580 125301 124804 gene locus_tag LOCUS_06590 125301 124804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 125582 125989 gene locus_tag LOCUS_06600 125582 125989 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926942.1 protein_id gnl|my_center|LOCUS_06600 126433 127458 gene locus_tag LOCUS_06610 gene carA 126433 127458 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198695.1 protein_id gnl|my_center|LOCUS_06610 127463 130681 gene locus_tag LOCUS_06620 gene carB 127463 130681 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809588.1 protein_id gnl|my_center|LOCUS_06620 130794 131285 gene locus_tag LOCUS_06630 gene greA 130794 131285 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192392.1 protein_id gnl|my_center|LOCUS_06630 131986 131510 gene locus_tag LOCUS_06640 131986 131510 CDS product YhbY family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193985.1 protein_id gnl|my_center|LOCUS_06640 132019 132663 gene locus_tag LOCUS_06650 132019 132663 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193119.1 protein_id gnl|my_center|LOCUS_06650 132785 134674 gene locus_tag LOCUS_06660 gene ftsH 132785 134674 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191694.1 protein_id gnl|my_center|LOCUS_06660 134810 135649 gene locus_tag LOCUS_06670 gene folP 134810 135649 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809626.1 protein_id gnl|my_center|LOCUS_06670 135665 137011 gene locus_tag LOCUS_06680 gene glmM 135665 137011 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266863.1 protein_id gnl|my_center|LOCUS_06680 137205 137281 gene locus_tag LOCUS_t00270 137205 137281 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 137892 139520 gene locus_tag LOCUS_06690 137892 139520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 140970 139612 gene locus_tag LOCUS_06700 140970 139612 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191226.1 protein_id gnl|my_center|LOCUS_06700 141460 141071 gene locus_tag LOCUS_06710 141460 141071 CDS product DUF2069 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812700.1 protein_id gnl|my_center|LOCUS_06710 142068 141457 gene locus_tag LOCUS_06720 gene wrbA 142068 141457 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193704.1 protein_id gnl|my_center|LOCUS_06720 142250 143506 gene locus_tag LOCUS_06730 142250 143506 CDS product YihY family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193660.1 protein_id gnl|my_center|LOCUS_06730 143503 144558 gene locus_tag LOCUS_06740 143503 144558 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878505.1 protein_id gnl|my_center|LOCUS_06740 145941 144571 gene locus_tag LOCUS_06750 gene vpsL 145941 144571 CDS product exopolysaccharide biosynthesis glycosyltransferase VpsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001889848.1 protein_id gnl|my_center|LOCUS_06750 147034 146117 gene locus_tag LOCUS_06760 147034 146117 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024331.1 protein_id gnl|my_center|LOCUS_06760 147419 148321 gene locus_tag LOCUS_06770 147419 148321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 148327 149769 gene locus_tag LOCUS_06780 148327 149769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 149762 150700 gene locus_tag LOCUS_06790 149762 150700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 150706 151662 gene locus_tag LOCUS_06800 150706 151662 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158657585.1 protein_id gnl|my_center|LOCUS_06800 151659 152708 gene locus_tag LOCUS_06810 151659 152708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 154010 152700 gene locus_tag LOCUS_06820 154010 152700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 154183 156627 gene locus_tag LOCUS_06830 154183 156627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 156965 158263 gene locus_tag LOCUS_06840 gene aceA 156965 158263 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192082.1 protein_id gnl|my_center|LOCUS_06840 158562 159053 gene locus_tag LOCUS_06850 158562 159053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 159908 159108 gene locus_tag LOCUS_06860 159908 159108 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930429.1 protein_id gnl|my_center|LOCUS_06860 160415 167140 gene locus_tag LOCUS_06870 160415 167140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 167156 168100 gene locus_tag LOCUS_06880 167156 168100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 168147 171443 gene locus_tag LOCUS_06890 168147 171443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 171952 172599 gene locus_tag LOCUS_06900 171952 172599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 172705 178797 gene locus_tag LOCUS_06910 172705 178797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 178803 179687 gene locus_tag LOCUS_06920 178803 179687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 179984 180559 gene locus_tag LOCUS_06930 179984 180559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 >Feature sequence015 279 354 gene locus_tag LOCUS_t00280 279 354 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 387 463 gene locus_tag LOCUS_t00290 387 463 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1967 1059 gene locus_tag LOCUS_06940 1967 1059 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812788.1 protein_id gnl|my_center|LOCUS_06940 2164 2694 gene locus_tag LOCUS_06950 2164 2694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 2848 4560 gene locus_tag LOCUS_06960 gene argS 2848 4560 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522947.1 protein_id gnl|my_center|LOCUS_06960 4601 5227 gene locus_tag LOCUS_06970 4601 5227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 5246 6007 gene locus_tag LOCUS_06980 gene dsbA 5246 6007 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190112.1 protein_id gnl|my_center|LOCUS_06980 6051 6830 gene locus_tag LOCUS_06990 6051 6830 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809590.1 protein_id gnl|my_center|LOCUS_06990 6835 7641 gene locus_tag LOCUS_07000 6835 7641 CDS product helical backbone metal receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962702.1 protein_id gnl|my_center|LOCUS_07000 7831 10257 gene locus_tag LOCUS_07010 7831 10257 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962806.1 protein_id gnl|my_center|LOCUS_07010 10526 11065 gene locus_tag LOCUS_07020 10526 11065 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922248.1 protein_id gnl|my_center|LOCUS_07020 11960 11067 gene locus_tag LOCUS_07030 11960 11067 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792911.1 protein_id gnl|my_center|LOCUS_07030 13907 12027 gene locus_tag LOCUS_07040 13907 12027 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767002.1 protein_id gnl|my_center|LOCUS_07040 14215 15141 gene locus_tag LOCUS_07050 14215 15141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 15611 15991 gene locus_tag LOCUS_07060 15611 15991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194998.1 protein_id gnl|my_center|LOCUS_07060 16038 16553 gene locus_tag LOCUS_07070 16038 16553 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809255.1 protein_id gnl|my_center|LOCUS_07070 16567 17397 gene locus_tag LOCUS_07080 16567 17397 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809257.1 protein_id gnl|my_center|LOCUS_07080 17682 17521 gene locus_tag LOCUS_07090 17682 17521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 17654 18373 gene locus_tag LOCUS_07100 17654 18373 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920502.1 protein_id gnl|my_center|LOCUS_07100 18389 18898 gene locus_tag LOCUS_07110 18389 18898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 18990 19421 gene locus_tag LOCUS_07120 18990 19421 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085641.1 protein_id gnl|my_center|LOCUS_07120 19482 19826 gene locus_tag LOCUS_07130 19482 19826 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189643.1 protein_id gnl|my_center|LOCUS_07130 19840 20313 gene locus_tag LOCUS_07140 19840 20313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 21427 20354 gene locus_tag LOCUS_07150 21427 20354 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189449.1 protein_id gnl|my_center|LOCUS_07150 21623 22018 gene locus_tag LOCUS_07160 21623 22018 CDS product MerR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929528.1 protein_id gnl|my_center|LOCUS_07160 22076 22402 gene locus_tag LOCUS_07170 22076 22402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 22523 22993 gene locus_tag LOCUS_07180 22523 22993 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337636.1 protein_id gnl|my_center|LOCUS_07180 23073 24257 gene locus_tag LOCUS_07190 23073 24257 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525387.1 protein_id gnl|my_center|LOCUS_07190 24263 25219 gene locus_tag LOCUS_07200 24263 25219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 25234 27015 gene locus_tag LOCUS_07210 gene aceK 25234 27015 CDS product bifunctional isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525974.1 protein_id gnl|my_center|LOCUS_07210 27107 28288 gene locus_tag LOCUS_07220 27107 28288 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815952.1 protein_id gnl|my_center|LOCUS_07220 28419 29114 gene locus_tag LOCUS_07230 28419 29114 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522956.1 protein_id gnl|my_center|LOCUS_07230 29170 30303 gene locus_tag LOCUS_07240 29170 30303 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207123.1 protein_id gnl|my_center|LOCUS_07240 30469 30864 gene locus_tag LOCUS_07250 30469 30864 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531694.1 protein_id gnl|my_center|LOCUS_07250 30861 31514 gene locus_tag LOCUS_07260 30861 31514 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448378.1 protein_id gnl|my_center|LOCUS_07260 31546 31926 gene locus_tag LOCUS_07270 31546 31926 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188900.1 protein_id gnl|my_center|LOCUS_07270 31935 33557 gene locus_tag LOCUS_07280 31935 33557 CDS product biotin-dependent carboxyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528747.1 protein_id gnl|my_center|LOCUS_07280 33580 34053 gene locus_tag LOCUS_07290 33580 34053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 34163 35017 gene locus_tag LOCUS_07300 34163 35017 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086254.1 protein_id gnl|my_center|LOCUS_07300 35218 35997 gene locus_tag LOCUS_07310 35218 35997 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201022.1 protein_id gnl|my_center|LOCUS_07310 36037 36585 gene locus_tag LOCUS_07320 36037 36585 CDS product DUF1569 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170923.1 protein_id gnl|my_center|LOCUS_07320 36597 37943 gene locus_tag LOCUS_07330 gene bioA 36597 37943 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525973.1 protein_id gnl|my_center|LOCUS_07330 37940 39226 gene locus_tag LOCUS_07340 gene bioF 37940 39226 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189736.1 protein_id gnl|my_center|LOCUS_07340 39226 39939 gene locus_tag LOCUS_07350 gene bioD 39226 39939 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530983.1 protein_id gnl|my_center|LOCUS_07350 39952 40980 gene locus_tag LOCUS_07360 gene bioB 39952 40980 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200336.1 protein_id gnl|my_center|LOCUS_07360 41124 43127 gene locus_tag LOCUS_07370 41124 43127 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555739.1 protein_id gnl|my_center|LOCUS_07370 43517 44245 gene locus_tag LOCUS_07380 43517 44245 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035270.1 protein_id gnl|my_center|LOCUS_07380 44572 45453 gene locus_tag LOCUS_07390 44572 45453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 45540 45899 gene locus_tag LOCUS_07400 45540 45899 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116220.1 protein_id gnl|my_center|LOCUS_07400 45920 46465 gene locus_tag LOCUS_07410 45920 46465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 46566 48371 gene locus_tag LOCUS_07420 46566 48371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 48512 52555 gene locus_tag LOCUS_07430 48512 52555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 52552 53040 gene locus_tag LOCUS_07440 52552 53040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 53043 53525 gene locus_tag LOCUS_07450 53043 53525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 53731 54645 gene locus_tag LOCUS_07460 53731 54645 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038737.1 protein_id gnl|my_center|LOCUS_07460 55011 54721 gene locus_tag LOCUS_07470 55011 54721 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259052.1 protein_id gnl|my_center|LOCUS_07470 56246 55017 gene locus_tag LOCUS_07480 gene egtB 56246 55017 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812990.1 protein_id gnl|my_center|LOCUS_07480 57237 56269 gene locus_tag LOCUS_07490 gene egtD 57237 56269 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931515.1 protein_id gnl|my_center|LOCUS_07490 58165 58464 gene locus_tag LOCUS_07500 58165 58464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 58545 60734 gene locus_tag LOCUS_07510 58545 60734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 60744 61142 gene locus_tag LOCUS_07520 60744 61142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 61593 61216 gene locus_tag LOCUS_07530 61593 61216 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083764.1 protein_id gnl|my_center|LOCUS_07530 62316 61711 gene locus_tag LOCUS_07540 gene gstA 62316 61711 CDS product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210962.1 protein_id gnl|my_center|LOCUS_07540 62443 63357 gene locus_tag LOCUS_07550 62443 63357 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095765.1 protein_id gnl|my_center|LOCUS_07550 64106 63360 gene locus_tag LOCUS_07560 64106 63360 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072068.1 protein_id gnl|my_center|LOCUS_07560 65113 64103 gene locus_tag LOCUS_07570 65113 64103 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072067.1 protein_id gnl|my_center|LOCUS_07570 65347 66522 gene locus_tag LOCUS_07580 65347 66522 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965326.1 protein_id gnl|my_center|LOCUS_07580 66602 67159 gene locus_tag LOCUS_07590 66602 67159 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185751.1 protein_id gnl|my_center|LOCUS_07590 67195 67722 gene locus_tag LOCUS_07600 67195 67722 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186620.1 protein_id gnl|my_center|LOCUS_07600 67754 68491 gene locus_tag LOCUS_07610 67754 68491 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336794.1 protein_id gnl|my_center|LOCUS_07610 68535 69083 gene locus_tag LOCUS_07620 68535 69083 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106834.1 protein_id gnl|my_center|LOCUS_07620 69558 70388 gene locus_tag LOCUS_07630 69558 70388 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201260.1 protein_id gnl|my_center|LOCUS_07630 71067 71252 gene locus_tag LOCUS_07640 71067 71252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 71410 72624 gene locus_tag LOCUS_07650 71410 72624 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478734.1 protein_id gnl|my_center|LOCUS_07650 73198 72731 gene locus_tag LOCUS_07660 73198 72731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 73501 74328 gene locus_tag LOCUS_07670 73501 74328 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072508.1 protein_id gnl|my_center|LOCUS_07670 75721 74405 gene locus_tag LOCUS_07680 75721 74405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 76125 76505 gene locus_tag LOCUS_07690 76125 76505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 77193 76561 gene locus_tag LOCUS_07700 77193 76561 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546220.1 protein_id gnl|my_center|LOCUS_07700 77815 77612 gene locus_tag LOCUS_07710 77815 77612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 78049 77870 gene locus_tag LOCUS_07720 78049 77870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 78285 78082 gene locus_tag LOCUS_07730 78285 78082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 80181 78520 gene locus_tag LOCUS_07740 gene gshA 80181 78520 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109990.1 protein_id gnl|my_center|LOCUS_07740 80390 82579 gene locus_tag LOCUS_07750 80390 82579 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140133.1 protein_id gnl|my_center|LOCUS_07750 82640 83032 gene locus_tag LOCUS_07760 82640 83032 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049863.1 protein_id gnl|my_center|LOCUS_07760 83809 83084 gene locus_tag LOCUS_07770 83809 83084 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026080286.1 protein_id gnl|my_center|LOCUS_07770 84197 84709 gene locus_tag LOCUS_07780 84197 84709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187158.1 protein_id gnl|my_center|LOCUS_07780 84852 85586 gene locus_tag LOCUS_07790 84852 85586 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918723.1 protein_id gnl|my_center|LOCUS_07790 85586 87139 gene locus_tag LOCUS_07800 85586 87139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143411.1 protein_id gnl|my_center|LOCUS_07800 87184 88443 gene locus_tag LOCUS_07810 87184 88443 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941163.1 protein_id gnl|my_center|LOCUS_07810 88443 89198 gene locus_tag LOCUS_07820 88443 89198 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393834.1 protein_id gnl|my_center|LOCUS_07820 89195 90418 gene locus_tag LOCUS_07830 89195 90418 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_07830 90454 90849 gene locus_tag LOCUS_07840 90454 90849 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939050.1 protein_id gnl|my_center|LOCUS_07840 91628 90972 gene locus_tag LOCUS_07850 gene dsbA 91628 90972 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190112.1 protein_id gnl|my_center|LOCUS_07850 91976 92479 gene locus_tag LOCUS_07860 91976 92479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087459406.1 protein_id gnl|my_center|LOCUS_07860 92711 93841 gene locus_tag LOCUS_07870 92711 93841 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112360.1 protein_id gnl|my_center|LOCUS_07870 93856 95427 gene locus_tag LOCUS_07880 gene glpD 93856 95427 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526148.1 protein_id gnl|my_center|LOCUS_07880 95655 96473 gene locus_tag LOCUS_07890 95655 96473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 96544 97353 gene locus_tag LOCUS_07900 96544 97353 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107567.1 protein_id gnl|my_center|LOCUS_07900 97678 98745 gene locus_tag LOCUS_07910 97678 98745 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253048.1 protein_id gnl|my_center|LOCUS_07910 100046 98874 gene locus_tag LOCUS_07920 100046 98874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 100198 101454 gene locus_tag LOCUS_07930 100198 101454 CDS product TIGR03862 family flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202907611.1 protein_id gnl|my_center|LOCUS_07930 101598 101924 gene locus_tag LOCUS_07940 101598 101924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 102094 102567 gene locus_tag LOCUS_07950 102094 102567 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929250.1 protein_id gnl|my_center|LOCUS_07950 102564 102779 gene locus_tag LOCUS_07960 102564 102779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 102828 103466 gene locus_tag LOCUS_07970 102828 103466 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186002.1 protein_id gnl|my_center|LOCUS_07970 103463 104371 gene locus_tag LOCUS_07980 103463 104371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 104432 104809 gene locus_tag LOCUS_07990 104432 104809 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019237965.1 protein_id gnl|my_center|LOCUS_07990 104820 105002 gene locus_tag LOCUS_08000 104820 105002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 106612 105758 gene locus_tag LOCUS_08010 106612 105758 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918242.1 protein_id gnl|my_center|LOCUS_08010 106707 107717 gene locus_tag LOCUS_08020 106707 107717 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523004.1 protein_id gnl|my_center|LOCUS_08020 107749 108051 gene locus_tag LOCUS_08030 107749 108051 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065135.1 protein_id gnl|my_center|LOCUS_08030 108163 109281 gene locus_tag LOCUS_08040 108163 109281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 109791 109357 gene locus_tag LOCUS_08050 109791 109357 CDS product DUF3052 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089880.1 protein_id gnl|my_center|LOCUS_08050 112108 109856 gene locus_tag LOCUS_08060 112108 109856 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114948.1 protein_id gnl|my_center|LOCUS_08060 112581 112123 gene locus_tag LOCUS_08070 112581 112123 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038959.1 protein_id gnl|my_center|LOCUS_08070 112875 114278 gene locus_tag LOCUS_08080 112875 114278 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119569.1 protein_id gnl|my_center|LOCUS_08080 114253 115338 gene locus_tag LOCUS_08090 114253 115338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 116597 115350 gene locus_tag LOCUS_08100 116597 115350 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818460.1 protein_id gnl|my_center|LOCUS_08100 117642 116791 gene locus_tag LOCUS_08110 117642 116791 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807257.1 protein_id gnl|my_center|LOCUS_08110 119030 117729 gene locus_tag LOCUS_08120 119030 117729 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528156.1 protein_id gnl|my_center|LOCUS_08120 120227 119169 gene locus_tag LOCUS_08130 120227 119169 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807261.1 protein_id gnl|my_center|LOCUS_08130 121180 120278 gene locus_tag LOCUS_08140 121180 120278 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104319.1 protein_id gnl|my_center|LOCUS_08140 122151 121363 gene locus_tag LOCUS_08150 122151 121363 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807268.1 protein_id gnl|my_center|LOCUS_08150 124134 122161 gene locus_tag LOCUS_08160 124134 122161 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807270.1 protein_id gnl|my_center|LOCUS_08160 124538 125215 gene locus_tag LOCUS_08170 124538 125215 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807272.1 protein_id gnl|my_center|LOCUS_08170 125212 126042 gene locus_tag LOCUS_08180 125212 126042 CDS product Rossmann-like and DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958357.1 protein_id gnl|my_center|LOCUS_08180 127487 126027 gene locus_tag LOCUS_08190 127487 126027 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074089.1 protein_id gnl|my_center|LOCUS_08190 128483 127932 gene locus_tag LOCUS_08200 128483 127932 CDS product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210925.1 protein_id gnl|my_center|LOCUS_08200 128770 129159 gene locus_tag LOCUS_08210 128770 129159 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096828425.1 protein_id gnl|my_center|LOCUS_08210 129156 130184 gene locus_tag LOCUS_08220 129156 130184 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105224.1 protein_id gnl|my_center|LOCUS_08220 130225 130530 gene locus_tag LOCUS_08230 130225 130530 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087723.1 protein_id gnl|my_center|LOCUS_08230 130737 132035 gene locus_tag LOCUS_08240 gene gshA 130737 132035 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522914.1 protein_id gnl|my_center|LOCUS_08240 132068 133027 gene locus_tag LOCUS_08250 gene gshB 132068 133027 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198015.1 protein_id gnl|my_center|LOCUS_08250 133122 133529 gene locus_tag LOCUS_08260 133122 133529 CDS product PTS mannose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812601.1 protein_id gnl|my_center|LOCUS_08260 133547 133816 gene locus_tag LOCUS_08270 133547 133816 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686964.1 protein_id gnl|my_center|LOCUS_08270 134145 135965 gene locus_tag LOCUS_08280 gene ptsP 134145 135965 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522912.1 protein_id gnl|my_center|LOCUS_08280 136226 137377 gene locus_tag LOCUS_08290 136226 137377 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198305.1 protein_id gnl|my_center|LOCUS_08290 137374 137976 gene locus_tag LOCUS_08300 gene metW 137374 137976 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545692.1 protein_id gnl|my_center|LOCUS_08300 138143 139045 gene locus_tag LOCUS_08310 138143 139045 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244107.1 protein_id gnl|my_center|LOCUS_08310 139658 141982 gene locus_tag LOCUS_08320 139658 141982 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771478.1 protein_id gnl|my_center|LOCUS_08320 142094 143806 gene locus_tag LOCUS_08330 142094 143806 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887150.1 protein_id gnl|my_center|LOCUS_08330 144707 143934 gene locus_tag LOCUS_08340 144707 143934 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225717.1 protein_id gnl|my_center|LOCUS_08340 144837 145124 gene locus_tag LOCUS_08350 144837 145124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 145140 148142 gene locus_tag LOCUS_08360 145140 148142 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877559.1 protein_id gnl|my_center|LOCUS_08360 148221 148886 gene locus_tag LOCUS_08370 gene pyrE 148221 148886 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929769.1 protein_id gnl|my_center|LOCUS_08370 149129 150166 gene locus_tag LOCUS_08380 gene gmd 149129 150166 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414986.1 protein_id gnl|my_center|LOCUS_08380 150166 151071 gene locus_tag LOCUS_08390 150166 151071 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266714.1 protein_id gnl|my_center|LOCUS_08390 151068 152258 gene locus_tag LOCUS_08400 151068 152258 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102573.1 protein_id gnl|my_center|LOCUS_08400 152271 153395 gene locus_tag LOCUS_08410 gene wbpZ 152271 153395 CDS product D-rhamnosyltransferase WbpZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114105.1 protein_id gnl|my_center|LOCUS_08410 154700 153456 gene locus_tag LOCUS_08420 154700 153456 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004419151.1 protein_id gnl|my_center|LOCUS_08420 155491 154697 gene locus_tag LOCUS_08430 155491 154697 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004419153.1 protein_id gnl|my_center|LOCUS_08430 156888 155515 gene locus_tag LOCUS_08440 156888 155515 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529087.1 protein_id gnl|my_center|LOCUS_08440 157300 158655 gene locus_tag LOCUS_08450 157300 158655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 158714 162016 gene locus_tag LOCUS_08460 158714 162016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 163021 162047 gene locus_tag LOCUS_08470 163021 162047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 164557 163034 gene locus_tag LOCUS_08480 164557 163034 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140949.1 protein_id gnl|my_center|LOCUS_08480 165416 164607 gene locus_tag LOCUS_08490 165416 164607 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546542.1 protein_id gnl|my_center|LOCUS_08490 165779 165606 gene locus_tag LOCUS_08500 165779 165606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 166166 165807 gene locus_tag LOCUS_08510 166166 165807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 167421 166183 gene locus_tag LOCUS_08520 167421 166183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 169307 167418 gene locus_tag LOCUS_08530 169307 167418 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090647.1 protein_id gnl|my_center|LOCUS_08530 169746 171146 gene locus_tag LOCUS_08540 169746 171146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 >Feature sequence016 269 670 gene locus_tag LOCUS_08550 269 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 1327 2388 gene locus_tag LOCUS_08560 gene aroG 1327 2388 CDS product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550019.1 protein_id gnl|my_center|LOCUS_08560 3292 2474 gene locus_tag LOCUS_08570 3292 2474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 3474 4196 gene locus_tag LOCUS_08580 3474 4196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 4418 6283 gene locus_tag LOCUS_08590 4418 6283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 7159 6470 gene locus_tag LOCUS_08600 7159 6470 CDS product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093301.1 protein_id gnl|my_center|LOCUS_08600 7651 7166 gene locus_tag LOCUS_08610 7651 7166 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189237.1 protein_id gnl|my_center|LOCUS_08610 7822 8850 gene locus_tag LOCUS_08620 gene murB 7822 8850 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189377.1 protein_id gnl|my_center|LOCUS_08620 8989 10545 gene locus_tag LOCUS_08630 8989 10545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 11687 10650 gene locus_tag LOCUS_08640 11687 10650 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941130.1 protein_id gnl|my_center|LOCUS_08640 12787 11684 gene locus_tag LOCUS_08650 12787 11684 CDS product DUF898 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941131.1 protein_id gnl|my_center|LOCUS_08650 13438 12980 gene locus_tag LOCUS_08660 13438 12980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 14545 13574 gene locus_tag LOCUS_08670 14545 13574 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257832.1 protein_id gnl|my_center|LOCUS_08670 14658 15539 gene locus_tag LOCUS_08680 14658 15539 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367316.1 protein_id gnl|my_center|LOCUS_08680 15550 16161 gene locus_tag LOCUS_08690 15550 16161 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704905.1 protein_id gnl|my_center|LOCUS_08690 16185 16706 gene locus_tag LOCUS_08700 16185 16706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 17040 17336 gene locus_tag LOCUS_08710 17040 17336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 17349 18335 gene locus_tag LOCUS_08720 17349 18335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 18532 20025 gene locus_tag LOCUS_08730 18532 20025 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088589.1 protein_id gnl|my_center|LOCUS_08730 20018 21259 gene locus_tag LOCUS_08740 20018 21259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967751.1 protein_id gnl|my_center|LOCUS_08740 21332 22831 gene locus_tag LOCUS_08750 21332 22831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971043.1 protein_id gnl|my_center|LOCUS_08750 23748 24662 gene locus_tag LOCUS_08760 23748 24662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 26017 25859 gene locus_tag LOCUS_08770 26017 25859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 26776 26111 gene locus_tag LOCUS_08780 26776 26111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 27154 28086 gene locus_tag LOCUS_08790 27154 28086 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144243.1 protein_id gnl|my_center|LOCUS_08790 28301 29008 gene locus_tag LOCUS_08800 28301 29008 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203497.1 protein_id gnl|my_center|LOCUS_08800 29076 29615 gene locus_tag LOCUS_08810 29076 29615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 32021 29736 gene locus_tag LOCUS_08820 32021 29736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 33584 32838 gene locus_tag LOCUS_08830 33584 32838 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116045.1 protein_id gnl|my_center|LOCUS_08830 34067 34384 gene locus_tag LOCUS_08840 34067 34384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 34475 34804 gene locus_tag LOCUS_08850 34475 34804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 34896 35393 gene locus_tag LOCUS_08860 34896 35393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 35625 36794 gene locus_tag LOCUS_08870 35625 36794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 38816 36885 gene locus_tag LOCUS_08880 38816 36885 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553869.1 protein_id gnl|my_center|LOCUS_08880 38961 39035 gene locus_tag LOCUS_t00300 38961 39035 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 42970 39506 gene locus_tag LOCUS_08890 42970 39506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 43708 44493 gene locus_tag LOCUS_08900 43708 44493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 44873 45439 gene locus_tag LOCUS_08910 44873 45439 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186966.1 protein_id gnl|my_center|LOCUS_08910 46063 45554 gene locus_tag LOCUS_08920 46063 45554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 46509 47291 gene locus_tag LOCUS_08930 46509 47291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 47605 48075 gene locus_tag LOCUS_08940 47605 48075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 50123 48201 gene locus_tag LOCUS_08950 50123 48201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 50602 50126 gene locus_tag LOCUS_08960 50602 50126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 50991 51566 gene locus_tag LOCUS_08970 50991 51566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 52677 53084 gene locus_tag LOCUS_08980 52677 53084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 53183 54400 gene locus_tag LOCUS_08990 53183 54400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 54540 54965 gene locus_tag LOCUS_09000 54540 54965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 54974 55372 gene locus_tag LOCUS_09010 54974 55372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 55493 61663 gene locus_tag LOCUS_09020 55493 61663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 61663 62586 gene locus_tag LOCUS_09030 61663 62586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 62586 63179 gene locus_tag LOCUS_09040 62586 63179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 63179 63490 gene locus_tag LOCUS_09050 63179 63490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 63493 65151 gene locus_tag LOCUS_09060 63493 65151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 68511 65536 gene locus_tag LOCUS_09070 68511 65536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 68753 69838 gene locus_tag LOCUS_09080 68753 69838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 70145 72535 gene locus_tag LOCUS_09090 70145 72535 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918608.1 protein_id gnl|my_center|LOCUS_09090 72549 73661 gene locus_tag LOCUS_09100 72549 73661 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275472.1 protein_id gnl|my_center|LOCUS_09100 74018 75148 gene locus_tag LOCUS_09110 74018 75148 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156863042.1 protein_id gnl|my_center|LOCUS_09110 77564 75606 gene locus_tag LOCUS_09120 77564 75606 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964060.1 protein_id gnl|my_center|LOCUS_09120 78055 79782 gene locus_tag LOCUS_09130 78055 79782 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033452234.1 protein_id gnl|my_center|LOCUS_09130 82205 81468 gene locus_tag LOCUS_09140 82205 81468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 83526 82303 gene locus_tag LOCUS_09150 83526 82303 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762391.1 protein_id gnl|my_center|LOCUS_09150 84836 83577 gene locus_tag LOCUS_09160 84836 83577 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808098.1 protein_id gnl|my_center|LOCUS_09160 85197 86513 gene locus_tag LOCUS_09170 85197 86513 CDS product C4-dicarboxylate transporter DctA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392212.1 protein_id gnl|my_center|LOCUS_09170 86651 87346 gene locus_tag LOCUS_09180 86651 87346 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812213.1 protein_id gnl|my_center|LOCUS_09180 87552 87406 gene locus_tag LOCUS_09190 87552 87406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 89054 87744 gene locus_tag LOCUS_09200 89054 87744 CDS product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267047.1 protein_id gnl|my_center|LOCUS_09200 89724 89305 gene locus_tag LOCUS_09210 89724 89305 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970751.1 protein_id gnl|my_center|LOCUS_09210 89958 90899 gene locus_tag LOCUS_09220 89958 90899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 90892 91248 gene locus_tag LOCUS_09230 90892 91248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 91555 91845 gene locus_tag LOCUS_09240 91555 91845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 91966 93555 gene locus_tag LOCUS_09250 91966 93555 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200601.1 protein_id gnl|my_center|LOCUS_09250 93903 93583 gene locus_tag LOCUS_09260 93903 93583 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942189.1 protein_id gnl|my_center|LOCUS_09260 94193 93900 gene locus_tag LOCUS_09270 94193 93900 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214300674.1 protein_id gnl|my_center|LOCUS_09270 95417 94401 gene locus_tag LOCUS_09280 95417 94401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 96433 95414 gene locus_tag LOCUS_09290 96433 95414 CDS product DUF2157 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704683.1 protein_id gnl|my_center|LOCUS_09290 97589 96660 gene locus_tag LOCUS_09300 97589 96660 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119870.1 protein_id gnl|my_center|LOCUS_09300 97721 98698 gene locus_tag LOCUS_09310 97721 98698 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967956.1 protein_id gnl|my_center|LOCUS_09310 98794 99489 gene locus_tag LOCUS_09320 98794 99489 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194030.1 protein_id gnl|my_center|LOCUS_09320 101097 99625 gene locus_tag LOCUS_09330 101097 99625 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227184.1 protein_id gnl|my_center|LOCUS_09330 101072 101287 gene locus_tag LOCUS_09340 101072 101287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 101461 102867 gene locus_tag LOCUS_09350 101461 102867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 104249 103134 gene locus_tag LOCUS_09360 104249 103134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 104519 104289 gene locus_tag LOCUS_09370 104519 104289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 104808 105320 gene locus_tag LOCUS_09380 104808 105320 CDS product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478026.1 protein_id gnl|my_center|LOCUS_09380 106842 105550 gene locus_tag LOCUS_09390 106842 105550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 107236 108201 gene locus_tag LOCUS_09400 107236 108201 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207210.1 protein_id gnl|my_center|LOCUS_09400 108557 108300 gene locus_tag LOCUS_09410 108557 108300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 111432 109306 gene locus_tag LOCUS_09420 111432 109306 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545619.1 protein_id gnl|my_center|LOCUS_09420 112418 111477 gene locus_tag LOCUS_09430 112418 111477 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037440.1 protein_id gnl|my_center|LOCUS_09430 112877 112500 gene locus_tag LOCUS_09440 112877 112500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 114130 113348 gene locus_tag LOCUS_09450 114130 113348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 114576 114265 gene locus_tag LOCUS_09460 114576 114265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 116088 114739 gene locus_tag LOCUS_09470 116088 114739 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093492.1 protein_id gnl|my_center|LOCUS_09470 116442 116834 gene locus_tag LOCUS_09480 116442 116834 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087131.1 protein_id gnl|my_center|LOCUS_09480 117034 117417 gene locus_tag LOCUS_09490 117034 117417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 117709 118776 gene locus_tag LOCUS_09500 117709 118776 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085825.1 protein_id gnl|my_center|LOCUS_09500 119623 118799 gene locus_tag LOCUS_09510 119623 118799 CDS product DUF1868 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919658.1 protein_id gnl|my_center|LOCUS_09510 122413 119696 gene locus_tag LOCUS_09520 122413 119696 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057218.1 protein_id gnl|my_center|LOCUS_09520 123206 124378 gene locus_tag LOCUS_09530 123206 124378 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039122.1 protein_id gnl|my_center|LOCUS_09530 124475 125758 gene locus_tag LOCUS_09540 124475 125758 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770075.1 protein_id gnl|my_center|LOCUS_09540 126552 125773 gene locus_tag LOCUS_09550 126552 125773 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705597.1 protein_id gnl|my_center|LOCUS_09550 128229 126604 gene locus_tag LOCUS_09560 128229 126604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 129297 128533 gene locus_tag LOCUS_09570 129297 128533 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026080286.1 protein_id gnl|my_center|LOCUS_09570 130510 129524 gene locus_tag LOCUS_09580 130510 129524 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204499.1 protein_id gnl|my_center|LOCUS_09580 130606 131067 gene locus_tag LOCUS_09590 130606 131067 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293639.1 protein_id gnl|my_center|LOCUS_09590 132354 131077 gene locus_tag LOCUS_09600 gene dctA 132354 131077 CDS product C4-dicarboxylate transporter DctA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080139272.1 protein_id gnl|my_center|LOCUS_09600 133271 132354 gene locus_tag LOCUS_09610 133271 132354 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268260.1 protein_id gnl|my_center|LOCUS_09610 133456 134547 gene locus_tag LOCUS_09620 133456 134547 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529415.1 protein_id gnl|my_center|LOCUS_09620 134566 135372 gene locus_tag LOCUS_09630 134566 135372 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087565.1 protein_id gnl|my_center|LOCUS_09630 135454 136773 gene locus_tag LOCUS_09640 135454 136773 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268262.1 protein_id gnl|my_center|LOCUS_09640 138741 137047 gene locus_tag LOCUS_09650 138741 137047 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767035.1 protein_id gnl|my_center|LOCUS_09650 138629 138850 gene locus_tag LOCUS_09660 138629 138850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 139183 140400 gene locus_tag LOCUS_09670 139183 140400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 >Feature sequence017 <1 500 gene locus_tag LOCUS_09680 <1 500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004198356.1:elongation factor Tu 570 645 gene locus_tag LOCUS_t00310 570 645 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 682 1065 gene locus_tag LOCUS_09690 gene secE 682 1065 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551020.1 protein_id gnl|my_center|LOCUS_09690 1065 1658 gene locus_tag LOCUS_09700 gene nusG 1065 1658 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198369.1 protein_id gnl|my_center|LOCUS_09700 1821 2252 gene locus_tag LOCUS_09710 gene rplK 1821 2252 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806886.1 protein_id gnl|my_center|LOCUS_09710 2252 2947 gene locus_tag LOCUS_09720 gene rplA 2252 2947 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185135.1 protein_id gnl|my_center|LOCUS_09720 3246 3785 gene locus_tag LOCUS_09730 gene rplJ 3246 3785 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199864.1 protein_id gnl|my_center|LOCUS_09730 3838 4206 gene locus_tag LOCUS_09740 gene rplL 3838 4206 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198366.1 protein_id gnl|my_center|LOCUS_09740 4421 8527 gene locus_tag LOCUS_09750 gene rpoB 4421 8527 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198365.1 protein_id gnl|my_center|LOCUS_09750 8774 13003 gene locus_tag LOCUS_09760 gene rpoC 8774 13003 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521902.1 protein_id gnl|my_center|LOCUS_09760 13192 14004 gene locus_tag LOCUS_09770 13192 14004 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200328.1 protein_id gnl|my_center|LOCUS_09770 14049 14819 gene locus_tag LOCUS_09780 14049 14819 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196311.1 protein_id gnl|my_center|LOCUS_09780 14837 15517 gene locus_tag LOCUS_09790 14837 15517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 15559 15849 gene locus_tag LOCUS_09800 15559 15849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 15979 16743 gene locus_tag LOCUS_09810 15979 16743 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039874.1 protein_id gnl|my_center|LOCUS_09810 16778 17599 gene locus_tag LOCUS_09820 gene hutG 16778 17599 CDS product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193651.1 protein_id gnl|my_center|LOCUS_09820 17596 18969 gene locus_tag LOCUS_09830 17596 18969 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114467.1 protein_id gnl|my_center|LOCUS_09830 20107 19052 gene locus_tag LOCUS_09840 20107 19052 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109525.1 protein_id gnl|my_center|LOCUS_09840 20285 21043 gene locus_tag LOCUS_09850 20285 21043 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199071.1 protein_id gnl|my_center|LOCUS_09850 21194 21736 gene locus_tag LOCUS_09860 21194 21736 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941975.1 protein_id gnl|my_center|LOCUS_09860 21968 22831 gene locus_tag LOCUS_09870 21968 22831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 24100 22856 gene locus_tag LOCUS_09880 gene lysA 24100 22856 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030919.1 protein_id gnl|my_center|LOCUS_09880 24234 24683 gene locus_tag LOCUS_09890 24234 24683 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869023.1 protein_id gnl|my_center|LOCUS_09890 24753 25550 gene locus_tag LOCUS_09900 24753 25550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 25676 26197 gene locus_tag LOCUS_09910 25676 26197 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198028.1 protein_id gnl|my_center|LOCUS_09910 26746 26198 gene locus_tag LOCUS_09920 26746 26198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 27012 27743 gene locus_tag LOCUS_09930 27012 27743 CDS product flagellar brake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197265.1 protein_id gnl|my_center|LOCUS_09930 28008 29834 gene locus_tag LOCUS_09940 28008 29834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 29981 30376 gene locus_tag LOCUS_09950 29981 30376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 30373 32220 gene locus_tag LOCUS_09960 30373 32220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 32320 34521 gene locus_tag LOCUS_09970 32320 34521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 34608 35780 gene locus_tag LOCUS_09980 gene ampC 34608 35780 CDS product class C beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972736.1 protein_id gnl|my_center|LOCUS_09980 35931 41573 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttccggtcagagcacatatcccaatctgttagact 41970 41644 gene locus_tag LOCUS_09990 41970 41644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 42906 41977 gene locus_tag LOCUS_10000 gene cas1 42906 41977 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963638.1 protein_id gnl|my_center|LOCUS_10000 45719 42912 gene locus_tag LOCUS_10010 45719 42912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 46269 47126 gene locus_tag LOCUS_10020 46269 47126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 47321 48523 gene locus_tag LOCUS_10030 47321 48523 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186310.1 protein_id gnl|my_center|LOCUS_10030 49263 49568 gene locus_tag LOCUS_10040 49263 49568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 49636 50328 gene locus_tag LOCUS_10050 49636 50328 CDS product DUF3334 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742113.1 protein_id gnl|my_center|LOCUS_10050 51578 50454 gene locus_tag LOCUS_10060 51578 50454 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268679.1 protein_id gnl|my_center|LOCUS_10060 52800 52033 gene locus_tag LOCUS_10070 gene fghA 52800 52033 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526232.1 protein_id gnl|my_center|LOCUS_10070 54014 52911 gene locus_tag LOCUS_10080 54014 52911 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815761.1 protein_id gnl|my_center|LOCUS_10080 54187 55257 gene locus_tag LOCUS_10090 54187 55257 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534132.1 protein_id gnl|my_center|LOCUS_10090 55852 55217 gene locus_tag LOCUS_10100 55852 55217 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970934.1 protein_id gnl|my_center|LOCUS_10100 57029 56040 gene locus_tag LOCUS_10110 57029 56040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 59161 57131 gene locus_tag LOCUS_10120 59161 57131 CDS product site-specific recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207492.1 protein_id gnl|my_center|LOCUS_10120 59365 60666 gene locus_tag LOCUS_10130 59365 60666 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195684.1 protein_id gnl|my_center|LOCUS_10130 60976 64626 gene locus_tag LOCUS_10140 60976 64626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 65521 64661 gene locus_tag LOCUS_10150 65521 64661 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807247.1 protein_id gnl|my_center|LOCUS_10150 65670 66479 gene locus_tag LOCUS_10160 65670 66479 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527136.1 protein_id gnl|my_center|LOCUS_10160 66856 66515 gene locus_tag LOCUS_10170 66856 66515 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056614.1 protein_id gnl|my_center|LOCUS_10170 67159 68136 gene locus_tag LOCUS_10180 67159 68136 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814733.1 protein_id gnl|my_center|LOCUS_10180 68146 71370 gene locus_tag LOCUS_10190 68146 71370 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181711674.1 protein_id gnl|my_center|LOCUS_10190 71367 71576 gene locus_tag LOCUS_10200 71367 71576 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963915.1 protein_id gnl|my_center|LOCUS_10200 71909 71595 gene locus_tag LOCUS_10210 71909 71595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 72748 72038 gene locus_tag LOCUS_10220 72748 72038 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174123.1 protein_id gnl|my_center|LOCUS_10220 73693 73040 gene locus_tag LOCUS_10230 73693 73040 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970020.1 protein_id gnl|my_center|LOCUS_10230 73891 74919 gene locus_tag LOCUS_10240 gene dctP 73891 74919 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087202.1 protein_id gnl|my_center|LOCUS_10240 74916 75470 gene locus_tag LOCUS_10250 74916 75470 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087201.1 protein_id gnl|my_center|LOCUS_10250 75467 76816 gene locus_tag LOCUS_10260 75467 76816 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087200.1 protein_id gnl|my_center|LOCUS_10260 76816 78480 gene locus_tag LOCUS_10270 gene mdcA 76816 78480 CDS product malonate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038693.1 protein_id gnl|my_center|LOCUS_10270 78491 78811 gene locus_tag LOCUS_10280 gene mdcC 78491 78811 CDS product malonate decarboxylase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038694.1 protein_id gnl|my_center|LOCUS_10280 78808 79725 gene locus_tag LOCUS_10290 78808 79725 CDS product biotin-independent malonate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994153.1 protein_id gnl|my_center|LOCUS_10290 79725 80435 gene locus_tag LOCUS_10300 gene mdcE 79725 80435 CDS product biotin-independent malonate decarboxylase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038696.1 protein_id gnl|my_center|LOCUS_10300 80439 81155 gene locus_tag LOCUS_10310 gene mdcG 80439 81155 CDS product malonate decarboxylase holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083098.1 protein_id gnl|my_center|LOCUS_10310 81149 82078 gene locus_tag LOCUS_10320 gene mdcB 81149 82078 CDS product triphosphoribosyl-dephospho-CoA synthase MdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083097.1 protein_id gnl|my_center|LOCUS_10320 82071 83006 gene locus_tag LOCUS_10330 gene mdcH 82071 83006 CDS product malonate decarboxylase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038699.1 protein_id gnl|my_center|LOCUS_10330 83046 83678 gene locus_tag LOCUS_10340 83046 83678 CDS product carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085430.1 protein_id gnl|my_center|LOCUS_10340 83706 83861 gene locus_tag LOCUS_10350 83706 83861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 84060 83797 gene locus_tag LOCUS_10360 gene infA 84060 83797 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809486.1 protein_id gnl|my_center|LOCUS_10360 84493 84302 gene locus_tag LOCUS_10370 84493 84302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 86312 84564 gene locus_tag LOCUS_10380 86312 84564 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528767.1 protein_id gnl|my_center|LOCUS_10380 87406 86687 gene locus_tag LOCUS_10390 gene lytT 87406 86687 CDS product two-component system response regulator LytT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229479.1 protein_id gnl|my_center|LOCUS_10390 88895 87387 gene locus_tag LOCUS_10400 88895 87387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 88950 89138 gene locus_tag LOCUS_10410 88950 89138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 89372 91507 gene locus_tag LOCUS_10420 89372 91507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 92771 91731 gene locus_tag LOCUS_10430 92771 91731 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812183.1 protein_id gnl|my_center|LOCUS_10430 95012 92784 gene locus_tag LOCUS_10440 95012 92784 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114948.1 protein_id gnl|my_center|LOCUS_10440 95496 95023 gene locus_tag LOCUS_10450 95496 95023 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808116.1 protein_id gnl|my_center|LOCUS_10450 96162 95572 gene locus_tag LOCUS_10460 96162 95572 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940393.1 protein_id gnl|my_center|LOCUS_10460 96315 97253 gene locus_tag LOCUS_10470 96315 97253 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943748.1 protein_id gnl|my_center|LOCUS_10470 97475 98458 gene locus_tag LOCUS_10480 97475 98458 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088295.1 protein_id gnl|my_center|LOCUS_10480 98740 100218 gene locus_tag LOCUS_10490 98740 100218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 100382 100891 gene locus_tag LOCUS_10500 100382 100891 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267105.1 protein_id gnl|my_center|LOCUS_10500 101329 101093 gene locus_tag LOCUS_10510 101329 101093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 101692 103542 gene locus_tag LOCUS_10520 101692 103542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 104155 104412 gene locus_tag LOCUS_10530 104155 104412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 105570 104614 gene locus_tag LOCUS_10540 105570 104614 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226787.1 protein_id gnl|my_center|LOCUS_10540 106021 105893 gene locus_tag LOCUS_10550 106021 105893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 106010 106675 gene locus_tag LOCUS_10560 106010 106675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 107593 106865 gene locus_tag LOCUS_10570 107593 106865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 108700 107594 gene locus_tag LOCUS_10580 108700 107594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 110952 108697 gene locus_tag LOCUS_10590 110952 108697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 112321 110963 gene locus_tag LOCUS_10600 112321 110963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 112363 112518 gene locus_tag LOCUS_10610 112363 112518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 113607 112624 gene locus_tag LOCUS_10620 gene lipA 113607 112624 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189177.1 protein_id gnl|my_center|LOCUS_10620 114295 113630 gene locus_tag LOCUS_10630 gene lipB 114295 113630 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553813.1 protein_id gnl|my_center|LOCUS_10630 115275 114379 gene locus_tag LOCUS_10640 115275 114379 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704350.1 protein_id gnl|my_center|LOCUS_10640 115923 115372 gene locus_tag LOCUS_10650 115923 115372 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902791.1 protein_id gnl|my_center|LOCUS_10650 116302 115979 gene locus_tag LOCUS_10660 116302 115979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 116471 117367 gene locus_tag LOCUS_10670 116471 117367 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189368.1 protein_id gnl|my_center|LOCUS_10670 117722 117441 gene locus_tag LOCUS_10680 117722 117441 CDS product YbeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807142.1 protein_id gnl|my_center|LOCUS_10680 118803 117958 gene locus_tag LOCUS_10690 118803 117958 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189800.1 protein_id gnl|my_center|LOCUS_10690 120113 118965 gene locus_tag LOCUS_10700 120113 118965 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064727.1 protein_id gnl|my_center|LOCUS_10700 120854 120204 gene locus_tag LOCUS_10710 120854 120204 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522936.1 protein_id gnl|my_center|LOCUS_10710 121135 120860 gene locus_tag LOCUS_10720 121135 120860 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530970.1 protein_id gnl|my_center|LOCUS_10720 122459 121308 gene locus_tag LOCUS_10730 122459 121308 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038743784.1 protein_id gnl|my_center|LOCUS_10730 123099 122476 gene locus_tag LOCUS_10740 123099 122476 CDS product ABC-type transport auxiliary lipoprotein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189249.1 protein_id gnl|my_center|LOCUS_10740 124060 123110 gene locus_tag LOCUS_10750 124060 123110 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807132.1 protein_id gnl|my_center|LOCUS_10750 124855 124064 gene locus_tag LOCUS_10760 124855 124064 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190185.1 protein_id gnl|my_center|LOCUS_10760 125979 124855 gene locus_tag LOCUS_10770 125979 124855 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929619.1 protein_id gnl|my_center|LOCUS_10770 127978 126077 gene locus_tag LOCUS_10780 127978 126077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 128653 129036 gene locus_tag LOCUS_10790 gene rpsL 128653 129036 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521903.1 protein_id gnl|my_center|LOCUS_10790 129182 129652 gene locus_tag LOCUS_10800 gene rpsG 129182 129652 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198359.1 protein_id gnl|my_center|LOCUS_10800 129781 131886 gene locus_tag LOCUS_10810 gene fusA 129781 131886 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806902.1 protein_id gnl|my_center|LOCUS_10810 >Feature sequence018 661 3906 gene locus_tag LOCUS_10820 661 3906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 7960 3950 gene locus_tag LOCUS_10830 7960 3950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 8650 8183 gene locus_tag LOCUS_10840 8650 8183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 9292 8792 gene locus_tag LOCUS_10850 9292 8792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965306.1 protein_id gnl|my_center|LOCUS_10850 9401 9658 gene locus_tag LOCUS_10860 9401 9658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 9759 10100 gene locus_tag LOCUS_10870 9759 10100 CDS product four-helix bundle copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969066.1 protein_id gnl|my_center|LOCUS_10870 10219 11817 gene locus_tag LOCUS_10880 10219 11817 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084107.1 protein_id gnl|my_center|LOCUS_10880 13470 11977 gene locus_tag LOCUS_10890 13470 11977 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704858.1 protein_id gnl|my_center|LOCUS_10890 14216 13467 gene locus_tag LOCUS_10900 14216 13467 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704857.1 protein_id gnl|my_center|LOCUS_10900 14330 14818 gene locus_tag LOCUS_10910 gene msrB 14330 14818 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109730.1 protein_id gnl|my_center|LOCUS_10910 14837 16705 gene locus_tag LOCUS_10920 14837 16705 CDS product cytochrome c biogenesis protein DipZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186447661.1 protein_id gnl|my_center|LOCUS_10920 16747 17436 gene locus_tag LOCUS_10930 gene msrA 16747 17436 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089780.1 protein_id gnl|my_center|LOCUS_10930 18107 17583 gene locus_tag LOCUS_10940 18107 17583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 19252 18266 gene locus_tag LOCUS_10950 19252 18266 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103965.1 protein_id gnl|my_center|LOCUS_10950 19842 19378 gene locus_tag LOCUS_10960 19842 19378 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156585.1 protein_id gnl|my_center|LOCUS_10960 20326 22770 gene locus_tag LOCUS_10970 20326 22770 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275222.1 protein_id gnl|my_center|LOCUS_10970 23594 22818 gene locus_tag LOCUS_10980 23594 22818 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201757.1 protein_id gnl|my_center|LOCUS_10980 24500 23625 gene locus_tag LOCUS_10990 24500 23625 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087999.1 protein_id gnl|my_center|LOCUS_10990 25777 24581 gene locus_tag LOCUS_11000 25777 24581 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537877.1 protein_id gnl|my_center|LOCUS_11000 28396 25958 gene locus_tag LOCUS_11010 28396 25958 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189629.1 protein_id gnl|my_center|LOCUS_11010 30193 28403 gene locus_tag LOCUS_11020 30193 28403 CDS product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526128.1 protein_id gnl|my_center|LOCUS_11020 30888 30286 gene locus_tag LOCUS_11030 30888 30286 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189774.1 protein_id gnl|my_center|LOCUS_11030 31540 31154 gene locus_tag LOCUS_11040 31540 31154 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194347.1 protein_id gnl|my_center|LOCUS_11040 31813 32451 gene locus_tag LOCUS_11050 31813 32451 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265528.1 protein_id gnl|my_center|LOCUS_11050 33547 32747 gene locus_tag LOCUS_11060 33547 32747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 34707 33544 gene locus_tag LOCUS_11070 gene clsB 34707 33544 CDS product cardiolipin synthase ClsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522800.1 protein_id gnl|my_center|LOCUS_11070 35519 34704 gene locus_tag LOCUS_11080 35519 34704 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807040.1 protein_id gnl|my_center|LOCUS_11080 36058 35531 gene locus_tag LOCUS_11090 gene nudB 36058 35531 CDS product dihydroneopterin triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189197.1 protein_id gnl|my_center|LOCUS_11090 36677 36195 gene locus_tag LOCUS_11100 36677 36195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 37801 36995 gene locus_tag LOCUS_11110 37801 36995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 39626 37830 gene locus_tag LOCUS_11120 gene aspS 39626 37830 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189849.1 protein_id gnl|my_center|LOCUS_11120 40296 39694 gene locus_tag LOCUS_11130 40296 39694 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189093.1 protein_id gnl|my_center|LOCUS_11130 40670 40350 gene locus_tag LOCUS_11140 40670 40350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 42254 40830 gene locus_tag LOCUS_11150 42254 40830 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121872.1 protein_id gnl|my_center|LOCUS_11150 42637 43317 gene locus_tag LOCUS_11160 42637 43317 CDS product Bax inhibitor-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327344.1 protein_id gnl|my_center|LOCUS_11160 44379 43414 gene locus_tag LOCUS_11170 44379 43414 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920359.1 protein_id gnl|my_center|LOCUS_11170 44746 45876 gene locus_tag LOCUS_11180 44746 45876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 45901 46209 gene locus_tag LOCUS_11190 45901 46209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 46913 46323 gene locus_tag LOCUS_11200 46913 46323 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035344.1 protein_id gnl|my_center|LOCUS_11200 47579 46947 gene locus_tag LOCUS_11210 47579 46947 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337686.1 protein_id gnl|my_center|LOCUS_11210 47714 48160 gene locus_tag LOCUS_11220 47714 48160 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869023.1 protein_id gnl|my_center|LOCUS_11220 48338 49018 gene locus_tag LOCUS_11230 48338 49018 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167344383.1 protein_id gnl|my_center|LOCUS_11230 50255 49026 gene locus_tag LOCUS_11240 50255 49026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265931.1 protein_id gnl|my_center|LOCUS_11240 50529 52517 gene locus_tag LOCUS_11250 50529 52517 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036303.1 protein_id gnl|my_center|LOCUS_11250 53160 52594 gene locus_tag LOCUS_11260 53160 52594 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111779.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11260 53253 54332 gene locus_tag LOCUS_11270 53253 54332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 54865 54326 gene locus_tag LOCUS_11280 54865 54326 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086804.1 protein_id gnl|my_center|LOCUS_11280 55093 54869 gene locus_tag LOCUS_11290 55093 54869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 55341 57641 gene locus_tag LOCUS_11300 55341 57641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 58062 58823 gene locus_tag LOCUS_11310 58062 58823 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071376.1 protein_id gnl|my_center|LOCUS_11310 59455 58838 gene locus_tag LOCUS_11320 59455 58838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 59795 59658 gene locus_tag LOCUS_11330 59795 59658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 60464 59805 gene locus_tag LOCUS_11340 60464 59805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 61319 60705 gene locus_tag LOCUS_11350 61319 60705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 62455 61463 gene locus_tag LOCUS_11360 62455 61463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 62787 62452 gene locus_tag LOCUS_11370 62787 62452 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071043.1 protein_id gnl|my_center|LOCUS_11370 63033 64298 gene locus_tag LOCUS_11380 63033 64298 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064634437.1 protein_id gnl|my_center|LOCUS_11380 64291 65061 gene locus_tag LOCUS_11390 64291 65061 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038759.1 protein_id gnl|my_center|LOCUS_11390 65061 66464 gene locus_tag LOCUS_11400 65061 66464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 66700 67038 gene locus_tag LOCUS_11410 66700 67038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 67756 67106 gene locus_tag LOCUS_11420 gene pcp 67756 67106 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704765.1 protein_id gnl|my_center|LOCUS_11420 68791 67805 gene locus_tag LOCUS_11430 68791 67805 CDS product DUF979 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096574.1 protein_id gnl|my_center|LOCUS_11430 69576 68788 gene locus_tag LOCUS_11440 69576 68788 CDS product DUF969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096573.1 protein_id gnl|my_center|LOCUS_11440 71032 69683 gene locus_tag LOCUS_11450 gene pssA 71032 69683 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268302.1 protein_id gnl|my_center|LOCUS_11450 72129 71104 gene locus_tag LOCUS_11460 72129 71104 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213256.1 protein_id gnl|my_center|LOCUS_11460 72829 72218 gene locus_tag LOCUS_11470 72829 72218 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535935.1 protein_id gnl|my_center|LOCUS_11470 74408 72843 gene locus_tag LOCUS_11480 gene ubiB 74408 72843 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189815.1 protein_id gnl|my_center|LOCUS_11480 74977 74405 gene locus_tag LOCUS_11490 74977 74405 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188960.1 protein_id gnl|my_center|LOCUS_11490 76227 75298 gene locus_tag LOCUS_11500 76227 75298 CDS product TIM44-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189141.1 protein_id gnl|my_center|LOCUS_11500 76993 76259 gene locus_tag LOCUS_11510 gene ubiE 76993 76259 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189973.1 protein_id gnl|my_center|LOCUS_11510 80114 77058 gene locus_tag LOCUS_11520 80114 77058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 81714 80782 gene locus_tag LOCUS_11530 81714 80782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 81821 82855 gene locus_tag LOCUS_11540 81821 82855 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242607.1 protein_id gnl|my_center|LOCUS_11540 82860 83555 gene locus_tag LOCUS_11550 82860 83555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 85025 84606 gene locus_tag LOCUS_11560 85025 84606 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190130.1 protein_id gnl|my_center|LOCUS_11560 85450 85022 gene locus_tag LOCUS_11570 85450 85022 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925740.1 protein_id gnl|my_center|LOCUS_11570 89424 85450 gene locus_tag LOCUS_11580 89424 85450 CDS product FAD/FMN-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535491.1 protein_id gnl|my_center|LOCUS_11580 91173 89872 gene locus_tag LOCUS_11590 91173 89872 CDS product haloacid dehalogenase-like hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190115.1 protein_id gnl|my_center|LOCUS_11590 91876 91385 gene locus_tag LOCUS_11600 91876 91385 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815154.1 protein_id gnl|my_center|LOCUS_11600 91990 93525 gene locus_tag LOCUS_11610 gene ilvA 91990 93525 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064913.1 protein_id gnl|my_center|LOCUS_11610 93591 94436 gene locus_tag LOCUS_11620 gene queF 93591 94436 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189061.1 protein_id gnl|my_center|LOCUS_11620 94556 95140 gene locus_tag LOCUS_11630 94556 95140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 95328 97961 gene locus_tag LOCUS_11640 95328 97961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 98065 98538 gene locus_tag LOCUS_11650 gene ptsN 98065 98538 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534308.1 protein_id gnl|my_center|LOCUS_11650 98570 99571 gene locus_tag LOCUS_11660 gene hprK 98570 99571 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929965.1 protein_id gnl|my_center|LOCUS_11660 99592 100455 gene locus_tag LOCUS_11670 gene rapZ 99592 100455 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195227.1 protein_id gnl|my_center|LOCUS_11670 101645 100482 gene locus_tag LOCUS_11680 101645 100482 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140055.1 protein_id gnl|my_center|LOCUS_11680 102475 101645 gene locus_tag LOCUS_11690 102475 101645 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039041.1 protein_id gnl|my_center|LOCUS_11690 103983 102472 gene locus_tag LOCUS_11700 103983 102472 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928419.1 protein_id gnl|my_center|LOCUS_11700 105204 104062 gene locus_tag LOCUS_11710 gene mutY 105204 104062 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195232.1 protein_id gnl|my_center|LOCUS_11710 107172 105235 gene locus_tag LOCUS_11720 107172 105235 CDS product dynamin-like GTPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114887.1 protein_id gnl|my_center|LOCUS_11720 108096 107275 gene locus_tag LOCUS_11730 gene mutM 108096 107275 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522858.1 protein_id gnl|my_center|LOCUS_11730 108309 110060 gene locus_tag LOCUS_11740 108309 110060 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195237.1 protein_id gnl|my_center|LOCUS_11740 110225 110881 gene locus_tag LOCUS_11750 gene lolB 110225 110881 CDS product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526060.1 protein_id gnl|my_center|LOCUS_11750 110872 111768 gene locus_tag LOCUS_11760 gene ispE 110872 111768 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195241.1 protein_id gnl|my_center|LOCUS_11760 111801 111877 gene locus_tag LOCUS_t00320 111801 111877 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 112028 112960 gene locus_tag LOCUS_11770 112028 112960 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195243.1 protein_id gnl|my_center|LOCUS_11770 113073 113660 gene locus_tag LOCUS_11780 113073 113660 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200150.1 protein_id gnl|my_center|LOCUS_11780 113791 115536 gene locus_tag LOCUS_11790 gene ggt 113791 115536 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072047.1 protein_id gnl|my_center|LOCUS_11790 116135 115554 gene locus_tag LOCUS_11800 116135 115554 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536308.1 protein_id gnl|my_center|LOCUS_11800 116170 118134 gene locus_tag LOCUS_11810 116170 118134 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525894.1 protein_id gnl|my_center|LOCUS_11810 118147 118860 gene locus_tag LOCUS_11820 118147 118860 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197238.1 protein_id gnl|my_center|LOCUS_11820 118870 120081 gene locus_tag LOCUS_11830 118870 120081 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525896.1 protein_id gnl|my_center|LOCUS_11830 120180 120866 gene locus_tag LOCUS_11840 120180 120866 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202737.1 protein_id gnl|my_center|LOCUS_11840 122029 121526 gene locus_tag LOCUS_11850 122029 121526 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202739.1 protein_id gnl|my_center|LOCUS_11850 122209 123321 gene locus_tag LOCUS_11860 gene hppD 122209 123321 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197900.1 protein_id gnl|my_center|LOCUS_11860 123406 124293 gene locus_tag LOCUS_11870 gene phhA 123406 124293 CDS product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035413.1 protein_id gnl|my_center|LOCUS_11870 124896 124348 gene locus_tag LOCUS_11880 124896 124348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 125109 125912 gene locus_tag LOCUS_11890 gene bfmR 125109 125912 CDS product two-component system response regulator BfmR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113023.1 protein_id gnl|my_center|LOCUS_11890 125912 127252 gene locus_tag LOCUS_11900 125912 127252 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969540.1 protein_id gnl|my_center|LOCUS_11900 127294 127452 gene locus_tag LOCUS_11910 127294 127452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 >Feature sequence019 1278 457 gene locus_tag LOCUS_11920 1278 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 2264 1644 gene locus_tag LOCUS_11930 2264 1644 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208463.1 protein_id gnl|my_center|LOCUS_11930 2388 3284 gene locus_tag LOCUS_11940 2388 3284 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707554.1 protein_id gnl|my_center|LOCUS_11940 4141 3278 gene locus_tag LOCUS_11950 4141 3278 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199068.1 protein_id gnl|my_center|LOCUS_11950 4998 4138 gene locus_tag LOCUS_11960 4998 4138 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807187.1 protein_id gnl|my_center|LOCUS_11960 5250 6431 gene locus_tag LOCUS_11970 gene metK 5250 6431 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925730.1 protein_id gnl|my_center|LOCUS_11970 6488 7402 gene locus_tag LOCUS_11980 6488 7402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 8061 7549 gene locus_tag LOCUS_11990 8061 7549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 9599 8187 gene locus_tag LOCUS_12000 9599 8187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 10900 9602 gene locus_tag LOCUS_12010 10900 9602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 11142 11891 gene locus_tag LOCUS_12020 11142 11891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 11893 13962 gene locus_tag LOCUS_12030 11893 13962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 14431 14048 gene locus_tag LOCUS_12040 14431 14048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 15306 14434 gene locus_tag LOCUS_12050 15306 14434 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192197.1 protein_id gnl|my_center|LOCUS_12050 15741 15382 gene locus_tag LOCUS_12060 15741 15382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 15926 16501 gene locus_tag LOCUS_12070 15926 16501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 16491 17264 gene locus_tag LOCUS_12080 16491 17264 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085797.1 protein_id gnl|my_center|LOCUS_12080 17493 19604 gene locus_tag LOCUS_12090 17493 19604 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038598.1 protein_id gnl|my_center|LOCUS_12090 20717 19827 gene locus_tag LOCUS_12100 20717 19827 CDS product glutamate/aspartate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082770.1 protein_id gnl|my_center|LOCUS_12100 21074 22825 gene locus_tag LOCUS_12110 21074 22825 CDS product SmdA family multidrug ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235623.1 protein_id gnl|my_center|LOCUS_12110 22773 24581 gene locus_tag LOCUS_12120 22773 24581 CDS product SmdB family multidrug efflux ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208628.1 protein_id gnl|my_center|LOCUS_12120 24590 26857 gene locus_tag LOCUS_12130 24590 26857 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521234.1 protein_id gnl|my_center|LOCUS_12130 27246 27752 gene locus_tag LOCUS_12140 27246 27752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 29032 27806 gene locus_tag LOCUS_12150 gene metC 29032 27806 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389303.1 protein_id gnl|my_center|LOCUS_12150 29265 29744 gene locus_tag LOCUS_12160 29265 29744 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809010.1 protein_id gnl|my_center|LOCUS_12160 30490 29750 gene locus_tag LOCUS_12170 30490 29750 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093967.1 protein_id gnl|my_center|LOCUS_12170 30781 31683 gene locus_tag LOCUS_12180 30781 31683 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706015.1 protein_id gnl|my_center|LOCUS_12180 32620 31793 gene locus_tag LOCUS_12190 gene metF 32620 31793 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198631.1 protein_id gnl|my_center|LOCUS_12190 32963 32607 gene locus_tag LOCUS_12200 32963 32607 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198632.1 protein_id gnl|my_center|LOCUS_12200 34495 33068 gene locus_tag LOCUS_12210 gene ahcY 34495 33068 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942520.1 protein_id gnl|my_center|LOCUS_12210 35144 34683 gene locus_tag LOCUS_12220 35144 34683 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965831.1 protein_id gnl|my_center|LOCUS_12220 35726 35184 gene locus_tag LOCUS_12230 35726 35184 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534111.1 protein_id gnl|my_center|LOCUS_12230 37741 35759 gene locus_tag LOCUS_12240 37741 35759 CDS product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195204.1 protein_id gnl|my_center|LOCUS_12240 37855 38895 gene locus_tag LOCUS_12250 37855 38895 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195206.1 protein_id gnl|my_center|LOCUS_12250 38895 39431 gene locus_tag LOCUS_12260 38895 39431 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200146.1 protein_id gnl|my_center|LOCUS_12260 39428 40078 gene locus_tag LOCUS_12270 gene lptC 39428 40078 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929967.1 protein_id gnl|my_center|LOCUS_12270 40106 40657 gene locus_tag LOCUS_12280 40106 40657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 40658 41410 gene locus_tag LOCUS_12290 gene lptB 40658 41410 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195214.1 protein_id gnl|my_center|LOCUS_12290 41422 42909 gene locus_tag LOCUS_12300 41422 42909 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195216.1 protein_id gnl|my_center|LOCUS_12300 43019 43366 gene locus_tag LOCUS_12310 gene raiA 43019 43366 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195219.1 protein_id gnl|my_center|LOCUS_12310 43963 44205 gene locus_tag LOCUS_12320 43963 44205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 44202 45296 gene locus_tag LOCUS_12330 44202 45296 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199465.1 protein_id gnl|my_center|LOCUS_12330 46608 45880 gene locus_tag LOCUS_12340 46608 45880 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815204.1 protein_id gnl|my_center|LOCUS_12340 48568 46619 gene locus_tag LOCUS_12350 48568 46619 CDS product branched-chain amino acid ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209484109.1 protein_id gnl|my_center|LOCUS_12350 49468 48578 gene locus_tag LOCUS_12360 49468 48578 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815515.1 protein_id gnl|my_center|LOCUS_12360 50759 49602 gene locus_tag LOCUS_12370 50759 49602 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152802079.1 protein_id gnl|my_center|LOCUS_12370 51827 51126 gene locus_tag LOCUS_12380 51827 51126 CDS product DUF4197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144308590.1 protein_id gnl|my_center|LOCUS_12380 53025 51874 gene locus_tag LOCUS_12390 53025 51874 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196750.1 protein_id gnl|my_center|LOCUS_12390 54683 53031 gene locus_tag LOCUS_12400 54683 53031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 57109 54737 gene locus_tag LOCUS_12410 57109 54737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 59260 57173 gene locus_tag LOCUS_12420 gene pilQ 59260 57173 CDS product type 4a pilus secretin PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114575.1 protein_id gnl|my_center|LOCUS_12420 59856 59320 gene locus_tag LOCUS_12430 59856 59320 CDS product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038332.1 protein_id gnl|my_center|LOCUS_12430 60506 59856 gene locus_tag LOCUS_12440 gene pilO 60506 59856 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103268.1 protein_id gnl|my_center|LOCUS_12440 61162 60548 gene locus_tag LOCUS_12450 61162 60548 CDS product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214520.1 protein_id gnl|my_center|LOCUS_12450 62241 61162 gene locus_tag LOCUS_12460 62241 61162 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038335.1 protein_id gnl|my_center|LOCUS_12460 62546 64858 gene locus_tag LOCUS_12470 62546 64858 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110255951.1 protein_id gnl|my_center|LOCUS_12470 65257 64949 gene locus_tag LOCUS_12480 gene cyaY 65257 64949 CDS product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806945.1 protein_id gnl|my_center|LOCUS_12480 66084 65458 gene locus_tag LOCUS_12490 66084 65458 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 protein_id gnl|my_center|LOCUS_12490 66825 66199 gene locus_tag LOCUS_12500 gene msrQ 66825 66199 CDS product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527905.1 protein_id gnl|my_center|LOCUS_12500 67807 66827 gene locus_tag LOCUS_12510 gene msrP 67807 66827 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527906.1 protein_id gnl|my_center|LOCUS_12510 69063 67918 gene locus_tag LOCUS_12520 gene ccsB 69063 67918 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197914.1 protein_id gnl|my_center|LOCUS_12520 71282 69117 gene locus_tag LOCUS_12530 71282 69117 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527907.1 protein_id gnl|my_center|LOCUS_12530 72194 71496 gene locus_tag LOCUS_12540 72194 71496 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806941.1 protein_id gnl|my_center|LOCUS_12540 72395 73150 gene locus_tag LOCUS_12550 gene yihA 72395 73150 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521909.1 protein_id gnl|my_center|LOCUS_12550 73423 74436 gene locus_tag LOCUS_12560 gene hemB 73423 74436 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521908.1 protein_id gnl|my_center|LOCUS_12560 74446 75153 gene locus_tag LOCUS_12570 74446 75153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 75146 76396 gene locus_tag LOCUS_12580 75146 76396 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405145.1 protein_id gnl|my_center|LOCUS_12580 76377 77471 gene locus_tag LOCUS_12590 76377 77471 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208248.1 protein_id gnl|my_center|LOCUS_12590 77549 78985 gene locus_tag LOCUS_12600 gene sbcB 77549 78985 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104954.1 protein_id gnl|my_center|LOCUS_12600 79708 79070 gene locus_tag LOCUS_12610 79708 79070 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186345.1 protein_id gnl|my_center|LOCUS_12610 81605 79830 gene locus_tag LOCUS_12620 gene dsbD 81605 79830 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806937.1 protein_id gnl|my_center|LOCUS_12620 81991 81602 gene locus_tag LOCUS_12630 81991 81602 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071016.1 protein_id gnl|my_center|LOCUS_12630 82581 82186 gene locus_tag LOCUS_12640 gene rplQ 82581 82186 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064753.1 protein_id gnl|my_center|LOCUS_12640 83683 82706 gene locus_tag LOCUS_12650 gene rpoA 83683 82706 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197925.1 protein_id gnl|my_center|LOCUS_12650 84411 83788 gene locus_tag LOCUS_12660 gene rpsD 84411 83788 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197926.1 protein_id gnl|my_center|LOCUS_12660 85067 84663 gene locus_tag LOCUS_12670 gene rpsK 85067 84663 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806930.1 protein_id gnl|my_center|LOCUS_12670 85464 85099 gene locus_tag LOCUS_12680 gene rpsM 85464 85099 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197938.1 protein_id gnl|my_center|LOCUS_12680 85857 85639 gene locus_tag LOCUS_12690 gene infA 85857 85639 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521905.1 protein_id gnl|my_center|LOCUS_12690 87074 85881 gene locus_tag LOCUS_12700 gene secY 87074 85881 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806926.1 protein_id gnl|my_center|LOCUS_12700 87672 87241 gene locus_tag LOCUS_12710 gene rplO 87672 87241 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197941.1 protein_id gnl|my_center|LOCUS_12710 87880 87701 gene locus_tag LOCUS_12720 gene rpmD 87880 87701 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202755.1 protein_id gnl|my_center|LOCUS_12720 88409 87891 gene locus_tag LOCUS_12730 gene rpsE 88409 87891 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197945.1 protein_id gnl|my_center|LOCUS_12730 88784 88422 gene locus_tag LOCUS_12740 gene rplR 88784 88422 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197946.1 protein_id gnl|my_center|LOCUS_12740 89330 88797 gene locus_tag LOCUS_12750 gene rplF 89330 88797 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197947.1 protein_id gnl|my_center|LOCUS_12750 89736 89341 gene locus_tag LOCUS_12760 gene rpsH 89736 89341 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185153.1 protein_id gnl|my_center|LOCUS_12760 90056 89751 gene locus_tag LOCUS_12770 gene rpsN 90056 89751 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806919.1 protein_id gnl|my_center|LOCUS_12770 90603 90064 gene locus_tag LOCUS_12780 gene rplE 90603 90064 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202757.1 protein_id gnl|my_center|LOCUS_12780 90922 90608 gene locus_tag LOCUS_12790 gene rplX 90922 90608 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806917.1 protein_id gnl|my_center|LOCUS_12790 91300 90932 gene locus_tag LOCUS_12800 gene rplN 91300 90932 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197951.1 protein_id gnl|my_center|LOCUS_12800 91812 91540 gene locus_tag LOCUS_12810 gene rpsQ 91812 91540 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201274.1 protein_id gnl|my_center|LOCUS_12810 92003 91812 gene locus_tag LOCUS_12820 gene rpmC 92003 91812 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199856.1 protein_id gnl|my_center|LOCUS_12820 92435 92016 gene locus_tag LOCUS_12830 gene rplP 92435 92016 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199857.1 protein_id gnl|my_center|LOCUS_12830 93271 92438 gene locus_tag LOCUS_12840 gene rpsC 93271 92438 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185240.1 protein_id gnl|my_center|LOCUS_12840 93610 93281 gene locus_tag LOCUS_12850 gene rplV 93610 93281 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215424.1 protein_id gnl|my_center|LOCUS_12850 93895 93620 gene locus_tag LOCUS_12860 gene rpsS 93895 93620 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199273.1 protein_id gnl|my_center|LOCUS_12860 94733 93906 gene locus_tag LOCUS_12870 gene rplB 94733 93906 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806907.1 protein_id gnl|my_center|LOCUS_12870 95050 94736 gene locus_tag LOCUS_12880 gene rplW 95050 94736 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199275.1 protein_id gnl|my_center|LOCUS_12880 95670 95047 gene locus_tag LOCUS_12890 gene rplD 95670 95047 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199276.1 protein_id gnl|my_center|LOCUS_12890 96330 95674 gene locus_tag LOCUS_12900 gene rplC 96330 95674 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521904.1 protein_id gnl|my_center|LOCUS_12900 96870 96553 gene locus_tag LOCUS_12910 gene rpsJ 96870 96553 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199280.1 protein_id gnl|my_center|LOCUS_12910 >Feature sequence020 1142 609 gene locus_tag LOCUS_12920 1142 609 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095346.1 protein_id gnl|my_center|LOCUS_12920 1624 1142 gene locus_tag LOCUS_12930 1624 1142 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479700.1 protein_id gnl|my_center|LOCUS_12930 1724 2749 gene locus_tag LOCUS_12940 1724 2749 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162840014.1 protein_id gnl|my_center|LOCUS_12940 2942 3604 gene locus_tag LOCUS_12950 2942 3604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 4357 3644 gene locus_tag LOCUS_12960 4357 3644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 4641 6320 gene locus_tag LOCUS_12970 4641 6320 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201704.1 protein_id gnl|my_center|LOCUS_12970 6376 7233 gene locus_tag LOCUS_12980 6376 7233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 7397 8377 gene locus_tag LOCUS_12990 7397 8377 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967956.1 protein_id gnl|my_center|LOCUS_12990 8426 9694 gene locus_tag LOCUS_13000 8426 9694 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085640.1 protein_id gnl|my_center|LOCUS_13000 9727 10893 gene locus_tag LOCUS_13010 9727 10893 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200062.1 protein_id gnl|my_center|LOCUS_13010 10928 11806 gene locus_tag LOCUS_13020 10928 11806 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920014.1 protein_id gnl|my_center|LOCUS_13020 12130 11810 gene locus_tag LOCUS_13030 12130 11810 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115842.1 protein_id gnl|my_center|LOCUS_13030 12720 12499 gene locus_tag LOCUS_13040 12720 12499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 13629 12802 gene locus_tag LOCUS_13050 13629 12802 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532405.1 protein_id gnl|my_center|LOCUS_13050 13957 15324 gene locus_tag LOCUS_13060 13957 15324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 16633 15365 gene locus_tag LOCUS_13070 16633 15365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 18033 17005 gene locus_tag LOCUS_13080 18033 17005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 18300 19373 gene locus_tag LOCUS_13090 18300 19373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 19886 19581 gene locus_tag LOCUS_13100 19886 19581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 20666 22231 gene locus_tag LOCUS_13110 20666 22231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 22766 22332 gene locus_tag LOCUS_13120 22766 22332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 23252 22869 gene locus_tag LOCUS_13130 23252 22869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 24081 23284 gene locus_tag LOCUS_13140 24081 23284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 24482 24162 gene locus_tag LOCUS_13150 24482 24162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 26041 24563 gene locus_tag LOCUS_13160 26041 24563 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114178.1 protein_id gnl|my_center|LOCUS_13160 26715 26041 gene locus_tag LOCUS_13170 26715 26041 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739198.1 protein_id gnl|my_center|LOCUS_13170 27072 28187 gene locus_tag LOCUS_13180 27072 28187 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089288.1 protein_id gnl|my_center|LOCUS_13180 28265 29275 gene locus_tag LOCUS_13190 28265 29275 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365605.1 protein_id gnl|my_center|LOCUS_13190 29379 30485 gene locus_tag LOCUS_13200 29379 30485 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198094.1 protein_id gnl|my_center|LOCUS_13200 30606 32384 gene locus_tag LOCUS_13210 30606 32384 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208545.1 protein_id gnl|my_center|LOCUS_13210 32458 33522 gene locus_tag LOCUS_13220 32458 33522 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705183.1 protein_id gnl|my_center|LOCUS_13220 33693 34112 gene locus_tag LOCUS_13230 33693 34112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 34167 35108 gene locus_tag LOCUS_13240 gene dapA 34167 35108 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925705.1 protein_id gnl|my_center|LOCUS_13240 35148 35795 gene locus_tag LOCUS_13250 35148 35795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 35814 36311 gene locus_tag LOCUS_13260 35814 36311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 36334 36957 gene locus_tag LOCUS_13270 36334 36957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 37775 37047 gene locus_tag LOCUS_13280 37775 37047 CDS product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811028.1 protein_id gnl|my_center|LOCUS_13280 38689 37970 gene locus_tag LOCUS_13290 gene kdpE 38689 37970 CDS product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185947.1 protein_id gnl|my_center|LOCUS_13290 41448 38686 gene locus_tag LOCUS_13300 41448 38686 CDS product DUF4118 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526440.1 protein_id gnl|my_center|LOCUS_13300 42105 41491 gene locus_tag LOCUS_13310 gene kdpC 42105 41491 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814050.1 protein_id gnl|my_center|LOCUS_13310 44274 42154 gene locus_tag LOCUS_13320 gene kdpB 44274 42154 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522436.1 protein_id gnl|my_center|LOCUS_13320 46203 44359 gene locus_tag LOCUS_13330 gene kdpA 46203 44359 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185359.1 protein_id gnl|my_center|LOCUS_13330 46756 49686 gene locus_tag LOCUS_13340 46756 49686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 50561 49668 gene locus_tag LOCUS_13350 50561 49668 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119903.1 protein_id gnl|my_center|LOCUS_13350 50858 52111 gene locus_tag LOCUS_13360 gene alaC 50858 52111 CDS product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785618.1 protein_id gnl|my_center|LOCUS_13360 53347 52181 gene locus_tag LOCUS_13370 53347 52181 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339264.1 protein_id gnl|my_center|LOCUS_13370 53452 54342 gene locus_tag LOCUS_13380 53452 54342 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206176.1 protein_id gnl|my_center|LOCUS_13380 55481 54744 gene locus_tag LOCUS_13390 55481 54744 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532447.1 protein_id gnl|my_center|LOCUS_13390 55574 55990 gene locus_tag LOCUS_13400 55574 55990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 56030 57091 gene locus_tag LOCUS_13410 gene hisC 56030 57091 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098833.1 protein_id gnl|my_center|LOCUS_13410 57816 57319 gene locus_tag LOCUS_13420 57816 57319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 58309 57824 gene locus_tag LOCUS_13430 58309 57824 CDS product asparaginase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391477.1 protein_id gnl|my_center|LOCUS_13430 58470 59243 gene locus_tag LOCUS_13440 58470 59243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 60011 59256 gene locus_tag LOCUS_13450 60011 59256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 60686 60099 gene locus_tag LOCUS_13460 60686 60099 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105095.1 protein_id gnl|my_center|LOCUS_13460 62708 60786 gene locus_tag LOCUS_13470 62708 60786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 64013 63036 gene locus_tag LOCUS_13480 64013 63036 CDS product D-2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525849.1 protein_id gnl|my_center|LOCUS_13480 64438 66288 gene locus_tag LOCUS_13490 64438 66288 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817018.1 protein_id gnl|my_center|LOCUS_13490 66866 66471 gene locus_tag LOCUS_13500 66866 66471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 67281 66964 gene locus_tag LOCUS_13510 67281 66964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 67417 68391 gene locus_tag LOCUS_13520 67417 68391 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088245.1 protein_id gnl|my_center|LOCUS_13520 68562 70601 gene locus_tag LOCUS_13530 gene ladS 68562 70601 CDS product hybrid sensor histidine kinase/response regulator LadS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114327.1 protein_id gnl|my_center|LOCUS_13530 70665 71381 gene locus_tag LOCUS_13540 70665 71381 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931175.1 protein_id gnl|my_center|LOCUS_13540 71446 71886 gene locus_tag LOCUS_13550 71446 71886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 72007 71831 gene locus_tag LOCUS_13560 72007 71831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 72012 72515 gene locus_tag LOCUS_13570 72012 72515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 72754 77844 gene locus_tag LOCUS_13580 72754 77844 CDS product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161952232.1 protein_id gnl|my_center|LOCUS_13580 77946 80324 gene locus_tag LOCUS_13590 gene pbpC 77946 80324 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064081.1 protein_id gnl|my_center|LOCUS_13590 80442 80822 gene locus_tag LOCUS_13600 80442 80822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 81417 80971 gene locus_tag LOCUS_13610 81417 80971 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105462.1 protein_id gnl|my_center|LOCUS_13610 82493 81414 gene locus_tag LOCUS_13620 82493 81414 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974518.1 protein_id gnl|my_center|LOCUS_13620 82730 83092 gene locus_tag LOCUS_13630 82730 83092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 >Feature sequence021 2466 982 gene locus_tag LOCUS_13640 2466 982 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817192.1 protein_id gnl|my_center|LOCUS_13640 3812 2484 gene locus_tag LOCUS_13650 3812 2484 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189952.1 protein_id gnl|my_center|LOCUS_13650 4142 3888 gene locus_tag LOCUS_13660 4142 3888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 4565 4801 gene locus_tag LOCUS_13670 4565 4801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 8174 4998 gene locus_tag LOCUS_13680 8174 4998 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920672.1 protein_id gnl|my_center|LOCUS_13680 8524 8357 gene locus_tag LOCUS_13690 8524 8357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 10193 8586 gene locus_tag LOCUS_13700 10193 8586 CDS product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992104.1 protein_id gnl|my_center|LOCUS_13700 11758 10190 gene locus_tag LOCUS_13710 11758 10190 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275414.1 protein_id gnl|my_center|LOCUS_13710 12580 12149 gene locus_tag LOCUS_13720 12580 12149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 13176 12583 gene locus_tag LOCUS_13730 13176 12583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 13506 13751 gene locus_tag LOCUS_13740 13506 13751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 13748 15046 gene locus_tag LOCUS_13750 13748 15046 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267577.1 protein_id gnl|my_center|LOCUS_13750 15048 15818 gene locus_tag LOCUS_13760 15048 15818 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931863.1 protein_id gnl|my_center|LOCUS_13760 16257 16072 gene locus_tag LOCUS_13770 16257 16072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 17011 17661 gene locus_tag LOCUS_13780 17011 17661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 18217 19872 gene locus_tag LOCUS_13790 18217 19872 CDS product DUF5597 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920642.1 protein_id gnl|my_center|LOCUS_13790 20168 21175 gene locus_tag LOCUS_13800 20168 21175 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920901.1 protein_id gnl|my_center|LOCUS_13800 21801 23258 gene locus_tag LOCUS_13810 gene mdtA 21801 23258 CDS product multidrug efflux RND transporter subunit MdtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678969.1 protein_id gnl|my_center|LOCUS_13810 23274 26414 gene locus_tag LOCUS_13820 gene muxB 23274 26414 CDS product multidrug efflux RND transporter permease subunit MuxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089920.1 protein_id gnl|my_center|LOCUS_13820 26411 29521 gene locus_tag LOCUS_13830 gene mdtC 26411 29521 CDS product multidrug efflux RND transporter permease subunit MdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815800.1 protein_id gnl|my_center|LOCUS_13830 29532 30980 gene locus_tag LOCUS_13840 gene opmB 29532 30980 CDS product multidrug efflux RND transporter outer membrane subunit OpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089909.1 protein_id gnl|my_center|LOCUS_13840 31029 31397 gene locus_tag LOCUS_13850 31029 31397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 31656 31444 gene locus_tag LOCUS_13860 31656 31444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 32097 31789 gene locus_tag LOCUS_13870 32097 31789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 32469 32768 gene locus_tag LOCUS_13880 32469 32768 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037004.1 protein_id gnl|my_center|LOCUS_13880 32768 34651 gene locus_tag LOCUS_13890 32768 34651 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037005.1 protein_id gnl|my_center|LOCUS_13890 35064 35618 gene locus_tag LOCUS_13900 35064 35618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 37346 35745 gene locus_tag LOCUS_13910 37346 35745 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538238.1 protein_id gnl|my_center|LOCUS_13910 37753 37562 gene locus_tag LOCUS_13920 37753 37562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 38050 40716 gene locus_tag LOCUS_13930 38050 40716 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919497.1 protein_id gnl|my_center|LOCUS_13930 40734 42161 gene locus_tag LOCUS_13940 40734 42161 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202608288.1 protein_id gnl|my_center|LOCUS_13940 42167 43081 gene locus_tag LOCUS_13950 42167 43081 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919495.1 protein_id gnl|my_center|LOCUS_13950 43153 45078 gene locus_tag LOCUS_13960 43153 45078 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640291.1 protein_id gnl|my_center|LOCUS_13960 45219 46355 gene locus_tag LOCUS_13970 45219 46355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 48543 46465 gene locus_tag LOCUS_13980 48543 46465 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192524.1 protein_id gnl|my_center|LOCUS_13980 49535 48825 gene locus_tag LOCUS_13990 49535 48825 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810083.1 protein_id gnl|my_center|LOCUS_13990 50296 49532 gene locus_tag LOCUS_14000 50296 49532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 51579 50293 gene locus_tag LOCUS_14010 51579 50293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 52530 51583 gene locus_tag LOCUS_14020 52530 51583 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191272.1 protein_id gnl|my_center|LOCUS_14020 53862 52627 gene locus_tag LOCUS_14030 53862 52627 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196429.1 protein_id gnl|my_center|LOCUS_14030 55623 53971 gene locus_tag LOCUS_14040 55623 53971 CDS product 3-(methylthio)propionyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539668.1 protein_id gnl|my_center|LOCUS_14040 56832 55918 gene locus_tag LOCUS_14050 gene rlmJ 56832 55918 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538077.1 protein_id gnl|my_center|LOCUS_14050 57441 56938 gene locus_tag LOCUS_14060 57441 56938 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193331.1 protein_id gnl|my_center|LOCUS_14060 57841 57452 gene locus_tag LOCUS_14070 57841 57452 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036225.1 protein_id gnl|my_center|LOCUS_14070 58897 57863 gene locus_tag LOCUS_14080 58897 57863 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192693.1 protein_id gnl|my_center|LOCUS_14080 59550 58894 gene locus_tag LOCUS_14090 gene tmk 59550 58894 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527198.1 protein_id gnl|my_center|LOCUS_14090 60611 59625 gene locus_tag LOCUS_14100 gene mltG 60611 59625 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191597.1 protein_id gnl|my_center|LOCUS_14100 60753 61793 gene locus_tag LOCUS_14110 60753 61793 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193428.1 protein_id gnl|my_center|LOCUS_14110 61854 62141 gene locus_tag LOCUS_14120 61854 62141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 62132 62878 gene locus_tag LOCUS_14130 62132 62878 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446814.1 protein_id gnl|my_center|LOCUS_14130 64155 62914 gene locus_tag LOCUS_14140 64155 62914 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388484.1 protein_id gnl|my_center|LOCUS_14140 65599 64289 gene locus_tag LOCUS_14150 65599 64289 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193856.1 protein_id gnl|my_center|LOCUS_14150 66903 65674 gene locus_tag LOCUS_14160 66903 65674 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527177.1 protein_id gnl|my_center|LOCUS_14160 67341 68228 gene locus_tag LOCUS_14170 gene bla 67341 68228 CDS product class A beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140598.1 protein_id gnl|my_center|LOCUS_14170 68391 68768 gene locus_tag LOCUS_14180 68391 68768 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198835.1 protein_id gnl|my_center|LOCUS_14180 68765 70453 gene locus_tag LOCUS_14190 68765 70453 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535987.1 protein_id gnl|my_center|LOCUS_14190 70535 71662 gene locus_tag LOCUS_14200 70535 71662 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527179.1 protein_id gnl|my_center|LOCUS_14200 71683 72648 gene locus_tag LOCUS_14210 71683 72648 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191549.1 protein_id gnl|my_center|LOCUS_14210 72659 73585 gene locus_tag LOCUS_14220 72659 73585 CDS product formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192441.1 protein_id gnl|my_center|LOCUS_14220 73643 74683 gene locus_tag LOCUS_14230 73643 74683 CDS product bifunctional UDP-4-keto-pentose/UDP-xylose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193921.1 protein_id gnl|my_center|LOCUS_14230 74695 75630 gene locus_tag LOCUS_14240 74695 75630 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191750.1 protein_id gnl|my_center|LOCUS_14240 75667 76149 gene locus_tag LOCUS_14250 75667 76149 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521302.1 protein_id gnl|my_center|LOCUS_14250 76266 77981 gene locus_tag LOCUS_14260 76266 77981 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015600258.1 protein_id gnl|my_center|LOCUS_14260 79994 78108 gene locus_tag LOCUS_14270 79994 78108 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009937746.1 protein_id gnl|my_center|LOCUS_14270 80825 80094 gene locus_tag LOCUS_14280 80825 80094 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982276.1 protein_id gnl|my_center|LOCUS_14280 82193 80829 gene locus_tag LOCUS_14290 82193 80829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 82908 82207 gene locus_tag LOCUS_14300 gene lolD 82908 82207 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195923.1 protein_id gnl|my_center|LOCUS_14300 84157 82901 gene locus_tag LOCUS_14310 84157 82901 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191984.1 protein_id gnl|my_center|LOCUS_14310 84252 85253 gene locus_tag LOCUS_14320 84252 85253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193226.1 protein_id gnl|my_center|LOCUS_14320 85250 86938 gene locus_tag LOCUS_14330 gene recJ 85250 86938 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191649.1 protein_id gnl|my_center|LOCUS_14330 87659 86970 gene locus_tag LOCUS_14340 87659 86970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 87991 89598 gene locus_tag LOCUS_14350 87991 89598 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817398.1 protein_id gnl|my_center|LOCUS_14350 89795 90799 gene locus_tag LOCUS_14360 89795 90799 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525885.1 protein_id gnl|my_center|LOCUS_14360 90844 91791 gene locus_tag LOCUS_14370 90844 91791 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112858.1 protein_id gnl|my_center|LOCUS_14370 91805 92821 gene locus_tag LOCUS_14380 gene dppD 91805 92821 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703765.1 protein_id gnl|my_center|LOCUS_14380 92818 93810 gene locus_tag LOCUS_14390 92818 93810 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400031.1 protein_id gnl|my_center|LOCUS_14390 94096 96159 gene locus_tag LOCUS_14400 94096 96159 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051379148.1 protein_id gnl|my_center|LOCUS_14400 98267 96279 gene locus_tag LOCUS_14410 98267 96279 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192700.1 protein_id gnl|my_center|LOCUS_14410 98515 98315 gene locus_tag LOCUS_14420 98515 98315 CDS product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089847.1 protein_id gnl|my_center|LOCUS_14420 98600 99400 gene locus_tag LOCUS_14430 98600 99400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 100169 99522 gene locus_tag LOCUS_14440 100169 99522 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196420.1 protein_id gnl|my_center|LOCUS_14440 102094 100307 gene locus_tag LOCUS_14450 102094 100307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 103359 102601 gene locus_tag LOCUS_14460 103359 102601 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193115.1 protein_id gnl|my_center|LOCUS_14460 103520 104320 gene locus_tag LOCUS_14470 103520 104320 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191664.1 protein_id gnl|my_center|LOCUS_14470 104414 105799 gene locus_tag LOCUS_14480 104414 105799 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197309.1 protein_id gnl|my_center|LOCUS_14480 106708 105890 gene locus_tag LOCUS_14490 106708 105890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815935.1 protein_id gnl|my_center|LOCUS_14490 107036 109669 gene locus_tag LOCUS_14500 gene mutS 107036 109669 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193335.1 protein_id gnl|my_center|LOCUS_14500 110307 109741 gene locus_tag LOCUS_14510 110307 109741 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524740.1 protein_id gnl|my_center|LOCUS_14510 110386 111519 gene locus_tag LOCUS_14520 110386 111519 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535743.1 protein_id gnl|my_center|LOCUS_14520 112108 111845 gene locus_tag LOCUS_14530 112108 111845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 112688 112335 gene locus_tag LOCUS_14540 112688 112335 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012248488.1 protein_id gnl|my_center|LOCUS_14540 113027 112704 gene locus_tag LOCUS_14550 113027 112704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 113412 114275 gene locus_tag LOCUS_14560 113412 114275 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186676.1 protein_id gnl|my_center|LOCUS_14560 116487 114493 gene locus_tag LOCUS_14570 gene acs 116487 114493 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188376.1 protein_id gnl|my_center|LOCUS_14570 116855 117454 gene locus_tag LOCUS_14580 116855 117454 CDS product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202253.1 protein_id gnl|my_center|LOCUS_14580 117529 119049 gene locus_tag LOCUS_14590 117529 119049 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064992.1 protein_id gnl|my_center|LOCUS_14590 119081 119914 gene locus_tag LOCUS_14600 gene murI 119081 119914 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768855.1 protein_id gnl|my_center|LOCUS_14600 119946 120635 gene locus_tag LOCUS_14610 119946 120635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 121024 120677 gene locus_tag LOCUS_14620 121024 120677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 121617 121090 gene locus_tag LOCUS_14630 121617 121090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 122219 121698 gene locus_tag LOCUS_14640 122219 121698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 123496 122303 gene locus_tag LOCUS_14650 123496 122303 CDS product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704591.1 protein_id gnl|my_center|LOCUS_14650 127021 123740 gene locus_tag LOCUS_14660 127021 123740 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070433.1 protein_id gnl|my_center|LOCUS_14660 127271 131206 gene locus_tag LOCUS_14670 127271 131206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 132413 131262 gene locus_tag LOCUS_14680 132413 131262 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919707.1 protein_id gnl|my_center|LOCUS_14680 133595 132453 gene locus_tag LOCUS_14690 133595 132453 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224351.1 protein_id gnl|my_center|LOCUS_14690 133820 134395 gene locus_tag LOCUS_14700 133820 134395 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524888.1 protein_id gnl|my_center|LOCUS_14700 134845 134426 gene locus_tag LOCUS_14710 134845 134426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 136335 135037 gene locus_tag LOCUS_14720 136335 135037 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206388.1 protein_id gnl|my_center|LOCUS_14720 137748 136615 gene locus_tag LOCUS_14730 137748 136615 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037556.1 protein_id gnl|my_center|LOCUS_14730 138690 137794 gene locus_tag LOCUS_14740 138690 137794 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529089.1 protein_id gnl|my_center|LOCUS_14740 139694 139092 gene locus_tag LOCUS_14750 139694 139092 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368916.1 protein_id gnl|my_center|LOCUS_14750 140366 139722 gene locus_tag LOCUS_14760 gene ureG 140366 139722 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185810.1 protein_id gnl|my_center|LOCUS_14760 141095 140415 gene locus_tag LOCUS_14770 141095 140415 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533998.1 protein_id gnl|my_center|LOCUS_14770 141616 141098 gene locus_tag LOCUS_14780 141616 141098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 143317 141620 gene locus_tag LOCUS_14790 gene ureC 143317 141620 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186033.1 protein_id gnl|my_center|LOCUS_14790 143619 143314 gene locus_tag LOCUS_14800 143619 143314 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084271.1 protein_id gnl|my_center|LOCUS_14800 143931 143629 gene locus_tag LOCUS_14810 gene ureA 143931 143629 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186513.1 protein_id gnl|my_center|LOCUS_14810 144382 145020 gene locus_tag LOCUS_14820 144382 145020 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256813.1 protein_id gnl|my_center|LOCUS_14820 145017 145538 gene locus_tag LOCUS_14830 145017 145538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 145602 146834 gene locus_tag LOCUS_14840 145602 146834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 146989 146765 gene locus_tag LOCUS_14850 146989 146765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 148618 147146 gene locus_tag LOCUS_14860 148618 147146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 149194 148736 gene locus_tag LOCUS_14870 149194 148736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 150117 149848 gene locus_tag LOCUS_14880 150117 149848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 150501 150340 gene locus_tag LOCUS_14890 150501 150340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 151119 150589 gene locus_tag LOCUS_14900 151119 150589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 151658 151374 gene locus_tag LOCUS_14910 151658 151374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 152449 152129 gene locus_tag LOCUS_14920 152449 152129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 153060 152536 gene locus_tag LOCUS_14930 153060 152536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 153863 153333 gene locus_tag LOCUS_14940 153863 153333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 154106 153921 gene locus_tag LOCUS_14950 154106 153921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 155392 154940 gene locus_tag LOCUS_14960 155392 154940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 155856 155425 gene locus_tag LOCUS_14970 155856 155425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 156377 155934 gene locus_tag LOCUS_14980 156377 155934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 158951 156498 gene locus_tag LOCUS_14990 158951 156498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 160402 159014 gene locus_tag LOCUS_15000 160402 159014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 162228 160498 gene locus_tag LOCUS_15010 162228 160498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 163856 163350 gene locus_tag LOCUS_15020 163856 163350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 164245 163853 gene locus_tag LOCUS_15030 164245 163853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 164764 164285 gene locus_tag LOCUS_15040 164764 164285 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942421.1 protein_id gnl|my_center|LOCUS_15040 167050 164777 gene locus_tag LOCUS_15050 167050 164777 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942422.1 protein_id gnl|my_center|LOCUS_15050 167733 167161 gene locus_tag LOCUS_15060 167733 167161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 168344 167730 gene locus_tag LOCUS_15070 168344 167730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 168895 168341 gene locus_tag LOCUS_15080 168895 168341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 171376 169730 gene locus_tag LOCUS_15090 171376 169730 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942427.1 protein_id gnl|my_center|LOCUS_15090 172623 171421 gene locus_tag LOCUS_15100 172623 171421 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880450.1 protein_id gnl|my_center|LOCUS_15100 173040 172660 gene locus_tag LOCUS_15110 gene gspG 173040 172660 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088760.1 protein_id gnl|my_center|LOCUS_15110 173661 175235 gene locus_tag LOCUS_15120 173661 175235 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046237212.1 protein_id gnl|my_center|LOCUS_15120 176048 180106 gene locus_tag LOCUS_15130 176048 180106 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269157.1 protein_id gnl|my_center|LOCUS_15130 180799 180572 gene locus_tag LOCUS_15140 180799 180572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 180984 182342 gene locus_tag LOCUS_15150 gene chrA 180984 182342 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096587.1 protein_id gnl|my_center|LOCUS_15150 182481 183215 gene locus_tag LOCUS_15160 gene imuA 182481 183215 CDS product translesion DNA synthesis-associated protein ImuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040022.1 protein_id gnl|my_center|LOCUS_15160 183157 184740 gene locus_tag LOCUS_15170 183157 184740 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550915.1 protein_id gnl|my_center|LOCUS_15170 184746 187940 gene locus_tag LOCUS_15180 184746 187940 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063897.1 protein_id gnl|my_center|LOCUS_15180 189260 187959 gene locus_tag LOCUS_15190 189260 187959 CDS product nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943582.1 protein_id gnl|my_center|LOCUS_15190 191016 189283 gene locus_tag LOCUS_15200 191016 189283 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943581.1 protein_id gnl|my_center|LOCUS_15200 191015 191242 gene locus_tag LOCUS_15210 191015 191242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 192090 191395 gene locus_tag LOCUS_15220 192090 191395 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191824.1 protein_id gnl|my_center|LOCUS_15220 192877 192098 gene locus_tag LOCUS_15230 192877 192098 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192025.1 protein_id gnl|my_center|LOCUS_15230 194097 192937 gene locus_tag LOCUS_15240 gene lpxB 194097 192937 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063750.1 protein_id gnl|my_center|LOCUS_15240 194894 194106 gene locus_tag LOCUS_15250 gene lpxA 194894 194106 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063749.1 protein_id gnl|my_center|LOCUS_15250 195362 194910 gene locus_tag LOCUS_15260 gene fabZ 195362 194910 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192266.1 protein_id gnl|my_center|LOCUS_15260 196416 195355 gene locus_tag LOCUS_15270 gene lpxD 196416 195355 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191858.1 protein_id gnl|my_center|LOCUS_15270 196940 196422 gene locus_tag LOCUS_15280 196940 196422 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930951.1 protein_id gnl|my_center|LOCUS_15280 199335 196987 gene locus_tag LOCUS_15290 gene bamA 199335 196987 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197083.1 protein_id gnl|my_center|LOCUS_15290 200778 199405 gene locus_tag LOCUS_15300 gene rseP 200778 199405 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063746.1 protein_id gnl|my_center|LOCUS_15300 201971 200775 gene locus_tag LOCUS_15310 201971 200775 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527290.1 protein_id gnl|my_center|LOCUS_15310 202780 201962 gene locus_tag LOCUS_15320 202780 201962 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521189.1 protein_id gnl|my_center|LOCUS_15320 203559 202780 gene locus_tag LOCUS_15330 gene uppS 203559 202780 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527291.1 protein_id gnl|my_center|LOCUS_15330 204155 203595 gene locus_tag LOCUS_15340 gene frr 204155 203595 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192143.1 protein_id gnl|my_center|LOCUS_15340 204956 204240 gene locus_tag LOCUS_15350 gene pyrH 204956 204240 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193606.1 protein_id gnl|my_center|LOCUS_15350 206087 205206 gene locus_tag LOCUS_15360 gene tsf 206087 205206 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197087.1 protein_id gnl|my_center|LOCUS_15360 206958 206224 gene locus_tag LOCUS_15370 gene rpsB 206958 206224 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193246.1 protein_id gnl|my_center|LOCUS_15370 207293 208111 gene locus_tag LOCUS_15380 gene map 207293 208111 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193235.1 protein_id gnl|my_center|LOCUS_15380 208125 210677 gene locus_tag LOCUS_15390 208125 210677 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544413.1 protein_id gnl|my_center|LOCUS_15390 210807 211553 gene locus_tag LOCUS_15400 210807 211553 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930119.1 protein_id gnl|my_center|LOCUS_15400 212282 211749 gene locus_tag LOCUS_15410 gene def 212282 211749 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064978.1 protein_id gnl|my_center|LOCUS_15410 213258 212383 gene locus_tag LOCUS_15420 gene galU 213258 212383 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192544.1 protein_id gnl|my_center|LOCUS_15420 215314 213260 gene locus_tag LOCUS_15430 gene ligA 215314 213260 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009937986.1 protein_id gnl|my_center|LOCUS_15430 216404 215325 gene locus_tag LOCUS_15440 216404 215325 CDS product cell division protein ZipA C-terminal FtsZ-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535807.1 protein_id gnl|my_center|LOCUS_15440 219847 216401 gene locus_tag LOCUS_15450 gene smc 219847 216401 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205139.1 protein_id gnl|my_center|LOCUS_15450 220345 221565 gene locus_tag LOCUS_15460 gene dapC 220345 221565 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198896.1 protein_id gnl|my_center|LOCUS_15460 221687 222514 gene locus_tag LOCUS_15470 gene dapD 221687 222514 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191680.1 protein_id gnl|my_center|LOCUS_15470 222557 223699 gene locus_tag LOCUS_15480 222557 223699 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948029.1 protein_id gnl|my_center|LOCUS_15480 223725 224096 gene locus_tag LOCUS_15490 223725 224096 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004206564.1 protein_id gnl|my_center|LOCUS_15490 224099 225226 gene locus_tag LOCUS_15500 gene dapE 224099 225226 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191377.1 protein_id gnl|my_center|LOCUS_15500 225266 226168 gene locus_tag LOCUS_15510 gene prmB 225266 226168 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192731.1 protein_id gnl|my_center|LOCUS_15510 226278 228263 gene locus_tag LOCUS_15520 226278 228263 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531442.1 protein_id gnl|my_center|LOCUS_15520 229137 228316 gene locus_tag LOCUS_15530 229137 228316 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073205.1 protein_id gnl|my_center|LOCUS_15530 230635 229313 gene locus_tag LOCUS_15540 230635 229313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 233221 230651 gene locus_tag LOCUS_15550 233221 230651 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206776.1 protein_id gnl|my_center|LOCUS_15550 234274 233300 gene locus_tag LOCUS_15560 234274 233300 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082671.1 protein_id gnl|my_center|LOCUS_15560 234843 234271 gene locus_tag LOCUS_15570 gene sigX 234843 234271 CDS product RNA polymerase sigma factor SigX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230521.1 protein_id gnl|my_center|LOCUS_15570 235106 235333 gene locus_tag LOCUS_15580 235106 235333 CDS product DUF6500 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029304506.1 protein_id gnl|my_center|LOCUS_15580 235718 236833 gene locus_tag LOCUS_15590 235718 236833 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083007.1 protein_id gnl|my_center|LOCUS_15590 237369 236890 gene locus_tag LOCUS_15600 237369 236890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 240099 237421 gene locus_tag LOCUS_15610 240099 237421 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039300.1 protein_id gnl|my_center|LOCUS_15610 240910 240218 gene locus_tag LOCUS_15620 240910 240218 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013992.1 protein_id gnl|my_center|LOCUS_15620 241133 243199 gene locus_tag LOCUS_15630 241133 243199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 243257 244168 gene locus_tag LOCUS_15640 243257 244168 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444160.1 protein_id gnl|my_center|LOCUS_15640 244165 245055 gene locus_tag LOCUS_15650 244165 245055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 247035 245086 gene locus_tag LOCUS_15660 247035 245086 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962866.1 protein_id gnl|my_center|LOCUS_15660 248121 247171 gene locus_tag LOCUS_15670 248121 247171 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192895.1 protein_id gnl|my_center|LOCUS_15670 248631 248197 gene locus_tag LOCUS_15680 248631 248197 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811761.1 protein_id gnl|my_center|LOCUS_15680 251380 248963 gene locus_tag LOCUS_15690 gene ppsA 251380 248963 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193522.1 protein_id gnl|my_center|LOCUS_15690 251692 252540 gene locus_tag LOCUS_15700 251692 252540 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192738.1 protein_id gnl|my_center|LOCUS_15700 253396 252602 gene locus_tag LOCUS_15710 253396 252602 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191284.1 protein_id gnl|my_center|LOCUS_15710 254013 253408 gene locus_tag LOCUS_15720 gene rnhB 254013 253408 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113866.1 protein_id gnl|my_center|LOCUS_15720 254263 254006 gene locus_tag LOCUS_15730 254263 254006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 255921 254428 gene locus_tag LOCUS_15740 255921 254428 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192020.1 protein_id gnl|my_center|LOCUS_15740 256953 255934 gene locus_tag LOCUS_15750 256953 255934 CDS product MucB/RseB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042144922.1 protein_id gnl|my_center|LOCUS_15750 257633 256956 gene locus_tag LOCUS_15760 257633 256956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 258301 257699 gene locus_tag LOCUS_15770 gene rpoE 258301 257699 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 protein_id gnl|my_center|LOCUS_15770 258888 258433 gene locus_tag LOCUS_15780 258888 258433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 260205 258964 gene locus_tag LOCUS_15790 gene fabF 260205 258964 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193086.1 protein_id gnl|my_center|LOCUS_15790 260477 260238 gene locus_tag LOCUS_15800 gene acpP 260477 260238 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197638.1 protein_id gnl|my_center|LOCUS_15800 261381 260629 gene locus_tag LOCUS_15810 gene fabG 261381 260629 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197597.1 protein_id gnl|my_center|LOCUS_15810 262319 261378 gene locus_tag LOCUS_15820 gene fabD 262319 261378 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193828.1 protein_id gnl|my_center|LOCUS_15820 263377 262391 gene locus_tag LOCUS_15830 263377 262391 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524613.1 protein_id gnl|my_center|LOCUS_15830 264456 263374 gene locus_tag LOCUS_15840 gene plsX 264456 263374 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192749.1 protein_id gnl|my_center|LOCUS_15840 264878 264696 gene locus_tag LOCUS_15850 gene rpmF 264878 264696 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813827.1 protein_id gnl|my_center|LOCUS_15850 265528 265004 gene locus_tag LOCUS_15860 265528 265004 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193919.1 protein_id gnl|my_center|LOCUS_15860 265655 266266 gene locus_tag LOCUS_15870 265655 266266 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192535.1 protein_id gnl|my_center|LOCUS_15870 266379 267131 gene locus_tag LOCUS_15880 266379 267131 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524612.1 protein_id gnl|my_center|LOCUS_15880 267190 268356 gene locus_tag LOCUS_15890 267190 268356 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198074.1 protein_id gnl|my_center|LOCUS_15890 269626 268403 gene locus_tag LOCUS_15900 269626 268403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 270481 269717 gene locus_tag LOCUS_15910 270481 269717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 271090 270491 gene locus_tag LOCUS_15920 271090 270491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 271365 271087 gene locus_tag LOCUS_15930 271365 271087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 271967 271488 gene locus_tag LOCUS_15940 271967 271488 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212871.1 protein_id gnl|my_center|LOCUS_15940 272254 272111 gene locus_tag LOCUS_15950 272254 272111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 272631 272359 gene locus_tag LOCUS_15960 272631 272359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 273173 272670 gene locus_tag LOCUS_15970 gene ispF 273173 272670 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191369.1 protein_id gnl|my_center|LOCUS_15970 273954 273163 gene locus_tag LOCUS_15980 gene ispD 273954 273163 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191584.1 protein_id gnl|my_center|LOCUS_15980 274043 277474 gene locus_tag LOCUS_15990 gene mfd 274043 277474 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193121.1 protein_id gnl|my_center|LOCUS_15990 277525 278373 gene locus_tag LOCUS_16000 gene serB 277525 278373 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193217.1 protein_id gnl|my_center|LOCUS_16000 278947 278444 gene locus_tag LOCUS_16010 278947 278444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 279709 279146 gene locus_tag LOCUS_16020 279709 279146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 279934 281007 gene locus_tag LOCUS_16030 279934 281007 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186177.1 protein_id gnl|my_center|LOCUS_16030 281070 282329 gene locus_tag LOCUS_16040 281070 282329 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522404.1 protein_id gnl|my_center|LOCUS_16040 283060 282404 gene locus_tag LOCUS_16050 283060 282404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 284557 283202 gene locus_tag LOCUS_16060 284557 283202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 284934 284554 gene locus_tag LOCUS_16070 284934 284554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 285970 285113 gene locus_tag LOCUS_16080 285970 285113 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114815.1 protein_id gnl|my_center|LOCUS_16080 286192 286884 gene locus_tag LOCUS_16090 286192 286884 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112525.1 protein_id gnl|my_center|LOCUS_16090 286952 288178 gene locus_tag LOCUS_16100 286952 288178 CDS product DUF2863 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199318.1 protein_id gnl|my_center|LOCUS_16100 288221 288745 gene locus_tag LOCUS_16110 288221 288745 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072248.1 protein_id gnl|my_center|LOCUS_16110 288881 290734 gene locus_tag LOCUS_16120 288881 290734 CDS product DUF3857 and transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009941162.1 protein_id gnl|my_center|LOCUS_16120 291013 292203 gene locus_tag LOCUS_16130 291013 292203 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185551.1 protein_id gnl|my_center|LOCUS_16130 292214 293353 gene locus_tag LOCUS_16140 292214 293353 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526465.1 protein_id gnl|my_center|LOCUS_16140 293456 293917 gene locus_tag LOCUS_16150 293456 293917 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186182.1 protein_id gnl|my_center|LOCUS_16150 294032 294487 gene locus_tag LOCUS_16160 294032 294487 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977127.1 protein_id gnl|my_center|LOCUS_16160 294560 294931 gene locus_tag LOCUS_16170 294560 294931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 296898 294946 gene locus_tag LOCUS_16180 296898 294946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 298152 297070 gene locus_tag LOCUS_16190 298152 297070 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109596.1 protein_id gnl|my_center|LOCUS_16190 298424 298155 gene locus_tag LOCUS_16200 298424 298155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 298893 298417 gene locus_tag LOCUS_16210 298893 298417 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055869.1 protein_id gnl|my_center|LOCUS_16210 300045 298921 gene locus_tag LOCUS_16220 300045 298921 CDS product M14-type cytosolic carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526471.1 protein_id gnl|my_center|LOCUS_16220 300258 300334 gene locus_tag LOCUS_t00330 300258 300334 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 301253 300552 gene locus_tag LOCUS_16230 301253 300552 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122175.1 protein_id gnl|my_center|LOCUS_16230 301419 301880 gene locus_tag LOCUS_16240 301419 301880 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089222.1 protein_id gnl|my_center|LOCUS_16240 301969 302679 gene locus_tag LOCUS_16250 301969 302679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 303002 303961 gene locus_tag LOCUS_16260 303002 303961 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775527.1 protein_id gnl|my_center|LOCUS_16260 303974 305095 gene locus_tag LOCUS_16270 303974 305095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 308377 305081 gene locus_tag LOCUS_16280 308377 305081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 308781 310172 gene locus_tag LOCUS_16290 308781 310172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 311251 310274 gene locus_tag LOCUS_16300 311251 310274 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974703.1 protein_id gnl|my_center|LOCUS_16300 311661 311248 gene locus_tag LOCUS_16310 311661 311248 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313628.1 protein_id gnl|my_center|LOCUS_16310 312394 311717 gene locus_tag LOCUS_16320 312394 311717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 312895 313806 gene locus_tag LOCUS_16330 312895 313806 CDS product O-acetylserine/cysteine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526255.1 protein_id gnl|my_center|LOCUS_16330 313821 314780 gene locus_tag LOCUS_16340 313821 314780 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814870.1 protein_id gnl|my_center|LOCUS_16340 314944 315480 gene locus_tag LOCUS_16350 314944 315480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 315507 316010 gene locus_tag LOCUS_16360 315507 316010 CDS product DUF6265 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920316.1 protein_id gnl|my_center|LOCUS_16360 317574 316114 gene locus_tag LOCUS_16370 gene thrC 317574 316114 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192708.1 protein_id gnl|my_center|LOCUS_16370 318550 317684 gene locus_tag LOCUS_16380 gene fdhD 318550 317684 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809308.1 protein_id gnl|my_center|LOCUS_16380 318884 318564 gene locus_tag LOCUS_16390 318884 318564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 321237 318877 gene locus_tag LOCUS_16400 321237 318877 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037497.1 protein_id gnl|my_center|LOCUS_16400 321951 321379 gene locus_tag LOCUS_16410 321951 321379 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194572.1 protein_id gnl|my_center|LOCUS_16410 322124 323329 gene locus_tag LOCUS_16420 gene kbl 322124 323329 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213823.1 protein_id gnl|my_center|LOCUS_16420 323338 324309 gene locus_tag LOCUS_16430 323338 324309 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838116.1 protein_id gnl|my_center|LOCUS_16430 324343 325728 gene locus_tag LOCUS_16440 324343 325728 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037978.1 protein_id gnl|my_center|LOCUS_16440 327899 325845 gene locus_tag LOCUS_16450 327899 325845 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986774.1 protein_id gnl|my_center|LOCUS_16450 328168 328482 gene locus_tag LOCUS_16460 328168 328482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 328561 328908 gene locus_tag LOCUS_16470 328561 328908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 329463 329017 gene locus_tag LOCUS_16480 329463 329017 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446510.1 protein_id gnl|my_center|LOCUS_16480 329634 330725 gene locus_tag LOCUS_16490 329634 330725 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970366.1 protein_id gnl|my_center|LOCUS_16490 330863 332374 gene locus_tag LOCUS_16500 330863 332374 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551866.1 protein_id gnl|my_center|LOCUS_16500 332508 332804 gene locus_tag LOCUS_16510 332508 332804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 332908 333390 gene locus_tag LOCUS_16520 gene iscR 332908 333390 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195928.1 protein_id gnl|my_center|LOCUS_16520 333407 334660 gene locus_tag LOCUS_16530 333407 334660 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524724.1 protein_id gnl|my_center|LOCUS_16530 334732 335133 gene locus_tag LOCUS_16540 gene iscU 334732 335133 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192918.1 protein_id gnl|my_center|LOCUS_16540 335185 335508 gene locus_tag LOCUS_16550 gene iscA 335185 335508 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550200.1 protein_id gnl|my_center|LOCUS_16550 335520 336023 gene locus_tag LOCUS_16560 gene hscB 335520 336023 CDS product Fe-S protein assembly co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202016.1 protein_id gnl|my_center|LOCUS_16560 336127 337962 gene locus_tag LOCUS_16570 gene hscA 336127 337962 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938156.1 protein_id gnl|my_center|LOCUS_16570 338011 338349 gene locus_tag LOCUS_16580 gene fdx 338011 338349 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812453.1 protein_id gnl|my_center|LOCUS_16580 338426 338617 gene locus_tag LOCUS_16590 gene iscX 338426 338617 CDS product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460231.1 protein_id gnl|my_center|LOCUS_16590 338891 340555 gene locus_tag LOCUS_16600 338891 340555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 340705 341499 gene locus_tag LOCUS_16610 gene thyA 340705 341499 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816253.1 protein_id gnl|my_center|LOCUS_16610 341542 342024 gene locus_tag LOCUS_16620 341542 342024 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189313.1 protein_id gnl|my_center|LOCUS_16620 342032 342601 gene locus_tag LOCUS_16630 342032 342601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 342618 343406 gene locus_tag LOCUS_16640 342618 343406 CDS product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532005.1 protein_id gnl|my_center|LOCUS_16640 343796 346066 gene locus_tag LOCUS_16650 343796 346066 CDS product arginine/lysine/ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808393.1 protein_id gnl|my_center|LOCUS_16650 346261 347169 gene locus_tag LOCUS_16660 346261 347169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 347539 350031 gene locus_tag LOCUS_16670 347539 350031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 350044 351495 gene locus_tag LOCUS_16680 350044 351495 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920272.1 protein_id gnl|my_center|LOCUS_16680 352515 351595 gene locus_tag LOCUS_16690 352515 351595 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184594.1 protein_id gnl|my_center|LOCUS_16690 353081 352515 gene locus_tag LOCUS_16700 gene dcd 353081 352515 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808382.1 protein_id gnl|my_center|LOCUS_16700 353438 355843 gene locus_tag LOCUS_16710 353438 355843 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100007.1 protein_id gnl|my_center|LOCUS_16710 356002 356292 gene locus_tag LOCUS_16720 356002 356292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 356772 357659 gene locus_tag LOCUS_16730 gene prfB 356772 357659 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199566.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16730 357752 359293 gene locus_tag LOCUS_16740 gene lysS 357752 359293 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205152.1 protein_id gnl|my_center|LOCUS_16740 359665 361452 gene locus_tag LOCUS_16750 359665 361452 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144121.1 protein_id gnl|my_center|LOCUS_16750 361560 362033 gene locus_tag LOCUS_16760 361560 362033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 363132 362131 gene locus_tag LOCUS_16770 363132 362131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 363667 363218 gene locus_tag LOCUS_16780 363667 363218 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193328.1 protein_id gnl|my_center|LOCUS_16780 363855 365165 gene locus_tag LOCUS_16790 363855 365165 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084053.1 protein_id gnl|my_center|LOCUS_16790 365167 365973 gene locus_tag LOCUS_16800 365167 365973 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084052.1 protein_id gnl|my_center|LOCUS_16800 365996 366613 gene locus_tag LOCUS_16810 365996 366613 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528284.1 protein_id gnl|my_center|LOCUS_16810 367703 366633 gene locus_tag LOCUS_16820 367703 366633 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187699.1 protein_id gnl|my_center|LOCUS_16820 368800 367790 gene locus_tag LOCUS_16830 368800 367790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330175.1 protein_id gnl|my_center|LOCUS_16830 369507 368812 gene locus_tag LOCUS_16840 gene cysC 369507 368812 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536954.1 protein_id gnl|my_center|LOCUS_16840 371296 369545 gene locus_tag LOCUS_16850 371296 369545 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536557.1 protein_id gnl|my_center|LOCUS_16850 371810 372142 gene locus_tag LOCUS_16860 371810 372142 CDS product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265918.1 protein_id gnl|my_center|LOCUS_16860 372646 372212 gene locus_tag LOCUS_16870 372646 372212 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812977.1 protein_id gnl|my_center|LOCUS_16870 373086 372643 gene locus_tag LOCUS_16880 373086 372643 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098308.1 protein_id gnl|my_center|LOCUS_16880 373988 373092 gene locus_tag LOCUS_16890 373988 373092 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144243.1 protein_id gnl|my_center|LOCUS_16890 374921 374022 gene locus_tag LOCUS_16900 374921 374022 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641673.1 protein_id gnl|my_center|LOCUS_16900 375911 374979 gene locus_tag LOCUS_16910 375911 374979 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092916.1 protein_id gnl|my_center|LOCUS_16910 376955 375945 gene locus_tag LOCUS_16920 376955 375945 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192815.1 protein_id gnl|my_center|LOCUS_16920 378276 376963 gene locus_tag LOCUS_16930 378276 376963 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135173384.1 protein_id gnl|my_center|LOCUS_16930 378800 378327 gene locus_tag LOCUS_16940 378800 378327 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193935.1 protein_id gnl|my_center|LOCUS_16940 379606 378812 gene locus_tag LOCUS_16950 379606 378812 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889459.1 protein_id gnl|my_center|LOCUS_16950 381552 379735 gene locus_tag LOCUS_16960 381552 379735 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206873.1 protein_id gnl|my_center|LOCUS_16960 382823 381645 gene locus_tag LOCUS_16970 382823 381645 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550299.1 protein_id gnl|my_center|LOCUS_16970 383293 384957 gene locus_tag LOCUS_16980 383293 384957 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526206.1 protein_id gnl|my_center|LOCUS_16980 385963 385061 gene locus_tag LOCUS_16990 385963 385061 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040000.1 protein_id gnl|my_center|LOCUS_16990 386579 386046 gene locus_tag LOCUS_17000 gene tadA 386579 386046 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191221.1 protein_id gnl|my_center|LOCUS_17000 387022 386579 gene locus_tag LOCUS_17010 gene queD 387022 386579 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189793.1 protein_id gnl|my_center|LOCUS_17010 387664 387029 gene locus_tag LOCUS_17020 gene queE 387664 387029 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189241.1 protein_id gnl|my_center|LOCUS_17020 389604 388075 gene locus_tag LOCUS_17030 389604 388075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 390677 389652 gene locus_tag LOCUS_17040 390677 389652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 392677 390803 gene locus_tag LOCUS_17050 392677 390803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 396543 393970 gene locus_tag LOCUS_17060 396543 393970 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103467.1 protein_id gnl|my_center|LOCUS_17060 397690 396653 gene locus_tag LOCUS_17070 397690 396653 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205506.1 protein_id gnl|my_center|LOCUS_17070 398213 397704 gene locus_tag LOCUS_17080 398213 397704 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524116.1 protein_id gnl|my_center|LOCUS_17080 400014 398464 gene locus_tag LOCUS_17090 400014 398464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 401813 400221 gene locus_tag LOCUS_17100 gene guaA 401813 400221 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812366.1 protein_id gnl|my_center|LOCUS_17100 402800 401817 gene locus_tag LOCUS_17110 402800 401817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 404364 402904 gene locus_tag LOCUS_17120 gene guaB 404364 402904 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192833.1 protein_id gnl|my_center|LOCUS_17120 404469 404969 gene locus_tag LOCUS_17130 404469 404969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 405298 405020 gene locus_tag LOCUS_17140 405298 405020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 405809 405309 gene locus_tag LOCUS_17150 405809 405309 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192775.1 protein_id gnl|my_center|LOCUS_17150 405852 406301 gene locus_tag LOCUS_17160 gene smpB 405852 406301 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063759.1 protein_id gnl|my_center|LOCUS_17160 406748 406374 gene locus_tag LOCUS_17170 406748 406374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 407006 407773 gene locus_tag LOCUS_17180 gene ompR 407006 407773 CDS product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199523.1 protein_id gnl|my_center|LOCUS_17180 407829 409190 gene locus_tag LOCUS_17190 407829 409190 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196632.1 protein_id gnl|my_center|LOCUS_17190 410608 409265 gene locus_tag LOCUS_17200 gene dctA 410608 409265 CDS product C4-dicarboxylate transporter DctC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082442.1 protein_id gnl|my_center|LOCUS_17200 412004 410628 gene locus_tag LOCUS_17210 gene pcaB 412004 410628 CDS product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090665.1 protein_id gnl|my_center|LOCUS_17210 412140 412877 gene locus_tag LOCUS_17220 412140 412877 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050450674.1 protein_id gnl|my_center|LOCUS_17220 418610 413001 gene locus_tag LOCUS_17230 418610 413001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 418814 419446 gene locus_tag LOCUS_17240 gene upp 418814 419446 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384917.1 protein_id gnl|my_center|LOCUS_17240 419479 420645 gene locus_tag LOCUS_17250 419479 420645 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024900539.1 protein_id gnl|my_center|LOCUS_17250 422391 420883 gene locus_tag LOCUS_17260 422391 420883 CDS product DUF3999 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765555.1 protein_id gnl|my_center|LOCUS_17260 426374 422388 gene locus_tag LOCUS_17270 426374 422388 CDS product DUF2339 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114470.1 protein_id gnl|my_center|LOCUS_17270 427151 426744 gene locus_tag LOCUS_17280 427151 426744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 428245 427148 gene locus_tag LOCUS_17290 gene zapE 428245 427148 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550551.1 protein_id gnl|my_center|LOCUS_17290 429837 428407 gene locus_tag LOCUS_17300 gene lpdA 429837 428407 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813626.1 protein_id gnl|my_center|LOCUS_17300 430240 429908 gene locus_tag LOCUS_17310 430240 429908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 431531 430272 gene locus_tag LOCUS_17320 gene odhB 431531 430272 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521670.1 protein_id gnl|my_center|LOCUS_17320 434448 431593 gene locus_tag LOCUS_17330 434448 431593 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191889.1 protein_id gnl|my_center|LOCUS_17330 436101 434797 gene locus_tag LOCUS_17340 gene gltA 436101 434797 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188362.1 protein_id gnl|my_center|LOCUS_17340 436443 436162 gene locus_tag LOCUS_17350 436443 436162 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528990.1 protein_id gnl|my_center|LOCUS_17350 437261 436551 gene locus_tag LOCUS_17360 437261 436551 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065157.1 protein_id gnl|my_center|LOCUS_17360 439049 437274 gene locus_tag LOCUS_17370 gene sdhA 439049 437274 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009940953.1 protein_id gnl|my_center|LOCUS_17370 439420 439052 gene locus_tag LOCUS_17380 gene sdhD 439420 439052 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187439.1 protein_id gnl|my_center|LOCUS_17380 439828 439421 gene locus_tag LOCUS_17390 gene sdhC 439828 439421 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536542.1 protein_id gnl|my_center|LOCUS_17390 440876 440043 gene locus_tag LOCUS_17400 440876 440043 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196014.1 protein_id gnl|my_center|LOCUS_17400 441202 442191 gene locus_tag LOCUS_17410 441202 442191 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065155.1 protein_id gnl|my_center|LOCUS_17410 442288 443226 gene locus_tag LOCUS_17420 442288 443226 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188261.1 protein_id gnl|my_center|LOCUS_17420 443237 443716 gene locus_tag LOCUS_17430 443237 443716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 443815 446550 gene locus_tag LOCUS_17440 gene acnA 443815 446550 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820240.1 protein_id gnl|my_center|LOCUS_17440 446783 447019 gene locus_tag LOCUS_17450 446783 447019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 448317 447136 gene locus_tag LOCUS_17460 448317 447136 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527146.1 protein_id gnl|my_center|LOCUS_17460 448779 449666 gene locus_tag LOCUS_17470 448779 449666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 449799 450524 gene locus_tag LOCUS_17480 449799 450524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 451043 450573 gene locus_tag LOCUS_17490 451043 450573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 452425 451043 gene locus_tag LOCUS_17500 gene rimO 452425 451043 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521351.1 protein_id gnl|my_center|LOCUS_17500 453150 452593 gene locus_tag LOCUS_17510 gene phaR 453150 452593 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192676.1 protein_id gnl|my_center|LOCUS_17510 454205 453465 gene locus_tag LOCUS_17520 454205 453465 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193701.1 protein_id gnl|my_center|LOCUS_17520 455975 454251 gene locus_tag LOCUS_17530 gene phaC 455975 454251 CDS product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527151.1 protein_id gnl|my_center|LOCUS_17530 456133 456438 gene locus_tag LOCUS_17540 456133 456438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 457279 456449 gene locus_tag LOCUS_17550 gene yfiH 457279 456449 CDS product purine nucleoside phosphorylase YfiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209471.1 protein_id gnl|my_center|LOCUS_17550 458316 457276 gene locus_tag LOCUS_17560 458316 457276 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203970.1 protein_id gnl|my_center|LOCUS_17560 458501 459163 gene locus_tag LOCUS_17570 458501 459163 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193722.1 protein_id gnl|my_center|LOCUS_17570 460114 459338 gene locus_tag LOCUS_17580 gene yaaA 460114 459338 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420750.1 protein_id gnl|my_center|LOCUS_17580 460136 460618 gene locus_tag LOCUS_17590 460136 460618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 460882 461646 gene locus_tag LOCUS_17600 gene cheZ 460882 461646 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811909.1 protein_id gnl|my_center|LOCUS_17600 461646 463496 gene locus_tag LOCUS_17610 461646 463496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 463649 465133 gene locus_tag LOCUS_17620 463649 465133 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538218.1 protein_id gnl|my_center|LOCUS_17620 465149 465544 gene locus_tag LOCUS_17630 gene msrB 465149 465544 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813871.1 protein_id gnl|my_center|LOCUS_17630 465556 466179 gene locus_tag LOCUS_17640 465556 466179 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813872.1 protein_id gnl|my_center|LOCUS_17640 466176 466448 gene locus_tag LOCUS_17650 466176 466448 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037355.1 protein_id gnl|my_center|LOCUS_17650 466500 467273 gene locus_tag LOCUS_17660 466500 467273 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191958.1 protein_id gnl|my_center|LOCUS_17660 468100 467393 gene locus_tag LOCUS_17670 468100 467393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 472446 468403 gene locus_tag LOCUS_17680 gene purL 472446 468403 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527208.1 protein_id gnl|my_center|LOCUS_17680 474245 472560 gene locus_tag LOCUS_17690 gene arnT 474245 472560 CDS product lipid IV(A) 4-amino-4-deoxy-L-arabinosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704923.1 protein_id gnl|my_center|LOCUS_17690 475612 474395 gene locus_tag LOCUS_17700 475612 474395 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706002.1 protein_id gnl|my_center|LOCUS_17700 476225 475653 gene locus_tag LOCUS_17710 gene cheZ 476225 475653 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811909.1 protein_id gnl|my_center|LOCUS_17710 476705 476316 gene locus_tag LOCUS_17720 gene cheY 476705 476316 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367338.1 protein_id gnl|my_center|LOCUS_17720 477887 476811 gene locus_tag LOCUS_17730 477887 476811 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200023.1 protein_id gnl|my_center|LOCUS_17730 478552 477947 gene locus_tag LOCUS_17740 gene cheD 478552 477947 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072188.1 protein_id gnl|my_center|LOCUS_17740 479448 478549 gene locus_tag LOCUS_17750 479448 478549 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525698.1 protein_id gnl|my_center|LOCUS_17750 481417 479669 gene locus_tag LOCUS_17760 481417 479669 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201704.1 protein_id gnl|my_center|LOCUS_17760 482018 481500 gene locus_tag LOCUS_17770 gene cheW 482018 481500 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199265.1 protein_id gnl|my_center|LOCUS_17770 484108 482054 gene locus_tag LOCUS_17780 gene cheA 484108 482054 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205291.1 protein_id gnl|my_center|LOCUS_17780 484525 484160 gene locus_tag LOCUS_17790 484525 484160 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083943.1 protein_id gnl|my_center|LOCUS_17790 485128 484577 gene locus_tag LOCUS_17800 485128 484577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 486103 485180 gene locus_tag LOCUS_17810 gene motB 486103 485180 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938926.1 protein_id gnl|my_center|LOCUS_17810 486981 486121 gene locus_tag LOCUS_17820 gene motA 486981 486121 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198197.1 protein_id gnl|my_center|LOCUS_17820 487905 487099 gene locus_tag LOCUS_17830 487905 487099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 488475 487921 gene locus_tag LOCUS_17840 gene flhC 488475 487921 CDS product flagellar transcriptional regulator FlhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198198.1 protein_id gnl|my_center|LOCUS_17840 488813 488514 gene locus_tag LOCUS_17850 gene flhD 488813 488514 CDS product flagellar transcriptional regulator FlhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198199.1 protein_id gnl|my_center|LOCUS_17850 490085 489378 gene locus_tag LOCUS_17860 gene dnaQ 490085 489378 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531112.1 protein_id gnl|my_center|LOCUS_17860 491512 490112 gene locus_tag LOCUS_17870 gene tilS 491512 490112 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524749.1 protein_id gnl|my_center|LOCUS_17870 492483 491509 gene locus_tag LOCUS_17880 492483 491509 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193249.1 protein_id gnl|my_center|LOCUS_17880 493045 494058 gene locus_tag LOCUS_17890 493045 494058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 494133 495326 gene locus_tag LOCUS_17900 494133 495326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 495533 496084 gene locus_tag LOCUS_17910 495533 496084 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191635.1 protein_id gnl|my_center|LOCUS_17910 496140 496628 gene locus_tag LOCUS_17920 496140 496628 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019248574.1 protein_id gnl|my_center|LOCUS_17920 496656 497462 gene locus_tag LOCUS_17930 496656 497462 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039346.1 protein_id gnl|my_center|LOCUS_17930 498144 497452 gene locus_tag LOCUS_17940 498144 497452 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928863.1 protein_id gnl|my_center|LOCUS_17940 498276 498812 gene locus_tag LOCUS_17950 498276 498812 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009942000.1 protein_id gnl|my_center|LOCUS_17950 498816 499880 gene locus_tag LOCUS_17960 gene mnmH 498816 499880 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526161.1 protein_id gnl|my_center|LOCUS_17960 500052 499909 gene locus_tag LOCUS_17970 500052 499909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 502329 500056 gene locus_tag LOCUS_17980 502329 500056 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766952.1 protein_id gnl|my_center|LOCUS_17980 502598 502356 gene locus_tag LOCUS_17990 502598 502356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 504082 503099 gene locus_tag LOCUS_18000 504082 503099 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191725.1 protein_id gnl|my_center|LOCUS_18000 504462 504097 gene locus_tag LOCUS_18010 504462 504097 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193415.1 protein_id gnl|my_center|LOCUS_18010 505138 504479 gene locus_tag LOCUS_18020 505138 504479 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524610.1 protein_id gnl|my_center|LOCUS_18020 506195 505227 gene locus_tag LOCUS_18030 506195 505227 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193798.1 protein_id gnl|my_center|LOCUS_18030 506869 509973 gene locus_tag LOCUS_18040 506869 509973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 510180 511328 gene locus_tag LOCUS_18050 gene moaA 510180 511328 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532083.1 protein_id gnl|my_center|LOCUS_18050 511452 512072 gene locus_tag LOCUS_18060 gene mobA 511452 512072 CDS product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930371.1 protein_id gnl|my_center|LOCUS_18060 512074 513375 gene locus_tag LOCUS_18070 512074 513375 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930370.1 protein_id gnl|my_center|LOCUS_18070 513554 514402 gene locus_tag LOCUS_18080 513554 514402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 514493 514843 gene locus_tag LOCUS_18090 514493 514843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 514966 516213 gene locus_tag LOCUS_18100 514966 516213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181712483.1 protein_id gnl|my_center|LOCUS_18100 516223 516657 gene locus_tag LOCUS_18110 516223 516657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 516665 518311 gene locus_tag LOCUS_18120 516665 518311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 519371 518304 gene locus_tag LOCUS_18130 519371 518304 CDS product questin oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818081.1 protein_id gnl|my_center|LOCUS_18130 519455 519934 gene locus_tag LOCUS_18140 gene soxR 519455 519934 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706522.1 protein_id gnl|my_center|LOCUS_18140 521633 519945 gene locus_tag LOCUS_18150 gene rmuC 521633 519945 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527474.1 protein_id gnl|my_center|LOCUS_18150 522089 521676 gene locus_tag LOCUS_18160 522089 521676 CDS product group II truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526443.1 protein_id gnl|my_center|LOCUS_18160 522762 522124 gene locus_tag LOCUS_18170 gene yfcF 522762 522124 CDS product glutathione transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206483.1 protein_id gnl|my_center|LOCUS_18170 525322 522827 gene locus_tag LOCUS_18180 525322 522827 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039500.1 protein_id gnl|my_center|LOCUS_18180 526820 525579 gene locus_tag LOCUS_18190 526820 525579 CDS product cystathionine gamma-synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812972.1 protein_id gnl|my_center|LOCUS_18190 527817 526921 gene locus_tag LOCUS_18200 527817 526921 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192762.1 protein_id gnl|my_center|LOCUS_18200 527974 529665 gene locus_tag LOCUS_18210 527974 529665 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065145.1 protein_id gnl|my_center|LOCUS_18210 530307 529684 gene locus_tag LOCUS_18220 530307 529684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 530414 530938 gene locus_tag LOCUS_18230 530414 530938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 531093 531725 gene locus_tag LOCUS_18240 531093 531725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 532585 531734 gene locus_tag LOCUS_18250 532585 531734 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004566336.1 protein_id gnl|my_center|LOCUS_18250 532665 533189 gene locus_tag LOCUS_18260 532665 533189 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524734.1 protein_id gnl|my_center|LOCUS_18260 533219 534145 gene locus_tag LOCUS_18270 gene hslO 533219 534145 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191092.1 protein_id gnl|my_center|LOCUS_18270 534399 535463 gene locus_tag LOCUS_18280 534399 535463 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531377.1 protein_id gnl|my_center|LOCUS_18280 535466 536827 gene locus_tag LOCUS_18290 535466 536827 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931796.1 protein_id gnl|my_center|LOCUS_18290 537434 536973 gene locus_tag LOCUS_18300 537434 536973 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942521.1 protein_id gnl|my_center|LOCUS_18300 537703 538806 gene locus_tag LOCUS_18310 537703 538806 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969472.1 protein_id gnl|my_center|LOCUS_18310 539708 538833 gene locus_tag LOCUS_18320 539708 538833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 540633 539725 gene locus_tag LOCUS_18330 540633 539725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 541721 542650 gene locus_tag LOCUS_18340 541721 542650 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921395.1 protein_id gnl|my_center|LOCUS_18340 542660 546259 gene locus_tag LOCUS_18350 542660 546259 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037426.1 protein_id gnl|my_center|LOCUS_18350 546552 548414 gene locus_tag LOCUS_18360 gene pepF 546552 548414 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944353.1 protein_id gnl|my_center|LOCUS_18360 548540 550594 gene locus_tag LOCUS_18370 548540 550594 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142622.1 protein_id gnl|my_center|LOCUS_18370 550796 551395 gene locus_tag LOCUS_18380 550796 551395 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459058.1 protein_id gnl|my_center|LOCUS_18380 552306 551407 gene locus_tag LOCUS_18390 552306 551407 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390650.1 protein_id gnl|my_center|LOCUS_18390 556588 552443 gene locus_tag LOCUS_18400 gene hrpA 556588 552443 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202033.1 protein_id gnl|my_center|LOCUS_18400 556986 558134 gene locus_tag LOCUS_18410 556986 558134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071063.1 protein_id gnl|my_center|LOCUS_18410 558281 559591 gene locus_tag LOCUS_18420 gene argA 558281 559591 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192168.1 protein_id gnl|my_center|LOCUS_18420 559666 559938 gene locus_tag LOCUS_18430 559666 559938 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193961.1 protein_id gnl|my_center|LOCUS_18430 560698 560027 gene locus_tag LOCUS_18440 gene rpiA 560698 560027 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192848.1 protein_id gnl|my_center|LOCUS_18440 561789 560782 gene locus_tag LOCUS_18450 561789 560782 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556653.1 protein_id gnl|my_center|LOCUS_18450 561899 562612 gene locus_tag LOCUS_18460 561899 562612 CDS product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933923.1 protein_id gnl|my_center|LOCUS_18460 562734 562988 gene locus_tag LOCUS_18470 562734 562988 CDS product acyl-CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191359.1 protein_id gnl|my_center|LOCUS_18470 563956 562985 gene locus_tag LOCUS_18480 563956 562985 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203830.1 protein_id gnl|my_center|LOCUS_18480 564321 564503 gene locus_tag LOCUS_18490 564321 564503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 565436 566035 gene locus_tag LOCUS_18500 565436 566035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 566032 566997 gene locus_tag LOCUS_18510 566032 566997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 567001 568125 gene locus_tag LOCUS_18520 567001 568125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 568846 569169 gene locus_tag LOCUS_18530 568846 569169 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004205776.1 protein_id gnl|my_center|LOCUS_18530 569244 570314 gene locus_tag LOCUS_18540 569244 570314 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088624.1 protein_id gnl|my_center|LOCUS_18540 571549 570425 gene locus_tag LOCUS_18550 571549 570425 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704392.1 protein_id gnl|my_center|LOCUS_18550 575905 571613 gene locus_tag LOCUS_18560 575905 571613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 576472 577707 gene locus_tag LOCUS_18570 gene phaZ 576472 577707 CDS product polyhydroxyalkanoate depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813854.1 protein_id gnl|my_center|LOCUS_18570 577870 578520 gene locus_tag LOCUS_18580 577870 578520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 578517 579164 gene locus_tag LOCUS_18590 gene nth 578517 579164 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210602.1 protein_id gnl|my_center|LOCUS_18590 579844 579263 gene locus_tag LOCUS_18600 579844 579263 CDS product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195469.1 protein_id gnl|my_center|LOCUS_18600 579957 580385 gene locus_tag LOCUS_18610 579957 580385 CDS product DUF1841 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553866.1 protein_id gnl|my_center|LOCUS_18610 581668 580493 gene locus_tag LOCUS_18620 gene bamC 581668 580493 CDS product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809956.1 protein_id gnl|my_center|LOCUS_18620 582588 581746 gene locus_tag LOCUS_18630 gene dapA 582588 581746 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191516.1 protein_id gnl|my_center|LOCUS_18630 583281 582730 gene locus_tag LOCUS_18640 583281 582730 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192474.1 protein_id gnl|my_center|LOCUS_18640 583956 583294 gene locus_tag LOCUS_18650 583956 583294 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192745.1 protein_id gnl|my_center|LOCUS_18650 584631 584008 gene locus_tag LOCUS_18660 584631 584008 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192132.1 protein_id gnl|my_center|LOCUS_18660 585560 584685 gene locus_tag LOCUS_18670 gene htpX 585560 584685 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813142.1 protein_id gnl|my_center|LOCUS_18670 586477 585629 gene locus_tag LOCUS_18680 586477 585629 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193008.1 protein_id gnl|my_center|LOCUS_18680 588934 586616 gene locus_tag LOCUS_18690 gene pfeA 588934 586616 CDS product siderophore enterobactin receptor PfeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113404.1 protein_id gnl|my_center|LOCUS_18690 590558 589239 gene locus_tag LOCUS_18700 gene lnrM 590558 589239 CDS product linearmycin resistance permease LnrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242483.1 protein_id gnl|my_center|LOCUS_18700 591599 590652 gene locus_tag LOCUS_18710 gene lnrL 591599 590652 CDS product linearmycin resistance ATP-binding protein LnrL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244346.1 protein_id gnl|my_center|LOCUS_18710 593311 591794 gene locus_tag LOCUS_18720 gene purF 593311 591794 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525195.1 protein_id gnl|my_center|LOCUS_18720 593822 593334 gene locus_tag LOCUS_18730 593822 593334 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811815.1 protein_id gnl|my_center|LOCUS_18730 594887 593835 gene locus_tag LOCUS_18740 594887 593835 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015041541.1 protein_id gnl|my_center|LOCUS_18740 596166 594949 gene locus_tag LOCUS_18750 gene folC 596166 594949 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811819.1 protein_id gnl|my_center|LOCUS_18750 597171 596296 gene locus_tag LOCUS_18760 gene accD 597171 596296 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188147.1 protein_id gnl|my_center|LOCUS_18760 598054 597257 gene locus_tag LOCUS_18770 gene trpA 598054 597257 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528976.1 protein_id gnl|my_center|LOCUS_18770 599453 598185 gene locus_tag LOCUS_18780 gene trpB 599453 598185 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188704.1 protein_id gnl|my_center|LOCUS_18780 600178 599513 gene locus_tag LOCUS_18790 600178 599513 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187259.1 protein_id gnl|my_center|LOCUS_18790 601738 600374 gene locus_tag LOCUS_18800 601738 600374 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809289.1 protein_id gnl|my_center|LOCUS_18800 602035 602970 gene locus_tag LOCUS_18810 602035 602970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 602970 604976 gene locus_tag LOCUS_18820 gene cyoB 602970 604976 CDS product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204250004.1 protein_id gnl|my_center|LOCUS_18820 604969 605634 gene locus_tag LOCUS_18830 gene cyoC 604969 605634 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819722.1 protein_id gnl|my_center|LOCUS_18830 605631 606113 gene locus_tag LOCUS_18840 gene cyoD 605631 606113 CDS product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809276.1 protein_id gnl|my_center|LOCUS_18840 606110 606979 gene locus_tag LOCUS_18850 606110 606979 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015456717.1 protein_id gnl|my_center|LOCUS_18850 607105 608415 gene locus_tag LOCUS_18860 607105 608415 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531508.1 protein_id gnl|my_center|LOCUS_18860 608528 609064 gene locus_tag LOCUS_18870 608528 609064 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919635.1 protein_id gnl|my_center|LOCUS_18870 609871 609329 gene locus_tag LOCUS_18880 609871 609329 CDS product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811971.1 protein_id gnl|my_center|LOCUS_18880 610743 609871 gene locus_tag LOCUS_18890 gene purU 610743 609871 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522850.1 protein_id gnl|my_center|LOCUS_18890 611038 612063 gene locus_tag LOCUS_18900 611038 612063 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097826.1 protein_id gnl|my_center|LOCUS_18900 612967 612173 gene locus_tag LOCUS_18910 612967 612173 CDS product hydroxypyruvate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524357.1 protein_id gnl|my_center|LOCUS_18910 613908 612979 gene locus_tag LOCUS_18920 613908 612979 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100363.1 protein_id gnl|my_center|LOCUS_18920 614214 614651 gene locus_tag LOCUS_18930 614214 614651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 615135 614668 gene locus_tag LOCUS_18940 615135 614668 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107647.1 protein_id gnl|my_center|LOCUS_18940 616691 615204 gene locus_tag LOCUS_18950 616691 615204 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536419.1 protein_id gnl|my_center|LOCUS_18950 617177 618100 gene locus_tag LOCUS_18960 617177 618100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 619363 618197 gene locus_tag LOCUS_18970 619363 618197 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194932.1 protein_id gnl|my_center|LOCUS_18970 619931 619467 gene locus_tag LOCUS_18980 gene nusB 619931 619467 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808599.1 protein_id gnl|my_center|LOCUS_18980 620476 619979 gene locus_tag LOCUS_18990 gene ribH 620476 619979 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186056.1 protein_id gnl|my_center|LOCUS_18990 621692 620571 gene locus_tag LOCUS_19000 gene ribBA 621692 620571 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186115.1 protein_id gnl|my_center|LOCUS_19000 622772 621870 gene locus_tag LOCUS_19010 622772 621870 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065180.1 protein_id gnl|my_center|LOCUS_19010 623758 622769 gene locus_tag LOCUS_19020 623758 622769 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525879.1 protein_id gnl|my_center|LOCUS_19020 623947 625422 gene locus_tag LOCUS_19030 623947 625422 CDS product oligopeptide:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444487.1 protein_id gnl|my_center|LOCUS_19030 626311 625427 gene locus_tag LOCUS_19040 626311 625427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 626602 627891 gene locus_tag LOCUS_19050 626602 627891 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226634.1 protein_id gnl|my_center|LOCUS_19050 628051 630315 gene locus_tag LOCUS_19060 628051 630315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 630479 630748 gene locus_tag LOCUS_19070 630479 630748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 632052 630826 gene locus_tag LOCUS_19080 gene flgL 632052 630826 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037107.1 protein_id gnl|my_center|LOCUS_19080 634319 632061 gene locus_tag LOCUS_19090 gene flgK 634319 632061 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203463.1 protein_id gnl|my_center|LOCUS_19090 635413 634496 gene locus_tag LOCUS_19100 gene flgJ 635413 634496 CDS product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197262.1 protein_id gnl|my_center|LOCUS_19100 636493 635423 gene locus_tag LOCUS_19110 636493 635423 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550967.1 protein_id gnl|my_center|LOCUS_19110 637245 636571 gene locus_tag LOCUS_19120 gene flgH 637245 636571 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197258.1 protein_id gnl|my_center|LOCUS_19120 638092 637310 gene locus_tag LOCUS_19130 gene flgG 638092 637310 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625851.1 protein_id gnl|my_center|LOCUS_19130 638896 638156 gene locus_tag LOCUS_19140 gene flgF 638896 638156 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185014.1 protein_id gnl|my_center|LOCUS_19140 640306 638966 gene locus_tag LOCUS_19150 gene flgE 640306 638966 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197255.1 protein_id gnl|my_center|LOCUS_19150 641037 640369 gene locus_tag LOCUS_19160 gene flgD 641037 640369 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211112.1 protein_id gnl|my_center|LOCUS_19160 641464 641060 gene locus_tag LOCUS_19170 gene flgC 641464 641060 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097782.1 protein_id gnl|my_center|LOCUS_19170 641933 641526 gene locus_tag LOCUS_19180 gene flgB 641933 641526 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097139.1 protein_id gnl|my_center|LOCUS_19180 642161 642856 gene locus_tag LOCUS_19190 gene flgA 642161 642856 CDS product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197247.1 protein_id gnl|my_center|LOCUS_19190 642989 643297 gene locus_tag LOCUS_19200 642989 643297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 643300 643803 gene locus_tag LOCUS_19210 643300 643803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 644737 643901 gene locus_tag LOCUS_19220 gene motD 644737 643901 CDS product flagellar motor protein MotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103791.1 protein_id gnl|my_center|LOCUS_19220 645511 644771 gene locus_tag LOCUS_19230 645511 644771 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378725.1 protein_id gnl|my_center|LOCUS_19230 646248 645493 gene locus_tag LOCUS_19240 646248 645493 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198636.1 protein_id gnl|my_center|LOCUS_19240 647071 646229 gene locus_tag LOCUS_19250 647071 646229 CDS product flagellar biosynthesis protein FlhG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198637.1 protein_id gnl|my_center|LOCUS_19250 648401 647064 gene locus_tag LOCUS_19260 648401 647064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 650485 648398 gene locus_tag LOCUS_19270 gene flhA 650485 648398 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198639.1 protein_id gnl|my_center|LOCUS_19270 651633 650482 gene locus_tag LOCUS_19280 gene flhB 651633 650482 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930321.1 protein_id gnl|my_center|LOCUS_19280 653111 651861 gene locus_tag LOCUS_19290 653111 651861 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083543.1 protein_id gnl|my_center|LOCUS_19290 654463 653237 gene locus_tag LOCUS_19300 654463 653237 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963656.1 protein_id gnl|my_center|LOCUS_19300 654708 655268 gene locus_tag LOCUS_19310 654708 655268 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225604.1 protein_id gnl|my_center|LOCUS_19310 655916 655308 gene locus_tag LOCUS_19320 655916 655308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 656122 657708 gene locus_tag LOCUS_19330 656122 657708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 657863 658207 gene locus_tag LOCUS_19340 657863 658207 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198701.1 protein_id gnl|my_center|LOCUS_19340 658236 658916 gene locus_tag LOCUS_19350 658236 658916 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919378.1 protein_id gnl|my_center|LOCUS_19350 658941 659360 gene locus_tag LOCUS_19360 gene arsC 658941 659360 CDS product glutaredoxin-dependent arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705616.1 protein_id gnl|my_center|LOCUS_19360 660410 659532 gene locus_tag LOCUS_19370 660410 659532 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676765.1 protein_id gnl|my_center|LOCUS_19370 660936 660412 gene locus_tag LOCUS_19380 660936 660412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 662828 660933 gene locus_tag LOCUS_19390 662828 660933 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545101.1 protein_id gnl|my_center|LOCUS_19390 663142 666444 gene locus_tag LOCUS_19400 663142 666444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 667705 666497 gene locus_tag LOCUS_19410 667705 666497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 667704 667886 gene locus_tag LOCUS_19420 667704 667886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 668147 669229 gene locus_tag LOCUS_19430 668147 669229 CDS product type I restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039177.1 protein_id gnl|my_center|LOCUS_19430 670232 669483 gene locus_tag LOCUS_19440 670232 669483 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023619652.1 protein_id gnl|my_center|LOCUS_19440 670446 671348 gene locus_tag LOCUS_19450 670446 671348 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096538.1 protein_id gnl|my_center|LOCUS_19450 671699 672823 gene locus_tag LOCUS_19460 671699 672823 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038940.1 protein_id gnl|my_center|LOCUS_19460 673882 672863 gene locus_tag LOCUS_19470 673882 672863 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265922.1 protein_id gnl|my_center|LOCUS_19470 674255 674710 gene locus_tag LOCUS_19480 674255 674710 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975573.1 protein_id gnl|my_center|LOCUS_19480 675244 674792 gene locus_tag LOCUS_19490 675244 674792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 675539 675288 gene locus_tag LOCUS_19500 675539 675288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 676256 675630 gene locus_tag LOCUS_19510 676256 675630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 677190 676390 gene locus_tag LOCUS_19520 677190 676390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 677426 677334 gene locus_tag LOCUS_t00340 677426 677334 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 677578 677505 gene locus_tag LOCUS_t00350 677578 677505 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 677758 677683 gene locus_tag LOCUS_t00360 677758 677683 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 677870 677795 gene locus_tag LOCUS_t00370 677870 677795 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 677990 677915 gene locus_tag LOCUS_t00380 677990 677915 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 678655 678071 gene locus_tag LOCUS_19530 gene pgsA 678655 678071 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192722.1 protein_id gnl|my_center|LOCUS_19530 678863 678705 gene locus_tag LOCUS_19540 678863 678705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 680770 678902 gene locus_tag LOCUS_19550 gene uvrC 680770 678902 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930726.1 protein_id gnl|my_center|LOCUS_19550 681205 680804 gene locus_tag LOCUS_19560 gene acpS 681205 680804 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191194.1 protein_id gnl|my_center|LOCUS_19560 681977 681207 gene locus_tag LOCUS_19570 gene pdxJ 681977 681207 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192885.1 protein_id gnl|my_center|LOCUS_19570 682837 681974 gene locus_tag LOCUS_19580 gene recO 682837 681974 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192953.1 protein_id gnl|my_center|LOCUS_19580 683748 682846 gene locus_tag LOCUS_19590 gene era 683748 682846 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191678.1 protein_id gnl|my_center|LOCUS_19590 684744 683767 gene locus_tag LOCUS_19600 684744 683767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 685161 684751 gene locus_tag LOCUS_19610 685161 684751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 686379 685468 gene locus_tag LOCUS_19620 gene lepB 686379 685468 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193513.1 protein_id gnl|my_center|LOCUS_19620 688169 686376 gene locus_tag LOCUS_19630 gene lepA 688169 686376 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193305.1 protein_id gnl|my_center|LOCUS_19630 689158 688340 gene locus_tag LOCUS_19640 gene truA 689158 688340 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203245.1 protein_id gnl|my_center|LOCUS_19640 692054 689229 gene locus_tag LOCUS_19650 692054 689229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 693617 692487 gene locus_tag LOCUS_19660 gene asd 693617 692487 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188178.1 protein_id gnl|my_center|LOCUS_19660 694736 693666 gene locus_tag LOCUS_19670 gene leuB 694736 693666 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187693.1 protein_id gnl|my_center|LOCUS_19670 695428 694781 gene locus_tag LOCUS_19680 gene leuD 695428 694781 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187882.1 protein_id gnl|my_center|LOCUS_19680 696982 695579 gene locus_tag LOCUS_19690 gene leuC 696982 695579 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446523.1 protein_id gnl|my_center|LOCUS_19690 698392 697409 gene locus_tag LOCUS_19700 gene aroC 698392 697409 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266572.1 protein_id gnl|my_center|LOCUS_19700 698773 701007 gene locus_tag LOCUS_19710 698773 701007 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388417.1 protein_id gnl|my_center|LOCUS_19710 701281 702633 gene locus_tag LOCUS_19720 701281 702633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 702642 703400 gene locus_tag LOCUS_19730 702642 703400 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038759.1 protein_id gnl|my_center|LOCUS_19730 704526 703516 gene locus_tag LOCUS_19740 704526 703516 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193771.1 protein_id gnl|my_center|LOCUS_19740 705237 704611 gene locus_tag LOCUS_19750 705237 704611 CDS product DUF47 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193838.1 protein_id gnl|my_center|LOCUS_19750 706798 705401 gene locus_tag LOCUS_19760 706798 705401 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192724.1 protein_id gnl|my_center|LOCUS_19760 707443 706991 gene locus_tag LOCUS_19770 gene rplI 707443 706991 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191711.1 protein_id gnl|my_center|LOCUS_19770 707754 707470 gene locus_tag LOCUS_19780 gene rpsR 707754 707470 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193360.1 protein_id gnl|my_center|LOCUS_19780 708063 707764 gene locus_tag LOCUS_19790 gene priB 708063 707764 CDS product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192181.1 protein_id gnl|my_center|LOCUS_19790 708463 708095 gene locus_tag LOCUS_19800 gene rpsF 708463 708095 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193673.1 protein_id gnl|my_center|LOCUS_19800 708728 709384 gene locus_tag LOCUS_19810 gene lexA 708728 709384 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191638.1 protein_id gnl|my_center|LOCUS_19810 709642 709421 gene locus_tag LOCUS_19820 709642 709421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 710159 709809 gene locus_tag LOCUS_19830 710159 709809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 710748 710212 gene locus_tag LOCUS_19840 710748 710212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 711793 710831 gene locus_tag LOCUS_19850 711793 710831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 <713829 711811 gene locus_tag LOCUS_19860 <713829 711811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014467599.1:RHS repeat-associated core domain-containing protein >Feature sequence022 760 233 gene locus_tag LOCUS_19870 760 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 3826 1127 gene locus_tag LOCUS_19880 3826 1127 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207266.1 protein_id gnl|my_center|LOCUS_19880 4596 4204 gene locus_tag LOCUS_19890 4596 4204 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392702.1 protein_id gnl|my_center|LOCUS_19890 5600 4698 gene locus_tag LOCUS_19900 5600 4698 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113300.1 protein_id gnl|my_center|LOCUS_19900 6509 5841 gene locus_tag LOCUS_19910 6509 5841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 7536 6643 gene locus_tag LOCUS_19920 7536 6643 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530541.1 protein_id gnl|my_center|LOCUS_19920 8083 7682 gene locus_tag LOCUS_19930 8083 7682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 9232 8327 gene locus_tag LOCUS_19940 9232 8327 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189230.1 protein_id gnl|my_center|LOCUS_19940 9574 9864 gene locus_tag LOCUS_19950 9574 9864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 10213 11157 gene locus_tag LOCUS_19960 10213 11157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 11950 11186 gene locus_tag LOCUS_19970 11950 11186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 13180 12344 gene locus_tag LOCUS_19980 13180 12344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 13594 14436 gene locus_tag LOCUS_19990 13594 14436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 14727 14473 gene locus_tag LOCUS_20000 14727 14473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20000 14893 14738 gene locus_tag LOCUS_20010 14893 14738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 15063 15413 gene locus_tag LOCUS_20020 15063 15413 CDS product GlpM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729333.1 protein_id gnl|my_center|LOCUS_20020 16614 15481 gene locus_tag LOCUS_20030 16614 15481 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192765.1 protein_id gnl|my_center|LOCUS_20030 17291 17118 gene locus_tag LOCUS_20040 17291 17118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 18974 17826 gene locus_tag LOCUS_20050 18974 17826 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210825.1 protein_id gnl|my_center|LOCUS_20050 19116 19322 gene locus_tag LOCUS_20060 19116 19322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 19340 19801 gene locus_tag LOCUS_20070 19340 19801 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942521.1 protein_id gnl|my_center|LOCUS_20070 20337 19945 gene locus_tag LOCUS_20080 20337 19945 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920003.1 protein_id gnl|my_center|LOCUS_20080 20657 21415 gene locus_tag LOCUS_20090 20657 21415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 21594 22325 gene locus_tag LOCUS_20100 21594 22325 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527793.1 protein_id gnl|my_center|LOCUS_20100 22434 22757 gene locus_tag LOCUS_20110 22434 22757 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089489.1 protein_id gnl|my_center|LOCUS_20110 22757 23179 gene locus_tag LOCUS_20120 22757 23179 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061436.1 protein_id gnl|my_center|LOCUS_20120 23314 23748 gene locus_tag LOCUS_20130 23314 23748 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089492.1 protein_id gnl|my_center|LOCUS_20130 23843 24748 gene locus_tag LOCUS_20140 23843 24748 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397461.1 protein_id gnl|my_center|LOCUS_20140 24974 26284 gene locus_tag LOCUS_20150 24974 26284 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103171.1 protein_id gnl|my_center|LOCUS_20150 26400 28973 gene locus_tag LOCUS_20160 26400 28973 CDS product glycosyl hydrolase 115 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639999.1 protein_id gnl|my_center|LOCUS_20160 29098 29553 gene locus_tag LOCUS_20170 29098 29553 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035518.1 protein_id gnl|my_center|LOCUS_20170 30027 30452 gene locus_tag LOCUS_20180 30027 30452 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817404.1 protein_id gnl|my_center|LOCUS_20180 30495 31514 gene locus_tag LOCUS_20190 30495 31514 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103700.1 protein_id gnl|my_center|LOCUS_20190 33083 31668 gene locus_tag LOCUS_20200 33083 31668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 34138 33416 gene locus_tag LOCUS_20210 34138 33416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 34971 34291 gene locus_tag LOCUS_20220 34971 34291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 36107 35136 gene locus_tag LOCUS_20230 36107 35136 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098210.1 protein_id gnl|my_center|LOCUS_20230 36229 37434 gene locus_tag LOCUS_20240 36229 37434 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705534.1 protein_id gnl|my_center|LOCUS_20240 37639 38436 gene locus_tag LOCUS_20250 37639 38436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 39772 38591 gene locus_tag LOCUS_20260 39772 38591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818585.1 protein_id gnl|my_center|LOCUS_20260 41605 39884 gene locus_tag LOCUS_20270 41605 39884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 42200 41724 gene locus_tag LOCUS_20280 42200 41724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 43297 42236 gene locus_tag LOCUS_20290 43297 42236 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976957.1 protein_id gnl|my_center|LOCUS_20290 43420 44349 gene locus_tag LOCUS_20300 43420 44349 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212117.1 protein_id gnl|my_center|LOCUS_20300 45260 44406 gene locus_tag LOCUS_20310 45260 44406 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192727398.1 protein_id gnl|my_center|LOCUS_20310 45463 46446 gene locus_tag LOCUS_20320 45463 46446 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198301.1 protein_id gnl|my_center|LOCUS_20320 46567 47238 gene locus_tag LOCUS_20330 46567 47238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 47286 47825 gene locus_tag LOCUS_20340 47286 47825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 48756 48091 gene locus_tag LOCUS_20350 48756 48091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222220.1 protein_id gnl|my_center|LOCUS_20350 51336 48832 gene locus_tag LOCUS_20360 51336 48832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 53335 51626 gene locus_tag LOCUS_20370 53335 51626 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201704.1 protein_id gnl|my_center|LOCUS_20370 54609 53791 gene locus_tag LOCUS_20380 54609 53791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 55007 55405 gene locus_tag LOCUS_20390 55007 55405 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063838.1 protein_id gnl|my_center|LOCUS_20390 55599 55832 gene locus_tag LOCUS_20400 55599 55832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 55954 56490 gene locus_tag LOCUS_20410 55954 56490 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929869.1 protein_id gnl|my_center|LOCUS_20410 57040 57345 gene locus_tag LOCUS_20420 57040 57345 CDS product YqjD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533578.1 protein_id gnl|my_center|LOCUS_20420 58076 57432 gene locus_tag LOCUS_20430 58076 57432 CDS product ABC-type transport auxiliary lipoprotein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771783.1 protein_id gnl|my_center|LOCUS_20430 59017 58073 gene locus_tag LOCUS_20440 59017 58073 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771786.1 protein_id gnl|my_center|LOCUS_20440 59907 59002 gene locus_tag LOCUS_20450 59907 59002 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920178.1 protein_id gnl|my_center|LOCUS_20450 61091 59907 gene locus_tag LOCUS_20460 61091 59907 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772900.1 protein_id gnl|my_center|LOCUS_20460 61658 61804 gene locus_tag LOCUS_20470 61658 61804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 61844 62761 gene locus_tag LOCUS_20480 61844 62761 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808614.1 protein_id gnl|my_center|LOCUS_20480 64187 62931 gene locus_tag LOCUS_20490 64187 62931 CDS product ectonucleotide pyrophosphatase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640195.1 protein_id gnl|my_center|LOCUS_20490 64694 68188 gene locus_tag LOCUS_20500 64694 68188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 68316 70097 gene locus_tag LOCUS_20510 68316 70097 CDS product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922210.1 protein_id gnl|my_center|LOCUS_20510 70948 70118 gene locus_tag LOCUS_20520 70948 70118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 71300 72247 gene locus_tag LOCUS_20530 71300 72247 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096831545.1 protein_id gnl|my_center|LOCUS_20530 72448 72263 gene locus_tag LOCUS_20540 72448 72263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 72466 72969 gene locus_tag LOCUS_20550 72466 72969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 74383 73004 gene locus_tag LOCUS_20560 74383 73004 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766669.1 protein_id gnl|my_center|LOCUS_20560 75587 74505 gene locus_tag LOCUS_20570 75587 74505 CDS product ionic transporter y4hA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198339.1 protein_id gnl|my_center|LOCUS_20570 >Feature sequence023 526 1446 gene locus_tag LOCUS_20580 526 1446 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229746.1 protein_id gnl|my_center|LOCUS_20580 4268 1473 gene locus_tag LOCUS_20590 4268 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 7028 4395 gene locus_tag LOCUS_20600 7028 4395 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525850.1 protein_id gnl|my_center|LOCUS_20600 7606 7142 gene locus_tag LOCUS_20610 7606 7142 CDS product DUF494 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040781.1 protein_id gnl|my_center|LOCUS_20610 8928 7831 gene locus_tag LOCUS_20620 gene dprA 8928 7831 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807293.1 protein_id gnl|my_center|LOCUS_20620 10041 8941 gene locus_tag LOCUS_20630 10041 8941 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 protein_id gnl|my_center|LOCUS_20630 10202 10726 gene locus_tag LOCUS_20640 gene def 10202 10726 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201745.1 protein_id gnl|my_center|LOCUS_20640 10726 11688 gene locus_tag LOCUS_20650 gene fmt 10726 11688 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549892.1 protein_id gnl|my_center|LOCUS_20650 11895 12572 gene locus_tag LOCUS_20660 11895 12572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 12572 13138 gene locus_tag LOCUS_20670 12572 13138 CDS product FlgO family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938122.1 protein_id gnl|my_center|LOCUS_20670 14140 13226 gene locus_tag LOCUS_20680 gene nhaR 14140 13226 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405479.1 protein_id gnl|my_center|LOCUS_20680 14304 14990 gene locus_tag LOCUS_20690 14304 14990 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090386.1 protein_id gnl|my_center|LOCUS_20690 14993 15967 gene locus_tag LOCUS_20700 14993 15967 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706425.1 protein_id gnl|my_center|LOCUS_20700 18423 16060 gene locus_tag LOCUS_20710 18423 16060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 19117 22866 gene locus_tag LOCUS_20720 gene metH 19117 22866 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064919.1 protein_id gnl|my_center|LOCUS_20720 24598 22961 gene locus_tag LOCUS_20730 24598 22961 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942194.1 protein_id gnl|my_center|LOCUS_20730 24907 24608 gene locus_tag LOCUS_20740 24907 24608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 28073 25191 gene locus_tag LOCUS_20750 28073 25191 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206610.1 protein_id gnl|my_center|LOCUS_20750 28321 29307 gene locus_tag LOCUS_20760 28321 29307 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024658.1 protein_id gnl|my_center|LOCUS_20760 29416 30435 gene locus_tag LOCUS_20770 29416 30435 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415784.1 protein_id gnl|my_center|LOCUS_20770 30445 31233 gene locus_tag LOCUS_20780 30445 31233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 31284 31769 gene locus_tag LOCUS_20790 31284 31769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 32037 33317 gene locus_tag LOCUS_20800 32037 33317 CDS product DUF3391 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349264.1 protein_id gnl|my_center|LOCUS_20800 33314 35710 gene locus_tag LOCUS_20810 33314 35710 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946626.1 protein_id gnl|my_center|LOCUS_20810 36460 35738 gene locus_tag LOCUS_20820 36460 35738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 36682 37572 gene locus_tag LOCUS_20830 36682 37572 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039702.1 protein_id gnl|my_center|LOCUS_20830 38392 37577 gene locus_tag LOCUS_20840 38392 37577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 39318 38503 gene locus_tag LOCUS_20850 39318 38503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 40218 39424 gene locus_tag LOCUS_20860 40218 39424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 40335 40823 gene locus_tag LOCUS_20870 40335 40823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 41140 41706 gene locus_tag LOCUS_20880 41140 41706 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809301.1 protein_id gnl|my_center|LOCUS_20880 41706 42302 gene locus_tag LOCUS_20890 41706 42302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 42476 42252 gene locus_tag LOCUS_20900 42476 42252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 42618 42451 gene locus_tag LOCUS_20910 42618 42451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 42699 43556 gene locus_tag LOCUS_20920 42699 43556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 44216 43659 gene locus_tag LOCUS_20930 44216 43659 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083119.1 protein_id gnl|my_center|LOCUS_20930 44686 44345 gene locus_tag LOCUS_20940 44686 44345 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226523.1 protein_id gnl|my_center|LOCUS_20940 45270 44875 gene locus_tag LOCUS_20950 45270 44875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 46120 45824 gene locus_tag LOCUS_20960 46120 45824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 46306 47763 gene locus_tag LOCUS_20970 46306 47763 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064067.1 protein_id gnl|my_center|LOCUS_20970 48052 49377 gene locus_tag LOCUS_20980 gene dctA 48052 49377 CDS product C4-dicarboxylate transporter DctC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082442.1 protein_id gnl|my_center|LOCUS_20980 50701 49472 gene locus_tag LOCUS_20990 50701 49472 CDS product TCR/Tet family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615760.1 protein_id gnl|my_center|LOCUS_20990 50780 52093 gene locus_tag LOCUS_21000 50780 52093 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210164.1 protein_id gnl|my_center|LOCUS_21000 52184 53458 gene locus_tag LOCUS_21010 52184 53458 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376398.1 protein_id gnl|my_center|LOCUS_21010 53650 55899 gene locus_tag LOCUS_21020 53650 55899 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388417.1 protein_id gnl|my_center|LOCUS_21020 56663 56055 gene locus_tag LOCUS_21030 56663 56055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 57043 57768 gene locus_tag LOCUS_21040 57043 57768 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705478.1 protein_id gnl|my_center|LOCUS_21040 57786 59114 gene locus_tag LOCUS_21050 57786 59114 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096596.1 protein_id gnl|my_center|LOCUS_21050 60069 59197 gene locus_tag LOCUS_21060 gene ygiD 60069 59197 CDS product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000245226.1 protein_id gnl|my_center|LOCUS_21060 60160 60633 gene locus_tag LOCUS_21070 60160 60633 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926892.1 protein_id gnl|my_center|LOCUS_21070 62151 60754 gene locus_tag LOCUS_21080 62151 60754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 62352 64013 gene locus_tag LOCUS_21090 62352 64013 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086113.1 protein_id gnl|my_center|LOCUS_21090 65413 64361 gene locus_tag LOCUS_21100 65413 64361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21100 >Feature sequence024 1244 468 gene locus_tag LOCUS_21110 1244 468 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198410.1 protein_id gnl|my_center|LOCUS_21110 1385 1537 gene locus_tag LOCUS_21120 1385 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 1918 1544 gene locus_tag LOCUS_21130 gene apaG 1918 1544 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186878.1 protein_id gnl|my_center|LOCUS_21130 2022 2687 gene locus_tag LOCUS_21140 gene rpe 2022 2687 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522003.1 protein_id gnl|my_center|LOCUS_21140 2754 3437 gene locus_tag LOCUS_21150 2754 3437 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531889.1 protein_id gnl|my_center|LOCUS_21150 3711 5207 gene locus_tag LOCUS_21160 gene trpE 3711 5207 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186866.1 protein_id gnl|my_center|LOCUS_21160 5212 5631 gene locus_tag LOCUS_21170 5212 5631 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_21170 5673 6245 gene locus_tag LOCUS_21180 5673 6245 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815390.1 protein_id gnl|my_center|LOCUS_21180 6242 7273 gene locus_tag LOCUS_21190 gene trpD 6242 7273 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186823.1 protein_id gnl|my_center|LOCUS_21190 7278 8078 gene locus_tag LOCUS_21200 gene trpC 7278 8078 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522001.1 protein_id gnl|my_center|LOCUS_21200 8791 8153 gene locus_tag LOCUS_21210 8791 8153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 9868 8933 gene locus_tag LOCUS_21220 9868 8933 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532207.1 protein_id gnl|my_center|LOCUS_21220 10155 11024 gene locus_tag LOCUS_21230 10155 11024 CDS product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532208.1 protein_id gnl|my_center|LOCUS_21230 12965 11097 gene locus_tag LOCUS_21240 12965 11097 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527796.1 protein_id gnl|my_center|LOCUS_21240 13499 13044 gene locus_tag LOCUS_21250 13499 13044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 14310 13747 gene locus_tag LOCUS_21260 14310 13747 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524160.1 protein_id gnl|my_center|LOCUS_21260 15125 14385 gene locus_tag LOCUS_21270 15125 14385 CDS product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186871.1 protein_id gnl|my_center|LOCUS_21270 16436 15216 gene locus_tag LOCUS_21280 16436 15216 CDS product UbiH/UbiF family hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521997.1 protein_id gnl|my_center|LOCUS_21280 16592 16667 gene locus_tag LOCUS_t00390 16592 16667 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 17046 17810 gene locus_tag LOCUS_21290 17046 17810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 18676 17837 gene locus_tag LOCUS_21300 18676 17837 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268019.1 protein_id gnl|my_center|LOCUS_21300 18898 20373 gene locus_tag LOCUS_21310 18898 20373 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970431.1 protein_id gnl|my_center|LOCUS_21310 20434 21933 gene locus_tag LOCUS_21320 20434 21933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 22805 22236 gene locus_tag LOCUS_21330 22805 22236 CDS product DUF3455 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266352.1 protein_id gnl|my_center|LOCUS_21330 23342 23989 gene locus_tag LOCUS_21340 gene prfH 23342 23989 CDS product peptide chain release factor H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602135.1 protein_id gnl|my_center|LOCUS_21340 24452 23997 gene locus_tag LOCUS_21350 gene zntR 24452 23997 CDS product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174611.1 protein_id gnl|my_center|LOCUS_21350 24728 27154 gene locus_tag LOCUS_21360 24728 27154 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141986.1 protein_id gnl|my_center|LOCUS_21360 27584 30907 gene locus_tag LOCUS_21370 27584 30907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 32183 31071 gene locus_tag LOCUS_21380 32183 31071 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404861.1 protein_id gnl|my_center|LOCUS_21380 32695 32180 gene locus_tag LOCUS_21390 32695 32180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 33148 34299 gene locus_tag LOCUS_21400 33148 34299 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104714.1 protein_id gnl|my_center|LOCUS_21400 34300 35109 gene locus_tag LOCUS_21410 34300 35109 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225835.1 protein_id gnl|my_center|LOCUS_21410 35102 35764 gene locus_tag LOCUS_21420 35102 35764 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692419.1 protein_id gnl|my_center|LOCUS_21420 35789 36619 gene locus_tag LOCUS_21430 35789 36619 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225833.1 protein_id gnl|my_center|LOCUS_21430 36628 38016 gene locus_tag LOCUS_21440 36628 38016 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194658.1 protein_id gnl|my_center|LOCUS_21440 38061 39047 gene locus_tag LOCUS_21450 38061 39047 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114494.1 protein_id gnl|my_center|LOCUS_21450 39070 39981 gene locus_tag LOCUS_21460 39070 39981 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102304.1 protein_id gnl|my_center|LOCUS_21460 39983 40717 gene locus_tag LOCUS_21470 39983 40717 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010203323.1 protein_id gnl|my_center|LOCUS_21470 41169 41948 gene locus_tag LOCUS_21480 gene minC 41169 41948 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522312.1 protein_id gnl|my_center|LOCUS_21480 42030 42845 gene locus_tag LOCUS_21490 gene minD 42030 42845 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185427.1 protein_id gnl|my_center|LOCUS_21490 42848 43114 gene locus_tag LOCUS_21500 gene minE 42848 43114 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186076.1 protein_id gnl|my_center|LOCUS_21500 43382 44074 gene locus_tag LOCUS_21510 43382 44074 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193573.1 protein_id gnl|my_center|LOCUS_21510 44147 45862 gene locus_tag LOCUS_21520 44147 45862 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192128.1 protein_id gnl|my_center|LOCUS_21520 45893 48313 gene locus_tag LOCUS_21530 45893 48313 CDS product CHASE2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521708.1 protein_id gnl|my_center|LOCUS_21530 48490 49776 gene locus_tag LOCUS_21540 gene hemA 48490 49776 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521984.1 protein_id gnl|my_center|LOCUS_21540 49891 50964 gene locus_tag LOCUS_21550 gene prfA 49891 50964 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222130.1 protein_id gnl|my_center|LOCUS_21550 51203 51709 gene locus_tag LOCUS_21560 51203 51709 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406623.1 protein_id gnl|my_center|LOCUS_21560 51709 52551 gene locus_tag LOCUS_21570 gene prmC 51709 52551 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186904.1 protein_id gnl|my_center|LOCUS_21570 53325 52645 gene locus_tag LOCUS_21580 53325 52645 CDS product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389207.1 protein_id gnl|my_center|LOCUS_21580 54728 53706 gene locus_tag LOCUS_21590 54728 53706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 55463 54756 gene locus_tag LOCUS_21600 55463 54756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 55995 55450 gene locus_tag LOCUS_21610 55995 55450 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102257240.1 protein_id gnl|my_center|LOCUS_21610 56111 56440 gene locus_tag LOCUS_21620 56111 56440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 56751 57323 gene locus_tag LOCUS_21630 gene cysC 56751 57323 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193917.1 protein_id gnl|my_center|LOCUS_21630 57320 58165 gene locus_tag LOCUS_21640 57320 58165 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521465.1 protein_id gnl|my_center|LOCUS_21640 >Feature sequence025 598 897 gene locus_tag LOCUS_21650 598 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 1146 2186 gene locus_tag LOCUS_21660 1146 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 2244 3869 gene locus_tag LOCUS_21670 2244 3869 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037608.1 protein_id gnl|my_center|LOCUS_21670 4744 3974 gene locus_tag LOCUS_21680 4744 3974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 5124 4741 gene locus_tag LOCUS_21690 5124 4741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 6647 5298 gene locus_tag LOCUS_21700 6647 5298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 7404 6721 gene locus_tag LOCUS_21710 7404 6721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 7654 9645 gene locus_tag LOCUS_21720 7654 9645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 9779 11050 gene locus_tag LOCUS_21730 9779 11050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 11041 12399 gene locus_tag LOCUS_21740 11041 12399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 12401 12625 gene locus_tag LOCUS_21750 12401 12625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 12653 14587 gene locus_tag LOCUS_21760 12653 14587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 15374 14622 gene locus_tag LOCUS_21770 15374 14622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 16624 15632 gene locus_tag LOCUS_21780 gene ftrA 16624 15632 CDS product transcriptional regulator FtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194618.1 protein_id gnl|my_center|LOCUS_21780 16887 17084 gene locus_tag LOCUS_21790 16887 17084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 17543 19348 gene locus_tag LOCUS_21800 17543 19348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 19348 21792 gene locus_tag LOCUS_21810 19348 21792 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707108.1 protein_id gnl|my_center|LOCUS_21810 22155 22679 gene locus_tag LOCUS_21820 22155 22679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 24886 22724 gene locus_tag LOCUS_21830 24886 22724 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986774.1 protein_id gnl|my_center|LOCUS_21830 25235 25852 gene locus_tag LOCUS_21840 25235 25852 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090002.1 protein_id gnl|my_center|LOCUS_21840 25849 26721 gene locus_tag LOCUS_21850 25849 26721 CDS product YgcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189948.1 protein_id gnl|my_center|LOCUS_21850 26724 27230 gene locus_tag LOCUS_21860 26724 27230 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090000.1 protein_id gnl|my_center|LOCUS_21860 27896 27471 gene locus_tag LOCUS_21870 27896 27471 CDS product DUF2177 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767545.1 protein_id gnl|my_center|LOCUS_21870 28145 28840 gene locus_tag LOCUS_21880 28145 28840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 28919 29671 gene locus_tag LOCUS_21890 28919 29671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 29917 30828 gene locus_tag LOCUS_21900 29917 30828 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112287.1 protein_id gnl|my_center|LOCUS_21900 31011 34433 gene locus_tag LOCUS_21910 31011 34433 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188267.1 protein_id gnl|my_center|LOCUS_21910 34476 36995 gene locus_tag LOCUS_21920 34476 36995 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266502.1 protein_id gnl|my_center|LOCUS_21920 38307 37210 gene locus_tag LOCUS_21930 38307 37210 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087276.1 protein_id gnl|my_center|LOCUS_21930 40933 38528 gene locus_tag LOCUS_21940 40933 38528 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814468.1 protein_id gnl|my_center|LOCUS_21940 42212 41184 gene locus_tag LOCUS_21950 42212 41184 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070694233.1 protein_id gnl|my_center|LOCUS_21950 42633 42214 gene locus_tag LOCUS_21960 42633 42214 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038677.1 protein_id gnl|my_center|LOCUS_21960 43542 43375 gene locus_tag LOCUS_21970 43542 43375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 43712 44839 gene locus_tag LOCUS_21980 43712 44839 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202567.1 protein_id gnl|my_center|LOCUS_21980 44836 46164 gene locus_tag LOCUS_21990 44836 46164 CDS product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606740.1 protein_id gnl|my_center|LOCUS_21990 46168 47109 gene locus_tag LOCUS_22000 46168 47109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 47554 47478 gene locus_tag LOCUS_t00400 47554 47478 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 48756 47806 gene locus_tag LOCUS_22010 gene miaA 48756 47806 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194103.1 protein_id gnl|my_center|LOCUS_22010 49973 48753 gene locus_tag LOCUS_22020 49973 48753 CDS product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538642.1 protein_id gnl|my_center|LOCUS_22020 51948 50017 gene locus_tag LOCUS_22030 gene mutL 51948 50017 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194266.1 protein_id gnl|my_center|LOCUS_22030 52042 52680 gene locus_tag LOCUS_22040 52042 52680 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065016.1 protein_id gnl|my_center|LOCUS_22040 52733 53074 gene locus_tag LOCUS_22050 52733 53074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 53752 53102 gene locus_tag LOCUS_22060 53752 53102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 54508 53885 gene locus_tag LOCUS_22070 54508 53885 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568039.1 protein_id gnl|my_center|LOCUS_22070 54610 55935 gene locus_tag LOCUS_22080 54610 55935 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551357.1 protein_id gnl|my_center|LOCUS_22080 57334 55952 gene locus_tag LOCUS_22090 57334 55952 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247543.1 protein_id gnl|my_center|LOCUS_22090 57846 57361 gene locus_tag LOCUS_22100 57846 57361 CDS product bifunctional tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE/phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189096.1 protein_id gnl|my_center|LOCUS_22100 57926 59008 gene locus_tag LOCUS_22110 gene queG 57926 59008 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550792.1 protein_id gnl|my_center|LOCUS_22110 >Feature sequence026 613 449 gene locus_tag LOCUS_22120 613 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 1399 947 gene locus_tag LOCUS_22130 gene nrdR 1399 947 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814871.1 protein_id gnl|my_center|LOCUS_22130 2708 1458 gene locus_tag LOCUS_22140 2708 1458 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186490.1 protein_id gnl|my_center|LOCUS_22140 3077 3829 gene locus_tag LOCUS_22150 gene ydfG 3077 3829 CDS product bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185593.1 protein_id gnl|my_center|LOCUS_22150 3999 4397 gene locus_tag LOCUS_22160 gene ybgC 3999 4397 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527641.1 protein_id gnl|my_center|LOCUS_22160 4466 5161 gene locus_tag LOCUS_22170 gene tolQ 4466 5161 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186467.1 protein_id gnl|my_center|LOCUS_22170 5178 5621 gene locus_tag LOCUS_22180 gene tolR 5178 5621 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522197.1 protein_id gnl|my_center|LOCUS_22180 5632 7524 gene locus_tag LOCUS_22190 5632 7524 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192380.1 protein_id gnl|my_center|LOCUS_22190 7526 11734 gene locus_tag LOCUS_22200 7526 11734 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204931.1 protein_id gnl|my_center|LOCUS_22200 14625 11863 gene locus_tag LOCUS_22210 14625 11863 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202237.1 protein_id gnl|my_center|LOCUS_22210 14977 14798 gene locus_tag LOCUS_22220 14977 14798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 15704 14889 gene locus_tag LOCUS_22230 15704 14889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 16344 15835 gene locus_tag LOCUS_22240 16344 15835 CDS product DUF2867 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208083.1 protein_id gnl|my_center|LOCUS_22240 16730 16341 gene locus_tag LOCUS_22250 16730 16341 CDS product DUF6463 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108249.1 protein_id gnl|my_center|LOCUS_22250 18066 16714 gene locus_tag LOCUS_22260 18066 16714 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838492.1 protein_id gnl|my_center|LOCUS_22260 18806 18063 gene locus_tag LOCUS_22270 18806 18063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 21590 19332 gene locus_tag LOCUS_22280 21590 19332 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113616.1 protein_id gnl|my_center|LOCUS_22280 23287 21587 gene locus_tag LOCUS_22290 gene fan1 23287 21587 CDS product nuclease Fan1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113615.1 protein_id gnl|my_center|LOCUS_22290 23474 23839 gene locus_tag LOCUS_22300 23474 23839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 24017 25741 gene locus_tag LOCUS_22310 24017 25741 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070743.1 protein_id gnl|my_center|LOCUS_22310 25734 26972 gene locus_tag LOCUS_22320 25734 26972 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083500625.1 protein_id gnl|my_center|LOCUS_22320 27046 27357 gene locus_tag LOCUS_22330 27046 27357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 27345 27650 gene locus_tag LOCUS_22340 27345 27650 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071641.1 protein_id gnl|my_center|LOCUS_22340 27647 30739 gene locus_tag LOCUS_22350 27647 30739 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070740.1 protein_id gnl|my_center|LOCUS_22350 30736 31446 gene locus_tag LOCUS_22360 30736 31446 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070739.1 protein_id gnl|my_center|LOCUS_22360 31536 32486 gene locus_tag LOCUS_22370 31536 32486 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909131.1 protein_id gnl|my_center|LOCUS_22370 33213 33620 gene locus_tag LOCUS_22380 33213 33620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 34440 34973 gene locus_tag LOCUS_22390 34440 34973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 36588 36944 gene locus_tag LOCUS_22400 36588 36944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 37026 37748 gene locus_tag LOCUS_22410 37026 37748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 38372 37914 gene locus_tag LOCUS_22420 38372 37914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 38838 39455 gene locus_tag LOCUS_22430 38838 39455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 39452 40561 gene locus_tag LOCUS_22440 39452 40561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143953.1 protein_id gnl|my_center|LOCUS_22440 40685 41023 gene locus_tag LOCUS_22450 40685 41023 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948550.1 protein_id gnl|my_center|LOCUS_22450 41709 41993 gene locus_tag LOCUS_22460 41709 41993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 42640 43968 gene locus_tag LOCUS_22470 42640 43968 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189952.1 protein_id gnl|my_center|LOCUS_22470 >Feature sequence027 1056 532 gene locus_tag LOCUS_22480 1056 532 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193734.1 protein_id gnl|my_center|LOCUS_22480 1693 1145 gene locus_tag LOCUS_22490 1693 1145 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192241.1 protein_id gnl|my_center|LOCUS_22490 3712 1844 gene locus_tag LOCUS_22500 3712 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 5065 3779 gene locus_tag LOCUS_22510 5065 3779 CDS product DUF3391 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349264.1 protein_id gnl|my_center|LOCUS_22510 5211 6134 gene locus_tag LOCUS_22520 gene asd 5211 6134 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357921.1 protein_id gnl|my_center|LOCUS_22520 6442 6633 gene locus_tag LOCUS_22530 6442 6633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 6661 6999 gene locus_tag LOCUS_22540 6661 6999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 7013 7252 gene locus_tag LOCUS_22550 7013 7252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 7261 7941 gene locus_tag LOCUS_22560 7261 7941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 8148 8624 gene locus_tag LOCUS_22570 gene bfr 8148 8624 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188572.1 protein_id gnl|my_center|LOCUS_22570 9439 8831 gene locus_tag LOCUS_22580 9439 8831 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200504.1 protein_id gnl|my_center|LOCUS_22580 9761 11071 gene locus_tag LOCUS_22590 gene purB 9761 11071 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522085.1 protein_id gnl|my_center|LOCUS_22590 12437 11235 gene locus_tag LOCUS_22600 12437 11235 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207152.1 protein_id gnl|my_center|LOCUS_22600 12743 13279 gene locus_tag LOCUS_22610 12743 13279 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194252.1 protein_id gnl|my_center|LOCUS_22610 13302 13868 gene locus_tag LOCUS_22620 13302 13868 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194156.1 protein_id gnl|my_center|LOCUS_22620 13938 14504 gene locus_tag LOCUS_22630 13938 14504 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194433.1 protein_id gnl|my_center|LOCUS_22630 14605 15039 gene locus_tag LOCUS_22640 14605 15039 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142755.1 protein_id gnl|my_center|LOCUS_22640 18347 15258 gene locus_tag LOCUS_22650 18347 15258 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531051.1 protein_id gnl|my_center|LOCUS_22650 19669 18344 gene locus_tag LOCUS_22660 19669 18344 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531050.1 protein_id gnl|my_center|LOCUS_22660 21004 19982 gene locus_tag LOCUS_22670 gene secF 21004 19982 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522118.1 protein_id gnl|my_center|LOCUS_22670 22915 21038 gene locus_tag LOCUS_22680 gene secD 22915 21038 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550004.1 protein_id gnl|my_center|LOCUS_22680 23317 22994 gene locus_tag LOCUS_22690 gene yajC 23317 22994 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194088.1 protein_id gnl|my_center|LOCUS_22690 25058 23625 gene locus_tag LOCUS_22700 25058 23625 CDS product YdgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705246.1 protein_id gnl|my_center|LOCUS_22700 26725 25202 gene locus_tag LOCUS_22710 26725 25202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 27995 26862 gene locus_tag LOCUS_22720 gene tgt 27995 26862 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194199.1 protein_id gnl|my_center|LOCUS_22720 29037 27988 gene locus_tag LOCUS_22730 gene queA 29037 27988 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538740.1 protein_id gnl|my_center|LOCUS_22730 29199 31490 gene locus_tag LOCUS_22740 gene recG 29199 31490 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014917883.1 protein_id gnl|my_center|LOCUS_22740 31526 32014 gene locus_tag LOCUS_22750 31526 32014 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064305.1 protein_id gnl|my_center|LOCUS_22750 >Feature sequence028 8999 4449 gene locus_tag LOCUS_22760 8999 4449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 9766 8999 gene locus_tag LOCUS_22770 9766 8999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 10686 9763 gene locus_tag LOCUS_22780 10686 9763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 11333 10842 gene locus_tag LOCUS_22790 11333 10842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 12536 11769 gene locus_tag LOCUS_22800 12536 11769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 14049 12580 gene locus_tag LOCUS_22810 gene tldD 14049 12580 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194084.1 protein_id gnl|my_center|LOCUS_22810 14946 14152 gene locus_tag LOCUS_22820 14946 14152 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522140.1 protein_id gnl|my_center|LOCUS_22820 19311 14974 gene locus_tag LOCUS_22830 19311 14974 CDS product YhdP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009241452.1 protein_id gnl|my_center|LOCUS_22830 19497 19321 gene locus_tag LOCUS_22840 19497 19321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 20044 19844 gene locus_tag LOCUS_22850 20044 19844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 19952 22429 gene locus_tag LOCUS_22860 gene glnE 19952 22429 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196324.1 protein_id gnl|my_center|LOCUS_22860 23667 22525 gene locus_tag LOCUS_22870 23667 22525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 26556 23743 gene locus_tag LOCUS_22880 26556 23743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 26831 27019 gene locus_tag LOCUS_22890 26831 27019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 27487 27020 gene locus_tag LOCUS_22900 27487 27020 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942521.1 protein_id gnl|my_center|LOCUS_22900 >Feature sequence029 717 884 gene locus_tag LOCUS_22910 717 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 1165 1413 gene locus_tag LOCUS_22920 1165 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 2870 1329 gene locus_tag LOCUS_22930 gene lnt 2870 1329 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064331.1 protein_id gnl|my_center|LOCUS_22930 3759 2935 gene locus_tag LOCUS_22940 3759 2935 CDS product transporter associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189366.1 protein_id gnl|my_center|LOCUS_22940 4215 4568 gene locus_tag LOCUS_22950 4215 4568 CDS product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182869854.1 protein_id gnl|my_center|LOCUS_22950 5495 4605 gene locus_tag LOCUS_22960 5495 4605 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534169.1 protein_id gnl|my_center|LOCUS_22960 6201 5707 gene locus_tag LOCUS_22970 6201 5707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 7297 6185 gene locus_tag LOCUS_22980 7297 6185 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189139.1 protein_id gnl|my_center|LOCUS_22980 8637 7297 gene locus_tag LOCUS_22990 gene miaB 8637 7297 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190165.1 protein_id gnl|my_center|LOCUS_22990 9144 8743 gene locus_tag LOCUS_23000 9144 8743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 9515 10021 gene locus_tag LOCUS_23010 9515 10021 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189275.1 protein_id gnl|my_center|LOCUS_23010 10037 10300 gene locus_tag LOCUS_23020 10037 10300 CDS product SemiSWEET transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125345.1 protein_id gnl|my_center|LOCUS_23020 10357 10833 gene locus_tag LOCUS_23030 10357 10833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 10882 11880 gene locus_tag LOCUS_23040 10882 11880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220886.1 protein_id gnl|my_center|LOCUS_23040 12585 11959 gene locus_tag LOCUS_23050 12585 11959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 13344 13087 gene locus_tag LOCUS_23060 13344 13087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 13954 13334 gene locus_tag LOCUS_23070 13954 13334 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818983.1 protein_id gnl|my_center|LOCUS_23070 15133 14192 gene locus_tag LOCUS_23080 15133 14192 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401124.1 protein_id gnl|my_center|LOCUS_23080 15423 15169 gene locus_tag LOCUS_23090 15423 15169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 15356 16726 gene locus_tag LOCUS_23100 15356 16726 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968432.1 protein_id gnl|my_center|LOCUS_23100 17243 16752 gene locus_tag LOCUS_23110 17243 16752 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072147.1 protein_id gnl|my_center|LOCUS_23110 17859 17335 gene locus_tag LOCUS_23120 17859 17335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 18892 17852 gene locus_tag LOCUS_23130 18892 17852 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809529.1 protein_id gnl|my_center|LOCUS_23130 20109 18889 gene locus_tag LOCUS_23140 20109 18889 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522681.1 protein_id gnl|my_center|LOCUS_23140 20925 20413 gene locus_tag LOCUS_23150 gene purE 20925 20413 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247930.1 protein_id gnl|my_center|LOCUS_23150 21821 20925 gene locus_tag LOCUS_23160 21821 20925 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189256.1 protein_id gnl|my_center|LOCUS_23160 23302 22238 gene locus_tag LOCUS_23170 gene fba 23302 22238 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190157.1 protein_id gnl|my_center|LOCUS_23170 24794 23361 gene locus_tag LOCUS_23180 gene pyk 24794 23361 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188973.1 protein_id gnl|my_center|LOCUS_23180 26218 25025 gene locus_tag LOCUS_23190 26218 25025 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189839.1 protein_id gnl|my_center|LOCUS_23190 >Feature sequence030 1214 672 gene locus_tag LOCUS_23200 gene pagL 1214 672 CDS product lipid A 3-O-deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099307.1 protein_id gnl|my_center|LOCUS_23200 1298 2263 gene locus_tag LOCUS_23210 1298 2263 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967128.1 protein_id gnl|my_center|LOCUS_23210 2411 4492 gene locus_tag LOCUS_23220 2411 4492 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527789.1 protein_id gnl|my_center|LOCUS_23220 4822 6498 gene locus_tag LOCUS_23230 4822 6498 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084137.1 protein_id gnl|my_center|LOCUS_23230 8212 6620 gene locus_tag LOCUS_23240 8212 6620 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771483.1 protein_id gnl|my_center|LOCUS_23240 8596 8213 gene locus_tag LOCUS_23250 8596 8213 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189082.1 protein_id gnl|my_center|LOCUS_23250 8961 10559 gene locus_tag LOCUS_23260 8961 10559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 11211 10534 gene locus_tag LOCUS_23270 11211 10534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 12076 11222 gene locus_tag LOCUS_23280 12076 11222 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 protein_id gnl|my_center|LOCUS_23280 12366 14255 gene locus_tag LOCUS_23290 12366 14255 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189741.1 protein_id gnl|my_center|LOCUS_23290 14258 15241 gene locus_tag LOCUS_23300 14258 15241 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194310.1 protein_id gnl|my_center|LOCUS_23300 15489 16775 gene locus_tag LOCUS_23310 15489 16775 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194166.1 protein_id gnl|my_center|LOCUS_23310 17189 18085 gene locus_tag LOCUS_23320 17189 18085 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389840.1 protein_id gnl|my_center|LOCUS_23320 18282 19229 gene locus_tag LOCUS_23330 18282 19229 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090327.1 protein_id gnl|my_center|LOCUS_23330 19349 20098 gene locus_tag LOCUS_23340 19349 20098 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389841.1 protein_id gnl|my_center|LOCUS_23340 20100 20792 gene locus_tag LOCUS_23350 20100 20792 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090325.1 protein_id gnl|my_center|LOCUS_23350 20852 21577 gene locus_tag LOCUS_23360 20852 21577 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194225.1 protein_id gnl|my_center|LOCUS_23360 >Feature sequence031 >Feature sequence032 1227 487 gene locus_tag LOCUS_23370 1227 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 2326 1262 gene locus_tag LOCUS_23380 2326 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 2316 2534 gene locus_tag LOCUS_23390 2316 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 2986 2486 gene locus_tag LOCUS_23400 2986 2486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 3477 3091 gene locus_tag LOCUS_23410 3477 3091 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094405.1 protein_id gnl|my_center|LOCUS_23410 3812 4438 gene locus_tag LOCUS_23420 3812 4438 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932750.1 protein_id gnl|my_center|LOCUS_23420 4438 4689 gene locus_tag LOCUS_23430 4438 4689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 4746 5885 gene locus_tag LOCUS_23440 4746 5885 CDS product DUF3570 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926978.1 protein_id gnl|my_center|LOCUS_23440 5963 6883 gene locus_tag LOCUS_23450 5963 6883 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932752.1 protein_id gnl|my_center|LOCUS_23450 6950 8209 gene locus_tag LOCUS_23460 6950 8209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 8580 8323 gene locus_tag LOCUS_23470 8580 8323 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389752.1 protein_id gnl|my_center|LOCUS_23470 8836 8564 gene locus_tag LOCUS_23480 8836 8564 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836217.1 protein_id gnl|my_center|LOCUS_23480 10872 9043 gene locus_tag LOCUS_23490 10872 9043 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000241.1 protein_id gnl|my_center|LOCUS_23490 12037 11183 gene locus_tag LOCUS_23500 12037 11183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 12232 12870 gene locus_tag LOCUS_23510 12232 12870 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707260.1 protein_id gnl|my_center|LOCUS_23510 13430 12972 gene locus_tag LOCUS_23520 13430 12972 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089995.1 protein_id gnl|my_center|LOCUS_23520 13707 17240 gene locus_tag LOCUS_23530 gene putA 13707 17240 CDS product trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524499.1 protein_id gnl|my_center|LOCUS_23530 18259 17396 gene locus_tag LOCUS_23540 18259 17396 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087073.1 protein_id gnl|my_center|LOCUS_23540 18357 19241 gene locus_tag LOCUS_23550 18357 19241 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530571.1 protein_id gnl|my_center|LOCUS_23550 19467 20141 gene locus_tag LOCUS_23560 19467 20141 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389714.1 protein_id gnl|my_center|LOCUS_23560 21296 20193 gene locus_tag LOCUS_23570 21296 20193 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127805.1 protein_id gnl|my_center|LOCUS_23570 22396 21890 gene locus_tag LOCUS_23580 22396 21890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 24526 23402 gene locus_tag LOCUS_23590 24526 23402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 25750 24536 gene locus_tag LOCUS_23600 25750 24536 CDS product DUF3419 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530941.1 protein_id gnl|my_center|LOCUS_23600 26314 25931 gene locus_tag LOCUS_23610 26314 25931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 26890 26357 gene locus_tag LOCUS_23620 gene kdpF 26890 26357 CDS product K(+)-transporting ATPase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089904.1 protein_id gnl|my_center|LOCUS_23620 28538 27069 gene locus_tag LOCUS_23630 gene glpK 28538 27069 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888563.1 protein_id gnl|my_center|LOCUS_23630 28766 29038 gene locus_tag LOCUS_23640 28766 29038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 29555 29076 gene locus_tag LOCUS_23650 29555 29076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 29914 29633 gene locus_tag LOCUS_23660 29914 29633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186603.1 protein_id gnl|my_center|LOCUS_23660 30696 29914 gene locus_tag LOCUS_23670 30696 29914 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106332.1 protein_id gnl|my_center|LOCUS_23670 31680 30796 gene locus_tag LOCUS_23680 31680 30796 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195802.1 protein_id gnl|my_center|LOCUS_23680 31794 33290 gene locus_tag LOCUS_23690 31794 33290 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808433.1 protein_id gnl|my_center|LOCUS_23690 34156 35196 gene locus_tag LOCUS_23700 34156 35196 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551047.1 protein_id gnl|my_center|LOCUS_23700 35193 36833 gene locus_tag LOCUS_23710 35193 36833 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195805.1 protein_id gnl|my_center|LOCUS_23710 37300 38073 gene locus_tag LOCUS_23720 37300 38073 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821323.1 protein_id gnl|my_center|LOCUS_23720 38070 38789 gene locus_tag LOCUS_23730 38070 38789 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813858.1 protein_id gnl|my_center|LOCUS_23730 38874 40094 gene locus_tag LOCUS_23740 38874 40094 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185183.1 protein_id gnl|my_center|LOCUS_23740 40430 41314 gene locus_tag LOCUS_23750 40430 41314 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813860.1 protein_id gnl|my_center|LOCUS_23750 41325 42308 gene locus_tag LOCUS_23760 41325 42308 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813861.1 protein_id gnl|my_center|LOCUS_23760 42432 42842 gene locus_tag LOCUS_23770 42432 42842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 43012 43680 gene locus_tag LOCUS_23780 43012 43680 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184583.1 protein_id gnl|my_center|LOCUS_23780 45112 43709 gene locus_tag LOCUS_23790 45112 43709 CDS product heavy metal sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064906.1 protein_id gnl|my_center|LOCUS_23790 45789 45109 gene locus_tag LOCUS_23800 45789 45109 CDS product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815229.1 protein_id gnl|my_center|LOCUS_23800 46093 46386 gene locus_tag LOCUS_23810 46093 46386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 46426 47814 gene locus_tag LOCUS_23820 46426 47814 CDS product beta-propeller fold lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815226.1 protein_id gnl|my_center|LOCUS_23820 49307 48150 gene locus_tag LOCUS_23830 49307 48150 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974401.1 protein_id gnl|my_center|LOCUS_23830 50264 49389 gene locus_tag LOCUS_23840 50264 49389 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921651.1 protein_id gnl|my_center|LOCUS_23840 50526 51284 gene locus_tag LOCUS_23850 50526 51284 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994212.1 protein_id gnl|my_center|LOCUS_23850 51470 53413 gene locus_tag LOCUS_23860 gene mnmG 51470 53413 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195816.1 protein_id gnl|my_center|LOCUS_23860 53410 54063 gene locus_tag LOCUS_23870 gene rsmG 53410 54063 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690016.1 protein_id gnl|my_center|LOCUS_23870 54081 54857 gene locus_tag LOCUS_23880 54081 54857 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195817.1 protein_id gnl|my_center|LOCUS_23880 54860 55753 gene locus_tag LOCUS_23890 54860 55753 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195818.1 protein_id gnl|my_center|LOCUS_23890 55756 56562 gene locus_tag LOCUS_23900 55756 56562 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531489.1 protein_id gnl|my_center|LOCUS_23900 56622 57179 gene locus_tag LOCUS_23910 56622 57179 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811244.1 protein_id gnl|my_center|LOCUS_23910 57482 57820 gene locus_tag LOCUS_23920 57482 57820 CDS product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815365.1 protein_id gnl|my_center|LOCUS_23920 57823 58653 gene locus_tag LOCUS_23930 gene atpB 57823 58653 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204192.1 protein_id gnl|my_center|LOCUS_23930 58739 58981 gene locus_tag LOCUS_23940 gene atpE 58739 58981 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815363.1 protein_id gnl|my_center|LOCUS_23940 59047 59517 gene locus_tag LOCUS_23950 59047 59517 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185283.1 protein_id gnl|my_center|LOCUS_23950 59520 60053 gene locus_tag LOCUS_23960 59520 60053 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195829.1 protein_id gnl|my_center|LOCUS_23960 60080 61621 gene locus_tag LOCUS_23970 gene atpA 60080 61621 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524507.1 protein_id gnl|my_center|LOCUS_23970 61651 62520 gene locus_tag LOCUS_23980 gene atpG 61651 62520 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195831.1 protein_id gnl|my_center|LOCUS_23980 62551 63957 gene locus_tag LOCUS_23990 gene atpD 62551 63957 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185243.1 protein_id gnl|my_center|LOCUS_23990 64031 64453 gene locus_tag LOCUS_24000 64031 64453 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195832.1 protein_id gnl|my_center|LOCUS_24000 64549 64965 gene locus_tag LOCUS_24010 64549 64965 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393898.1 protein_id gnl|my_center|LOCUS_24010 64999 65823 gene locus_tag LOCUS_24020 64999 65823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189747.1 protein_id gnl|my_center|LOCUS_24020 65820 66608 gene locus_tag LOCUS_24030 65820 66608 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113828.1 protein_id gnl|my_center|LOCUS_24030 66893 68026 gene locus_tag LOCUS_24040 gene hemE 66893 68026 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706638.1 protein_id gnl|my_center|LOCUS_24040 68645 70582 gene locus_tag LOCUS_24050 68645 70582 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205311.1 protein_id gnl|my_center|LOCUS_24050 70603 71046 gene locus_tag LOCUS_24060 70603 71046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24060 71056 71235 gene locus_tag LOCUS_24070 71056 71235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24070 71325 71771 gene locus_tag LOCUS_24080 71325 71771 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481688.1 protein_id gnl|my_center|LOCUS_24080 72282 71815 gene locus_tag LOCUS_24090 72282 71815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 72473 73330 gene locus_tag LOCUS_24100 72473 73330 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523532.1 protein_id gnl|my_center|LOCUS_24100 73391 74077 gene locus_tag LOCUS_24110 73391 74077 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480654.1 protein_id gnl|my_center|LOCUS_24110 74123 74461 gene locus_tag LOCUS_24120 74123 74461 CDS product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070685.1 protein_id gnl|my_center|LOCUS_24120 74573 74908 gene locus_tag LOCUS_24130 74573 74908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366895.1 protein_id gnl|my_center|LOCUS_24130 74923 75504 gene locus_tag LOCUS_24140 74923 75504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 75600 76670 gene locus_tag LOCUS_24150 75600 76670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 76667 78565 gene locus_tag LOCUS_24160 76667 78565 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895630.1 protein_id gnl|my_center|LOCUS_24160 78562 79218 gene locus_tag LOCUS_24170 78562 79218 CDS product 4Fe-4S cluster-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114396.1 protein_id gnl|my_center|LOCUS_24170 79219 81633 gene locus_tag LOCUS_24180 79219 81633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 81620 82048 gene locus_tag LOCUS_24190 81620 82048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 82825 82067 gene locus_tag LOCUS_24200 82825 82067 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091026.1 protein_id gnl|my_center|LOCUS_24200 83005 84498 gene locus_tag LOCUS_24210 83005 84498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 84647 84907 gene locus_tag LOCUS_24220 84647 84907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 84940 86415 gene locus_tag LOCUS_24230 gene xdhA 84940 86415 CDS product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186232.1 protein_id gnl|my_center|LOCUS_24230 86430 88805 gene locus_tag LOCUS_24240 gene xdhB 86430 88805 CDS product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522221.1 protein_id gnl|my_center|LOCUS_24240 88831 89961 gene locus_tag LOCUS_24250 gene xdhC 88831 89961 CDS product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189595.1 protein_id gnl|my_center|LOCUS_24250 90122 91453 gene locus_tag LOCUS_24260 gene guaD 90122 91453 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189962.1 protein_id gnl|my_center|LOCUS_24260 91529 91717 gene locus_tag LOCUS_24270 91529 91717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 92515 92712 gene locus_tag LOCUS_24280 92515 92712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 92820 95216 gene locus_tag LOCUS_24290 92820 95216 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038158.1 protein_id gnl|my_center|LOCUS_24290 95213 96493 gene locus_tag LOCUS_24300 95213 96493 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965326.1 protein_id gnl|my_center|LOCUS_24300 97808 96585 gene locus_tag LOCUS_24310 97808 96585 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762391.1 protein_id gnl|my_center|LOCUS_24310 99078 97858 gene locus_tag LOCUS_24320 99078 97858 CDS product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550272.1 protein_id gnl|my_center|LOCUS_24320 99803 99450 gene locus_tag LOCUS_24330 gene uraH 99803 99450 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521222.1 protein_id gnl|my_center|LOCUS_24330 100021 101781 gene locus_tag LOCUS_24340 100021 101781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 102598 101789 gene locus_tag LOCUS_24350 102598 101789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 102886 104265 gene locus_tag LOCUS_24360 102886 104265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 104262 105080 gene locus_tag LOCUS_24370 104262 105080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 105884 105111 gene locus_tag LOCUS_24380 105884 105111 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481713.1 protein_id gnl|my_center|LOCUS_24380 106899 106006 gene locus_tag LOCUS_24390 106899 106006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 107262 106945 gene locus_tag LOCUS_24400 107262 106945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 107474 107845 gene locus_tag LOCUS_24410 107474 107845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 107929 108315 gene locus_tag LOCUS_24420 107929 108315 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161790920.1 protein_id gnl|my_center|LOCUS_24420 110367 108361 gene locus_tag LOCUS_24430 110367 108361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 111830 110562 gene locus_tag LOCUS_24440 111830 110562 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390217.1 protein_id gnl|my_center|LOCUS_24440 112098 112700 gene locus_tag LOCUS_24450 gene lpcA 112098 112700 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705469.1 protein_id gnl|my_center|LOCUS_24450 112693 113178 gene locus_tag LOCUS_24460 112693 113178 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877376.1 protein_id gnl|my_center|LOCUS_24460 114112 113198 gene locus_tag LOCUS_24470 114112 113198 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529199.1 protein_id gnl|my_center|LOCUS_24470 114252 115229 gene locus_tag LOCUS_24480 114252 115229 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529197.1 protein_id gnl|my_center|LOCUS_24480 115555 116070 gene locus_tag LOCUS_24490 115555 116070 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497633.1 protein_id gnl|my_center|LOCUS_24490 116060 116878 gene locus_tag LOCUS_24500 116060 116878 CDS product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258316.1 protein_id gnl|my_center|LOCUS_24500 118278 116893 gene locus_tag LOCUS_24510 gene dbpA 118278 116893 CDS product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820592.1 protein_id gnl|my_center|LOCUS_24510 120345 118699 gene locus_tag LOCUS_24520 120345 118699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 120569 121105 gene locus_tag LOCUS_24530 120569 121105 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045629.1 protein_id gnl|my_center|LOCUS_24530 121108 121392 gene locus_tag LOCUS_24540 121108 121392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 121516 122364 gene locus_tag LOCUS_24550 121516 122364 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640518.1 protein_id gnl|my_center|LOCUS_24550 122753 122415 gene locus_tag LOCUS_24560 122753 122415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 123515 126286 gene locus_tag LOCUS_24570 123515 126286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 128524 126389 gene locus_tag LOCUS_24580 128524 126389 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073664.1 protein_id gnl|my_center|LOCUS_24580 128886 129542 gene locus_tag LOCUS_24590 128886 129542 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974767.1 protein_id gnl|my_center|LOCUS_24590 129597 129794 gene locus_tag LOCUS_24600 129597 129794 CDS product DUF1737 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122004.1 protein_id gnl|my_center|LOCUS_24600 129862 130677 gene locus_tag LOCUS_24610 129862 130677 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203662.1 protein_id gnl|my_center|LOCUS_24610 131813 130716 gene locus_tag LOCUS_24620 131813 130716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 132447 131965 gene locus_tag LOCUS_24630 132447 131965 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188247.1 protein_id gnl|my_center|LOCUS_24630 132924 132559 gene locus_tag LOCUS_24640 132924 132559 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406684.1 protein_id gnl|my_center|LOCUS_24640 136081 132926 gene locus_tag LOCUS_24650 136081 132926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 136972 136151 gene locus_tag LOCUS_24660 136972 136151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 138035 136965 gene locus_tag LOCUS_24670 138035 136965 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870115.1 protein_id gnl|my_center|LOCUS_24670 138335 140365 gene locus_tag LOCUS_24680 138335 140365 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524472.1 protein_id gnl|my_center|LOCUS_24680 140614 141318 gene locus_tag LOCUS_24690 140614 141318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 141369 141989 gene locus_tag LOCUS_24700 141369 141989 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038740.1 protein_id gnl|my_center|LOCUS_24700 142089 143000 gene locus_tag LOCUS_24710 142089 143000 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583996.1 protein_id gnl|my_center|LOCUS_24710 143570 143103 gene locus_tag LOCUS_24720 143570 143103 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036060.1 protein_id gnl|my_center|LOCUS_24720 145501 143567 gene locus_tag LOCUS_24730 145501 143567 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036061.1 protein_id gnl|my_center|LOCUS_24730 146307 145498 gene locus_tag LOCUS_24740 146307 145498 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036062.1 protein_id gnl|my_center|LOCUS_24740 146425 146919 gene locus_tag LOCUS_24750 146425 146919 CDS product SgcJ/EcaC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005617103.1 protein_id gnl|my_center|LOCUS_24750 147203 147628 gene locus_tag LOCUS_24760 147203 147628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 148438 147656 gene locus_tag LOCUS_24770 148438 147656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 149871 148672 gene locus_tag LOCUS_24780 149871 148672 CDS product DUF2807 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789219.1 protein_id gnl|my_center|LOCUS_24780 150069 150710 gene locus_tag LOCUS_24790 150069 150710 CDS product YcbK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919386.1 protein_id gnl|my_center|LOCUS_24790 153463 150746 gene locus_tag LOCUS_24800 153463 150746 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930957.1 protein_id gnl|my_center|LOCUS_24800 156303 153529 gene locus_tag LOCUS_24810 156303 153529 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814074.1 protein_id gnl|my_center|LOCUS_24810 157322 156507 gene locus_tag LOCUS_24820 157322 156507 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460080.1 protein_id gnl|my_center|LOCUS_24820 157429 157887 gene locus_tag LOCUS_24830 157429 157887 CDS product SirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073594.1 protein_id gnl|my_center|LOCUS_24830 157908 159452 gene locus_tag LOCUS_24840 157908 159452 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640504.1 protein_id gnl|my_center|LOCUS_24840 161092 159500 gene locus_tag LOCUS_24850 161092 159500 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966127.1 protein_id gnl|my_center|LOCUS_24850 161211 162281 gene locus_tag LOCUS_24860 161211 162281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 164619 162289 gene locus_tag LOCUS_24870 164619 162289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 165152 164685 gene locus_tag LOCUS_24880 165152 164685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 165377 166381 gene locus_tag LOCUS_24890 gene dinB 165377 166381 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191702.1 protein_id gnl|my_center|LOCUS_24890 169234 166463 gene locus_tag LOCUS_24900 169234 166463 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814074.1 protein_id gnl|my_center|LOCUS_24900 170371 169751 gene locus_tag LOCUS_24910 170371 169751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 171830 171754 gene locus_tag LOCUS_t00410 171830 171754 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 172111 172662 gene locus_tag LOCUS_24920 172111 172662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 173276 176056 gene locus_tag LOCUS_24930 173276 176056 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114864.1 protein_id gnl|my_center|LOCUS_24930 177011 180124 gene locus_tag LOCUS_24940 177011 180124 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037703.1 protein_id gnl|my_center|LOCUS_24940 180877 183744 gene locus_tag LOCUS_24950 180877 183744 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032613447.1 protein_id gnl|my_center|LOCUS_24950 184331 186064 gene locus_tag LOCUS_24960 184331 186064 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201704.1 protein_id gnl|my_center|LOCUS_24960 186208 186552 gene locus_tag LOCUS_24970 186208 186552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 188010 186790 gene locus_tag LOCUS_24980 188010 186790 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367899.1 protein_id gnl|my_center|LOCUS_24980 188161 188964 gene locus_tag LOCUS_24990 188161 188964 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038810.1 protein_id gnl|my_center|LOCUS_24990 191201 189021 gene locus_tag LOCUS_25000 191201 189021 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994073.1 protein_id gnl|my_center|LOCUS_25000 192782 191568 gene locus_tag LOCUS_25010 192782 191568 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086798.1 protein_id gnl|my_center|LOCUS_25010 193047 194558 gene locus_tag LOCUS_25020 193047 194558 CDS product AlkA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143598.1 protein_id gnl|my_center|LOCUS_25020 194585 195130 gene locus_tag LOCUS_25030 194585 195130 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037783.1 protein_id gnl|my_center|LOCUS_25030 195319 195882 gene locus_tag LOCUS_25040 195319 195882 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199567.1 protein_id gnl|my_center|LOCUS_25040 196380 195994 gene locus_tag LOCUS_25050 196380 195994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 198188 196434 gene locus_tag LOCUS_25060 198188 196434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 198342 199256 gene locus_tag LOCUS_25070 198342 199256 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114165.1 protein_id gnl|my_center|LOCUS_25070 199391 200566 gene locus_tag LOCUS_25080 199391 200566 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527150.1 protein_id gnl|my_center|LOCUS_25080 200769 202196 gene locus_tag LOCUS_25090 200769 202196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 203519 202365 gene locus_tag LOCUS_25100 203519 202365 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142975.1 protein_id gnl|my_center|LOCUS_25100 204715 203516 gene locus_tag LOCUS_25110 204715 203516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929157.1 protein_id gnl|my_center|LOCUS_25110 205110 204844 gene locus_tag LOCUS_25120 205110 204844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 206664 205162 gene locus_tag LOCUS_25130 206664 205162 CDS product DUF4331 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929156.1 protein_id gnl|my_center|LOCUS_25130 207292 208653 gene locus_tag LOCUS_25140 207292 208653 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000546469.1 protein_id gnl|my_center|LOCUS_25140 210247 208718 gene locus_tag LOCUS_25150 210247 208718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 210900 212228 gene locus_tag LOCUS_25160 210900 212228 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074152.1 protein_id gnl|my_center|LOCUS_25160 212233 213642 gene locus_tag LOCUS_25170 212233 213642 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074151.1 protein_id gnl|my_center|LOCUS_25170 213805 216267 gene locus_tag LOCUS_25180 213805 216267 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035989.1 protein_id gnl|my_center|LOCUS_25180 216422 216853 gene locus_tag LOCUS_25190 216422 216853 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868673.1 protein_id gnl|my_center|LOCUS_25190 216994 218352 gene locus_tag LOCUS_25200 216994 218352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 218372 219127 gene locus_tag LOCUS_25210 218372 219127 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038759.1 protein_id gnl|my_center|LOCUS_25210 219373 220182 gene locus_tag LOCUS_25220 219373 220182 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035554.1 protein_id gnl|my_center|LOCUS_25220 220771 220196 gene locus_tag LOCUS_25230 220771 220196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039241.1 protein_id gnl|my_center|LOCUS_25230 222928 221195 gene locus_tag LOCUS_25240 222928 221195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 223683 224555 gene locus_tag LOCUS_25250 223683 224555 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705854.1 protein_id gnl|my_center|LOCUS_25250 226625 224613 gene locus_tag LOCUS_25260 226625 224613 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037381.1 protein_id gnl|my_center|LOCUS_25260 227381 226719 gene locus_tag LOCUS_25270 227381 226719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 227518 228375 gene locus_tag LOCUS_25280 227518 228375 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819958.1 protein_id gnl|my_center|LOCUS_25280 228397 229215 gene locus_tag LOCUS_25290 228397 229215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 229307 231082 gene locus_tag LOCUS_25300 229307 231082 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206612.1 protein_id gnl|my_center|LOCUS_25300 231397 231092 gene locus_tag LOCUS_25310 231397 231092 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241605.1 protein_id gnl|my_center|LOCUS_25310 232754 231645 gene locus_tag LOCUS_25320 232754 231645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 233992 232904 gene locus_tag LOCUS_25330 233992 232904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 234687 234001 gene locus_tag LOCUS_25340 234687 234001 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019283.1 protein_id gnl|my_center|LOCUS_25340 235359 234700 gene locus_tag LOCUS_25350 235359 234700 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105364.1 protein_id gnl|my_center|LOCUS_25350 236604 235381 gene locus_tag LOCUS_25360 236604 235381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 237283 236873 gene locus_tag LOCUS_25370 237283 236873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 237538 239877 gene locus_tag LOCUS_25380 237538 239877 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037772.1 protein_id gnl|my_center|LOCUS_25380 240432 241766 gene locus_tag LOCUS_25390 240432 241766 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503865.1 protein_id gnl|my_center|LOCUS_25390 243962 241788 gene locus_tag LOCUS_25400 243962 241788 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943313.1 protein_id gnl|my_center|LOCUS_25400 245158 244181 gene locus_tag LOCUS_25410 245158 244181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 245561 247231 gene locus_tag LOCUS_25420 245561 247231 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073369.1 protein_id gnl|my_center|LOCUS_25420 247761 247609 gene locus_tag LOCUS_25430 247761 247609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 248038 247733 gene locus_tag LOCUS_25440 248038 247733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 247932 248684 gene locus_tag LOCUS_25450 247932 248684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 249039 253799 gene locus_tag LOCUS_25460 249039 253799 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028707.1 protein_id gnl|my_center|LOCUS_25460 254616 254434 gene locus_tag LOCUS_25470 254616 254434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 255088 254582 gene locus_tag LOCUS_25480 255088 254582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 255212 256834 gene locus_tag LOCUS_25490 255212 256834 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035282.1 protein_id gnl|my_center|LOCUS_25490 257003 259081 gene locus_tag LOCUS_25500 257003 259081 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275451.1 protein_id gnl|my_center|LOCUS_25500 259935 259093 gene locus_tag LOCUS_25510 259935 259093 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403515.1 protein_id gnl|my_center|LOCUS_25510 261131 259932 gene locus_tag LOCUS_25520 261131 259932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 261265 261750 gene locus_tag LOCUS_25530 261265 261750 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523768.1 protein_id gnl|my_center|LOCUS_25530 261747 263933 gene locus_tag LOCUS_25540 261747 263933 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114948.1 protein_id gnl|my_center|LOCUS_25540 264307 264065 gene locus_tag LOCUS_25550 264307 264065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 264482 264874 gene locus_tag LOCUS_25560 264482 264874 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405186.1 protein_id gnl|my_center|LOCUS_25560 266383 264884 gene locus_tag LOCUS_25570 266383 264884 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929319.1 protein_id gnl|my_center|LOCUS_25570 266569 266658 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 266836 267093 gene locus_tag LOCUS_25580 266836 267093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 267673 267125 gene locus_tag LOCUS_25590 267673 267125 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027568.1 protein_id gnl|my_center|LOCUS_25590 267890 268384 gene locus_tag LOCUS_25600 267890 268384 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812465.1 protein_id gnl|my_center|LOCUS_25600 268384 268620 gene locus_tag LOCUS_25610 268384 268620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 268731 269591 gene locus_tag LOCUS_25620 268731 269591 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096656.1 protein_id gnl|my_center|LOCUS_25620 270031 271215 gene locus_tag LOCUS_25630 270031 271215 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384483.1 protein_id gnl|my_center|LOCUS_25630 271218 274457 gene locus_tag LOCUS_25640 271218 274457 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974031.1 protein_id gnl|my_center|LOCUS_25640 275800 274796 gene locus_tag LOCUS_25650 275800 274796 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528459.1 protein_id gnl|my_center|LOCUS_25650 276713 275889 gene locus_tag LOCUS_25660 276713 275889 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704031.1 protein_id gnl|my_center|LOCUS_25660 276922 278268 gene locus_tag LOCUS_25670 276922 278268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 279852 278434 gene locus_tag LOCUS_25680 279852 278434 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767248.1 protein_id gnl|my_center|LOCUS_25680 280918 279869 gene locus_tag LOCUS_25690 280918 279869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 281956 280928 gene locus_tag LOCUS_25700 281956 280928 CDS product RNA ligase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068264228.1 protein_id gnl|my_center|LOCUS_25700 282156 282081 gene locus_tag LOCUS_t00420 282156 282081 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 283310 282690 gene locus_tag LOCUS_25710 283310 282690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 283491 283682 gene locus_tag LOCUS_25720 283491 283682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 284248 283907 gene locus_tag LOCUS_25730 284248 283907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 284521 284282 gene locus_tag LOCUS_25740 284521 284282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 284669 284541 gene locus_tag LOCUS_25750 284669 284541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 284898 284810 gene locus_tag LOCUS_t00430 284898 284810 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 284979 284904 gene locus_tag LOCUS_t00440 284979 284904 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 285060 284986 gene locus_tag LOCUS_t00450 285060 284986 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 285154 285067 gene locus_tag LOCUS_t00460 285154 285067 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 285311 285236 gene locus_tag LOCUS_t00470 285311 285236 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 285393 285318 gene locus_tag LOCUS_t00480 285393 285318 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 285524 285448 gene locus_tag LOCUS_t00490 285524 285448 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 285608 285534 gene locus_tag LOCUS_t00500 285608 285534 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 285702 285627 gene locus_tag LOCUS_t00510 285702 285627 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 285843 285770 gene locus_tag LOCUS_t00520 285843 285770 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 285999 285924 gene locus_tag LOCUS_t00530 285999 285924 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 286102 286026 gene locus_tag LOCUS_t00540 286102 286026 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 286207 286132 gene locus_tag LOCUS_t00550 286207 286132 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 286287 286213 gene locus_tag LOCUS_t00560 286287 286213 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 286873 286628 gene locus_tag LOCUS_25760 286873 286628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 287071 287376 gene locus_tag LOCUS_25770 287071 287376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 287789 287469 gene locus_tag LOCUS_25780 287789 287469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 289286 287955 gene locus_tag LOCUS_25790 289286 287955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 289948 289283 gene locus_tag LOCUS_25800 289948 289283 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926777.1 protein_id gnl|my_center|LOCUS_25800 294413 290049 gene locus_tag LOCUS_25810 294413 290049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 295286 294501 gene locus_tag LOCUS_25820 295286 294501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 295491 296192 gene locus_tag LOCUS_25830 295491 296192 CDS product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940907.1 protein_id gnl|my_center|LOCUS_25830 296890 296234 gene locus_tag LOCUS_25840 296890 296234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 297980 296898 gene locus_tag LOCUS_25850 297980 296898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337357.1 protein_id gnl|my_center|LOCUS_25850 299209 298055 gene locus_tag LOCUS_25860 299209 298055 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060486313.1 protein_id gnl|my_center|LOCUS_25860 299637 300071 gene locus_tag LOCUS_25870 299637 300071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 301457 300216 gene locus_tag LOCUS_25880 301457 300216 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268088.1 protein_id gnl|my_center|LOCUS_25880 301771 301454 gene locus_tag LOCUS_25890 301771 301454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 302919 301906 gene locus_tag LOCUS_25900 302919 301906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 304363 303047 gene locus_tag LOCUS_25910 304363 303047 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073342.1 protein_id gnl|my_center|LOCUS_25910 307497 304882 gene locus_tag LOCUS_25920 307497 304882 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918334.1 protein_id gnl|my_center|LOCUS_25920 309097 307850 gene locus_tag LOCUS_25930 309097 307850 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066871940.1 protein_id gnl|my_center|LOCUS_25930 311098 309665 gene locus_tag LOCUS_25940 311098 309665 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016348991.1 protein_id gnl|my_center|LOCUS_25940 311891 311169 gene locus_tag LOCUS_25950 311891 311169 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016348992.1 protein_id gnl|my_center|LOCUS_25950 313234 311909 gene locus_tag LOCUS_25960 313234 311909 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091472.1 protein_id gnl|my_center|LOCUS_25960 314897 313449 gene locus_tag LOCUS_25970 314897 313449 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140892.1 protein_id gnl|my_center|LOCUS_25970 315124 316005 gene locus_tag LOCUS_25980 315124 316005 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111854.1 protein_id gnl|my_center|LOCUS_25980 317119 316169 gene locus_tag LOCUS_25990 317119 316169 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705178.1 protein_id gnl|my_center|LOCUS_25990 318476 317274 gene locus_tag LOCUS_26000 318476 317274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 318629 319225 gene locus_tag LOCUS_26010 318629 319225 CDS product START domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932842.1 protein_id gnl|my_center|LOCUS_26010 319303 320019 gene locus_tag LOCUS_26020 319303 320019 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019237186.1 protein_id gnl|my_center|LOCUS_26020 321180 320116 gene locus_tag LOCUS_26030 321180 320116 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175517123.1 protein_id gnl|my_center|LOCUS_26030 321991 321395 gene locus_tag LOCUS_26040 321991 321395 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195598.1 protein_id gnl|my_center|LOCUS_26040 323649 322246 gene locus_tag LOCUS_26050 323649 322246 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870075.1 protein_id gnl|my_center|LOCUS_26050 323942 325453 gene locus_tag LOCUS_26060 323942 325453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 325755 325456 gene locus_tag LOCUS_26070 325755 325456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 327993 325801 gene locus_tag LOCUS_26080 327993 325801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 328496 328329 gene locus_tag LOCUS_26090 328496 328329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 328891 331146 gene locus_tag LOCUS_26100 328891 331146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 331235 332671 gene locus_tag LOCUS_26110 331235 332671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 333559 332783 gene locus_tag LOCUS_26120 333559 332783 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098249.1 protein_id gnl|my_center|LOCUS_26120 334182 333745 gene locus_tag LOCUS_26130 334182 333745 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061029547.1 protein_id gnl|my_center|LOCUS_26130 334853 334269 gene locus_tag LOCUS_26140 334853 334269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 334842 335102 gene locus_tag LOCUS_26150 334842 335102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 335453 335205 gene locus_tag LOCUS_26160 335453 335205 CDS product DUF3297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071089.1 protein_id gnl|my_center|LOCUS_26160 335799 337985 gene locus_tag LOCUS_26170 gene katG 335799 337985 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119918646.1 protein_id gnl|my_center|LOCUS_26170 339481 338216 gene locus_tag LOCUS_26180 339481 338216 CDS product flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085289.1 protein_id gnl|my_center|LOCUS_26180 339879 340418 gene locus_tag LOCUS_26190 339879 340418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 341177 342319 gene locus_tag LOCUS_26200 341177 342319 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480157.1 protein_id gnl|my_center|LOCUS_26200 342590 343345 gene locus_tag LOCUS_26210 342590 343345 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369251.1 protein_id gnl|my_center|LOCUS_26210 344312 343419 gene locus_tag LOCUS_26220 344312 343419 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975807.1 protein_id gnl|my_center|LOCUS_26220 344591 344872 gene locus_tag LOCUS_26230 344591 344872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 344869 345846 gene locus_tag LOCUS_26240 344869 345846 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101591.1 protein_id gnl|my_center|LOCUS_26240 346233 345988 gene locus_tag LOCUS_26250 346233 345988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 348189 347179 gene locus_tag LOCUS_26260 348189 347179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 349556 348186 gene locus_tag LOCUS_26270 349556 348186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 350834 349614 gene locus_tag LOCUS_26280 350834 349614 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921453.1 protein_id gnl|my_center|LOCUS_26280 353400 350905 gene locus_tag LOCUS_26290 gene gyrB 353400 350905 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196276.1 protein_id gnl|my_center|LOCUS_26290 354785 353679 gene locus_tag LOCUS_26300 gene dnaN 354785 353679 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196275.1 protein_id gnl|my_center|LOCUS_26300 357013 355625 gene locus_tag LOCUS_26310 gene dnaA 357013 355625 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929554.1 protein_id gnl|my_center|LOCUS_26310 357414 357626 gene locus_tag LOCUS_26320 357414 357626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 357666 358082 gene locus_tag LOCUS_26330 gene rnpA 357666 358082 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200284.1 protein_id gnl|my_center|LOCUS_26330 358094 358390 gene locus_tag LOCUS_26340 gene yidD 358094 358390 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198815.1 protein_id gnl|my_center|LOCUS_26340 358400 360064 gene locus_tag LOCUS_26350 gene yidC 358400 360064 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524584.1 protein_id gnl|my_center|LOCUS_26350 360465 361871 gene locus_tag LOCUS_26360 gene mnmE 360465 361871 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524586.1 protein_id gnl|my_center|LOCUS_26360 361898 362722 gene locus_tag LOCUS_26370 361898 362722 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104043.1 protein_id gnl|my_center|LOCUS_26370 363147 364328 gene locus_tag LOCUS_26380 363147 364328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 364580 364338 gene locus_tag LOCUS_26390 364580 364338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 365354 364764 gene locus_tag LOCUS_26400 365354 364764 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010205556.1 protein_id gnl|my_center|LOCUS_26400 366166 365465 gene locus_tag LOCUS_26410 366166 365465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 366527 366183 gene locus_tag LOCUS_26420 366527 366183 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528651.1 protein_id gnl|my_center|LOCUS_26420 367492 366524 gene locus_tag LOCUS_26430 367492 366524 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528051.1 protein_id gnl|my_center|LOCUS_26430 368691 367489 gene locus_tag LOCUS_26440 368691 367489 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065120.1 protein_id gnl|my_center|LOCUS_26440 368770 369477 gene locus_tag LOCUS_26450 368770 369477 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448528.1 protein_id gnl|my_center|LOCUS_26450 369807 369484 gene locus_tag LOCUS_26460 369807 369484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 370165 370968 gene locus_tag LOCUS_26470 370165 370968 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205980.1 protein_id gnl|my_center|LOCUS_26470 370965 371891 gene locus_tag LOCUS_26480 370965 371891 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521226.1 protein_id gnl|my_center|LOCUS_26480 373334 372174 gene locus_tag LOCUS_26490 373334 372174 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389655.1 protein_id gnl|my_center|LOCUS_26490 374376 373456 gene locus_tag LOCUS_26500 374376 373456 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389656.1 protein_id gnl|my_center|LOCUS_26500 375450 374383 gene locus_tag LOCUS_26510 375450 374383 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245542.1 protein_id gnl|my_center|LOCUS_26510 377029 375443 gene locus_tag LOCUS_26520 377029 375443 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184304236.1 protein_id gnl|my_center|LOCUS_26520 377383 378174 gene locus_tag LOCUS_26530 377383 378174 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115566.1 protein_id gnl|my_center|LOCUS_26530 378260 378985 gene locus_tag LOCUS_26540 378260 378985 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113515.1 protein_id gnl|my_center|LOCUS_26540 378982 379302 gene locus_tag LOCUS_26550 378982 379302 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368778.1 protein_id gnl|my_center|LOCUS_26550 379430 380608 gene locus_tag LOCUS_26560 379430 380608 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086802.1 protein_id gnl|my_center|LOCUS_26560 380692 382134 gene locus_tag LOCUS_26570 380692 382134 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205594.1 protein_id gnl|my_center|LOCUS_26570 382313 384535 gene locus_tag LOCUS_26580 382313 384535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 384894 386087 gene locus_tag LOCUS_26590 384894 386087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181712483.1 protein_id gnl|my_center|LOCUS_26590 386101 386514 gene locus_tag LOCUS_26600 386101 386514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 386913 388667 gene locus_tag LOCUS_26610 386913 388667 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205414.1 protein_id gnl|my_center|LOCUS_26610 389008 390756 gene locus_tag LOCUS_26620 389008 390756 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205414.1 protein_id gnl|my_center|LOCUS_26620 391432 390854 gene locus_tag LOCUS_26630 391432 390854 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314627.1 protein_id gnl|my_center|LOCUS_26630 392699 391491 gene locus_tag LOCUS_26640 392699 391491 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814551.1 protein_id gnl|my_center|LOCUS_26640 393190 394167 gene locus_tag LOCUS_26650 393190 394167 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816048.1 protein_id gnl|my_center|LOCUS_26650 394177 395088 gene locus_tag LOCUS_26660 394177 395088 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040797.1 protein_id gnl|my_center|LOCUS_26660 395101 396099 gene locus_tag LOCUS_26670 395101 396099 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267759.1 protein_id gnl|my_center|LOCUS_26670 396113 397114 gene locus_tag LOCUS_26680 396113 397114 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816041.1 protein_id gnl|my_center|LOCUS_26680 397774 398256 gene locus_tag LOCUS_26690 397774 398256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 399338 398571 gene locus_tag LOCUS_26700 399338 398571 CDS product DUF817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971962.1 protein_id gnl|my_center|LOCUS_26700 399400 399555 gene locus_tag LOCUS_26710 399400 399555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 399756 400706 gene locus_tag LOCUS_26720 gene puuE 399756 400706 CDS product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521217.1 protein_id gnl|my_center|LOCUS_26720 400797 401894 gene locus_tag LOCUS_26730 400797 401894 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537788.1 protein_id gnl|my_center|LOCUS_26730 402013 402912 gene locus_tag LOCUS_26740 402013 402912 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198106.1 protein_id gnl|my_center|LOCUS_26740 403023 403466 gene locus_tag LOCUS_26750 403023 403466 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209797.1 protein_id gnl|my_center|LOCUS_26750 404028 403492 gene locus_tag LOCUS_26760 404028 403492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071868.1 protein_id gnl|my_center|LOCUS_26760 405407 404193 gene locus_tag LOCUS_26770 405407 404193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 405660 405535 gene locus_tag LOCUS_26780 405660 405535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 406384 405953 gene locus_tag LOCUS_26790 406384 405953 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975835.1 protein_id gnl|my_center|LOCUS_26790 406374 406505 gene locus_tag LOCUS_26800 406374 406505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 406941 406510 gene locus_tag LOCUS_26810 406941 406510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 407201 406938 gene locus_tag LOCUS_26820 407201 406938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 407341 408345 gene locus_tag LOCUS_26830 407341 408345 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188985.1 protein_id gnl|my_center|LOCUS_26830 408374 409540 gene locus_tag LOCUS_26840 408374 409540 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538083.1 protein_id gnl|my_center|LOCUS_26840 410581 409550 gene locus_tag LOCUS_26850 410581 409550 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522340.1 protein_id gnl|my_center|LOCUS_26850 411184 410927 gene locus_tag LOCUS_26860 411184 410927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 411841 411470 gene locus_tag LOCUS_26870 411841 411470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 412584 411892 gene locus_tag LOCUS_26880 gene esaR 412584 411892 CDS product response regulator transcription factor EsaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009935896.1 protein_id gnl|my_center|LOCUS_26880 415234 412886 gene locus_tag LOCUS_26890 gene esaS 415234 412886 CDS product sensor histidine kinase EsaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523096.1 protein_id gnl|my_center|LOCUS_26890 415830 415243 gene locus_tag LOCUS_26900 415830 415243 CDS product DUF4390 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188929.1 protein_id gnl|my_center|LOCUS_26900 417383 415887 gene locus_tag LOCUS_26910 gene rsmB 417383 415887 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189046.1 protein_id gnl|my_center|LOCUS_26910 418448 417558 gene locus_tag LOCUS_26920 418448 417558 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815269.1 protein_id gnl|my_center|LOCUS_26920 418803 418453 gene locus_tag LOCUS_26930 418803 418453 CDS product DUF1840 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189319.1 protein_id gnl|my_center|LOCUS_26930 419403 418903 gene locus_tag LOCUS_26940 419403 418903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 419694 420035 gene locus_tag LOCUS_26950 419694 420035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 420051 420563 gene locus_tag LOCUS_26960 420051 420563 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705794.1 protein_id gnl|my_center|LOCUS_26960 420936 420670 gene locus_tag LOCUS_26970 420936 420670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 421506 423707 gene locus_tag LOCUS_26980 421506 423707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 424881 423679 gene locus_tag LOCUS_26990 424881 423679 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039013.1 protein_id gnl|my_center|LOCUS_26990 426468 424906 gene locus_tag LOCUS_27000 426468 424906 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063852.1 protein_id gnl|my_center|LOCUS_27000 427690 426944 gene locus_tag LOCUS_27010 427690 426944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 427910 429055 gene locus_tag LOCUS_27020 gene dcm 427910 429055 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689650.1 protein_id gnl|my_center|LOCUS_27020 431805 429037 gene locus_tag LOCUS_27030 431805 429037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 432482 431847 gene locus_tag LOCUS_27040 432482 431847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 433276 432482 gene locus_tag LOCUS_27050 433276 432482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 434989 433466 gene locus_tag LOCUS_27060 434989 433466 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550927.1 protein_id gnl|my_center|LOCUS_27060 435249 435007 gene locus_tag LOCUS_27070 435249 435007 CDS product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198021.1 protein_id gnl|my_center|LOCUS_27070 435589 436335 gene locus_tag LOCUS_27080 435589 436335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 436351 436689 gene locus_tag LOCUS_27090 436351 436689 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198020.1 protein_id gnl|my_center|LOCUS_27090 437029 436706 gene locus_tag LOCUS_27100 437029 436706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 437004 438305 gene locus_tag LOCUS_27110 gene amt 437004 438305 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707418.1 protein_id gnl|my_center|LOCUS_27110 439953 438661 gene locus_tag LOCUS_27120 439953 438661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 440764 440156 gene locus_tag LOCUS_27130 440764 440156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 441138 440833 gene locus_tag LOCUS_27140 441138 440833 CDS product DUF2288 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764940.1 protein_id gnl|my_center|LOCUS_27140 442716 441439 gene locus_tag LOCUS_27150 gene pelA 442716 441439 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764019.1 protein_id gnl|my_center|LOCUS_27150 443353 445311 gene locus_tag LOCUS_27160 443353 445311 CDS product LapD/MoxY N-terminal periplasmic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946565.1 protein_id gnl|my_center|LOCUS_27160 446234 445533 gene locus_tag LOCUS_27170 446234 445533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 446447 447490 gene locus_tag LOCUS_27180 gene ltaE 446447 447490 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529784.1 protein_id gnl|my_center|LOCUS_27180 448543 447518 gene locus_tag LOCUS_27190 448543 447518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 448907 448581 gene locus_tag LOCUS_27200 448907 448581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 449725 449114 gene locus_tag LOCUS_27210 449725 449114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 449887 451410 gene locus_tag LOCUS_27220 449887 451410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 451560 451417 gene locus_tag LOCUS_27230 451560 451417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 451808 451641 gene locus_tag LOCUS_27240 451808 451641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 452050 451889 gene locus_tag LOCUS_27250 452050 451889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 452280 452119 gene locus_tag LOCUS_27260 452280 452119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 452548 452351 gene locus_tag LOCUS_27270 452548 452351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 452782 452606 gene locus_tag LOCUS_27280 452782 452606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 453025 454296 gene locus_tag LOCUS_27290 453025 454296 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093492.1 protein_id gnl|my_center|LOCUS_27290 454418 456517 gene locus_tag LOCUS_27300 454418 456517 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545619.1 protein_id gnl|my_center|LOCUS_27300 456847 456686 gene locus_tag LOCUS_27310 456847 456686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 457061 456909 gene locus_tag LOCUS_27320 457061 456909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 457642 457181 gene locus_tag LOCUS_27330 457642 457181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 459941 457770 gene locus_tag LOCUS_27340 459941 457770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 460838 460251 gene locus_tag LOCUS_27350 460838 460251 CDS product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536930.1 protein_id gnl|my_center|LOCUS_27350 461681 461271 gene locus_tag LOCUS_27360 461681 461271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 463613 461946 gene locus_tag LOCUS_27370 gene ettA 463613 461946 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186903.1 protein_id gnl|my_center|LOCUS_27370 463828 464442 gene locus_tag LOCUS_27380 463828 464442 CDS product OmpW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972835.1 protein_id gnl|my_center|LOCUS_27380 464779 466026 gene locus_tag LOCUS_27390 464779 466026 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941822.1 protein_id gnl|my_center|LOCUS_27390 466084 466746 gene locus_tag LOCUS_27400 466084 466746 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786290.1 protein_id gnl|my_center|LOCUS_27400 466758 467993 gene locus_tag LOCUS_27410 466758 467993 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022822805.1 protein_id gnl|my_center|LOCUS_27410 467990 469195 gene locus_tag LOCUS_27420 467990 469195 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800756.1 protein_id gnl|my_center|LOCUS_27420 469307 470713 gene locus_tag LOCUS_27430 469307 470713 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762237.1 protein_id gnl|my_center|LOCUS_27430 470713 472092 gene locus_tag LOCUS_27440 470713 472092 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786305.1 protein_id gnl|my_center|LOCUS_27440 472224 472733 gene locus_tag LOCUS_27450 472224 472733 CDS product DUF1993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405482.1 protein_id gnl|my_center|LOCUS_27450 473414 472896 gene locus_tag LOCUS_27460 473414 472896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 473997 475271 gene locus_tag LOCUS_27470 gene tagH 473997 475271 CDS product type VI secretion system-associated FHA domain protein TagH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190504.1 protein_id gnl|my_center|LOCUS_27470 475299 476063 gene locus_tag LOCUS_27480 475299 476063 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096185.1 protein_id gnl|my_center|LOCUS_27480 476191 477951 gene locus_tag LOCUS_27490 476191 477951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 477964 478446 gene locus_tag LOCUS_27500 477964 478446 CDS product TssQ family T6SS-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806892.1 protein_id gnl|my_center|LOCUS_27500 479732 478521 gene locus_tag LOCUS_27510 gene mdpA 479732 478521 CDS product metallopeptidase MdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107426.1 protein_id gnl|my_center|LOCUS_27510 480635 479964 gene locus_tag LOCUS_27520 480635 479964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 481161 480679 gene locus_tag LOCUS_27530 481161 480679 CDS product group 1 truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764777.1 protein_id gnl|my_center|LOCUS_27530 482094 481186 gene locus_tag LOCUS_27540 482094 481186 CDS product DUF3034 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052844658.1 protein_id gnl|my_center|LOCUS_27540 482936 482490 gene locus_tag LOCUS_27550 482936 482490 CDS product group 1 truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764777.1 protein_id gnl|my_center|LOCUS_27550 483886 482972 gene locus_tag LOCUS_27560 483886 482972 CDS product DUF3034 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052844658.1 protein_id gnl|my_center|LOCUS_27560 485170 484022 gene locus_tag LOCUS_27570 485170 484022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 485539 485333 gene locus_tag LOCUS_27580 485539 485333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 485466 487178 gene locus_tag LOCUS_27590 485466 487178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 489584 487200 gene locus_tag LOCUS_27600 489584 487200 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037666.1 protein_id gnl|my_center|LOCUS_27600 490314 489691 gene locus_tag LOCUS_27610 490314 489691 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268752.1 protein_id gnl|my_center|LOCUS_27610 490834 491883 gene locus_tag LOCUS_27620 490834 491883 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043922219.1 protein_id gnl|my_center|LOCUS_27620 492804 491917 gene locus_tag LOCUS_27630 gene yedA 492804 491917 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112921.1 protein_id gnl|my_center|LOCUS_27630 492930 493376 gene locus_tag LOCUS_27640 492930 493376 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869023.1 protein_id gnl|my_center|LOCUS_27640 493398 494336 gene locus_tag LOCUS_27650 493398 494336 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807544.1 protein_id gnl|my_center|LOCUS_27650 494338 495399 gene locus_tag LOCUS_27660 494338 495399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 495428 496132 gene locus_tag LOCUS_27670 495428 496132 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840046.1 protein_id gnl|my_center|LOCUS_27670 496256 497455 gene locus_tag LOCUS_27680 496256 497455 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967105.1 protein_id gnl|my_center|LOCUS_27680 497907 497425 gene locus_tag LOCUS_27690 497907 497425 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731152.1 protein_id gnl|my_center|LOCUS_27690 498029 498928 gene locus_tag LOCUS_27700 498029 498928 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104037.1 protein_id gnl|my_center|LOCUS_27700 498997 500013 gene locus_tag LOCUS_27710 498997 500013 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707244.1 protein_id gnl|my_center|LOCUS_27710 500342 502900 gene locus_tag LOCUS_27720 500342 502900 CDS product exo 1,3/1,4-beta-D-glucan glucohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229330.1 protein_id gnl|my_center|LOCUS_27720 503343 506981 gene locus_tag LOCUS_27730 503343 506981 CDS product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523124.1 protein_id gnl|my_center|LOCUS_27730 507274 510552 gene locus_tag LOCUS_27740 507274 510552 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224369.1 protein_id gnl|my_center|LOCUS_27740 511072 511305 gene locus_tag LOCUS_27750 511072 511305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 511606 512079 gene locus_tag LOCUS_27760 511606 512079 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198641.1 protein_id gnl|my_center|LOCUS_27760 512183 512683 gene locus_tag LOCUS_27770 512183 512683 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705212.1 protein_id gnl|my_center|LOCUS_27770 512680 513135 gene locus_tag LOCUS_27780 512680 513135 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936133.1 protein_id gnl|my_center|LOCUS_27780 513343 515367 gene locus_tag LOCUS_27790 513343 515367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 515443 515784 gene locus_tag LOCUS_27800 515443 515784 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185161.1 protein_id gnl|my_center|LOCUS_27800 515815 516453 gene locus_tag LOCUS_27810 515815 516453 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119576.1 protein_id gnl|my_center|LOCUS_27810 518446 516527 gene locus_tag LOCUS_27820 518446 516527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 520238 518751 gene locus_tag LOCUS_27830 520238 518751 CDS product sulfite reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063987.1 protein_id gnl|my_center|LOCUS_27830 521308 520289 gene locus_tag LOCUS_27840 521308 520289 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265901.1 protein_id gnl|my_center|LOCUS_27840 522138 521329 gene locus_tag LOCUS_27850 522138 521329 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037905.1 protein_id gnl|my_center|LOCUS_27850 522676 522158 gene locus_tag LOCUS_27860 522676 522158 CDS product DUF2271 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930254.1 protein_id gnl|my_center|LOCUS_27860 523378 522737 gene locus_tag LOCUS_27870 523378 522737 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037903.1 protein_id gnl|my_center|LOCUS_27870 523670 525034 gene locus_tag LOCUS_27880 gene glmU 523670 525034 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190034.1 protein_id gnl|my_center|LOCUS_27880 525887 525123 gene locus_tag LOCUS_27890 525887 525123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 526265 527314 gene locus_tag LOCUS_27900 526265 527314 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194585.1 protein_id gnl|my_center|LOCUS_27900 528239 527421 gene locus_tag LOCUS_27910 528239 527421 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070794.1 protein_id gnl|my_center|LOCUS_27910 528991 528236 gene locus_tag LOCUS_27920 528991 528236 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530221.1 protein_id gnl|my_center|LOCUS_27920 529621 529031 gene locus_tag LOCUS_27930 529621 529031 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958140.1 protein_id gnl|my_center|LOCUS_27930 529743 530441 gene locus_tag LOCUS_27940 529743 530441 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185910.1 protein_id gnl|my_center|LOCUS_27940 530533 531366 gene locus_tag LOCUS_27950 530533 531366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 531434 532252 gene locus_tag LOCUS_27960 531434 532252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 532721 532260 gene locus_tag LOCUS_27970 532721 532260 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064827.1 protein_id gnl|my_center|LOCUS_27970 532878 534695 gene locus_tag LOCUS_27980 gene glmS 532878 534695 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064828.1 protein_id gnl|my_center|LOCUS_27980 534865 535260 gene locus_tag LOCUS_27990 534865 535260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 535709 535951 gene locus_tag LOCUS_28000 535709 535951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 536361 537134 gene locus_tag LOCUS_28010 536361 537134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 537131 537694 gene locus_tag LOCUS_28020 537131 537694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 537715 538350 gene locus_tag LOCUS_28030 537715 538350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 538739 540952 gene locus_tag LOCUS_28040 538739 540952 CDS product OsmC domain/YcaO domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206168.1 protein_id gnl|my_center|LOCUS_28040 541505 541074 gene locus_tag LOCUS_28050 541505 541074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 541960 545187 gene locus_tag LOCUS_28060 541960 545187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 545998 545360 gene locus_tag LOCUS_28070 545998 545360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 546345 546641 gene locus_tag LOCUS_28080 546345 546641 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737444.1 protein_id gnl|my_center|LOCUS_28080 546651 546935 gene locus_tag LOCUS_28090 546651 546935 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103139.1 protein_id gnl|my_center|LOCUS_28090 547991 547326 gene locus_tag LOCUS_28100 547991 547326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 548052 548882 gene locus_tag LOCUS_28110 548052 548882 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225904.1 protein_id gnl|my_center|LOCUS_28110 549086 549775 gene locus_tag LOCUS_28120 549086 549775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 550001 551938 gene locus_tag LOCUS_28130 550001 551938 CDS product M61 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640643.1 protein_id gnl|my_center|LOCUS_28130 552854 551988 gene locus_tag LOCUS_28140 552854 551988 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530117.1 protein_id gnl|my_center|LOCUS_28140 554017 553025 gene locus_tag LOCUS_28150 554017 553025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 555185 554136 gene locus_tag LOCUS_28160 555185 554136 CDS product pectinesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084794.1 protein_id gnl|my_center|LOCUS_28160 556586 555333 gene locus_tag LOCUS_28170 556586 555333 CDS product glycosyl hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038557.1 protein_id gnl|my_center|LOCUS_28170 557122 557595 gene locus_tag LOCUS_28180 557122 557595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 558746 557712 gene locus_tag LOCUS_28190 gene ceoR 558746 557712 CDS product putative multidrug efflux transcriptional regulator CeoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188318.1 protein_id gnl|my_center|LOCUS_28190 558958 559851 gene locus_tag LOCUS_28200 558958 559851 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187624.1 protein_id gnl|my_center|LOCUS_28200 559929 561194 gene locus_tag LOCUS_28210 559929 561194 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807730.1 protein_id gnl|my_center|LOCUS_28210 561231 564440 gene locus_tag LOCUS_28220 gene adeG 561231 564440 CDS product multidrug efflux RND transporter permease subunit AdeG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207234.1 protein_id gnl|my_center|LOCUS_28220 564447 565985 gene locus_tag LOCUS_28230 564447 565985 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927472.1 protein_id gnl|my_center|LOCUS_28230 567337 566075 gene locus_tag LOCUS_28240 567337 566075 CDS product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767299.1 protein_id gnl|my_center|LOCUS_28240 569776 567383 gene locus_tag LOCUS_28250 569776 567383 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767049.1 protein_id gnl|my_center|LOCUS_28250 571087 569957 gene locus_tag LOCUS_28260 571087 569957 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767015.1 protein_id gnl|my_center|LOCUS_28260 574103 571257 gene locus_tag LOCUS_28270 574103 571257 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035377.1 protein_id gnl|my_center|LOCUS_28270 574654 575685 gene locus_tag LOCUS_28280 574654 575685 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_28280 575702 577063 gene locus_tag LOCUS_28290 575702 577063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 577184 577792 gene locus_tag LOCUS_28300 577184 577792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 578161 577802 gene locus_tag LOCUS_28310 578161 577802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 578540 581011 gene locus_tag LOCUS_28320 578540 581011 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178372678.1 protein_id gnl|my_center|LOCUS_28320 581100 582236 gene locus_tag LOCUS_28330 581100 582236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 583417 582374 gene locus_tag LOCUS_28340 583417 582374 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113326.1 protein_id gnl|my_center|LOCUS_28340 583838 583338 gene locus_tag LOCUS_28350 583838 583338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 586510 584060 gene locus_tag LOCUS_28360 586510 584060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 587178 587816 gene locus_tag LOCUS_28370 587178 587816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 587895 588281 gene locus_tag LOCUS_28380 587895 588281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 589253 588300 gene locus_tag LOCUS_28390 589253 588300 CDS product sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199695.1 protein_id gnl|my_center|LOCUS_28390 590383 589340 gene locus_tag LOCUS_28400 590383 589340 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103107.1 protein_id gnl|my_center|LOCUS_28400 590584 592851 gene locus_tag LOCUS_28410 590584 592851 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206773.1 protein_id gnl|my_center|LOCUS_28410 592856 594142 gene locus_tag LOCUS_28420 592856 594142 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103108.1 protein_id gnl|my_center|LOCUS_28420 594224 595570 gene locus_tag LOCUS_28430 594224 595570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 595849 597222 gene locus_tag LOCUS_28440 595849 597222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 600182 597309 gene locus_tag LOCUS_28450 600182 597309 CDS product beta-galactosidase GalA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036450.1 protein_id gnl|my_center|LOCUS_28450 600207 600371 gene locus_tag LOCUS_28460 600207 600371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 602055 600388 gene locus_tag LOCUS_28470 602055 600388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 602941 606792 gene locus_tag LOCUS_28480 602941 606792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 606946 608406 gene locus_tag LOCUS_28490 606946 608406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 608653 609924 gene locus_tag LOCUS_28500 608653 609924 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038183.1 protein_id gnl|my_center|LOCUS_28500 612289 609983 gene locus_tag LOCUS_28510 612289 609983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 612637 613155 gene locus_tag LOCUS_28520 612637 613155 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206476.1 protein_id gnl|my_center|LOCUS_28520 613204 614187 gene locus_tag LOCUS_28530 613204 614187 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528649.1 protein_id gnl|my_center|LOCUS_28530 614332 615261 gene locus_tag LOCUS_28540 614332 615261 CDS product family 2A encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107594.1 protein_id gnl|my_center|LOCUS_28540 615236 617122 gene locus_tag LOCUS_28550 615236 617122 CDS product family 2A encapsulin nanocompartment cargo protein cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536863.1 protein_id gnl|my_center|LOCUS_28550 617440 617889 gene locus_tag LOCUS_28560 617440 617889 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337622.1 protein_id gnl|my_center|LOCUS_28560 619446 618010 gene locus_tag LOCUS_28570 619446 618010 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121616.1 protein_id gnl|my_center|LOCUS_28570 619851 620741 gene locus_tag LOCUS_28580 gene yghX 619851 620741 CDS product YghX family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350463.1 protein_id gnl|my_center|LOCUS_28580 621381 620800 gene locus_tag LOCUS_28590 621381 620800 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385638.1 protein_id gnl|my_center|LOCUS_28590 621838 622662 gene locus_tag LOCUS_28600 621838 622662 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115024.1 protein_id gnl|my_center|LOCUS_28600 622746 623684 gene locus_tag LOCUS_28610 622746 623684 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815402.1 protein_id gnl|my_center|LOCUS_28610 624346 623726 gene locus_tag LOCUS_28620 624346 623726 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040654.1 protein_id gnl|my_center|LOCUS_28620 625238 624357 gene locus_tag LOCUS_28630 625238 624357 CDS product CmcJ/NvfI family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089189.1 protein_id gnl|my_center|LOCUS_28630 625845 625459 gene locus_tag LOCUS_28640 625845 625459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28640 626557 626027 gene locus_tag LOCUS_28650 626557 626027 CDS product protein-tyrosine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256063.1 protein_id gnl|my_center|LOCUS_28650 627104 626550 gene locus_tag LOCUS_28660 627104 626550 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329713.1 protein_id gnl|my_center|LOCUS_28660 627263 628015 gene locus_tag LOCUS_28670 627263 628015 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206820.1 protein_id gnl|my_center|LOCUS_28670 628174 629043 gene locus_tag LOCUS_28680 628174 629043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 629110 630360 gene locus_tag LOCUS_28690 gene pncB 629110 630360 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225072.1 protein_id gnl|my_center|LOCUS_28690 630387 632090 gene locus_tag LOCUS_28700 630387 632090 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403181.1 protein_id gnl|my_center|LOCUS_28700 632124 633155 gene locus_tag LOCUS_28710 632124 633155 CDS product bifunctional nicotinamide-nucleotide adenylyltransferase/Nudix hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038544.1 protein_id gnl|my_center|LOCUS_28710 634034 633213 gene locus_tag LOCUS_28720 634034 633213 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167226660.1 protein_id gnl|my_center|LOCUS_28720 635685 634123 gene locus_tag LOCUS_28730 gene garD 635685 634123 CDS product galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268905.1 protein_id gnl|my_center|LOCUS_28730 636126 636857 gene locus_tag LOCUS_28740 636126 636857 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918870.1 protein_id gnl|my_center|LOCUS_28740 637048 639741 gene locus_tag LOCUS_28750 637048 639741 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206610.1 protein_id gnl|my_center|LOCUS_28750 640125 641009 gene locus_tag LOCUS_28760 640125 641009 CDS product rhamnogalacturonan acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035400.1 protein_id gnl|my_center|LOCUS_28760 641006 643711 gene locus_tag LOCUS_28770 641006 643711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 643832 645655 gene locus_tag LOCUS_28780 643832 645655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 646847 645921 gene locus_tag LOCUS_28790 646847 645921 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103398.1 protein_id gnl|my_center|LOCUS_28790 648232 646859 gene locus_tag LOCUS_28800 648232 646859 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769494.1 protein_id gnl|my_center|LOCUS_28800 649926 648349 gene locus_tag LOCUS_28810 649926 648349 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539579.1 protein_id gnl|my_center|LOCUS_28810 650960 650049 gene locus_tag LOCUS_28820 gene kdgD 650960 650049 CDS product 5-dehydro-4-deoxyglucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004411794.1 protein_id gnl|my_center|LOCUS_28820 652111 651332 gene locus_tag LOCUS_28830 652111 651332 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243745.1 protein_id gnl|my_center|LOCUS_28830 652615 653190 gene locus_tag LOCUS_28840 652615 653190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 653741 653328 gene locus_tag LOCUS_28850 653741 653328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 654892 653738 gene locus_tag LOCUS_28860 654892 653738 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526016.1 protein_id gnl|my_center|LOCUS_28860 654885 655244 gene locus_tag LOCUS_28870 654885 655244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 656809 655565 gene locus_tag LOCUS_28880 656809 655565 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932090.1 protein_id gnl|my_center|LOCUS_28880 658009 657014 gene locus_tag LOCUS_28890 gene rlmF 658009 657014 CDS product 23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092887.1 protein_id gnl|my_center|LOCUS_28890 658451 659026 gene locus_tag LOCUS_28900 658451 659026 CDS product DUF3455 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088492.1 protein_id gnl|my_center|LOCUS_28900 659735 659055 gene locus_tag LOCUS_28910 659735 659055 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943739.1 protein_id gnl|my_center|LOCUS_28910 661288 659768 gene locus_tag LOCUS_28920 661288 659768 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943740.1 protein_id gnl|my_center|LOCUS_28920 661575 663200 gene locus_tag LOCUS_28930 661575 663200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 663852 663301 gene locus_tag LOCUS_28940 663852 663301 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073032.1 protein_id gnl|my_center|LOCUS_28940 664110 664592 gene locus_tag LOCUS_28950 664110 664592 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709372.1 protein_id gnl|my_center|LOCUS_28950 666102 664750 gene locus_tag LOCUS_28960 666102 664750 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109388.1 protein_id gnl|my_center|LOCUS_28960 669228 666112 gene locus_tag LOCUS_28970 669228 666112 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109387.1 protein_id gnl|my_center|LOCUS_28970 670372 669221 gene locus_tag LOCUS_28980 670372 669221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 670601 671266 gene locus_tag LOCUS_28990 670601 671266 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526208.1 protein_id gnl|my_center|LOCUS_28990 671266 672630 gene locus_tag LOCUS_29000 671266 672630 CDS product sensor histidine kinase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526207.1 protein_id gnl|my_center|LOCUS_29000 673874 672738 gene locus_tag LOCUS_29010 673874 672738 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040791.1 protein_id gnl|my_center|LOCUS_29010 674913 674008 gene locus_tag LOCUS_29020 674913 674008 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808483.1 protein_id gnl|my_center|LOCUS_29020 675055 676386 gene locus_tag LOCUS_29030 gene hmgA 675055 676386 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194851.1 protein_id gnl|my_center|LOCUS_29030 676387 677718 gene locus_tag LOCUS_29040 gene fahA 676387 677718 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818932.1 protein_id gnl|my_center|LOCUS_29040 679498 678773 gene locus_tag LOCUS_29050 679498 678773 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528491.1 protein_id gnl|my_center|LOCUS_29050 680079 679498 gene locus_tag LOCUS_29060 680079 679498 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084991.1 protein_id gnl|my_center|LOCUS_29060 680904 680341 gene locus_tag LOCUS_29070 680904 680341 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705121.1 protein_id gnl|my_center|LOCUS_29070 681128 680940 gene locus_tag LOCUS_29080 681128 680940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 681051 681698 gene locus_tag LOCUS_29090 681051 681698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 682703 681741 gene locus_tag LOCUS_29100 682703 681741 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971003.1 protein_id gnl|my_center|LOCUS_29100 682832 683434 gene locus_tag LOCUS_29110 682832 683434 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549943.1 protein_id gnl|my_center|LOCUS_29110 683589 684494 gene locus_tag LOCUS_29120 683589 684494 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770654.1 protein_id gnl|my_center|LOCUS_29120 684788 685204 gene locus_tag LOCUS_29130 684788 685204 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976297.1 protein_id gnl|my_center|LOCUS_29130 685418 686263 gene locus_tag LOCUS_29140 gene phnC 685418 686263 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104080.1 protein_id gnl|my_center|LOCUS_29140 686292 687272 gene locus_tag LOCUS_29150 gene phnD 686292 687272 CDS product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246947.1 protein_id gnl|my_center|LOCUS_29150 687277 688086 gene locus_tag LOCUS_29160 gene phnE 687277 688086 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091793.1 protein_id gnl|my_center|LOCUS_29160 688137 688724 gene locus_tag LOCUS_29170 688137 688724 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090877.1 protein_id gnl|my_center|LOCUS_29170 690015 688741 gene locus_tag LOCUS_29180 690015 688741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 691220 690015 gene locus_tag LOCUS_29190 691220 690015 CDS product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090672.1 protein_id gnl|my_center|LOCUS_29190 691374 691841 gene locus_tag LOCUS_29200 gene phnG 691374 691841 CDS product phosphonate C-P lyase system protein PhnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267542.1 protein_id gnl|my_center|LOCUS_29200 691838 692464 gene locus_tag LOCUS_29210 gene phnH 691838 692464 CDS product phosphonate C-P lyase system protein PhnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267543.1 protein_id gnl|my_center|LOCUS_29210 692449 693627 gene locus_tag LOCUS_29220 692449 693627 CDS product carbon-phosphorus lyase complex subunit PhnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091786.1 protein_id gnl|my_center|LOCUS_29220 693624 694571 gene locus_tag LOCUS_29230 693624 694571 CDS product alpha-D-ribose 1-methylphosphonate 5-phosphate C-P-lyase PhnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267545.1 protein_id gnl|my_center|LOCUS_29230 694571 695359 gene locus_tag LOCUS_29240 gene phnK 694571 695359 CDS product phosphonate C-P lyase system protein PhnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969858.1 protein_id gnl|my_center|LOCUS_29240 695369 696079 gene locus_tag LOCUS_29250 gene phnL 695369 696079 CDS product phosphonate C-P lyase system protein PhnL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209287.1 protein_id gnl|my_center|LOCUS_29250 696090 697232 gene locus_tag LOCUS_29260 696090 697232 CDS product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194422.1 protein_id gnl|my_center|LOCUS_29260 698234 697293 gene locus_tag LOCUS_29270 gene ttcA 698234 697293 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189298.1 protein_id gnl|my_center|LOCUS_29270 698653 698255 gene locus_tag LOCUS_29280 698653 698255 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199336.1 protein_id gnl|my_center|LOCUS_29280 699471 698668 gene locus_tag LOCUS_29290 699471 698668 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389873.1 protein_id gnl|my_center|LOCUS_29290 699517 700689 gene locus_tag LOCUS_29300 699517 700689 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189567.1 protein_id gnl|my_center|LOCUS_29300 700772 700969 gene locus_tag LOCUS_29310 700772 700969 CDS product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189988.1 protein_id gnl|my_center|LOCUS_29310 701212 702840 gene locus_tag LOCUS_29320 701212 702840 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103766.1 protein_id gnl|my_center|LOCUS_29320 702906 704456 gene locus_tag LOCUS_29330 702906 704456 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521883.1 protein_id gnl|my_center|LOCUS_29330 704539 705192 gene locus_tag LOCUS_29340 704539 705192 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096365.1 protein_id gnl|my_center|LOCUS_29340 706060 705242 gene locus_tag LOCUS_29350 706060 705242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 706429 706067 gene locus_tag LOCUS_29360 gene arsC 706429 706067 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194454.1 protein_id gnl|my_center|LOCUS_29360 707081 706509 gene locus_tag LOCUS_29370 707081 706509 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947367.1 protein_id gnl|my_center|LOCUS_29370 707455 708201 gene locus_tag LOCUS_29380 707455 708201 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337653.1 protein_id gnl|my_center|LOCUS_29380 708873 708241 gene locus_tag LOCUS_29390 708873 708241 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197896.1 protein_id gnl|my_center|LOCUS_29390 709151 709235 gene locus_tag LOCUS_t00570 709151 709235 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 709284 709357 gene locus_tag LOCUS_t00580 709284 709357 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 709392 709466 gene locus_tag LOCUS_t00590 709392 709466 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence033 3237 368 gene locus_tag LOCUS_r00010 3237 368 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3734 3658 gene locus_tag LOCUS_t00600 3734 3658 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 3835 3760 gene locus_tag LOCUS_t00610 3835 3760 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 5446 3922 gene locus_tag LOCUS_r00020 5446 3922 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence034 >Feature sequence035 >Feature sequence036 >Feature sequence037 >Feature sequence038 >Feature sequence039 1478 42 gene locus_tag LOCUS_29400 1478 42 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164993978.1 protein_id gnl|my_center|LOCUS_29400 >Feature sequence040 6 551 gene locus_tag LOCUS_29410 6 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 >Feature sequence041 >Feature sequence042 >Feature sequence043 646 305 gene locus_tag LOCUS_29420 646 305 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038005.1 protein_id gnl|my_center|LOCUS_29420 849 1130 gene locus_tag LOCUS_29430 849 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 1530 1910 gene locus_tag LOCUS_29440 1530 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 2806 2003 gene locus_tag LOCUS_29450 2806 2003 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927097.1 protein_id gnl|my_center|LOCUS_29450 3360 2917 gene locus_tag LOCUS_29460 3360 2917 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887320.1 protein_id gnl|my_center|LOCUS_29460 3661 4212 gene locus_tag LOCUS_29470 3661 4212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195773.1 protein_id gnl|my_center|LOCUS_29470 4964 4752 gene locus_tag LOCUS_29480 4964 4752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 5328 5116 gene locus_tag LOCUS_29490 5328 5116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 5662 5300 gene locus_tag LOCUS_29500 5662 5300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 6517 5738 gene locus_tag LOCUS_29510 6517 5738 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204885.1 protein_id gnl|my_center|LOCUS_29510 7054 7257 gene locus_tag LOCUS_29520 7054 7257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 7753 8007 gene locus_tag LOCUS_29530 7753 8007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 8227 8033 gene locus_tag LOCUS_29540 8227 8033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 8878 8429 gene locus_tag LOCUS_29550 8878 8429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 9559 9362 gene locus_tag LOCUS_29560 9559 9362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 9643 9969 gene locus_tag LOCUS_29570 9643 9969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 10476 10024 gene locus_tag LOCUS_29580 10476 10024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 11449 10832 gene locus_tag LOCUS_29590 11449 10832 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765411.1 protein_id gnl|my_center|LOCUS_29590 15370 11651 gene locus_tag LOCUS_29600 15370 11651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 16156 15716 gene locus_tag LOCUS_29610 16156 15716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 16757 17254 gene locus_tag LOCUS_29620 16757 17254 CDS product spore coat U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024505608.1 protein_id gnl|my_center|LOCUS_29620 17511 18095 gene locus_tag LOCUS_29630 17511 18095 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970922.1 protein_id gnl|my_center|LOCUS_29630 19533 18556 gene locus_tag LOCUS_29640 19533 18556 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268128.1 protein_id gnl|my_center|LOCUS_29640 19740 20756 gene locus_tag LOCUS_29650 19740 20756 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766198.1 protein_id gnl|my_center|LOCUS_29650 21788 20787 gene locus_tag LOCUS_29660 21788 20787 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868968.1 protein_id gnl|my_center|LOCUS_29660 22192 22647 gene locus_tag LOCUS_29670 22192 22647 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224943.1 protein_id gnl|my_center|LOCUS_29670 23268 24359 gene locus_tag LOCUS_29680 23268 24359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 25572 24619 gene locus_tag LOCUS_29690 25572 24619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 25916 27130 gene locus_tag LOCUS_29700 25916 27130 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039059.1 protein_id gnl|my_center|LOCUS_29700 27142 27744 gene locus_tag LOCUS_29710 27142 27744 CDS product SLATT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039060.1 protein_id gnl|my_center|LOCUS_29710 28064 28366 gene locus_tag LOCUS_29720 28064 28366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 31978 29042 gene locus_tag LOCUS_29730 31978 29042 CDS product Tn3-like element Tn3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143760.1 protein_id gnl|my_center|LOCUS_29730 34665 32023 gene locus_tag LOCUS_29740 34665 32023 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467010.1 protein_id gnl|my_center|LOCUS_29740 36901 34859 gene locus_tag LOCUS_29750 36901 34859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 39078 37213 gene locus_tag LOCUS_29760 39078 37213 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967072.1 protein_id gnl|my_center|LOCUS_29760 39419 40396 gene locus_tag LOCUS_29770 39419 40396 CDS product bifunctional helix-turn-helix transcriptional regulator/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049034212.1 protein_id gnl|my_center|LOCUS_29770 41915 40485 gene locus_tag LOCUS_29780 41915 40485 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943221.1 protein_id gnl|my_center|LOCUS_29780 42225 42839 gene locus_tag LOCUS_29790 42225 42839 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037571.1 protein_id gnl|my_center|LOCUS_29790 43243 42986 gene locus_tag LOCUS_29800 43243 42986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 43441 43259 gene locus_tag LOCUS_29810 43441 43259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 43682 43425 gene locus_tag LOCUS_29820 43682 43425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 44728 44240 gene locus_tag LOCUS_29830 44728 44240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 46059 44962 gene locus_tag LOCUS_29840 46059 44962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 47223 46063 gene locus_tag LOCUS_29850 47223 46063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 47422 47225 gene locus_tag LOCUS_29860 47422 47225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 47761 47462 gene locus_tag LOCUS_29870 47761 47462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 48398 47763 gene locus_tag LOCUS_29880 48398 47763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 48703 48395 gene locus_tag LOCUS_29890 48703 48395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 49490 49290 gene locus_tag LOCUS_29900 49490 49290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 49728 49477 gene locus_tag LOCUS_29910 49728 49477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 50035 49721 gene locus_tag LOCUS_29920 50035 49721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 51107 50037 gene locus_tag LOCUS_29930 51107 50037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 51296 51117 gene locus_tag LOCUS_29940 51296 51117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 51499 51305 gene locus_tag LOCUS_29950 51499 51305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 51693 51538 gene locus_tag LOCUS_29960 51693 51538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 51779 52171 gene locus_tag LOCUS_29970 51779 52171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 52492 52313 gene locus_tag LOCUS_29980 52492 52313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 52868 52602 gene locus_tag LOCUS_29990 52868 52602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 53999 53778 gene locus_tag LOCUS_30000 53999 53778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 54774 54319 gene locus_tag LOCUS_30010 54774 54319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 55863 54973 gene locus_tag LOCUS_30020 55863 54973 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530541.1 protein_id gnl|my_center|LOCUS_30020 55965 56957 gene locus_tag LOCUS_30030 55965 56957 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817250.1 protein_id gnl|my_center|LOCUS_30030 56967 57548 gene locus_tag LOCUS_30040 56967 57548 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642965.1 protein_id gnl|my_center|LOCUS_30040 57670 58497 gene locus_tag LOCUS_30050 57670 58497 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101946.1 protein_id gnl|my_center|LOCUS_30050 59080 58511 gene locus_tag LOCUS_30060 59080 58511 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093058.1 protein_id gnl|my_center|LOCUS_30060 59191 59913 gene locus_tag LOCUS_30070 59191 59913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 60924 60025 gene locus_tag LOCUS_30080 60924 60025 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035570.1 protein_id gnl|my_center|LOCUS_30080 61035 63359 gene locus_tag LOCUS_30090 gene metE 61035 63359 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114925.1 protein_id gnl|my_center|LOCUS_30090 63473 64168 gene locus_tag LOCUS_30100 63473 64168 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810571.1 protein_id gnl|my_center|LOCUS_30100 64207 64884 gene locus_tag LOCUS_30110 64207 64884 CDS product HD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387978.1 protein_id gnl|my_center|LOCUS_30110 65499 64924 gene locus_tag LOCUS_30120 65499 64924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 65624 65830 gene locus_tag LOCUS_30130 65624 65830 CDS product ParD-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209417.1 protein_id gnl|my_center|LOCUS_30130 65833 66600 gene locus_tag LOCUS_30140 gene map 65833 66600 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114411.1 protein_id gnl|my_center|LOCUS_30140 66954 66643 gene locus_tag LOCUS_30150 66954 66643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 68653 66947 gene locus_tag LOCUS_30160 68653 66947 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065178.1 protein_id gnl|my_center|LOCUS_30160 68974 68669 gene locus_tag LOCUS_30170 68974 68669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 71429 68979 gene locus_tag LOCUS_30180 gene fpvA 71429 68979 CDS product ferripyoverdine/pyocin S3 receptor FpvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004349900.1 protein_id gnl|my_center|LOCUS_30180 71816 72742 gene locus_tag LOCUS_30190 71816 72742 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388634.1 protein_id gnl|my_center|LOCUS_30190 74522 72765 gene locus_tag LOCUS_30200 74522 72765 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387947.1 protein_id gnl|my_center|LOCUS_30200 76354 74522 gene locus_tag LOCUS_30210 76354 74522 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470594.1 protein_id gnl|my_center|LOCUS_30210 77565 76354 gene locus_tag LOCUS_30220 77565 76354 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968431.1 protein_id gnl|my_center|LOCUS_30220 79220 77562 gene locus_tag LOCUS_30230 79220 77562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 80527 79217 gene locus_tag LOCUS_30240 80527 79217 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014530006.1 protein_id gnl|my_center|LOCUS_30240 82602 80548 gene locus_tag LOCUS_30250 82602 80548 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388635.1 protein_id gnl|my_center|LOCUS_30250 82812 95687 gene locus_tag LOCUS_30260 82812 95687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 95773 102888 gene locus_tag LOCUS_30270 95773 102888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 102881 104041 gene locus_tag LOCUS_30280 102881 104041 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211390.1 protein_id gnl|my_center|LOCUS_30280 104038 105744 gene locus_tag LOCUS_30290 104038 105744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 105756 106439 gene locus_tag LOCUS_30300 105756 106439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 107602 106496 gene locus_tag LOCUS_30310 107602 106496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 108840 107881 gene locus_tag LOCUS_30320 108840 107881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 110939 108978 gene locus_tag LOCUS_30330 110939 108978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 116368 110939 gene locus_tag LOCUS_30340 116368 110939 CDS product multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941907.1 protein_id gnl|my_center|LOCUS_30340 116935 118398 gene locus_tag LOCUS_30350 116935 118398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 119338 118727 gene locus_tag LOCUS_30360 119338 118727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 119862 120734 gene locus_tag LOCUS_30370 119862 120734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 121172 120738 gene locus_tag LOCUS_30380 121172 120738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 122100 121189 gene locus_tag LOCUS_30390 122100 121189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 123141 122158 gene locus_tag LOCUS_30400 123141 122158 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176762490.1 protein_id gnl|my_center|LOCUS_30400 124394 123138 gene locus_tag LOCUS_30410 gene eboE 124394 123138 CDS product metabolite traffic protein EboE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368548.1 protein_id gnl|my_center|LOCUS_30410 125703 124408 gene locus_tag LOCUS_30420 125703 124408 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110716881.1 protein_id gnl|my_center|LOCUS_30420 126040 125870 gene locus_tag LOCUS_30430 126040 125870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 126705 128093 gene locus_tag LOCUS_30440 126705 128093 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368546.1 protein_id gnl|my_center|LOCUS_30440 128112 129233 gene locus_tag LOCUS_30450 128112 129233 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368544.1 protein_id gnl|my_center|LOCUS_30450 130211 129426 gene locus_tag LOCUS_30460 130211 129426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 131382 130156 gene locus_tag LOCUS_30470 131382 130156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 132131 131505 gene locus_tag LOCUS_30480 132131 131505 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037326.1 protein_id gnl|my_center|LOCUS_30480 135156 132190 gene locus_tag LOCUS_30490 135156 132190 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037325.1 protein_id gnl|my_center|LOCUS_30490 135290 136207 gene locus_tag LOCUS_30500 135290 136207 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731487.1 protein_id gnl|my_center|LOCUS_30500 136289 137080 gene locus_tag LOCUS_30510 136289 137080 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088129.1 protein_id gnl|my_center|LOCUS_30510 138013 137348 gene locus_tag LOCUS_30520 138013 137348 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036955.1 protein_id gnl|my_center|LOCUS_30520 141112 138020 gene locus_tag LOCUS_30530 141112 138020 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531051.1 protein_id gnl|my_center|LOCUS_30530 142290 141109 gene locus_tag LOCUS_30540 142290 141109 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531050.1 protein_id gnl|my_center|LOCUS_30540 143703 142372 gene locus_tag LOCUS_30550 143703 142372 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190128.1 protein_id gnl|my_center|LOCUS_30550 144386 143724 gene locus_tag LOCUS_30560 144386 143724 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189255.1 protein_id gnl|my_center|LOCUS_30560 144685 145482 gene locus_tag LOCUS_30570 144685 145482 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192698.1 protein_id gnl|my_center|LOCUS_30570 145560 145943 gene locus_tag LOCUS_30580 145560 145943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193824.1 protein_id gnl|my_center|LOCUS_30580 146043 146477 gene locus_tag LOCUS_30590 146043 146477 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088026.1 protein_id gnl|my_center|LOCUS_30590 146760 147440 gene locus_tag LOCUS_30600 gene ybiX 146760 147440 CDS product PKHD-type hydroxylase YbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990151.1 protein_id gnl|my_center|LOCUS_30600 147640 148866 gene locus_tag LOCUS_30610 147640 148866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 148866 151037 gene locus_tag LOCUS_30620 148866 151037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 151155 151544 gene locus_tag LOCUS_30630 151155 151544 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205349.1 protein_id gnl|my_center|LOCUS_30630 153823 151661 gene locus_tag LOCUS_30640 153823 151661 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071328.1 protein_id gnl|my_center|LOCUS_30640 154264 154061 gene locus_tag LOCUS_30650 154264 154061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 154250 156361 gene locus_tag LOCUS_30660 154250 156361 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103628.1 protein_id gnl|my_center|LOCUS_30660 156941 158749 gene locus_tag LOCUS_30670 156941 158749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 158825 161380 gene locus_tag LOCUS_30680 gene hypF 158825 161380 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107668.1 protein_id gnl|my_center|LOCUS_30680 161391 161669 gene locus_tag LOCUS_30690 gene hypC 161391 161669 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338277.1 protein_id gnl|my_center|LOCUS_30690 161700 162422 gene locus_tag LOCUS_30700 161700 162422 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225648.1 protein_id gnl|my_center|LOCUS_30700 162409 163563 gene locus_tag LOCUS_30710 gene hypD 162409 163563 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728537.1 protein_id gnl|my_center|LOCUS_30710 163560 164675 gene locus_tag LOCUS_30720 gene hypE 163560 164675 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720673.1 protein_id gnl|my_center|LOCUS_30720 164722 165333 gene locus_tag LOCUS_30730 164722 165333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 165333 166238 gene locus_tag LOCUS_30740 165333 166238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 166300 167109 gene locus_tag LOCUS_30750 166300 167109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 167161 169002 gene locus_tag LOCUS_30760 167161 169002 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894103.1 protein_id gnl|my_center|LOCUS_30760 170469 169051 gene locus_tag LOCUS_30770 170469 169051 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109152.1 protein_id gnl|my_center|LOCUS_30770 171258 170512 gene locus_tag LOCUS_30780 171258 170512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 172196 171279 gene locus_tag LOCUS_30790 172196 171279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 172694 173923 gene locus_tag LOCUS_30800 172694 173923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 174690 174025 gene locus_tag LOCUS_30810 174690 174025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 174811 175710 gene locus_tag LOCUS_30820 174811 175710 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103676442.1 protein_id gnl|my_center|LOCUS_30820 176098 175784 gene locus_tag LOCUS_30830 gene rhaM 176098 175784 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391995.1 protein_id gnl|my_center|LOCUS_30830 177327 176116 gene locus_tag LOCUS_30840 177327 176116 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767206.1 protein_id gnl|my_center|LOCUS_30840 178813 177365 gene locus_tag LOCUS_30850 178813 177365 CDS product glycosyl hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303183.1 protein_id gnl|my_center|LOCUS_30850 181485 178810 gene locus_tag LOCUS_30860 181485 178810 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776932.1 protein_id gnl|my_center|LOCUS_30860 183039 181744 gene locus_tag LOCUS_30870 gene rhaI 183039 181744 CDS product L-rhamnose catabolism isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533596.1 protein_id gnl|my_center|LOCUS_30870 185215 183107 gene locus_tag LOCUS_30880 185215 183107 CDS product bifunctional rhamnulose-1-phosphate aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968714.1 protein_id gnl|my_center|LOCUS_30880 185604 186470 gene locus_tag LOCUS_30890 185604 186470 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533598.1 protein_id gnl|my_center|LOCUS_30890 186509 187471 gene locus_tag LOCUS_30900 gene rhaS 186509 187471 CDS product rhamnose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973083.1 protein_id gnl|my_center|LOCUS_30900 187619 189190 gene locus_tag LOCUS_30910 187619 189190 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974436.1 protein_id gnl|my_center|LOCUS_30910 189187 190206 gene locus_tag LOCUS_30920 189187 190206 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241393.1 protein_id gnl|my_center|LOCUS_30920 190203 191219 gene locus_tag LOCUS_30930 190203 191219 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973086.1 protein_id gnl|my_center|LOCUS_30930 191221 192633 gene locus_tag LOCUS_30940 191221 192633 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533604.1 protein_id gnl|my_center|LOCUS_30940 194557 192710 gene locus_tag LOCUS_30950 194557 192710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 197995 194825 gene locus_tag LOCUS_30960 197995 194825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 199349 198402 gene locus_tag LOCUS_30970 199349 198402 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036922.1 protein_id gnl|my_center|LOCUS_30970 200187 199381 gene locus_tag LOCUS_30980 200187 199381 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538762.1 protein_id gnl|my_center|LOCUS_30980 201203 200184 gene locus_tag LOCUS_30990 gene araH 201203 200184 CDS product L-arabinose ABC transporter permease AraH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195084.1 protein_id gnl|my_center|LOCUS_30990 202739 201222 gene locus_tag LOCUS_31000 gene araG 202739 201222 CDS product L-arabinose ABC transporter ATP-binding protein AraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938735.1 protein_id gnl|my_center|LOCUS_31000 203769 202753 gene locus_tag LOCUS_31010 203769 202753 CDS product arabinose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194073.1 protein_id gnl|my_center|LOCUS_31010 204803 203766 gene locus_tag LOCUS_31020 204803 203766 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036919.1 protein_id gnl|my_center|LOCUS_31020 205684 205028 gene locus_tag LOCUS_31030 205684 205028 CDS product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267366.1 protein_id gnl|my_center|LOCUS_31030 206755 205727 gene locus_tag LOCUS_31040 206755 205727 CDS product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495856.1 protein_id gnl|my_center|LOCUS_31040 207852 206749 gene locus_tag LOCUS_31050 gene dgoD 207852 206749 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703894.1 protein_id gnl|my_center|LOCUS_31050 209554 208055 gene locus_tag LOCUS_31060 209554 208055 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582721.1 protein_id gnl|my_center|LOCUS_31060 211491 209821 gene locus_tag LOCUS_31070 211491 209821 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918459.1 protein_id gnl|my_center|LOCUS_31070 211942 212199 gene locus_tag LOCUS_31080 211942 212199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 212153 216049 gene locus_tag LOCUS_31090 212153 216049 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226283.1 protein_id gnl|my_center|LOCUS_31090 216073 217974 gene locus_tag LOCUS_31100 gene rhgW 216073 217974 CDS product rhamnogalacturonan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886436.1 protein_id gnl|my_center|LOCUS_31100 218076 220841 gene locus_tag LOCUS_31110 218076 220841 CDS product Tat pathway signal sequence domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136207739.1 protein_id gnl|my_center|LOCUS_31110 221252 223708 gene locus_tag LOCUS_31120 221252 223708 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918700.1 protein_id gnl|my_center|LOCUS_31120 223923 225173 gene locus_tag LOCUS_31130 223923 225173 CDS product rhamnogalacturonan acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109136.1 protein_id gnl|my_center|LOCUS_31130 225231 226100 gene locus_tag LOCUS_31140 225231 226100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 226140 226847 gene locus_tag LOCUS_31150 226140 226847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 227382 226903 gene locus_tag LOCUS_31160 227382 226903 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930798.1 protein_id gnl|my_center|LOCUS_31160 228760 227543 gene locus_tag LOCUS_31170 gene hmpA 228760 227543 CDS product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040024.1 protein_id gnl|my_center|LOCUS_31170 229517 228954 gene locus_tag LOCUS_31180 229517 228954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 229877 229803 gene locus_tag LOCUS_t00620 229877 229803 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 230181 229945 gene locus_tag LOCUS_31190 230181 229945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 230347 230264 gene locus_tag LOCUS_t00630 230347 230264 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 230856 230668 gene locus_tag LOCUS_31200 230856 230668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 232104 231154 gene locus_tag LOCUS_31210 232104 231154 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083105.1 protein_id gnl|my_center|LOCUS_31210 232210 232701 gene locus_tag LOCUS_31220 232210 232701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229734.1 protein_id gnl|my_center|LOCUS_31220 233207 232809 gene locus_tag LOCUS_31230 233207 232809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 233630 234712 gene locus_tag LOCUS_31240 233630 234712 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064349.1 protein_id gnl|my_center|LOCUS_31240 234875 235819 gene locus_tag LOCUS_31250 234875 235819 CDS product DedA family protein/thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190574.1 protein_id gnl|my_center|LOCUS_31250 236776 235880 gene locus_tag LOCUS_31260 236776 235880 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529142.1 protein_id gnl|my_center|LOCUS_31260 236874 237929 gene locus_tag LOCUS_31270 236874 237929 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972130.1 protein_id gnl|my_center|LOCUS_31270 238751 237873 gene locus_tag LOCUS_31280 238751 237873 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763106.1 protein_id gnl|my_center|LOCUS_31280 239478 238780 gene locus_tag LOCUS_31290 gene urtE 239478 238780 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112317.1 protein_id gnl|my_center|LOCUS_31290 240357 239500 gene locus_tag LOCUS_31300 gene urtD 240357 239500 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376420.1 protein_id gnl|my_center|LOCUS_31300 241457 240354 gene locus_tag LOCUS_31310 gene urtC 241457 240354 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522271.1 protein_id gnl|my_center|LOCUS_31310 243052 241454 gene locus_tag LOCUS_31320 gene urtB 243052 241454 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535962.1 protein_id gnl|my_center|LOCUS_31320 244428 243175 gene locus_tag LOCUS_31330 gene urtA 244428 243175 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269025.1 protein_id gnl|my_center|LOCUS_31330 245448 244801 gene locus_tag LOCUS_31340 245448 244801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 247070 245508 gene locus_tag LOCUS_31350 247070 245508 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109491.1 protein_id gnl|my_center|LOCUS_31350 248810 247122 gene locus_tag LOCUS_31360 248810 247122 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113972.1 protein_id gnl|my_center|LOCUS_31360 250417 248807 gene locus_tag LOCUS_31370 250417 248807 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113971.1 protein_id gnl|my_center|LOCUS_31370 250654 251709 gene locus_tag LOCUS_31380 250654 251709 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207125.1 protein_id gnl|my_center|LOCUS_31380 252287 251952 gene locus_tag LOCUS_31390 252287 251952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 253113 253346 gene locus_tag LOCUS_31400 253113 253346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 253532 254128 gene locus_tag LOCUS_31410 253532 254128 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017018676.1 protein_id gnl|my_center|LOCUS_31410 254520 255095 gene locus_tag LOCUS_31420 254520 255095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 255103 255993 gene locus_tag LOCUS_31430 255103 255993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 256011 257546 gene locus_tag LOCUS_31440 256011 257546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 257678 258094 gene locus_tag LOCUS_31450 257678 258094 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941643.1 protein_id gnl|my_center|LOCUS_31450 258108 258599 gene locus_tag LOCUS_31460 258108 258599 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941646.1 protein_id gnl|my_center|LOCUS_31460 258614 258778 gene locus_tag LOCUS_31470 258614 258778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 258781 259485 gene locus_tag LOCUS_31480 258781 259485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 259540 261330 gene locus_tag LOCUS_31490 259540 261330 CDS product VgrG-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226667.1 protein_id gnl|my_center|LOCUS_31490 261345 261644 gene locus_tag LOCUS_31500 261345 261644 CDS product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226572031.1 protein_id gnl|my_center|LOCUS_31500 261660 262079 gene locus_tag LOCUS_31510 261660 262079 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941652.1 protein_id gnl|my_center|LOCUS_31510 262095 265841 gene locus_tag LOCUS_31520 262095 265841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 265865 266659 gene locus_tag LOCUS_31530 265865 266659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 266667 266963 gene locus_tag LOCUS_31540 266667 266963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 266953 269454 gene locus_tag LOCUS_31550 266953 269454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 269451 276935 gene locus_tag LOCUS_31560 269451 276935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 276965 278305 gene locus_tag LOCUS_31570 276965 278305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 278779 281664 gene locus_tag LOCUS_31580 278779 281664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 282328 281762 gene locus_tag LOCUS_31590 282328 281762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 283553 282402 gene locus_tag LOCUS_31600 283553 282402 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195762.1 protein_id gnl|my_center|LOCUS_31600 284868 283885 gene locus_tag LOCUS_31610 284868 283885 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406407.1 protein_id gnl|my_center|LOCUS_31610 285016 285771 gene locus_tag LOCUS_31620 285016 285771 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388409.1 protein_id gnl|my_center|LOCUS_31620 285768 287051 gene locus_tag LOCUS_31630 285768 287051 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196258.1 protein_id gnl|my_center|LOCUS_31630 287056 288021 gene locus_tag LOCUS_31640 287056 288021 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929758.1 protein_id gnl|my_center|LOCUS_31640 288231 288929 gene locus_tag LOCUS_31650 288231 288929 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918870.1 protein_id gnl|my_center|LOCUS_31650 289199 291172 gene locus_tag LOCUS_31660 289199 291172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 292324 291308 gene locus_tag LOCUS_31670 292324 291308 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035256280.1 protein_id gnl|my_center|LOCUS_31670 292432 293319 gene locus_tag LOCUS_31680 292432 293319 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971057.1 protein_id gnl|my_center|LOCUS_31680 294254 293340 gene locus_tag LOCUS_31690 294254 293340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 294830 296236 gene locus_tag LOCUS_31700 294830 296236 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109152.1 protein_id gnl|my_center|LOCUS_31700 296252 297496 gene locus_tag LOCUS_31710 296252 297496 CDS product DUF4861 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762841.1 protein_id gnl|my_center|LOCUS_31710 298856 297597 gene locus_tag LOCUS_31720 298856 297597 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120385.1 protein_id gnl|my_center|LOCUS_31720 302063 299109 gene locus_tag LOCUS_31730 302063 299109 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035377.1 protein_id gnl|my_center|LOCUS_31730 302621 303202 gene locus_tag LOCUS_31740 302621 303202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 304206 303388 gene locus_tag LOCUS_31750 304206 303388 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093947370.1 protein_id gnl|my_center|LOCUS_31750 305377 304316 gene locus_tag LOCUS_31760 305377 304316 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037941.1 protein_id gnl|my_center|LOCUS_31760 306505 306098 gene locus_tag LOCUS_31770 306505 306098 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942420.1 protein_id gnl|my_center|LOCUS_31770 306950 306480 gene locus_tag LOCUS_31780 306950 306480 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942421.1 protein_id gnl|my_center|LOCUS_31780 308811 306952 gene locus_tag LOCUS_31790 308811 306952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 309290 308817 gene locus_tag LOCUS_31800 309290 308817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 309847 309290 gene locus_tag LOCUS_31810 309847 309290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 310404 309844 gene locus_tag LOCUS_31820 310404 309844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 311006 310401 gene locus_tag LOCUS_31830 311006 310401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 312696 311044 gene locus_tag LOCUS_31840 312696 311044 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942427.1 protein_id gnl|my_center|LOCUS_31840 313958 312777 gene locus_tag LOCUS_31850 313958 312777 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942428.1 protein_id gnl|my_center|LOCUS_31850 314432 313986 gene locus_tag LOCUS_31860 gene gspG 314432 313986 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088760.1 protein_id gnl|my_center|LOCUS_31860 314922 317207 gene locus_tag LOCUS_31870 314922 317207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 317689 319239 gene locus_tag LOCUS_31880 317689 319239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 319870 319259 gene locus_tag LOCUS_31890 319870 319259 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929111.1 protein_id gnl|my_center|LOCUS_31890 319982 320983 gene locus_tag LOCUS_31900 319982 320983 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395757.1 protein_id gnl|my_center|LOCUS_31900 321631 321933 gene locus_tag LOCUS_31910 321631 321933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 324870 322111 gene locus_tag LOCUS_31920 324870 322111 CDS product ligand-binding sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076055427.1 protein_id gnl|my_center|LOCUS_31920 325528 325941 gene locus_tag LOCUS_31930 325528 325941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 326159 326347 gene locus_tag LOCUS_31940 326159 326347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 326331 326630 gene locus_tag LOCUS_31950 326331 326630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 326766 327065 gene locus_tag LOCUS_31960 326766 327065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 327844 327296 gene locus_tag LOCUS_31970 327844 327296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 329549 331462 gene locus_tag LOCUS_31980 329549 331462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 331459 332868 gene locus_tag LOCUS_31990 331459 332868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31990 332928 335369 gene locus_tag LOCUS_32000 332928 335369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 335579 335992 gene locus_tag LOCUS_32010 335579 335992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 336315 336569 gene locus_tag LOCUS_32020 336315 336569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 336609 336866 gene locus_tag LOCUS_32030 336609 336866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 336880 337062 gene locus_tag LOCUS_32040 336880 337062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186946547.1 protein_id gnl|my_center|LOCUS_32040 337164 337550 gene locus_tag LOCUS_32050 337164 337550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 337627 338025 gene locus_tag LOCUS_32060 337627 338025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 338375 338100 gene locus_tag LOCUS_32070 338375 338100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 338435 338809 gene locus_tag LOCUS_32080 338435 338809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 339807 339718 gene locus_tag LOCUS_t00640 339807 339718 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 341867 339849 gene locus_tag LOCUS_32090 341867 339849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 343021 341870 gene locus_tag LOCUS_32100 343021 341870 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460337.1 protein_id gnl|my_center|LOCUS_32100 344583 343324 gene locus_tag LOCUS_32110 gene hemW 344583 343324 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186023.1 protein_id gnl|my_center|LOCUS_32110 345164 344580 gene locus_tag LOCUS_32120 gene rdgB 345164 344580 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687551.1 protein_id gnl|my_center|LOCUS_32120 345915 345178 gene locus_tag LOCUS_32130 gene rph 345915 345178 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186400.1 protein_id gnl|my_center|LOCUS_32130 346856 345921 gene locus_tag LOCUS_32140 346856 345921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 347969 346959 gene locus_tag LOCUS_32150 347969 346959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 348112 349014 gene locus_tag LOCUS_32160 348112 349014 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185526.1 protein_id gnl|my_center|LOCUS_32160 349156 349800 gene locus_tag LOCUS_32170 gene gmk 349156 349800 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185877.1 protein_id gnl|my_center|LOCUS_32170 349873 350076 gene locus_tag LOCUS_32180 gene rpoZ 349873 350076 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185855.1 protein_id gnl|my_center|LOCUS_32180 350160 352454 gene locus_tag LOCUS_32190 350160 352454 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194871.1 protein_id gnl|my_center|LOCUS_32190 353064 352516 gene locus_tag LOCUS_32200 gene greB 353064 352516 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812405.1 protein_id gnl|my_center|LOCUS_32200 353296 353943 gene locus_tag LOCUS_32210 gene rqpR 353296 353943 CDS product response regulator transcription factor RqpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197176.1 protein_id gnl|my_center|LOCUS_32210 354031 355677 gene locus_tag LOCUS_32220 354031 355677 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035660.1 protein_id gnl|my_center|LOCUS_32220 356507 355758 gene locus_tag LOCUS_32230 356507 355758 CDS product cephalosporin hydroxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526207.1 protein_id gnl|my_center|LOCUS_32230 357337 356504 gene locus_tag LOCUS_32240 357337 356504 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976075.1 protein_id gnl|my_center|LOCUS_32240 357822 357334 gene locus_tag LOCUS_32250 357822 357334 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395949.1 protein_id gnl|my_center|LOCUS_32250 359118 357892 gene locus_tag LOCUS_32260 359118 357892 CDS product methyltransferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707820.1 protein_id gnl|my_center|LOCUS_32260 359684 359115 gene locus_tag LOCUS_32270 359684 359115 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707821.1 protein_id gnl|my_center|LOCUS_32270 360825 359713 gene locus_tag LOCUS_32280 gene rfbG 360825 359713 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174704169.1 protein_id gnl|my_center|LOCUS_32280 361610 360840 gene locus_tag LOCUS_32290 gene rfbF 361610 360840 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545825.1 protein_id gnl|my_center|LOCUS_32290 363778 361607 gene locus_tag LOCUS_32300 363778 361607 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088369.1 protein_id gnl|my_center|LOCUS_32300 364277 365764 gene locus_tag LOCUS_32310 364277 365764 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947070.1 protein_id gnl|my_center|LOCUS_32310 365865 366248 gene locus_tag LOCUS_32320 365865 366248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 366366 368378 gene locus_tag LOCUS_32330 366366 368378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 368432 368902 gene locus_tag LOCUS_32340 gene fliS 368432 368902 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203429.1 protein_id gnl|my_center|LOCUS_32340 368909 369244 gene locus_tag LOCUS_32350 368909 369244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 369250 370599 gene locus_tag LOCUS_32360 369250 370599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 370592 370900 gene locus_tag LOCUS_32370 370592 370900 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811829.1 protein_id gnl|my_center|LOCUS_32370 370934 371695 gene locus_tag LOCUS_32380 370934 371695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 372171 371806 gene locus_tag LOCUS_32390 gene fliE 372171 371806 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274299.1 protein_id gnl|my_center|LOCUS_32390 372374 374068 gene locus_tag LOCUS_32400 gene fliF 372374 374068 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523066.1 protein_id gnl|my_center|LOCUS_32400 374061 375056 gene locus_tag LOCUS_32410 gene fliG 374061 375056 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197167.1 protein_id gnl|my_center|LOCUS_32410 375049 375729 gene locus_tag LOCUS_32420 gene fliH 375049 375729 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556525.1 protein_id gnl|my_center|LOCUS_32420 375740 377131 gene locus_tag LOCUS_32430 gene fliI 375740 377131 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197164.1 protein_id gnl|my_center|LOCUS_32430 377164 377604 gene locus_tag LOCUS_32440 gene fliJ 377164 377604 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097733.1 protein_id gnl|my_center|LOCUS_32440 377629 379248 gene locus_tag LOCUS_32450 377629 379248 CDS product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204243.1 protein_id gnl|my_center|LOCUS_32450 379583 379407 gene locus_tag LOCUS_32460 379583 379407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 379673 380182 gene locus_tag LOCUS_32470 379673 380182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 380186 381187 gene locus_tag LOCUS_32480 gene fliM 380186 381187 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196784.1 protein_id gnl|my_center|LOCUS_32480 381180 381602 gene locus_tag LOCUS_32490 gene fliN 381180 381602 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184995.1 protein_id gnl|my_center|LOCUS_32490 381599 382039 gene locus_tag LOCUS_32500 381599 382039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 382050 382817 gene locus_tag LOCUS_32510 gene fliP 382050 382817 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160406.1 protein_id gnl|my_center|LOCUS_32510 382837 383106 gene locus_tag LOCUS_32520 gene fliQ 382837 383106 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160414.1 protein_id gnl|my_center|LOCUS_32520 383143 383970 gene locus_tag LOCUS_32530 gene fliR 383143 383970 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201278.1 protein_id gnl|my_center|LOCUS_32530 383977 385533 gene locus_tag LOCUS_32540 383977 385533 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193193.1 protein_id gnl|my_center|LOCUS_32540 386503 385757 gene locus_tag LOCUS_32550 gene cysE 386503 385757 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193377.1 protein_id gnl|my_center|LOCUS_32550 387357 386617 gene locus_tag LOCUS_32560 gene rlmB 387357 386617 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191786.1 protein_id gnl|my_center|LOCUS_32560 389889 387379 gene locus_tag LOCUS_32570 gene rnr 389889 387379 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550537.1 protein_id gnl|my_center|LOCUS_32570 390049 390133 gene locus_tag LOCUS_t00650 390049 390133 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 390403 390487 gene locus_tag LOCUS_t00660 390403 390487 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 391232 390693 gene locus_tag LOCUS_32580 391232 390693 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527158.1 protein_id gnl|my_center|LOCUS_32580 392562 391249 gene locus_tag LOCUS_32590 392562 391249 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534924.1 protein_id gnl|my_center|LOCUS_32590 393717 392566 gene locus_tag LOCUS_32600 393717 392566 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192327.1 protein_id gnl|my_center|LOCUS_32600 394718 393816 gene locus_tag LOCUS_32610 gene hflC 394718 393816 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810713.1 protein_id gnl|my_center|LOCUS_32610 395966 394719 gene locus_tag LOCUS_32620 gene hflK 395966 394719 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930788.1 protein_id gnl|my_center|LOCUS_32620 397161 396034 gene locus_tag LOCUS_32630 gene hflX 397161 396034 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191816.1 protein_id gnl|my_center|LOCUS_32630 397433 397197 gene locus_tag LOCUS_32640 gene hfq 397433 397197 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192796.1 protein_id gnl|my_center|LOCUS_32640 398925 397585 gene locus_tag LOCUS_32650 gene der 398925 397585 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192452.1 protein_id gnl|my_center|LOCUS_32650 400091 398934 gene locus_tag LOCUS_32660 gene bamB 400091 398934 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810701.1 protein_id gnl|my_center|LOCUS_32660 400760 400104 gene locus_tag LOCUS_32670 400760 400104 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193441.1 protein_id gnl|my_center|LOCUS_32670 402173 400812 gene locus_tag LOCUS_32680 gene hisS 402173 400812 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521334.1 protein_id gnl|my_center|LOCUS_32680 403465 402188 gene locus_tag LOCUS_32690 gene ispG 403465 402188 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527159.1 protein_id gnl|my_center|LOCUS_32690 404538 403468 gene locus_tag LOCUS_32700 404538 403468 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193926.1 protein_id gnl|my_center|LOCUS_32700 405340 404546 gene locus_tag LOCUS_32710 gene pilW 405340 404546 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688950.1 protein_id gnl|my_center|LOCUS_32710 406509 405352 gene locus_tag LOCUS_32720 gene rlmN 406509 405352 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192451.1 protein_id gnl|my_center|LOCUS_32720 407014 406589 gene locus_tag LOCUS_32730 gene ndk 407014 406589 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193561.1 protein_id gnl|my_center|LOCUS_32730 408577 407243 gene locus_tag LOCUS_32740 gene rlmD 408577 407243 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192701.1 protein_id gnl|my_center|LOCUS_32740 409841 408774 gene locus_tag LOCUS_32750 gene rpoS 409841 408774 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193640.1 protein_id gnl|my_center|LOCUS_32750 410925 409981 gene locus_tag LOCUS_32760 410925 409981 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192107.1 protein_id gnl|my_center|LOCUS_32760 411859 410972 gene locus_tag LOCUS_32770 411859 410972 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531391.1 protein_id gnl|my_center|LOCUS_32770 412593 411856 gene locus_tag LOCUS_32780 gene surE 412593 411856 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930526.1 protein_id gnl|my_center|LOCUS_32780 412699 413679 gene locus_tag LOCUS_32790 412699 413679 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479781.1 protein_id gnl|my_center|LOCUS_32790 415121 413811 gene locus_tag LOCUS_32800 415121 413811 CDS product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113015.1 protein_id gnl|my_center|LOCUS_32800 416002 415199 gene locus_tag LOCUS_32810 416002 415199 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947427.1 protein_id gnl|my_center|LOCUS_32810 416640 415999 gene locus_tag LOCUS_32820 416640 415999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 417872 416652 gene locus_tag LOCUS_32830 gene gspF 417872 416652 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196821.1 protein_id gnl|my_center|LOCUS_32830 419315 417885 gene locus_tag LOCUS_32840 gene gspE 419315 417885 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196824.1 protein_id gnl|my_center|LOCUS_32840 421455 419323 gene locus_tag LOCUS_32850 gene gspD 421455 419323 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009315212.1 protein_id gnl|my_center|LOCUS_32850 422264 421485 gene locus_tag LOCUS_32860 422264 421485 CDS product type II secretion system protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196795.1 protein_id gnl|my_center|LOCUS_32860 422780 422280 gene locus_tag LOCUS_32870 422780 422280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 424039 422780 gene locus_tag LOCUS_32880 424039 422780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 425061 424048 gene locus_tag LOCUS_32890 gene gspK 425061 424048 CDS product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204164.1 protein_id gnl|my_center|LOCUS_32890 425708 425058 gene locus_tag LOCUS_32900 425708 425058 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185018.1 protein_id gnl|my_center|LOCUS_32900 426099 425722 gene locus_tag LOCUS_32910 gene gspI 426099 425722 CDS product type II secretion system minor pseudopilin GspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204729.1 protein_id gnl|my_center|LOCUS_32910 426565 426101 gene locus_tag LOCUS_32920 426565 426101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 427036 426575 gene locus_tag LOCUS_32930 gene gspG 427036 426575 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196811.1 protein_id gnl|my_center|LOCUS_32930 429558 427300 gene locus_tag LOCUS_32940 429558 427300 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532900.1 protein_id gnl|my_center|LOCUS_32940 429808 429608 gene locus_tag LOCUS_32950 429808 429608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 430058 430708 gene locus_tag LOCUS_32960 gene elbB 430058 430708 CDS product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704213.1 protein_id gnl|my_center|LOCUS_32960 430836 431435 gene locus_tag LOCUS_32970 430836 431435 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194061.1 protein_id gnl|my_center|LOCUS_32970 432801 431551 gene locus_tag LOCUS_32980 432801 431551 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809576.1 protein_id gnl|my_center|LOCUS_32980 433494 432829 gene locus_tag LOCUS_32990 433494 432829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531332.1 protein_id gnl|my_center|LOCUS_32990 434102 433506 gene locus_tag LOCUS_33000 gene recR 434102 433506 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521324.1 protein_id gnl|my_center|LOCUS_33000 434431 434105 gene locus_tag LOCUS_33010 434431 434105 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192342.1 protein_id gnl|my_center|LOCUS_33010 436901 434511 gene locus_tag LOCUS_33020 436901 434511 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193273.1 protein_id gnl|my_center|LOCUS_33020 437489 436920 gene locus_tag LOCUS_33030 437489 436920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 437652 439298 gene locus_tag LOCUS_33040 437652 439298 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535538.1 protein_id gnl|my_center|LOCUS_33040 440568 439393 gene locus_tag LOCUS_33050 440568 439393 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105512.1 protein_id gnl|my_center|LOCUS_33050 442194 440671 gene locus_tag LOCUS_33060 442194 440671 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815305.1 protein_id gnl|my_center|LOCUS_33060 442592 442197 gene locus_tag LOCUS_33070 442592 442197 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527982.1 protein_id gnl|my_center|LOCUS_33070 443121 442684 gene locus_tag LOCUS_33080 443121 442684 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814993.1 protein_id gnl|my_center|LOCUS_33080 444311 443118 gene locus_tag LOCUS_33090 444311 443118 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064927.1 protein_id gnl|my_center|LOCUS_33090 445168 444314 gene locus_tag LOCUS_33100 445168 444314 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815000.1 protein_id gnl|my_center|LOCUS_33100 445728 445165 gene locus_tag LOCUS_33110 445728 445165 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815019.1 protein_id gnl|my_center|LOCUS_33110 446510 445728 gene locus_tag LOCUS_33120 446510 445728 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927121.1 protein_id gnl|my_center|LOCUS_33120 448906 446513 gene locus_tag LOCUS_33130 448906 446513 CDS product bifunctional salicylyl-CoA 5-hydroxylase/oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815004.1 protein_id gnl|my_center|LOCUS_33130 450126 448951 gene locus_tag LOCUS_33140 450126 448951 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815015.1 protein_id gnl|my_center|LOCUS_33140 451819 450179 gene locus_tag LOCUS_33150 451819 450179 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814996.1 protein_id gnl|my_center|LOCUS_33150 452030 452950 gene locus_tag LOCUS_33160 452030 452950 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815013.1 protein_id gnl|my_center|LOCUS_33160 452961 453932 gene locus_tag LOCUS_33170 452961 453932 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815011.1 protein_id gnl|my_center|LOCUS_33170 453929 454696 gene locus_tag LOCUS_33180 453929 454696 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040563.1 protein_id gnl|my_center|LOCUS_33180 454693 455403 gene locus_tag LOCUS_33190 454693 455403 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083887.1 protein_id gnl|my_center|LOCUS_33190 456536 455424 gene locus_tag LOCUS_33200 456536 455424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 458982 456598 gene locus_tag LOCUS_33210 458982 456598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 459553 459227 gene locus_tag LOCUS_33220 gene ftsB 459553 459227 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065137.1 protein_id gnl|my_center|LOCUS_33220 460915 459632 gene locus_tag LOCUS_33230 gene eno 460915 459632 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065136.1 protein_id gnl|my_center|LOCUS_33230 462672 461029 gene locus_tag LOCUS_33240 462672 461029 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192790.1 protein_id gnl|my_center|LOCUS_33240 463730 462780 gene locus_tag LOCUS_33250 463730 462780 CDS product lipid A deacylase LpxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389754.1 protein_id gnl|my_center|LOCUS_33250 464635 463826 gene locus_tag LOCUS_33260 464635 463826 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524730.1 protein_id gnl|my_center|LOCUS_33260 467140 464648 gene locus_tag LOCUS_33270 467140 464648 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063648.1 protein_id gnl|my_center|LOCUS_33270 467962 467156 gene locus_tag LOCUS_33280 467962 467156 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192516.1 protein_id gnl|my_center|LOCUS_33280 468697 468014 gene locus_tag LOCUS_33290 468697 468014 CDS product ceramidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771218.1 protein_id gnl|my_center|LOCUS_33290 468949 469752 gene locus_tag LOCUS_33300 468949 469752 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477064.1 protein_id gnl|my_center|LOCUS_33300 470603 469791 gene locus_tag LOCUS_33310 470603 469791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 470856 470671 gene locus_tag LOCUS_33320 470856 470671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 471463 470969 gene locus_tag LOCUS_33330 gene rraA 471463 470969 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191744.1 protein_id gnl|my_center|LOCUS_33330 472745 471519 gene locus_tag LOCUS_33340 472745 471519 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810358.1 protein_id gnl|my_center|LOCUS_33340 472914 473699 gene locus_tag LOCUS_33350 472914 473699 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192042.1 protein_id gnl|my_center|LOCUS_33350 476389 473783 gene locus_tag LOCUS_33360 gene clpB 476389 473783 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521310.1 protein_id gnl|my_center|LOCUS_33360 476499 477053 gene locus_tag LOCUS_33370 476499 477053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 478142 477177 gene locus_tag LOCUS_33380 gene pip 478142 477177 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387845.1 protein_id gnl|my_center|LOCUS_33380 478265 479302 gene locus_tag LOCUS_33390 478265 479302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 479690 479307 gene locus_tag LOCUS_33400 gene crcB 479690 479307 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094051.1 protein_id gnl|my_center|LOCUS_33400 480169 479687 gene locus_tag LOCUS_33410 gene moaE 480169 479687 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535771.1 protein_id gnl|my_center|LOCUS_33410 480430 480173 gene locus_tag LOCUS_33420 gene moaD 480430 480173 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193789.1 protein_id gnl|my_center|LOCUS_33420 481640 480447 gene locus_tag LOCUS_33430 481640 480447 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192374.1 protein_id gnl|my_center|LOCUS_33430 482460 481912 gene locus_tag LOCUS_33440 482460 481912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 484016 482637 gene locus_tag LOCUS_33450 484016 482637 CDS product DUF3422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391173.1 protein_id gnl|my_center|LOCUS_33450 484985 484044 gene locus_tag LOCUS_33460 484985 484044 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036922.1 protein_id gnl|my_center|LOCUS_33460 486238 485222 gene locus_tag LOCUS_33470 gene yjfF 486238 485222 CDS product sugar ABC transporter permease YjfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226243.1 protein_id gnl|my_center|LOCUS_33470 487376 486258 gene locus_tag LOCUS_33480 487376 486258 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226242.1 protein_id gnl|my_center|LOCUS_33480 488977 487376 gene locus_tag LOCUS_33490 488977 487376 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114470298.1 protein_id gnl|my_center|LOCUS_33490 490025 489048 gene locus_tag LOCUS_33500 490025 489048 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226240.1 protein_id gnl|my_center|LOCUS_33500 491370 490276 gene locus_tag LOCUS_33510 491370 490276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 493850 491463 gene locus_tag LOCUS_33520 493850 491463 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107211.1 protein_id gnl|my_center|LOCUS_33520 494925 493891 gene locus_tag LOCUS_33530 494925 493891 CDS product arabinan endo-1,5-alpha-L-arabinosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083685838.1 protein_id gnl|my_center|LOCUS_33530 496560 494989 gene locus_tag LOCUS_33540 496560 494989 CDS product alpha-N-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919298.1 protein_id gnl|my_center|LOCUS_33540 498526 496601 gene locus_tag LOCUS_33550 498526 496601 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767043.1 protein_id gnl|my_center|LOCUS_33550 499481 498714 gene locus_tag LOCUS_33560 499481 498714 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201787933.1 protein_id gnl|my_center|LOCUS_33560 501144 499573 gene locus_tag LOCUS_33570 501144 499573 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038347.1 protein_id gnl|my_center|LOCUS_33570 502133 501141 gene locus_tag LOCUS_33580 gene gguC 502133 501141 CDS product GguC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533635.1 protein_id gnl|my_center|LOCUS_33580 503931 502189 gene locus_tag LOCUS_33590 503931 502189 CDS product IlvD/Edd family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206894.1 protein_id gnl|my_center|LOCUS_33590 505280 504102 gene locus_tag LOCUS_33600 505280 504102 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_33600 505607 505696 gene locus_tag LOCUS_t00670 505607 505696 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 506236 507507 gene locus_tag LOCUS_33610 506236 507507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 507661 507945 gene locus_tag LOCUS_33620 507661 507945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 507947 508579 gene locus_tag LOCUS_33630 507947 508579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 509208 508648 gene locus_tag LOCUS_33640 509208 508648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 509842 509366 gene locus_tag LOCUS_33650 509842 509366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 511541 510153 gene locus_tag LOCUS_33660 511541 510153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 511768 511980 gene locus_tag LOCUS_33670 511768 511980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 512037 513938 gene locus_tag LOCUS_33680 512037 513938 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770458.1 protein_id gnl|my_center|LOCUS_33680 515323 514028 gene locus_tag LOCUS_33690 gene serS 515323 514028 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186129.1 protein_id gnl|my_center|LOCUS_33690 517444 515471 gene locus_tag LOCUS_33700 517444 515471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 519175 517448 gene locus_tag LOCUS_33710 519175 517448 CDS product molecular chaperone HscC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104950.1 protein_id gnl|my_center|LOCUS_33710 520950 519475 gene locus_tag LOCUS_33720 520950 519475 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011342568.1 protein_id gnl|my_center|LOCUS_33720 522365 521058 gene locus_tag LOCUS_33730 522365 521058 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185515.1 protein_id gnl|my_center|LOCUS_33730 523019 522366 gene locus_tag LOCUS_33740 gene lolA 523019 522366 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185701.1 protein_id gnl|my_center|LOCUS_33740 525421 523085 gene locus_tag LOCUS_33750 525421 523085 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186104.1 protein_id gnl|my_center|LOCUS_33750 525720 526664 gene locus_tag LOCUS_33760 gene trxB 525720 526664 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186294.1 protein_id gnl|my_center|LOCUS_33760 526692 527327 gene locus_tag LOCUS_33770 526692 527327 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186084.1 protein_id gnl|my_center|LOCUS_33770 528566 527379 gene locus_tag LOCUS_33780 528566 527379 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937886.1 protein_id gnl|my_center|LOCUS_33780 528915 528577 gene locus_tag LOCUS_33790 528915 528577 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193987.1 protein_id gnl|my_center|LOCUS_33790 530649 529036 gene locus_tag LOCUS_33800 530649 529036 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198600.1 protein_id gnl|my_center|LOCUS_33800 530676 531857 gene locus_tag LOCUS_33810 530676 531857 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192390.1 protein_id gnl|my_center|LOCUS_33810 531982 532938 gene locus_tag LOCUS_33820 531982 532938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 533583 533047 gene locus_tag LOCUS_33830 gene ppa 533583 533047 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930982.1 protein_id gnl|my_center|LOCUS_33830 534876 533680 gene locus_tag LOCUS_33840 534876 533680 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526333.1 protein_id gnl|my_center|LOCUS_33840 536053 534881 gene locus_tag LOCUS_33850 536053 534881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33850 536847 536050 gene locus_tag LOCUS_33860 536847 536050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 537828 536869 gene locus_tag LOCUS_33870 gene hemC 537828 536869 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193185.1 protein_id gnl|my_center|LOCUS_33870 538192 539211 gene locus_tag LOCUS_33880 gene trpS 538192 539211 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116097.1 protein_id gnl|my_center|LOCUS_33880 539265 540491 gene locus_tag LOCUS_33890 539265 540491 CDS product crosslink repair DNA glycosylase YcaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198466.1 protein_id gnl|my_center|LOCUS_33890 540492 541394 gene locus_tag LOCUS_33900 540492 541394 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967309.1 protein_id gnl|my_center|LOCUS_33900 541537 541992 gene locus_tag LOCUS_33910 541537 541992 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814701.1 protein_id gnl|my_center|LOCUS_33910 542105 542746 gene locus_tag LOCUS_33920 542105 542746 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528392.1 protein_id gnl|my_center|LOCUS_33920 542958 543341 gene locus_tag LOCUS_33930 542958 543341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 543367 544284 gene locus_tag LOCUS_33940 543367 544284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 544429 545268 gene locus_tag LOCUS_33950 544429 545268 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200941.1 protein_id gnl|my_center|LOCUS_33950 545471 547417 gene locus_tag LOCUS_33960 545471 547417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 547502 547834 gene locus_tag LOCUS_33970 547502 547834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 548711 547872 gene locus_tag LOCUS_33980 548711 547872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 550116 548713 gene locus_tag LOCUS_33990 gene hemN 550116 548713 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535314.1 protein_id gnl|my_center|LOCUS_33990 550385 550128 gene locus_tag LOCUS_34000 550385 550128 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810392.1 protein_id gnl|my_center|LOCUS_34000 550990 550445 gene locus_tag LOCUS_34010 550990 550445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 552412 551000 gene locus_tag LOCUS_34020 gene ccoG 552412 551000 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818562.1 protein_id gnl|my_center|LOCUS_34020 553483 552446 gene locus_tag LOCUS_34030 gene ccoP 553483 552446 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930775.1 protein_id gnl|my_center|LOCUS_34030 553632 553486 gene locus_tag LOCUS_34040 553632 553486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 554298 553681 gene locus_tag LOCUS_34050 gene ccoO 554298 553681 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087318.1 protein_id gnl|my_center|LOCUS_34050 555716 554334 gene locus_tag LOCUS_34060 gene ccoN 555716 554334 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216619.1 protein_id gnl|my_center|LOCUS_34060 557945 556026 gene locus_tag LOCUS_34070 557945 556026 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191640.1 protein_id gnl|my_center|LOCUS_34070 558105 558029 gene locus_tag LOCUS_t00680 558105 558029 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 558207 558132 gene locus_tag LOCUS_t00690 558207 558132 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 558531 558259 gene locus_tag LOCUS_34080 558531 558259 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812968.1 protein_id gnl|my_center|LOCUS_34080 559038 560645 gene locus_tag LOCUS_34090 gene nadB 559038 560645 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186553.1 protein_id gnl|my_center|LOCUS_34090 560874 561545 gene locus_tag LOCUS_34100 560874 561545 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_34100 561542 563644 gene locus_tag LOCUS_34110 561542 563644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 563641 564882 gene locus_tag LOCUS_34120 563641 564882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 564879 566114 gene locus_tag LOCUS_34130 564879 566114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 567100 566234 gene locus_tag LOCUS_34140 gene nadC 567100 566234 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185611.1 protein_id gnl|my_center|LOCUS_34140 568272 567142 gene locus_tag LOCUS_34150 gene nadA 568272 567142 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185886.1 protein_id gnl|my_center|LOCUS_34150 570456 568405 gene locus_tag LOCUS_34160 570456 568405 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948307.1 protein_id gnl|my_center|LOCUS_34160 572444 570495 gene locus_tag LOCUS_34170 572444 570495 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037381.1 protein_id gnl|my_center|LOCUS_34170 572729 573163 gene locus_tag LOCUS_34180 572729 573163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 574238 573282 gene locus_tag LOCUS_34190 574238 573282 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168557.1 protein_id gnl|my_center|LOCUS_34190 575671 574301 gene locus_tag LOCUS_34200 gene ppnN 575671 574301 CDS product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093432.1 protein_id gnl|my_center|LOCUS_34200 575901 575977 gene locus_tag LOCUS_t00700 575901 575977 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 576463 576149 gene locus_tag LOCUS_34210 576463 576149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 577030 576503 gene locus_tag LOCUS_34220 577030 576503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296439.1 protein_id gnl|my_center|LOCUS_34220 577583 577140 gene locus_tag LOCUS_34230 577583 577140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 578321 577659 gene locus_tag LOCUS_34240 578321 577659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 578722 578396 gene locus_tag LOCUS_34250 578722 578396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 579384 579010 gene locus_tag LOCUS_34260 579384 579010 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967717.1 protein_id gnl|my_center|LOCUS_34260 580028 580255 gene locus_tag LOCUS_34270 580028 580255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 581095 580295 gene locus_tag LOCUS_34280 581095 580295 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068574319.1 protein_id gnl|my_center|LOCUS_34280 582129 581092 gene locus_tag LOCUS_34290 582129 581092 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012777536.1 protein_id gnl|my_center|LOCUS_34290 582326 583720 gene locus_tag LOCUS_34300 gene argH 582326 583720 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191886.1 protein_id gnl|my_center|LOCUS_34300 584086 585234 gene locus_tag LOCUS_34310 584086 585234 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888753.1 protein_id gnl|my_center|LOCUS_34310 585363 586280 gene locus_tag LOCUS_34320 585363 586280 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944005.1 protein_id gnl|my_center|LOCUS_34320 586285 587163 gene locus_tag LOCUS_34330 586285 587163 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153018191.1 protein_id gnl|my_center|LOCUS_34330 587164 587925 gene locus_tag LOCUS_34340 587164 587925 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194783.1 protein_id gnl|my_center|LOCUS_34340 587922 588635 gene locus_tag LOCUS_34350 587922 588635 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080267.1 protein_id gnl|my_center|LOCUS_34350 590097 588745 gene locus_tag LOCUS_34360 gene pmbA 590097 588745 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188997.1 protein_id gnl|my_center|LOCUS_34360 590275 590889 gene locus_tag LOCUS_34370 gene yjgA 590275 590889 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522378.1 protein_id gnl|my_center|LOCUS_34370 590916 591530 gene locus_tag LOCUS_34380 gene mog 590916 591530 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064299.1 protein_id gnl|my_center|LOCUS_34380 591560 592102 gene locus_tag LOCUS_34390 591560 592102 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113921.1 protein_id gnl|my_center|LOCUS_34390 592099 592773 gene locus_tag LOCUS_34400 592099 592773 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814899.1 protein_id gnl|my_center|LOCUS_34400 592794 593507 gene locus_tag LOCUS_34410 592794 593507 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122357.1 protein_id gnl|my_center|LOCUS_34410 593673 593509 gene locus_tag LOCUS_34420 593673 593509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 594825 594121 gene locus_tag LOCUS_34430 594825 594121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 <596825 594834 gene locus_tag LOCUS_34440 <596825 594834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_158208138.1:DNRLRE domain-containing protein >Feature sequence044 >Feature sequence045 161 559 gene locus_tag LOCUS_34450 161 559 CDS product DNA-packaging protein FI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158906.1 protein_id gnl|my_center|LOCUS_34450 >Feature sequence046 >Feature sequence047 >Feature sequence048 >Feature sequence049 >Feature sequence050 >Feature sequence051 >Feature sequence052 >Feature sequence053 >Feature sequence054 2202 3266 gene locus_tag LOCUS_34460 gene pyrC 2202 3266 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194429.1 protein_id gnl|my_center|LOCUS_34460 3279 4076 gene locus_tag LOCUS_34470 3279 4076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 4365 4117 gene locus_tag LOCUS_34480 4365 4117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 4652 6244 gene locus_tag LOCUS_34490 4652 6244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 7114 6296 gene locus_tag LOCUS_34500 7114 6296 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950478.1 protein_id gnl|my_center|LOCUS_34500 7774 7310 gene locus_tag LOCUS_34510 7774 7310 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507213.1 protein_id gnl|my_center|LOCUS_34510 10715 7890 gene locus_tag LOCUS_34520 10715 7890 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521705.1 protein_id gnl|my_center|LOCUS_34520 11307 13367 gene locus_tag LOCUS_34530 11307 13367 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925657.1 protein_id gnl|my_center|LOCUS_34530 13624 15537 gene locus_tag LOCUS_34540 gene thiC 13624 15537 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521865.1 protein_id gnl|my_center|LOCUS_34540 15540 15740 gene locus_tag LOCUS_34550 15540 15740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 15961 16326 gene locus_tag LOCUS_34560 15961 16326 CDS product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687278.1 protein_id gnl|my_center|LOCUS_34560 16490 17281 gene locus_tag LOCUS_34570 16490 17281 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446412.1 protein_id gnl|my_center|LOCUS_34570 17314 18132 gene locus_tag LOCUS_34580 17314 18132 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100335.1 protein_id gnl|my_center|LOCUS_34580 18129 18773 gene locus_tag LOCUS_34590 gene thiE 18129 18773 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064930.1 protein_id gnl|my_center|LOCUS_34590 19509 18784 gene locus_tag LOCUS_34600 19509 18784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 20520 19573 gene locus_tag LOCUS_34610 gene dapA 20520 19573 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925705.1 protein_id gnl|my_center|LOCUS_34610 20882 23173 gene locus_tag LOCUS_34620 20882 23173 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555925.1 protein_id gnl|my_center|LOCUS_34620 23906 23274 gene locus_tag LOCUS_34630 gene coq7 23906 23274 CDS product 2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527787.1 protein_id gnl|my_center|LOCUS_34630 24246 25382 gene locus_tag LOCUS_34640 24246 25382 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188361.1 protein_id gnl|my_center|LOCUS_34640 25762 26823 gene locus_tag LOCUS_34650 25762 26823 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040259.1 protein_id gnl|my_center|LOCUS_34650 28050 27166 gene locus_tag LOCUS_34660 28050 27166 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393278.1 protein_id gnl|my_center|LOCUS_34660 29209 28139 gene locus_tag LOCUS_34670 gene ruvB 29209 28139 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194268.1 protein_id gnl|my_center|LOCUS_34670 29794 29213 gene locus_tag LOCUS_34680 gene ruvA 29794 29213 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194029.1 protein_id gnl|my_center|LOCUS_34680 30497 29955 gene locus_tag LOCUS_34690 gene ruvC 30497 29955 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196340.1 protein_id gnl|my_center|LOCUS_34690 30754 30578 gene locus_tag LOCUS_34700 30754 30578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 31309 31028 gene locus_tag LOCUS_34710 31309 31028 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216166.1 protein_id gnl|my_center|LOCUS_34710 32966 31401 gene locus_tag LOCUS_34720 gene purH 32966 31401 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194285.1 protein_id gnl|my_center|LOCUS_34720 33247 33014 gene locus_tag LOCUS_34730 33247 33014 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194052.1 protein_id gnl|my_center|LOCUS_34730 34338 33328 gene locus_tag LOCUS_34740 gene dusB 34338 33328 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194278.1 protein_id gnl|my_center|LOCUS_34740 34661 35989 gene locus_tag LOCUS_34750 34661 35989 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005614782.1 protein_id gnl|my_center|LOCUS_34750 36863 36090 gene locus_tag LOCUS_34760 36863 36090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 37134 37811 gene locus_tag LOCUS_34770 37134 37811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 37878 38480 gene locus_tag LOCUS_34780 37878 38480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 38637 39617 gene locus_tag LOCUS_34790 38637 39617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 39614 40351 gene locus_tag LOCUS_34800 39614 40351 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481713.1 protein_id gnl|my_center|LOCUS_34800 40722 40549 gene locus_tag LOCUS_34810 40722 40549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 41052 42287 gene locus_tag LOCUS_34820 41052 42287 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072930.1 protein_id gnl|my_center|LOCUS_34820 43455 42787 gene locus_tag LOCUS_34830 43455 42787 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533589.1 protein_id gnl|my_center|LOCUS_34830 43903 43463 gene locus_tag LOCUS_34840 gene dtd 43903 43463 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200499.1 protein_id gnl|my_center|LOCUS_34840 45415 44147 gene locus_tag LOCUS_34850 gene tyrS 45415 44147 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194043.1 protein_id gnl|my_center|LOCUS_34850 45760 47079 gene locus_tag LOCUS_34860 45760 47079 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814879.1 protein_id gnl|my_center|LOCUS_34860 47162 47695 gene locus_tag LOCUS_34870 47162 47695 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463503.1 protein_id gnl|my_center|LOCUS_34870 47738 48898 gene locus_tag LOCUS_34880 47738 48898 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533564.1 protein_id gnl|my_center|LOCUS_34880 49315 50247 gene locus_tag LOCUS_34890 49315 50247 CDS product triacylglycerol lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033424.1 protein_id gnl|my_center|LOCUS_34890 50367 51323 gene locus_tag LOCUS_34900 50367 51323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 52207 51353 gene locus_tag LOCUS_34910 52207 51353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 53348 52344 gene locus_tag LOCUS_34920 53348 52344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 56073 53710 gene locus_tag LOCUS_34930 56073 53710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 56574 56846 gene locus_tag LOCUS_34940 56574 56846 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813109.1 protein_id gnl|my_center|LOCUS_34940 56843 57733 gene locus_tag LOCUS_34950 56843 57733 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190235.1 protein_id gnl|my_center|LOCUS_34950 58141 59985 gene locus_tag LOCUS_34960 gene dxs 58141 59985 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266656.1 protein_id gnl|my_center|LOCUS_34960 60203 60586 gene locus_tag LOCUS_34970 60203 60586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 60721 61008 gene locus_tag LOCUS_34980 60721 61008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 61079 61693 gene locus_tag LOCUS_34990 61079 61693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 62136 61804 gene locus_tag LOCUS_35000 62136 61804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 62769 62218 gene locus_tag LOCUS_35010 62769 62218 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201622.1 protein_id gnl|my_center|LOCUS_35010 62793 64280 gene locus_tag LOCUS_35020 62793 64280 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064125.1 protein_id gnl|my_center|LOCUS_35020 64512 65399 gene locus_tag LOCUS_35030 64512 65399 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114511.1 protein_id gnl|my_center|LOCUS_35030 67749 65362 gene locus_tag LOCUS_35040 67749 65362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 69098 68166 gene locus_tag LOCUS_35050 69098 68166 CDS product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187219.1 protein_id gnl|my_center|LOCUS_35050 69785 69135 gene locus_tag LOCUS_35060 69785 69135 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895526.1 protein_id gnl|my_center|LOCUS_35060 70140 71240 gene locus_tag LOCUS_35070 70140 71240 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190814.1 protein_id gnl|my_center|LOCUS_35070 71294 72223 gene locus_tag LOCUS_35080 71294 72223 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813139.1 protein_id gnl|my_center|LOCUS_35080 72277 73122 gene locus_tag LOCUS_35090 72277 73122 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190656.1 protein_id gnl|my_center|LOCUS_35090 73845 73183 gene locus_tag LOCUS_35100 73845 73183 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810564.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35100 74176 74976 gene locus_tag LOCUS_35110 74176 74976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 76443 75091 gene locus_tag LOCUS_35120 gene gorA 76443 75091 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812173.1 protein_id gnl|my_center|LOCUS_35120 77431 76550 gene locus_tag LOCUS_35130 77431 76550 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190499.1 protein_id gnl|my_center|LOCUS_35130 78015 77599 gene locus_tag LOCUS_35140 78015 77599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 78968 78492 gene locus_tag LOCUS_35150 78968 78492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 79134 80381 gene locus_tag LOCUS_35160 79134 80381 CDS product putative Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807020.1 protein_id gnl|my_center|LOCUS_35160 81067 82161 gene locus_tag LOCUS_35170 81067 82161 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189943.1 protein_id gnl|my_center|LOCUS_35170 82317 83513 gene locus_tag LOCUS_35180 82317 83513 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195784.1 protein_id gnl|my_center|LOCUS_35180 83515 84648 gene locus_tag LOCUS_35190 83515 84648 CDS product YbdK family carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195787.1 protein_id gnl|my_center|LOCUS_35190 84710 85270 gene locus_tag LOCUS_35200 84710 85270 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258945.1 protein_id gnl|my_center|LOCUS_35200 86796 85369 gene locus_tag LOCUS_35210 gene creD 86796 85369 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037822.1 protein_id gnl|my_center|LOCUS_35210 88318 86888 gene locus_tag LOCUS_35220 gene creC 88318 86888 CDS product two-component system sensor histidine kinase CreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817023.1 protein_id gnl|my_center|LOCUS_35220 89061 88315 gene locus_tag LOCUS_35230 gene blrA 89061 88315 CDS product beta-lactam response regulator transcription factor BlrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707903.1 protein_id gnl|my_center|LOCUS_35230 89572 89159 gene locus_tag LOCUS_35240 89572 89159 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187960.1 protein_id gnl|my_center|LOCUS_35240 89788 90444 gene locus_tag LOCUS_35250 89788 90444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 91433 90591 gene locus_tag LOCUS_35260 91433 90591 CDS product 2OG-Fe(II) oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707343.1 protein_id gnl|my_center|LOCUS_35260 92444 91446 gene locus_tag LOCUS_35270 92444 91446 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971730.1 protein_id gnl|my_center|LOCUS_35270 93813 92845 gene locus_tag LOCUS_35280 93813 92845 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067541.1 protein_id gnl|my_center|LOCUS_35280 94895 93813 gene locus_tag LOCUS_35290 94895 93813 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529632.1 protein_id gnl|my_center|LOCUS_35290 96517 94988 gene locus_tag LOCUS_35300 96517 94988 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970667.1 protein_id gnl|my_center|LOCUS_35300 97652 96648 gene locus_tag LOCUS_35310 97652 96648 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309949.1 protein_id gnl|my_center|LOCUS_35310 98887 97958 gene locus_tag LOCUS_35320 gene rbsK 98887 97958 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119387.1 protein_id gnl|my_center|LOCUS_35320 99371 99805 gene locus_tag LOCUS_35330 99371 99805 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111004.1 protein_id gnl|my_center|LOCUS_35330 100136 99945 gene locus_tag LOCUS_35340 100136 99945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 100541 100206 gene locus_tag LOCUS_35350 100541 100206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 100981 102084 gene locus_tag LOCUS_35360 100981 102084 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120110396.1 protein_id gnl|my_center|LOCUS_35360 102081 103010 gene locus_tag LOCUS_35370 102081 103010 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722579.1 protein_id gnl|my_center|LOCUS_35370 104656 103061 gene locus_tag LOCUS_35380 104656 103061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 105570 104662 gene locus_tag LOCUS_35390 gene prmA 105570 104662 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194259.1 protein_id gnl|my_center|LOCUS_35390 107433 106066 gene locus_tag LOCUS_35400 gene accC 107433 106066 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194420.1 protein_id gnl|my_center|LOCUS_35400 107999 107544 gene locus_tag LOCUS_35410 gene accB 107999 107544 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814952.1 protein_id gnl|my_center|LOCUS_35410 108583 108146 gene locus_tag LOCUS_35420 gene aroQ 108583 108146 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068810.1 protein_id gnl|my_center|LOCUS_35420 109198 108662 gene locus_tag LOCUS_35430 109198 108662 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527768.1 protein_id gnl|my_center|LOCUS_35430 109894 109280 gene locus_tag LOCUS_35440 109894 109280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195097.1 protein_id gnl|my_center|LOCUS_35440 110124 111530 gene locus_tag LOCUS_35450 gene mpl 110124 111530 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527766.1 protein_id gnl|my_center|LOCUS_35450 111527 112099 gene locus_tag LOCUS_35460 111527 112099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194143.1 protein_id gnl|my_center|LOCUS_35460 112134 112700 gene locus_tag LOCUS_35470 112134 112700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 113121 115199 gene locus_tag LOCUS_35480 113121 115199 CDS product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527764.1 protein_id gnl|my_center|LOCUS_35480 115199 116152 gene locus_tag LOCUS_35490 115199 116152 CDS product TonB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931246.1 protein_id gnl|my_center|LOCUS_35490 116149 117000 gene locus_tag LOCUS_35500 gene aroE 116149 117000 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194401.1 protein_id gnl|my_center|LOCUS_35500 117000 117695 gene locus_tag LOCUS_35510 gene mtgA 117000 117695 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814960.1 protein_id gnl|my_center|LOCUS_35510 117692 118159 gene locus_tag LOCUS_35520 117692 118159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 118683 118195 gene locus_tag LOCUS_35530 118683 118195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 119131 118727 gene locus_tag LOCUS_35540 119131 118727 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197761.1 protein_id gnl|my_center|LOCUS_35540 119295 119693 gene locus_tag LOCUS_35550 119295 119693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 119910 120878 gene locus_tag LOCUS_35560 gene corA 119910 120878 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211480.1 protein_id gnl|my_center|LOCUS_35560 120880 121278 gene locus_tag LOCUS_35570 120880 121278 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188348.1 protein_id gnl|my_center|LOCUS_35570 123285 121294 gene locus_tag LOCUS_35580 123285 121294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 123623 124327 gene locus_tag LOCUS_35590 123623 124327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084123.1 protein_id gnl|my_center|LOCUS_35590 125164 124358 gene locus_tag LOCUS_35600 125164 124358 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004347357.1 protein_id gnl|my_center|LOCUS_35600 127625 125520 gene locus_tag LOCUS_35610 gene fusA 127625 125520 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779472.1 protein_id gnl|my_center|LOCUS_35610 128584 128108 gene locus_tag LOCUS_35620 128584 128108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 130318 128600 gene locus_tag LOCUS_35630 130318 128600 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192099.1 protein_id gnl|my_center|LOCUS_35630 130413 131651 gene locus_tag LOCUS_35640 130413 131651 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976750.1 protein_id gnl|my_center|LOCUS_35640 132257 133144 gene locus_tag LOCUS_35650 132257 133144 CDS product VirK/YbjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211355.1 protein_id gnl|my_center|LOCUS_35650 133501 137478 gene locus_tag LOCUS_35660 133501 137478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 137627 138526 gene locus_tag LOCUS_35670 137627 138526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 138790 138602 gene locus_tag LOCUS_35680 138790 138602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 138866 139567 gene locus_tag LOCUS_35690 138866 139567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 140720 139707 gene locus_tag LOCUS_35700 140720 139707 CDS product ribonuclease T2 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443921.1 protein_id gnl|my_center|LOCUS_35700 141896 140853 gene locus_tag LOCUS_35710 141896 140853 CDS product IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101899139.1 protein_id gnl|my_center|LOCUS_35710 143455 141992 gene locus_tag LOCUS_35720 143455 141992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 143753 143680 gene locus_tag LOCUS_t00710 143753 143680 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 143964 144425 gene locus_tag LOCUS_35730 143964 144425 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035584.1 protein_id gnl|my_center|LOCUS_35730 144476 145060 gene locus_tag LOCUS_35740 144476 145060 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942196.1 protein_id gnl|my_center|LOCUS_35740 145106 145477 gene locus_tag LOCUS_35750 145106 145477 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971114.1 protein_id gnl|my_center|LOCUS_35750 145545 145988 gene locus_tag LOCUS_35760 145545 145988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 146262 146044 gene locus_tag LOCUS_35770 146262 146044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 147223 146312 gene locus_tag LOCUS_35780 147223 146312 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064670.1 protein_id gnl|my_center|LOCUS_35780 148734 147247 gene locus_tag LOCUS_35790 148734 147247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 148940 149836 gene locus_tag LOCUS_35800 148940 149836 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194310.1 protein_id gnl|my_center|LOCUS_35800 150063 151487 gene locus_tag LOCUS_35810 gene aspA 150063 151487 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384943.1 protein_id gnl|my_center|LOCUS_35810 151641 152942 gene locus_tag LOCUS_35820 151641 152942 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192723.1 protein_id gnl|my_center|LOCUS_35820 153698 152991 gene locus_tag LOCUS_35830 153698 152991 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530319.1 protein_id gnl|my_center|LOCUS_35830 153729 156515 gene locus_tag LOCUS_35840 gene polA 153729 156515 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540200.1 protein_id gnl|my_center|LOCUS_35840 156840 156625 gene locus_tag LOCUS_35850 156840 156625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 157857 156937 gene locus_tag LOCUS_35860 157857 156937 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038051.1 protein_id gnl|my_center|LOCUS_35860 158078 158812 gene locus_tag LOCUS_35870 158078 158812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 159488 158880 gene locus_tag LOCUS_35880 159488 158880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 159744 161540 gene locus_tag LOCUS_35890 159744 161540 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057111.1 protein_id gnl|my_center|LOCUS_35890 163401 161605 gene locus_tag LOCUS_35900 163401 161605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 163721 164725 gene locus_tag LOCUS_35910 163721 164725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 165036 166133 gene locus_tag LOCUS_35920 165036 166133 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073324.1 protein_id gnl|my_center|LOCUS_35920 168018 166135 gene locus_tag LOCUS_35930 168018 166135 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002146465.1 protein_id gnl|my_center|LOCUS_35930 169768 168005 gene locus_tag LOCUS_35940 169768 168005 CDS product GGDEF domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070885.1 protein_id gnl|my_center|LOCUS_35940 170305 169868 gene locus_tag LOCUS_35950 170305 169868 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070884.1 protein_id gnl|my_center|LOCUS_35950 170921 170583 gene locus_tag LOCUS_35960 170921 170583 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122463.1 protein_id gnl|my_center|LOCUS_35960 171666 171004 gene locus_tag LOCUS_35970 171666 171004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222220.1 protein_id gnl|my_center|LOCUS_35970 172155 171721 gene locus_tag LOCUS_35980 172155 171721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 173986 172289 gene locus_tag LOCUS_35990 173986 172289 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399307.1 protein_id gnl|my_center|LOCUS_35990 174850 177942 gene locus_tag LOCUS_36000 174850 177942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 178547 178975 gene locus_tag LOCUS_36010 gene mraZ 178547 178975 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931263.1 protein_id gnl|my_center|LOCUS_36010 178985 179941 gene locus_tag LOCUS_36020 gene rsmH 178985 179941 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194427.1 protein_id gnl|my_center|LOCUS_36020 179938 180213 gene locus_tag LOCUS_36030 179938 180213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 180210 181973 gene locus_tag LOCUS_36040 180210 181973 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532007.1 protein_id gnl|my_center|LOCUS_36040 181973 183499 gene locus_tag LOCUS_36050 181973 183499 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194154.1 protein_id gnl|my_center|LOCUS_36050 183499 184899 gene locus_tag LOCUS_36060 gene murF 183499 184899 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194098.1 protein_id gnl|my_center|LOCUS_36060 184901 186070 gene locus_tag LOCUS_36070 gene mraY 184901 186070 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194370.1 protein_id gnl|my_center|LOCUS_36070 186150 187655 gene locus_tag LOCUS_36080 gene murD 186150 187655 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203798.1 protein_id gnl|my_center|LOCUS_36080 187655 188872 gene locus_tag LOCUS_36090 gene ftsW 187655 188872 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194175.1 protein_id gnl|my_center|LOCUS_36090 188869 189960 gene locus_tag LOCUS_36100 gene murG 188869 189960 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039095.1 protein_id gnl|my_center|LOCUS_36100 189957 191342 gene locus_tag LOCUS_36110 gene murC 189957 191342 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522018.1 protein_id gnl|my_center|LOCUS_36110 191365 192327 gene locus_tag LOCUS_36120 191365 192327 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814571.1 protein_id gnl|my_center|LOCUS_36120 192346 193164 gene locus_tag LOCUS_36130 192346 193164 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522020.1 protein_id gnl|my_center|LOCUS_36130 193161 194393 gene locus_tag LOCUS_36140 gene ftsA 193161 194393 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194020.1 protein_id gnl|my_center|LOCUS_36140 194529 195710 gene locus_tag LOCUS_36150 gene ftsZ 194529 195710 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194380.1 protein_id gnl|my_center|LOCUS_36150 196209 196715 gene locus_tag LOCUS_36160 196209 196715 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064337.1 protein_id gnl|my_center|LOCUS_36160 197317 196823 gene locus_tag LOCUS_36170 197317 196823 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459931.1 protein_id gnl|my_center|LOCUS_36170 197542 198477 gene locus_tag LOCUS_36180 gene lpxC 197542 198477 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194158.1 protein_id gnl|my_center|LOCUS_36180 199098 198589 gene locus_tag LOCUS_36190 199098 198589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 199181 200128 gene locus_tag LOCUS_36200 199181 200128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 200321 203080 gene locus_tag LOCUS_36210 gene secA 200321 203080 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194125.1 protein_id gnl|my_center|LOCUS_36210 203996 203211 gene locus_tag LOCUS_36220 203996 203211 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097851.1 protein_id gnl|my_center|LOCUS_36220 204194 205375 gene locus_tag LOCUS_36230 204194 205375 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185551.1 protein_id gnl|my_center|LOCUS_36230 205489 206727 gene locus_tag LOCUS_36240 gene argJ 205489 206727 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202972.1 protein_id gnl|my_center|LOCUS_36240 206751 207620 gene locus_tag LOCUS_36250 206751 207620 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194150.1 protein_id gnl|my_center|LOCUS_36250 207622 208026 gene locus_tag LOCUS_36260 207622 208026 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194234.1 protein_id gnl|my_center|LOCUS_36260 208202 208038 gene locus_tag LOCUS_36270 208202 208038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 208609 209721 gene locus_tag LOCUS_36280 gene alr 208609 209721 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529079.1 protein_id gnl|my_center|LOCUS_36280 209847 211139 gene locus_tag LOCUS_36290 209847 211139 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085010.1 protein_id gnl|my_center|LOCUS_36290 211136 211726 gene locus_tag LOCUS_36300 211136 211726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 211769 213328 gene locus_tag LOCUS_36310 211769 213328 CDS product sigma-54-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406678.1 protein_id gnl|my_center|LOCUS_36310 213542 213366 gene locus_tag LOCUS_36320 213542 213366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 214300 213545 gene locus_tag LOCUS_36330 gene zapD 214300 213545 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195118.1 protein_id gnl|my_center|LOCUS_36330 215052 214438 gene locus_tag LOCUS_36340 gene coaE 215052 214438 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194322.1 protein_id gnl|my_center|LOCUS_36340 215915 215052 gene locus_tag LOCUS_36350 215915 215052 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707571.1 protein_id gnl|my_center|LOCUS_36350 217147 215915 gene locus_tag LOCUS_36360 217147 215915 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266635.1 protein_id gnl|my_center|LOCUS_36360 218890 217163 gene locus_tag LOCUS_36370 gene pilB 218890 217163 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070776.1 protein_id gnl|my_center|LOCUS_36370 220237 219185 gene locus_tag LOCUS_36380 220237 219185 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204136.1 protein_id gnl|my_center|LOCUS_36380 220442 220753 gene locus_tag LOCUS_36390 gene rplU 220442 220753 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194344.1 protein_id gnl|my_center|LOCUS_36390 220799 221056 gene locus_tag LOCUS_36400 gene rpmA 220799 221056 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194025.1 protein_id gnl|my_center|LOCUS_36400 221311 222423 gene locus_tag LOCUS_36410 gene obgE 221311 222423 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194312.1 protein_id gnl|my_center|LOCUS_36410 222702 223820 gene locus_tag LOCUS_36420 gene proB 222702 223820 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194262.1 protein_id gnl|my_center|LOCUS_36420 224400 223885 gene locus_tag LOCUS_36430 224400 223885 CDS product CNP1-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195111.1 protein_id gnl|my_center|LOCUS_36430 224976 224404 gene locus_tag LOCUS_36440 224976 224404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 225192 226940 gene locus_tag LOCUS_36450 225192 226940 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194217.1 protein_id gnl|my_center|LOCUS_36450 227114 227656 gene locus_tag LOCUS_36460 227114 227656 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688215.1 protein_id gnl|my_center|LOCUS_36460 227738 228547 gene locus_tag LOCUS_36470 227738 228547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 228618 229295 gene locus_tag LOCUS_36480 228618 229295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 229893 229486 gene locus_tag LOCUS_36490 229893 229486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 231507 230140 gene locus_tag LOCUS_36500 gene ffh 231507 230140 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194338.1 protein_id gnl|my_center|LOCUS_36500 232223 233383 gene locus_tag LOCUS_36510 232223 233383 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937886.1 protein_id gnl|my_center|LOCUS_36510 233603 234574 gene locus_tag LOCUS_36520 233603 234574 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211035.1 protein_id gnl|my_center|LOCUS_36520 234651 235469 gene locus_tag LOCUS_36530 234651 235469 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211034.1 protein_id gnl|my_center|LOCUS_36530 235471 236268 gene locus_tag LOCUS_36540 235471 236268 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064800.1 protein_id gnl|my_center|LOCUS_36540 236454 238256 gene locus_tag LOCUS_36550 236454 238256 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939039.1 protein_id gnl|my_center|LOCUS_36550 238321 239670 gene locus_tag LOCUS_36560 238321 239670 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529601.1 protein_id gnl|my_center|LOCUS_36560 239789 240598 gene locus_tag LOCUS_36570 gene ccsA 239789 240598 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194227.1 protein_id gnl|my_center|LOCUS_36570 240595 240843 gene locus_tag LOCUS_36580 240595 240843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 240864 242621 gene locus_tag LOCUS_36590 gene pilS 240864 242621 CDS product two-component system sensor histidine kinase PilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094692.1 protein_id gnl|my_center|LOCUS_36590 242618 244063 gene locus_tag LOCUS_36600 242618 244063 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183947609.1 protein_id gnl|my_center|LOCUS_36600 244578 247493 gene locus_tag LOCUS_36610 244578 247493 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194230.1 protein_id gnl|my_center|LOCUS_36610 247628 248806 gene locus_tag LOCUS_36620 247628 248806 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814929.1 protein_id gnl|my_center|LOCUS_36620 249400 250209 gene locus_tag LOCUS_36630 249400 250209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 250300 250851 gene locus_tag LOCUS_36640 250300 250851 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194943.1 protein_id gnl|my_center|LOCUS_36640 251943 250948 gene locus_tag LOCUS_36650 251943 250948 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119158.1 protein_id gnl|my_center|LOCUS_36650 252054 253331 gene locus_tag LOCUS_36660 252054 253331 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390598.1 protein_id gnl|my_center|LOCUS_36660 254846 253566 gene locus_tag LOCUS_36670 gene hemL 254846 253566 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527562.1 protein_id gnl|my_center|LOCUS_36670 255744 254929 gene locus_tag LOCUS_36680 255744 254929 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186397.1 protein_id gnl|my_center|LOCUS_36680 255872 256066 gene locus_tag LOCUS_36690 255872 256066 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186709.1 protein_id gnl|my_center|LOCUS_36690 256194 256586 gene locus_tag LOCUS_36700 gene pilG 256194 256586 CDS product twitching motility response regulator PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038048.1 protein_id gnl|my_center|LOCUS_36700 256621 256986 gene locus_tag LOCUS_36710 gene pilH 256621 256986 CDS product twitching motility response regulator PilH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266432.1 protein_id gnl|my_center|LOCUS_36710 257045 257629 gene locus_tag LOCUS_36720 257045 257629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 257690 260020 gene locus_tag LOCUS_36730 gene pilJ 257690 260020 CDS product chemotaxis chemoreceptor PilJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100940.1 protein_id gnl|my_center|LOCUS_36730 260384 267121 gene locus_tag LOCUS_36740 260384 267121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 269246 267756 gene locus_tag LOCUS_36750 269246 267756 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963159.1 protein_id gnl|my_center|LOCUS_36750 269373 270053 gene locus_tag LOCUS_36760 269373 270053 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185441.1 protein_id gnl|my_center|LOCUS_36760 270053 270448 gene locus_tag LOCUS_36770 gene ruvX 270053 270448 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186163.1 protein_id gnl|my_center|LOCUS_36770 270445 270957 gene locus_tag LOCUS_36780 gene pyrR 270445 270957 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185915.1 protein_id gnl|my_center|LOCUS_36780 270950 271921 gene locus_tag LOCUS_36790 270950 271921 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534003.1 protein_id gnl|my_center|LOCUS_36790 271929 273215 gene locus_tag LOCUS_36800 271929 273215 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186353.1 protein_id gnl|my_center|LOCUS_36800 273363 274121 gene locus_tag LOCUS_36810 273363 274121 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186297.1 protein_id gnl|my_center|LOCUS_36810 274942 274118 gene locus_tag LOCUS_36820 274942 274118 CDS product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929738.1 protein_id gnl|my_center|LOCUS_36820 276055 274949 gene locus_tag LOCUS_36830 gene hemH 276055 274949 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527679.1 protein_id gnl|my_center|LOCUS_36830 277715 276069 gene locus_tag LOCUS_36840 gene recN 277715 276069 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194023.1 protein_id gnl|my_center|LOCUS_36840 278686 277859 gene locus_tag LOCUS_36850 278686 277859 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533590.1 protein_id gnl|my_center|LOCUS_36850 278828 279514 gene locus_tag LOCUS_36860 278828 279514 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038978.1 protein_id gnl|my_center|LOCUS_36860 279559 280578 gene locus_tag LOCUS_36870 gene hrcA 279559 280578 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194248.1 protein_id gnl|my_center|LOCUS_36870 280735 281118 gene locus_tag LOCUS_36880 280735 281118 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023007.1 protein_id gnl|my_center|LOCUS_36880 281689 281249 gene locus_tag LOCUS_36890 gene fur 281689 281249 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194273.1 protein_id gnl|my_center|LOCUS_36890 281753 282322 gene locus_tag LOCUS_36900 281753 282322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 282329 283135 gene locus_tag LOCUS_36910 gene dapB 282329 283135 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557251.1 protein_id gnl|my_center|LOCUS_36910 283157 283804 gene locus_tag LOCUS_36920 283157 283804 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194134.1 protein_id gnl|my_center|LOCUS_36920 283874 284254 gene locus_tag LOCUS_36930 283874 284254 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812950.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36930 284406 287039 gene locus_tag LOCUS_36940 gene leuS 284406 287039 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810256.1 protein_id gnl|my_center|LOCUS_36940 287100 287609 gene locus_tag LOCUS_36950 287100 287609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 287611 288630 gene locus_tag LOCUS_36960 gene holA 287611 288630 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194041.1 protein_id gnl|my_center|LOCUS_36960 288780 290045 gene locus_tag LOCUS_36970 288780 290045 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557250.1 protein_id gnl|my_center|LOCUS_36970 290087 290509 gene locus_tag LOCUS_36980 290087 290509 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930898.1 protein_id gnl|my_center|LOCUS_36980 290606 291820 gene locus_tag LOCUS_36990 290606 291820 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194083.1 protein_id gnl|my_center|LOCUS_36990 291924 293405 gene locus_tag LOCUS_37000 gene gabD 291924 293405 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187560.1 protein_id gnl|my_center|LOCUS_37000 293510 294745 gene locus_tag LOCUS_37010 293510 294745 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036313.1 protein_id gnl|my_center|LOCUS_37010 295148 296224 gene locus_tag LOCUS_37020 295148 296224 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195141.1 protein_id gnl|my_center|LOCUS_37020 296431 296871 gene locus_tag LOCUS_37030 296431 296871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 296902 297864 gene locus_tag LOCUS_37040 296902 297864 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190439.1 protein_id gnl|my_center|LOCUS_37040 297942 298670 gene locus_tag LOCUS_37050 297942 298670 CDS product BPSS1780 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190835.1 protein_id gnl|my_center|LOCUS_37050 299110 298655 gene locus_tag LOCUS_37060 299110 298655 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549988.1 protein_id gnl|my_center|LOCUS_37060 299521 299949 gene locus_tag LOCUS_37070 gene rplM 299521 299949 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522094.1 protein_id gnl|my_center|LOCUS_37070 299959 300351 gene locus_tag LOCUS_37080 gene rpsI 299959 300351 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549989.1 protein_id gnl|my_center|LOCUS_37080 300530 301567 gene locus_tag LOCUS_37090 gene argC 300530 301567 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820599.1 protein_id gnl|my_center|LOCUS_37090 301577 302302 gene locus_tag LOCUS_37100 301577 302302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 302390 302779 gene locus_tag LOCUS_37110 302390 302779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 302829 303179 gene locus_tag LOCUS_37120 gene erpA 302829 303179 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194247.1 protein_id gnl|my_center|LOCUS_37120 303434 304915 gene locus_tag LOCUS_37130 303434 304915 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039543.1 protein_id gnl|my_center|LOCUS_37130 304954 306018 gene locus_tag LOCUS_37140 gene glcE 304954 306018 CDS product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194396.1 protein_id gnl|my_center|LOCUS_37140 306025 307290 gene locus_tag LOCUS_37150 gene glcF 306025 307290 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522135.1 protein_id gnl|my_center|LOCUS_37150 307884 307402 gene locus_tag LOCUS_37160 307884 307402 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192400.1 protein_id gnl|my_center|LOCUS_37160 309017 307881 gene locus_tag LOCUS_37170 309017 307881 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704392.1 protein_id gnl|my_center|LOCUS_37170 310106 309063 gene locus_tag LOCUS_37180 310106 309063 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070853.1 protein_id gnl|my_center|LOCUS_37180 310246 310983 gene locus_tag LOCUS_37190 310246 310983 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527690.1 protein_id gnl|my_center|LOCUS_37190 310973 311800 gene locus_tag LOCUS_37200 gene proC 310973 311800 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522133.1 protein_id gnl|my_center|LOCUS_37200 311924 313156 gene locus_tag LOCUS_37210 311924 313156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 313493 313200 gene locus_tag LOCUS_37220 313493 313200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224860.1 protein_id gnl|my_center|LOCUS_37220 314535 313528 gene locus_tag LOCUS_37230 314535 313528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 315276 314719 gene locus_tag LOCUS_37240 315276 314719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195773.1 protein_id gnl|my_center|LOCUS_37240 315636 315337 gene locus_tag LOCUS_37250 315636 315337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 316153 315842 gene locus_tag LOCUS_37260 316153 315842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 316478 317977 gene locus_tag LOCUS_37270 316478 317977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 318292 318074 gene locus_tag LOCUS_37280 318292 318074 CDS product DUF6434 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531986.1 protein_id gnl|my_center|LOCUS_37280 318432 319319 gene locus_tag LOCUS_37290 318432 319319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 319300 320352 gene locus_tag LOCUS_37300 319300 320352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 320509 323256 gene locus_tag LOCUS_37310 320509 323256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 326045 323253 gene locus_tag LOCUS_37320 326045 323253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 327489 326053 gene locus_tag LOCUS_37330 327489 326053 CDS product SWIM zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027699.1 protein_id gnl|my_center|LOCUS_37330 328539 327640 gene locus_tag LOCUS_37340 gene mmsB 328539 327640 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811743.1 protein_id gnl|my_center|LOCUS_37340 329940 328741 gene locus_tag LOCUS_37350 329940 328741 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063762.1 protein_id gnl|my_center|LOCUS_37350 330728 329937 gene locus_tag LOCUS_37360 330728 329937 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071830.1 protein_id gnl|my_center|LOCUS_37360 331885 330725 gene locus_tag LOCUS_37370 331885 330725 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811748.1 protein_id gnl|my_center|LOCUS_37370 333407 331896 gene locus_tag LOCUS_37380 333407 331896 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036454.1 protein_id gnl|my_center|LOCUS_37380 334261 335628 gene locus_tag LOCUS_37390 gene fumC 334261 335628 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705251.1 protein_id gnl|my_center|LOCUS_37390 336443 335805 gene locus_tag LOCUS_37400 336443 335805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 338188 336440 gene locus_tag LOCUS_37410 338188 336440 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522112.1 protein_id gnl|my_center|LOCUS_37410 338837 338181 gene locus_tag LOCUS_37420 338837 338181 CDS product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522113.1 protein_id gnl|my_center|LOCUS_37420 339384 338830 gene locus_tag LOCUS_37430 339384 338830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 342062 339762 gene locus_tag LOCUS_37440 gene metE 342062 339762 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938401.1 protein_id gnl|my_center|LOCUS_37440 342273 343193 gene locus_tag LOCUS_37450 342273 343193 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189234.1 protein_id gnl|my_center|LOCUS_37450 343501 345771 gene locus_tag LOCUS_37460 343501 345771 CDS product catecholate siderophore receptor Fiu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000430054.1 protein_id gnl|my_center|LOCUS_37460 347289 345997 gene locus_tag LOCUS_37470 347289 345997 CDS product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626085.1 protein_id gnl|my_center|LOCUS_37470 347619 347347 gene locus_tag LOCUS_37480 347619 347347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 348514 347648 gene locus_tag LOCUS_37490 348514 347648 CDS product ChaN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338346.1 protein_id gnl|my_center|LOCUS_37490 348902 348507 gene locus_tag LOCUS_37500 348902 348507 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005395273.1 protein_id gnl|my_center|LOCUS_37500 349874 348990 gene locus_tag LOCUS_37510 349874 348990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 350913 349852 gene locus_tag LOCUS_37520 350913 349852 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883993.1 protein_id gnl|my_center|LOCUS_37520 351917 350910 gene locus_tag LOCUS_37530 351917 350910 CDS product helical backbone metal receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531490.1 protein_id gnl|my_center|LOCUS_37530 353026 351905 gene locus_tag LOCUS_37540 353026 351905 CDS product hemin-degrading factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187023.1 protein_id gnl|my_center|LOCUS_37540 355233 353038 gene locus_tag LOCUS_37550 355233 353038 CDS product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920055.1 protein_id gnl|my_center|LOCUS_37550 355809 356525 gene locus_tag LOCUS_37560 gene trmB 355809 356525 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185899.1 protein_id gnl|my_center|LOCUS_37560 360423 356539 gene locus_tag LOCUS_37570 360423 356539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 363445 360926 gene locus_tag LOCUS_37580 363445 360926 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118645.1 protein_id gnl|my_center|LOCUS_37580 364067 363432 gene locus_tag LOCUS_37590 364067 363432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 365342 364302 gene locus_tag LOCUS_37600 365342 364302 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531377.1 protein_id gnl|my_center|LOCUS_37600 365709 366122 gene locus_tag LOCUS_37610 365709 366122 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070485.1 protein_id gnl|my_center|LOCUS_37610 366125 367030 gene locus_tag LOCUS_37620 366125 367030 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070486.1 protein_id gnl|my_center|LOCUS_37620 367173 368528 gene locus_tag LOCUS_37630 367173 368528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 369637 368813 gene locus_tag LOCUS_37640 369637 368813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 369829 370281 gene locus_tag LOCUS_37650 369829 370281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083828.1 protein_id gnl|my_center|LOCUS_37650 370386 370898 gene locus_tag LOCUS_37660 370386 370898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 371253 371663 gene locus_tag LOCUS_37670 371253 371663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 372606 371677 gene locus_tag LOCUS_37680 372606 371677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 373337 372786 gene locus_tag LOCUS_37690 373337 372786 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816758.1 protein_id gnl|my_center|LOCUS_37690 373854 375953 gene locus_tag LOCUS_37700 373854 375953 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089686.1 protein_id gnl|my_center|LOCUS_37700 376575 375997 gene locus_tag LOCUS_37710 376575 375997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 376907 378271 gene locus_tag LOCUS_37720 gene soxC 376907 378271 CDS product sulfite dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086300.1 protein_id gnl|my_center|LOCUS_37720 378273 379286 gene locus_tag LOCUS_37730 378273 379286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 379409 379897 gene locus_tag LOCUS_37740 379409 379897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37740 380194 380505 gene locus_tag LOCUS_37750 gene soxZ 380194 380505 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083832.1 protein_id gnl|my_center|LOCUS_37750 380518 381351 gene locus_tag LOCUS_37760 gene soxA 380518 381351 CDS product sulfur oxidation c-type cytochrome SoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228668.1 protein_id gnl|my_center|LOCUS_37760 381369 381992 gene locus_tag LOCUS_37770 gene soxX 381369 381992 CDS product sulfur oxidation c-type cytochrome SoxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228665.1 protein_id gnl|my_center|LOCUS_37770 382503 384218 gene locus_tag LOCUS_37780 gene soxB 382503 384218 CDS product thiosulfohydrolase SoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926971.1 protein_id gnl|my_center|LOCUS_37780 385564 384215 gene locus_tag LOCUS_37790 385564 384215 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038455.1 protein_id gnl|my_center|LOCUS_37790 386559 385561 gene locus_tag LOCUS_37800 386559 385561 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066267.1 protein_id gnl|my_center|LOCUS_37800 388241 386556 gene locus_tag LOCUS_37810 388241 386556 CDS product amylosucrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038457.1 protein_id gnl|my_center|LOCUS_37810 388140 388475 gene locus_tag LOCUS_37820 388140 388475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 391214 388848 gene locus_tag LOCUS_37830 391214 388848 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275273.1 protein_id gnl|my_center|LOCUS_37830 391991 393187 gene locus_tag LOCUS_37840 391991 393187 CDS product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242132.1 protein_id gnl|my_center|LOCUS_37840 393394 393663 gene locus_tag LOCUS_37850 393394 393663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 393756 394628 gene locus_tag LOCUS_37860 393756 394628 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444160.1 protein_id gnl|my_center|LOCUS_37860 394640 395419 gene locus_tag LOCUS_37870 394640 395419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 396559 395501 gene locus_tag LOCUS_37880 396559 395501 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919021.1 protein_id gnl|my_center|LOCUS_37880 397370 396678 gene locus_tag LOCUS_37890 397370 396678 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398720.1 protein_id gnl|my_center|LOCUS_37890 397797 397991 gene locus_tag LOCUS_37900 397797 397991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 398144 398629 gene locus_tag LOCUS_37910 398144 398629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 398773 398991 gene locus_tag LOCUS_37920 398773 398991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37920 399244 399714 gene locus_tag LOCUS_37930 399244 399714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 401716 399872 gene locus_tag LOCUS_37940 gene recQ 401716 399872 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198363.1 protein_id gnl|my_center|LOCUS_37940 402544 401732 gene locus_tag LOCUS_37950 402544 401732 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389556.1 protein_id gnl|my_center|LOCUS_37950 402775 402599 gene locus_tag LOCUS_37960 402775 402599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37960 403003 403575 gene locus_tag LOCUS_37970 403003 403575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37970 403895 403617 gene locus_tag LOCUS_37980 403895 403617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 403812 404267 gene locus_tag LOCUS_37990 403812 404267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 406193 404466 gene locus_tag LOCUS_38000 406193 404466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 408793 406757 gene locus_tag LOCUS_38010 408793 406757 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814040.1 protein_id gnl|my_center|LOCUS_38010 409064 408798 gene locus_tag LOCUS_38020 409064 408798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 410553 409051 gene locus_tag LOCUS_38030 410553 409051 CDS product sensor histidine kinase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526207.1 protein_id gnl|my_center|LOCUS_38030 411332 410595 gene locus_tag LOCUS_38040 411332 410595 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526208.1 protein_id gnl|my_center|LOCUS_38040 411736 412113 gene locus_tag LOCUS_38050 411736 412113 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640294.1 protein_id gnl|my_center|LOCUS_38050 412103 413383 gene locus_tag LOCUS_38060 412103 413383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060 413592 414221 gene locus_tag LOCUS_38070 413592 414221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 414679 414242 gene locus_tag LOCUS_38080 414679 414242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 415040 415531 gene locus_tag LOCUS_38090 415040 415531 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192835.1 protein_id gnl|my_center|LOCUS_38090 415564 417096 gene locus_tag LOCUS_38100 415564 417096 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064132.1 protein_id gnl|my_center|LOCUS_38100 417093 418334 gene locus_tag LOCUS_38110 417093 418334 CDS product EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205096.1 protein_id gnl|my_center|LOCUS_38110 418334 419893 gene locus_tag LOCUS_38120 418334 419893 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193982.1 protein_id gnl|my_center|LOCUS_38120 422327 419991 gene locus_tag LOCUS_38130 422327 419991 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206773.1 protein_id gnl|my_center|LOCUS_38130 424468 422579 gene locus_tag LOCUS_38140 424468 422579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 425825 424833 gene locus_tag LOCUS_38150 425825 424833 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582798.1 protein_id gnl|my_center|LOCUS_38150 426160 426990 gene locus_tag LOCUS_38160 426160 426990 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167226660.1 protein_id gnl|my_center|LOCUS_38160 427010 428173 gene locus_tag LOCUS_38170 427010 428173 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206046.1 protein_id gnl|my_center|LOCUS_38170 428175 429149 gene locus_tag LOCUS_38180 428175 429149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 430298 429192 gene locus_tag LOCUS_38190 430298 429192 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085560.1 protein_id gnl|my_center|LOCUS_38190 430544 430347 gene locus_tag LOCUS_38200 430544 430347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 430979 434296 gene locus_tag LOCUS_38210 430979 434296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 434293 435948 gene locus_tag LOCUS_38220 434293 435948 CDS product SWIM zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124765.1 protein_id gnl|my_center|LOCUS_38220 436416 438419 gene locus_tag LOCUS_38230 436416 438419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 439135 438464 gene locus_tag LOCUS_38240 439135 438464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 439859 439494 gene locus_tag LOCUS_38250 439859 439494 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942521.1 protein_id gnl|my_center|LOCUS_38250 441005 440241 gene locus_tag LOCUS_38260 441005 440241 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921407.1 protein_id gnl|my_center|LOCUS_38260 441196 441549 gene locus_tag LOCUS_38270 441196 441549 CDS product DUF1428 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367925.1 protein_id gnl|my_center|LOCUS_38270 442613 441690 gene locus_tag LOCUS_38280 442613 441690 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812099.1 protein_id gnl|my_center|LOCUS_38280 442737 443477 gene locus_tag LOCUS_38290 442737 443477 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928013.1 protein_id gnl|my_center|LOCUS_38290 443609 443821 gene locus_tag LOCUS_38300 443609 443821 CDS product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530653.1 protein_id gnl|my_center|LOCUS_38300 444798 443908 gene locus_tag LOCUS_38310 444798 443908 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464957.1 protein_id gnl|my_center|LOCUS_38310 444946 445809 gene locus_tag LOCUS_38320 444946 445809 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144396477.1 protein_id gnl|my_center|LOCUS_38320 445867 446286 gene locus_tag LOCUS_38330 445867 446286 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530093.1 protein_id gnl|my_center|LOCUS_38330 446652 447896 gene locus_tag LOCUS_38340 446652 447896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 448697 447969 gene locus_tag LOCUS_38350 448697 447969 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693159.1 protein_id gnl|my_center|LOCUS_38350 448959 449552 gene locus_tag LOCUS_38360 448959 449552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 449803 450621 gene locus_tag LOCUS_38370 449803 450621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38370 450762 451052 gene locus_tag LOCUS_38380 450762 451052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38380 451045 451572 gene locus_tag LOCUS_38390 451045 451572 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060300.1 protein_id gnl|my_center|LOCUS_38390 451569 452105 gene locus_tag LOCUS_38400 451569 452105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 455122 452909 gene locus_tag LOCUS_38410 455122 452909 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532900.1 protein_id gnl|my_center|LOCUS_38410 455291 457732 gene locus_tag LOCUS_38420 455291 457732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 457772 458758 gene locus_tag LOCUS_38430 457772 458758 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121256.1 protein_id gnl|my_center|LOCUS_38430 460946 458847 gene locus_tag LOCUS_38440 460946 458847 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105228.1 protein_id gnl|my_center|LOCUS_38440 461762 461166 gene locus_tag LOCUS_38450 461762 461166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 463434 461815 gene locus_tag LOCUS_38460 463434 461815 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113365.1 protein_id gnl|my_center|LOCUS_38460 464025 463456 gene locus_tag LOCUS_38470 464025 463456 CDS product cysteine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054993549.1 protein_id gnl|my_center|LOCUS_38470 465392 464064 gene locus_tag LOCUS_38480 465392 464064 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267510.1 protein_id gnl|my_center|LOCUS_38480 466412 465414 gene locus_tag LOCUS_38490 466412 465414 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742148.1 protein_id gnl|my_center|LOCUS_38490 468819 466402 gene locus_tag LOCUS_38500 468819 466402 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762818.1 protein_id gnl|my_center|LOCUS_38500 470020 469013 gene locus_tag LOCUS_38510 470020 469013 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026153082.1 protein_id gnl|my_center|LOCUS_38510 470468 470046 gene locus_tag LOCUS_38520 gene tolR 470468 470046 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388847.1 protein_id gnl|my_center|LOCUS_38520 471261 470470 gene locus_tag LOCUS_38530 471261 470470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38530 472028 471276 gene locus_tag LOCUS_38540 472028 471276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 472957 472064 gene locus_tag LOCUS_38550 472957 472064 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144270.1 protein_id gnl|my_center|LOCUS_38550 473960 472980 gene locus_tag LOCUS_38560 473960 472980 CDS product D-isomer specific 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267509.1 protein_id gnl|my_center|LOCUS_38560 475077 473974 gene locus_tag LOCUS_38570 475077 473974 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268532.1 protein_id gnl|my_center|LOCUS_38570 476375 475074 gene locus_tag LOCUS_38580 476375 475074 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268537.1 protein_id gnl|my_center|LOCUS_38580 477271 476378 gene locus_tag LOCUS_38590 477271 476378 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767689.1 protein_id gnl|my_center|LOCUS_38590 478167 477274 gene locus_tag LOCUS_38600 478167 477274 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767688.1 protein_id gnl|my_center|LOCUS_38600 479232 478297 gene locus_tag LOCUS_38610 479232 478297 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767686.1 protein_id gnl|my_center|LOCUS_38610 479656 481791 gene locus_tag LOCUS_38620 479656 481791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 484677 481891 gene locus_tag LOCUS_38630 484677 481891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38630 485191 486510 gene locus_tag LOCUS_38640 485191 486510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 488718 486634 gene locus_tag LOCUS_38650 488718 486634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 489151 490191 gene locus_tag LOCUS_38660 gene recA 489151 490191 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812760.1 protein_id gnl|my_center|LOCUS_38660 490348 490806 gene locus_tag LOCUS_38670 gene recX 490348 490806 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930990.1 protein_id gnl|my_center|LOCUS_38670 491401 491988 gene locus_tag LOCUS_38680 491401 491988 CDS product DUF2889 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189415.1 protein_id gnl|my_center|LOCUS_38680 492035 493204 gene locus_tag LOCUS_38690 gene sucC 492035 493204 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189251.1 protein_id gnl|my_center|LOCUS_38690 493223 494104 gene locus_tag LOCUS_38700 gene sucD 493223 494104 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550822.1 protein_id gnl|my_center|LOCUS_38700 494341 495114 gene locus_tag LOCUS_38710 494341 495114 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648703.1 protein_id gnl|my_center|LOCUS_38710 495145 495783 gene locus_tag LOCUS_38720 495145 495783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 495951 496919 gene locus_tag LOCUS_38730 495951 496919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 497966 496953 gene locus_tag LOCUS_38740 497966 496953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 499320 497959 gene locus_tag LOCUS_38750 499320 497959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545573.1 protein_id gnl|my_center|LOCUS_38750 500316 499381 gene locus_tag LOCUS_38760 500316 499381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 501143 500340 gene locus_tag LOCUS_38770 gene rfbF 501143 500340 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859505.1 protein_id gnl|my_center|LOCUS_38770 501948 501136 gene locus_tag LOCUS_38780 501948 501136 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921300.1 protein_id gnl|my_center|LOCUS_38780 503060 501951 gene locus_tag LOCUS_38790 503060 501951 CDS product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349320.1 protein_id gnl|my_center|LOCUS_38790 504904 503069 gene locus_tag LOCUS_38800 504904 503069 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023692.1 protein_id gnl|my_center|LOCUS_38800 506532 505009 gene locus_tag LOCUS_38810 506532 505009 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085758.1 protein_id gnl|my_center|LOCUS_38810 507873 506548 gene locus_tag LOCUS_38820 gene rfbH 507873 506548 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939427.1 protein_id gnl|my_center|LOCUS_38820 508765 507995 gene locus_tag LOCUS_38830 gene rfbF 508765 507995 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261038.1 protein_id gnl|my_center|LOCUS_38830 509300 508971 gene locus_tag LOCUS_38840 509300 508971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 509694 509311 gene locus_tag LOCUS_38850 509694 509311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 510010 509699 gene locus_tag LOCUS_38860 510010 509699 CDS product YqjD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200395.1 protein_id gnl|my_center|LOCUS_38860 511018 510152 gene locus_tag LOCUS_38870 gene ubiA 511018 510152 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194359.1 protein_id gnl|my_center|LOCUS_38870 511142 512455 gene locus_tag LOCUS_38880 gene ugpB 511142 512455 CDS product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811264.1 protein_id gnl|my_center|LOCUS_38880 512638 513519 gene locus_tag LOCUS_38890 gene ugpA 512638 513519 CDS product sn-glycerol-3-phosphate ABC transporter permease UgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811262.1 protein_id gnl|my_center|LOCUS_38890 513516 514373 gene locus_tag LOCUS_38900 gene ugpE 513516 514373 CDS product sn-glycerol-3-phosphate ABC transporter permease UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811259.1 protein_id gnl|my_center|LOCUS_38900 514396 515517 gene locus_tag LOCUS_38910 514396 515517 CDS product sn-glycerol-3-phosphate import ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196746.1 protein_id gnl|my_center|LOCUS_38910 515848 515573 gene locus_tag LOCUS_38920 515848 515573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 516148 516936 gene locus_tag LOCUS_38930 516148 516936 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477064.1 protein_id gnl|my_center|LOCUS_38930 519188 516909 gene locus_tag LOCUS_38940 519188 516909 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053799641.1 protein_id gnl|my_center|LOCUS_38940 519931 519377 gene locus_tag LOCUS_38950 gene rimJ 519931 519377 CDS product ribosomal protein S5-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704794.1 protein_id gnl|my_center|LOCUS_38950 520900 519956 gene locus_tag LOCUS_38960 520900 519956 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811203.1 protein_id gnl|my_center|LOCUS_38960 522017 521106 gene locus_tag LOCUS_38970 522017 521106 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206875.1 protein_id gnl|my_center|LOCUS_38970 522735 522361 gene locus_tag LOCUS_38980 522735 522361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 524103 522787 gene locus_tag LOCUS_38990 524103 522787 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023175504.1 protein_id gnl|my_center|LOCUS_38990 525551 524337 gene locus_tag LOCUS_39000 525551 524337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39000 525783 526175 gene locus_tag LOCUS_39010 525783 526175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 526762 526529 gene locus_tag LOCUS_39020 526762 526529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 526865 529516 gene locus_tag LOCUS_39030 526865 529516 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920148.1 protein_id gnl|my_center|LOCUS_39030 529695 531203 gene locus_tag LOCUS_39040 529695 531203 CDS product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919623.1 protein_id gnl|my_center|LOCUS_39040 531291 532490 gene locus_tag LOCUS_39050 531291 532490 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205497.1 protein_id gnl|my_center|LOCUS_39050 532888 534252 gene locus_tag LOCUS_39060 532888 534252 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814920.1 protein_id gnl|my_center|LOCUS_39060 534278 535963 gene locus_tag LOCUS_39070 534278 535963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 535997 538405 gene locus_tag LOCUS_39080 535997 538405 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989370.1 protein_id gnl|my_center|LOCUS_39080 538572 540488 gene locus_tag LOCUS_39090 538572 540488 CDS product bifunctional transcriptional regulator/glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204087.1 protein_id gnl|my_center|LOCUS_39090 540577 541731 gene locus_tag LOCUS_39100 540577 541731 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083636.1 protein_id gnl|my_center|LOCUS_39100 541852 542919 gene locus_tag LOCUS_39110 541852 542919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39110 543509 542934 gene locus_tag LOCUS_39120 543509 542934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 543857 543558 gene locus_tag LOCUS_39130 543857 543558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 544618 543854 gene locus_tag LOCUS_39140 544618 543854 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112932.1 protein_id gnl|my_center|LOCUS_39140 544734 545627 gene locus_tag LOCUS_39150 544734 545627 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927823.1 protein_id gnl|my_center|LOCUS_39150 545840 546676 gene locus_tag LOCUS_39160 545840 546676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 546739 547575 gene locus_tag LOCUS_39170 546739 547575 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813863.1 protein_id gnl|my_center|LOCUS_39170 547597 548001 gene locus_tag LOCUS_39180 547597 548001 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919370.1 protein_id gnl|my_center|LOCUS_39180 548526 548098 gene locus_tag LOCUS_39190 548526 548098 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200660.1 protein_id gnl|my_center|LOCUS_39190 549229 548795 gene locus_tag LOCUS_39200 549229 548795 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118000.1 protein_id gnl|my_center|LOCUS_39200 <550103 549460 gene locus_tag LOCUS_39210 <550103 549460 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206608.1:MotA/TolQ/ExbB proton channel family protein >Feature sequence055 >Feature sequence056 >Feature sequence057 >Feature sequence058 >Feature sequence059 >Feature sequence060 >Feature sequence061 >Feature sequence062 >Feature sequence063 >Feature sequence064 1316 972 gene locus_tag LOCUS_39220 1316 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39220 2136 1348 gene locus_tag LOCUS_39230 2136 1348 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461868.1 protein_id gnl|my_center|LOCUS_39230 3276 2239 gene locus_tag LOCUS_39240 3276 2239 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205586.1 protein_id gnl|my_center|LOCUS_39240 4239 3292 gene locus_tag LOCUS_39250 4239 3292 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065125.1 protein_id gnl|my_center|LOCUS_39250 5744 4632 gene locus_tag LOCUS_39260 gene mnmA 5744 4632 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544237.1 protein_id gnl|my_center|LOCUS_39260 6232 5744 gene locus_tag LOCUS_39270 6232 5744 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194031.1 protein_id gnl|my_center|LOCUS_39270 6774 7889 gene locus_tag LOCUS_39280 6774 7889 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112662.1 protein_id gnl|my_center|LOCUS_39280 7963 8328 gene locus_tag LOCUS_39290 7963 8328 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818672.1 protein_id gnl|my_center|LOCUS_39290 8419 8730 gene locus_tag LOCUS_39300 8419 8730 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813037.1 protein_id gnl|my_center|LOCUS_39300 8730 10163 gene locus_tag LOCUS_39310 8730 10163 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522105.1 protein_id gnl|my_center|LOCUS_39310 13482 10297 gene locus_tag LOCUS_39320 13482 10297 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524131.1 protein_id gnl|my_center|LOCUS_39320 15074 13494 gene locus_tag LOCUS_39330 15074 13494 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551660.1 protein_id gnl|my_center|LOCUS_39330 16441 15071 gene locus_tag LOCUS_39340 16441 15071 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113317.1 protein_id gnl|my_center|LOCUS_39340 16959 16552 gene locus_tag LOCUS_39350 16959 16552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 19272 17077 gene locus_tag LOCUS_39360 19272 17077 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105404.1 protein_id gnl|my_center|LOCUS_39360 19611 20057 gene locus_tag LOCUS_39370 gene cadR 19611 20057 CDS product Cd(II)/Pb(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195850.1 protein_id gnl|my_center|LOCUS_39370 20109 21161 gene locus_tag LOCUS_39380 20109 21161 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528582.1 protein_id gnl|my_center|LOCUS_39380 22093 21182 gene locus_tag LOCUS_39390 gene rocF 22093 21182 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808362.1 protein_id gnl|my_center|LOCUS_39390 23199 22126 gene locus_tag LOCUS_39400 23199 22126 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891456.1 protein_id gnl|my_center|LOCUS_39400 23594 24049 gene locus_tag LOCUS_39410 23594 24049 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266690.1 protein_id gnl|my_center|LOCUS_39410 24123 25379 gene locus_tag LOCUS_39420 24123 25379 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940840.1 protein_id gnl|my_center|LOCUS_39420 25376 26392 gene locus_tag LOCUS_39430 25376 26392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 26405 28066 gene locus_tag LOCUS_39440 26405 28066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 29969 28323 gene locus_tag LOCUS_39450 29969 28323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919016.1 protein_id gnl|my_center|LOCUS_39450 30201 30407 gene locus_tag LOCUS_39460 30201 30407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 30548 30336 gene locus_tag LOCUS_39470 30548 30336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39470 31838 30645 gene locus_tag LOCUS_39480 31838 30645 CDS product UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527722.1 protein_id gnl|my_center|LOCUS_39480 33223 31853 gene locus_tag LOCUS_39490 33223 31853 CDS product aminopeptidase P N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549996.1 protein_id gnl|my_center|LOCUS_39490 33939 33220 gene locus_tag LOCUS_39500 33939 33220 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927035.1 protein_id gnl|my_center|LOCUS_39500 34899 33949 gene locus_tag LOCUS_39510 34899 33949 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189686.1 protein_id gnl|my_center|LOCUS_39510 35161 37431 gene locus_tag LOCUS_39520 35161 37431 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189876.1 protein_id gnl|my_center|LOCUS_39520 37585 38982 gene locus_tag LOCUS_39530 37585 38982 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550859.1 protein_id gnl|my_center|LOCUS_39530 38982 40016 gene locus_tag LOCUS_39540 gene pdxA 38982 40016 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009970136.1 protein_id gnl|my_center|LOCUS_39540 40072 40848 gene locus_tag LOCUS_39550 gene rsmA 40072 40848 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189099.1 protein_id gnl|my_center|LOCUS_39550 41336 40899 gene locus_tag LOCUS_39560 41336 40899 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870063.1 protein_id gnl|my_center|LOCUS_39560 41825 43471 gene locus_tag LOCUS_39570 gene pgi 41825 43471 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869249.1 protein_id gnl|my_center|LOCUS_39570 44223 43804 gene locus_tag LOCUS_39580 44223 43804 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265697.1 protein_id gnl|my_center|LOCUS_39580 46703 44328 gene locus_tag LOCUS_39590 46703 44328 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943246.1 protein_id gnl|my_center|LOCUS_39590 47182 47946 gene locus_tag LOCUS_39600 47182 47946 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546308.1 protein_id gnl|my_center|LOCUS_39600 48049 49689 gene locus_tag LOCUS_39610 48049 49689 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056336.1 protein_id gnl|my_center|LOCUS_39610 49752 51992 gene locus_tag LOCUS_39620 49752 51992 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444419.1 protein_id gnl|my_center|LOCUS_39620 53300 52005 gene locus_tag LOCUS_39630 53300 52005 CDS product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087572.1 protein_id gnl|my_center|LOCUS_39630 53389 54831 gene locus_tag LOCUS_39640 gene mapR 53389 54831 CDS product GntR family transcriptional regulator MpaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201419982.1 protein_id gnl|my_center|LOCUS_39640 55762 54833 gene locus_tag LOCUS_39650 55762 54833 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040113.1 protein_id gnl|my_center|LOCUS_39650 55936 56775 gene locus_tag LOCUS_39660 gene legD1 55936 56775 CDS product Dot/Icm type IV secretion system effector LegD1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948394.1 protein_id gnl|my_center|LOCUS_39660 56814 57632 gene locus_tag LOCUS_39670 56814 57632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39670 57613 57768 gene locus_tag LOCUS_39680 57613 57768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39680 57806 58921 gene locus_tag LOCUS_39690 57806 58921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39690 59129 60079 gene locus_tag LOCUS_39700 59129 60079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39700 61745 60222 gene locus_tag LOCUS_39710 gene dacB 61745 60222 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091272.1 protein_id gnl|my_center|LOCUS_39710 62016 63989 gene locus_tag LOCUS_39720 gene rlhA 62016 63989 CDS product 23S rRNA 5-hydroxycytidine C2501 synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309488.1 protein_id gnl|my_center|LOCUS_39720 65393 64143 gene locus_tag LOCUS_39730 65393 64143 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813072.1 protein_id gnl|my_center|LOCUS_39730 67523 65502 gene locus_tag LOCUS_39740 67523 65502 CDS product alkyl sulfatase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965832.1 protein_id gnl|my_center|LOCUS_39740 67688 68593 gene locus_tag LOCUS_39750 67688 68593 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114165.1 protein_id gnl|my_center|LOCUS_39750 70918 68663 gene locus_tag LOCUS_39760 70918 68663 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920130.1 protein_id gnl|my_center|LOCUS_39760 71463 70930 gene locus_tag LOCUS_39770 71463 70930 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102736.1 protein_id gnl|my_center|LOCUS_39770 72522 71545 gene locus_tag LOCUS_39780 72522 71545 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124396.1 protein_id gnl|my_center|LOCUS_39780 72615 73517 gene locus_tag LOCUS_39790 72615 73517 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920971.1 protein_id gnl|my_center|LOCUS_39790 74190 73522 gene locus_tag LOCUS_39800 gene pgeF 74190 73522 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816160.1 protein_id gnl|my_center|LOCUS_39800 75120 74308 gene locus_tag LOCUS_39810 75120 74308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39810 75260 75928 gene locus_tag LOCUS_39820 75260 75928 CDS product thioesterase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001172947.1 protein_id gnl|my_center|LOCUS_39820 78889 76421 gene locus_tag LOCUS_39830 78889 76421 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037795.1 protein_id gnl|my_center|LOCUS_39830 79516 80526 gene locus_tag LOCUS_39840 79516 80526 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072259.1 protein_id gnl|my_center|LOCUS_39840 80940 83333 gene locus_tag LOCUS_39850 80940 83333 CDS product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861838.1 protein_id gnl|my_center|LOCUS_39850 83326 83979 gene locus_tag LOCUS_39860 gene pgmB 83326 83979 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990084.1 protein_id gnl|my_center|LOCUS_39860 84057 85313 gene locus_tag LOCUS_39870 84057 85313 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958165.1 protein_id gnl|my_center|LOCUS_39870 85389 86405 gene locus_tag LOCUS_39880 85389 86405 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530800.1 protein_id gnl|my_center|LOCUS_39880 88478 86442 gene locus_tag LOCUS_39890 88478 86442 CDS product 10S-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114857.1 protein_id gnl|my_center|LOCUS_39890 89053 88697 gene locus_tag LOCUS_39900 89053 88697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39900 89518 89946 gene locus_tag LOCUS_39910 89518 89946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39910 89956 91359 gene locus_tag LOCUS_39920 89956 91359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39920 91410 91877 gene locus_tag LOCUS_39930 91410 91877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39930 91896 92585 gene locus_tag LOCUS_39940 91896 92585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39940 92715 94004 gene locus_tag LOCUS_39950 92715 94004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39950 95745 94330 gene locus_tag LOCUS_39960 95745 94330 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038812.1 protein_id gnl|my_center|LOCUS_39960 96870 96550 gene locus_tag LOCUS_39970 96870 96550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39970 97250 97879 gene locus_tag LOCUS_39980 97250 97879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39980 98621 97977 gene locus_tag LOCUS_39990 98621 97977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39990 98891 99919 gene locus_tag LOCUS_40000 98891 99919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40000 100058 100222 gene locus_tag LOCUS_40010 100058 100222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40010 100602 100955 gene locus_tag LOCUS_40020 100602 100955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 101030 101299 gene locus_tag LOCUS_40030 101030 101299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40030 101442 101756 gene locus_tag LOCUS_40040 101442 101756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 103563 102361 gene locus_tag LOCUS_40050 103563 102361 CDS product DUF3322 and DUF2220 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727563.1 protein_id gnl|my_center|LOCUS_40050 106940 103560 gene locus_tag LOCUS_40060 106940 103560 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039227.1 protein_id gnl|my_center|LOCUS_40060 107613 106933 gene locus_tag LOCUS_40070 107613 106933 CDS product DUF4194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727561.1 protein_id gnl|my_center|LOCUS_40070 109064 107610 gene locus_tag LOCUS_40080 109064 107610 CDS product DUF3375 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892661.1 protein_id gnl|my_center|LOCUS_40080 109637 109939 gene locus_tag LOCUS_40090 109637 109939 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040056.1 protein_id gnl|my_center|LOCUS_40090 109943 110317 gene locus_tag LOCUS_40100 109943 110317 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810732.1 protein_id gnl|my_center|LOCUS_40100 111220 110513 gene locus_tag LOCUS_40110 111220 110513 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087772.1 protein_id gnl|my_center|LOCUS_40110 114484 111221 gene locus_tag LOCUS_40120 114484 111221 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087773.1 protein_id gnl|my_center|LOCUS_40120 115542 114481 gene locus_tag LOCUS_40130 115542 114481 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103420.1 protein_id gnl|my_center|LOCUS_40130 116843 115539 gene locus_tag LOCUS_40140 116843 115539 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087774.1 protein_id gnl|my_center|LOCUS_40140 119418 116836 gene locus_tag LOCUS_40150 119418 116836 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087775.1 protein_id gnl|my_center|LOCUS_40150 119956 119597 gene locus_tag LOCUS_tm00010 119956 119597 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 120678 120001 gene locus_tag LOCUS_40160 gene gph 120678 120001 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190123.1 protein_id gnl|my_center|LOCUS_40160 121441 120737 gene locus_tag LOCUS_40170 121441 120737 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532296.1 protein_id gnl|my_center|LOCUS_40170 122330 121671 gene locus_tag LOCUS_40180 122330 121671 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813377.1 protein_id gnl|my_center|LOCUS_40180 123224 122637 gene locus_tag LOCUS_40190 123224 122637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40190 123505 126153 gene locus_tag LOCUS_40200 gene gyrA 123505 126153 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926826.1 protein_id gnl|my_center|LOCUS_40200 126160 127263 gene locus_tag LOCUS_40210 gene serC 126160 127263 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189993.1 protein_id gnl|my_center|LOCUS_40210 127533 128606 gene locus_tag LOCUS_40220 gene pheA 127533 128606 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190098.1 protein_id gnl|my_center|LOCUS_40220 128614 129522 gene locus_tag LOCUS_40230 128614 129522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_40230 129576 130913 gene locus_tag LOCUS_40240 129576 130913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_40240 130944 131621 gene locus_tag LOCUS_40250 gene cmk 130944 131621 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813361.1 protein_id gnl|my_center|LOCUS_40250 131756 133474 gene locus_tag LOCUS_40260 gene rpsA 131756 133474 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189285.1 protein_id gnl|my_center|LOCUS_40260 133500 133805 gene locus_tag LOCUS_40270 133500 133805 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189865.1 protein_id gnl|my_center|LOCUS_40270 134066 134380 gene locus_tag LOCUS_40280 134066 134380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40280 134517 135692 gene locus_tag LOCUS_40290 gene lapB 134517 135692 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188993.1 protein_id gnl|my_center|LOCUS_40290 135918 137297 gene locus_tag LOCUS_40300 135918 137297 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539365.1 protein_id gnl|my_center|LOCUS_40300 137322 138239 gene locus_tag LOCUS_40310 gene rfaE1 137322 138239 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189069.1 protein_id gnl|my_center|LOCUS_40310 139117 138314 gene locus_tag LOCUS_40320 139117 138314 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125007115.1 protein_id gnl|my_center|LOCUS_40320 139292 140182 gene locus_tag LOCUS_40330 139292 140182 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082953.1 protein_id gnl|my_center|LOCUS_40330 140456 140878 gene locus_tag LOCUS_40340 140456 140878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40340 141216 142118 gene locus_tag LOCUS_40350 gene cysM 141216 142118 CDS product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532363.1 protein_id gnl|my_center|LOCUS_40350 142744 142445 gene locus_tag LOCUS_40360 142744 142445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40360 144197 143058 gene locus_tag LOCUS_40370 144197 143058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40370 146223 144214 gene locus_tag LOCUS_40380 gene tgpA 146223 144214 CDS product protein-glutamine gamma-glutamyltransferase TgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114743.1 protein_id gnl|my_center|LOCUS_40380 147230 146220 gene locus_tag LOCUS_40390 147230 146220 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765784.1 protein_id gnl|my_center|LOCUS_40390 148137 147217 gene locus_tag LOCUS_40400 148137 147217 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738027.1 protein_id gnl|my_center|LOCUS_40400 148413 149351 gene locus_tag LOCUS_40410 148413 149351 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533906.1 protein_id gnl|my_center|LOCUS_40410 149351 149908 gene locus_tag LOCUS_40420 149351 149908 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532798.1 protein_id gnl|my_center|LOCUS_40420 149929 150468 gene locus_tag LOCUS_40430 149929 150468 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962259.1 protein_id gnl|my_center|LOCUS_40430 150905 150465 gene locus_tag LOCUS_40440 150905 150465 CDS product DUF4952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958567.1 protein_id gnl|my_center|LOCUS_40440 151285 152217 gene locus_tag LOCUS_40450 gene ylqF 151285 152217 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072540.1 protein_id gnl|my_center|LOCUS_40450 152214 152999 gene locus_tag LOCUS_40460 152214 152999 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257230.1 protein_id gnl|my_center|LOCUS_40460 153474 153046 gene locus_tag LOCUS_40470 153474 153046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 154312 153596 gene locus_tag LOCUS_40480 154312 153596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 155677 154340 gene locus_tag LOCUS_40490 155677 154340 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036840.1 protein_id gnl|my_center|LOCUS_40490 156369 155674 gene locus_tag LOCUS_40500 156369 155674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40500 156968 156366 gene locus_tag LOCUS_40510 156968 156366 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965738.1 protein_id gnl|my_center|LOCUS_40510 157468 157854 gene locus_tag LOCUS_40520 157468 157854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 157881 160070 gene locus_tag LOCUS_40530 157881 160070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530 160128 160649 gene locus_tag LOCUS_40540 160128 160649 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932750.1 protein_id gnl|my_center|LOCUS_40540 160646 160897 gene locus_tag LOCUS_40550 160646 160897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 161015 162124 gene locus_tag LOCUS_40560 161015 162124 CDS product DUF3570 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926978.1 protein_id gnl|my_center|LOCUS_40560 162279 164156 gene locus_tag LOCUS_40570 gene dsbD 162279 164156 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926979.1 protein_id gnl|my_center|LOCUS_40570 164174 165148 gene locus_tag LOCUS_40580 gene trxB 164174 165148 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186294.1 protein_id gnl|my_center|LOCUS_40580 165986 165318 gene locus_tag LOCUS_40590 165986 165318 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244654.1 protein_id gnl|my_center|LOCUS_40590 166453 167220 gene locus_tag LOCUS_40600 166453 167220 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188202.1 protein_id gnl|my_center|LOCUS_40600 168196 167258 gene locus_tag LOCUS_40610 168196 167258 CDS product 4-hydroxyproline epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206386.1 protein_id gnl|my_center|LOCUS_40610 169020 168349 gene locus_tag LOCUS_40620 169020 168349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40620 169193 171187 gene locus_tag LOCUS_40630 169193 171187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 172113 171214 gene locus_tag LOCUS_40640 172113 171214 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526401.1 protein_id gnl|my_center|LOCUS_40640 173515 172235 gene locus_tag LOCUS_40650 173515 172235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40650 173722 174249 gene locus_tag LOCUS_40660 173722 174249 CDS product DTW domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766709.1 protein_id gnl|my_center|LOCUS_40660 174597 174265 gene locus_tag LOCUS_40670 174597 174265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40670 175146 174703 gene locus_tag LOCUS_40680 175146 174703 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265636.1 protein_id gnl|my_center|LOCUS_40680 177400 175418 gene locus_tag LOCUS_40690 177400 175418 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920498.1 protein_id gnl|my_center|LOCUS_40690 179565 177913 gene locus_tag LOCUS_40700 gene groL 179565 177913 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185913.1 protein_id gnl|my_center|LOCUS_40700 179897 179607 gene locus_tag LOCUS_40710 gene groES 179897 179607 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186661.1 protein_id gnl|my_center|LOCUS_40710 180534 181511 gene locus_tag LOCUS_40720 180534 181511 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762569.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40720 181529 182818 gene locus_tag LOCUS_40730 181529 182818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40730 183706 182804 gene locus_tag LOCUS_40740 183706 182804 CDS product HTH-type transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523490.1 protein_id gnl|my_center|LOCUS_40740 183961 184566 gene locus_tag LOCUS_40750 183961 184566 CDS product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943404.1 protein_id gnl|my_center|LOCUS_40750 184726 185016 gene locus_tag LOCUS_40760 184726 185016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40760 185127 186554 gene locus_tag LOCUS_40770 185127 186554 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529972.1 protein_id gnl|my_center|LOCUS_40770 186578 187990 gene locus_tag LOCUS_40780 186578 187990 CDS product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529973.1 protein_id gnl|my_center|LOCUS_40780 188179 188796 gene locus_tag LOCUS_40790 188179 188796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40790 189366 189572 gene locus_tag LOCUS_40800 189366 189572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40800 190605 189721 gene locus_tag LOCUS_40810 gene gluQRS 190605 189721 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186469.1 protein_id gnl|my_center|LOCUS_40810 191532 190615 gene locus_tag LOCUS_40820 191532 190615 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811174.1 protein_id gnl|my_center|LOCUS_40820 191651 192352 gene locus_tag LOCUS_40830 191651 192352 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568463.1 protein_id gnl|my_center|LOCUS_40830 192494 193063 gene locus_tag LOCUS_40840 192494 193063 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038751.1 protein_id gnl|my_center|LOCUS_40840 193610 193206 gene locus_tag LOCUS_40850 193610 193206 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809248.1 protein_id gnl|my_center|LOCUS_40850 194080 193676 gene locus_tag LOCUS_40860 194080 193676 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809248.1 protein_id gnl|my_center|LOCUS_40860 194440 194090 gene locus_tag LOCUS_40870 194440 194090 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082795.1 protein_id gnl|my_center|LOCUS_40870 194899 194462 gene locus_tag LOCUS_40880 194899 194462 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926507.1 protein_id gnl|my_center|LOCUS_40880 196272 194983 gene locus_tag LOCUS_40890 196272 194983 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082803.1 protein_id gnl|my_center|LOCUS_40890 197269 196442 gene locus_tag LOCUS_40900 197269 196442 CDS product DUF2145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038687.1 protein_id gnl|my_center|LOCUS_40900 197709 197266 gene locus_tag LOCUS_40910 197709 197266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40910 199983 197923 gene locus_tag LOCUS_40920 199983 197923 CDS product M13 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073607.1 protein_id gnl|my_center|LOCUS_40920 201272 200367 gene locus_tag LOCUS_40930 201272 200367 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185449.1 protein_id gnl|my_center|LOCUS_40930 201800 201321 gene locus_tag LOCUS_40940 201800 201321 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775709.1 protein_id gnl|my_center|LOCUS_40940 202664 201837 gene locus_tag LOCUS_40950 202664 201837 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038759.1 protein_id gnl|my_center|LOCUS_40950 203831 202707 gene locus_tag LOCUS_40960 203831 202707 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481721.1 protein_id gnl|my_center|LOCUS_40960 205221 203980 gene locus_tag LOCUS_40970 205221 203980 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204969.1 protein_id gnl|my_center|LOCUS_40970 205457 206203 gene locus_tag LOCUS_40980 gene ugpQ 205457 206203 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099123.1 protein_id gnl|my_center|LOCUS_40980 206356 206679 gene locus_tag LOCUS_40990 206356 206679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40990 207594 206953 gene locus_tag LOCUS_41000 207594 206953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41000 207908 208666 gene locus_tag LOCUS_41010 207908 208666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41010 209258 208797 gene locus_tag LOCUS_41020 209258 208797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41020 209667 209422 gene locus_tag LOCUS_41030 209667 209422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41030 210634 210308 gene locus_tag LOCUS_41040 210634 210308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41040 211195 210827 gene locus_tag LOCUS_41050 211195 210827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41050 211957 211427 gene locus_tag LOCUS_41060 211957 211427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41060 212905 212660 gene locus_tag LOCUS_41070 212905 212660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41070 213146 215758 gene locus_tag LOCUS_41080 gene alaS 213146 215758 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204967.1 protein_id gnl|my_center|LOCUS_41080 215755 216276 gene locus_tag LOCUS_41090 215755 216276 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707675.1 protein_id gnl|my_center|LOCUS_41090 216375 216893 gene locus_tag LOCUS_41100 216375 216893 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193543.1 protein_id gnl|my_center|LOCUS_41100 217286 217513 gene locus_tag LOCUS_41110 217286 217513 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193727.1 protein_id gnl|my_center|LOCUS_41110 218116 218868 gene locus_tag LOCUS_41120 218116 218868 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930110.1 protein_id gnl|my_center|LOCUS_41120 218965 219906 gene locus_tag LOCUS_41130 218965 219906 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813337.1 protein_id gnl|my_center|LOCUS_41130 220013 221803 gene locus_tag LOCUS_41140 220013 221803 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533897.1 protein_id gnl|my_center|LOCUS_41140 222076 223770 gene locus_tag LOCUS_41150 gene poxB 222076 223770 CDS product ubiquinone-dependent pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994147.1 protein_id gnl|my_center|LOCUS_41150 223856 224059 gene locus_tag LOCUS_41160 223856 224059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41160 224370 224849 gene locus_tag LOCUS_41170 224370 224849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41170 224924 225118 gene locus_tag LOCUS_41180 224924 225118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41180 225099 226004 gene locus_tag LOCUS_41190 225099 226004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528199.1 protein_id gnl|my_center|LOCUS_41190 226695 226267 gene locus_tag LOCUS_41200 226695 226267 CDS product NINE protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189308.1 protein_id gnl|my_center|LOCUS_41200 226881 227129 gene locus_tag LOCUS_41210 gene rpsP 226881 227129 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189402.1 protein_id gnl|my_center|LOCUS_41210 227141 227683 gene locus_tag LOCUS_41220 gene rimM 227141 227683 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527496.1 protein_id gnl|my_center|LOCUS_41220 227843 228589 gene locus_tag LOCUS_41230 gene trmD 227843 228589 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189914.1 protein_id gnl|my_center|LOCUS_41230 228720 229103 gene locus_tag LOCUS_41240 gene rplS 228720 229103 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217809.1 protein_id gnl|my_center|LOCUS_41240 229259 229948 gene locus_tag LOCUS_41250 229259 229948 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550123.1 protein_id gnl|my_center|LOCUS_41250 230225 231175 gene locus_tag LOCUS_41260 230225 231175 CDS product CobD/CbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195964.1 protein_id gnl|my_center|LOCUS_41260 231286 231858 gene locus_tag LOCUS_41270 231286 231858 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819219.1 protein_id gnl|my_center|LOCUS_41270 231887 233056 gene locus_tag LOCUS_41280 231887 233056 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003160261.1 protein_id gnl|my_center|LOCUS_41280 232963 233157 gene locus_tag LOCUS_41290 232963 233157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41290 233369 233701 gene locus_tag LOCUS_41300 233369 233701 CDS product DUF3579 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189028.1 protein_id gnl|my_center|LOCUS_41300 234681 233770 gene locus_tag LOCUS_41310 234681 233770 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090000.1 protein_id gnl|my_center|LOCUS_41310 234783 235514 gene locus_tag LOCUS_41320 234783 235514 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113600.1 protein_id gnl|my_center|LOCUS_41320 235709 236464 gene locus_tag LOCUS_41330 235709 236464 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190784.1 protein_id gnl|my_center|LOCUS_41330 236489 236938 gene locus_tag LOCUS_41340 236489 236938 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039868.1 protein_id gnl|my_center|LOCUS_41340 237017 238243 gene locus_tag LOCUS_41350 237017 238243 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522404.1 protein_id gnl|my_center|LOCUS_41350 238378 240087 gene locus_tag LOCUS_41360 238378 240087 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389067.1 protein_id gnl|my_center|LOCUS_41360 240356 240180 gene locus_tag LOCUS_41370 240356 240180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41370 240944 240435 gene locus_tag LOCUS_41380 240944 240435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269366.1 protein_id gnl|my_center|LOCUS_41380 241104 241766 gene locus_tag LOCUS_41390 241104 241766 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189255.1 protein_id gnl|my_center|LOCUS_41390 241763 243088 gene locus_tag LOCUS_41400 241763 243088 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190128.1 protein_id gnl|my_center|LOCUS_41400 243290 243829 gene locus_tag LOCUS_41410 gene pal 243290 243829 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186227.1 protein_id gnl|my_center|LOCUS_41410 244023 244859 gene locus_tag LOCUS_41420 gene pbpG 244023 244859 CDS product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114239.1 protein_id gnl|my_center|LOCUS_41420 245259 246359 gene locus_tag LOCUS_41430 245259 246359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939277.1 protein_id gnl|my_center|LOCUS_41430 246396 246836 gene locus_tag LOCUS_41440 gene arr 246396 246836 CDS product NAD(+)--rifampin ADP-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811445.1 protein_id gnl|my_center|LOCUS_41440 246894 247451 gene locus_tag LOCUS_41450 246894 247451 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083119.1 protein_id gnl|my_center|LOCUS_41450 248073 247669 gene locus_tag LOCUS_41460 248073 247669 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252508.1 protein_id gnl|my_center|LOCUS_41460 248160 248708 gene locus_tag LOCUS_41470 248160 248708 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014509305.1 protein_id gnl|my_center|LOCUS_41470 248782 249639 gene locus_tag LOCUS_41480 248782 249639 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170580.1 protein_id gnl|my_center|LOCUS_41480 250328 251542 gene locus_tag LOCUS_41490 250328 251542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41490 252462 251659 gene locus_tag LOCUS_41500 252462 251659 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297705.1 protein_id gnl|my_center|LOCUS_41500 252866 252621 gene locus_tag LOCUS_41510 252866 252621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41510 253462 252857 gene locus_tag LOCUS_41520 253462 252857 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038983.1 protein_id gnl|my_center|LOCUS_41520 254592 253459 gene locus_tag LOCUS_41530 254592 253459 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640160.1 protein_id gnl|my_center|LOCUS_41530 256584 254758 gene locus_tag LOCUS_41540 256584 254758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41540 258652 256796 gene locus_tag LOCUS_41550 gene sppA 258652 256796 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038843.1 protein_id gnl|my_center|LOCUS_41550 259724 258711 gene locus_tag LOCUS_41560 259724 258711 CDS product S1/P1 nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069704.1 protein_id gnl|my_center|LOCUS_41560 260712 260002 gene locus_tag LOCUS_41570 260712 260002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41570 260933 262618 gene locus_tag LOCUS_41580 260933 262618 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225531.1 protein_id gnl|my_center|LOCUS_41580 262997 263311 gene locus_tag LOCUS_41590 262997 263311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41590 263628 264434 gene locus_tag LOCUS_41600 263628 264434 CDS product cystine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191674.1 protein_id gnl|my_center|LOCUS_41600 264564 265223 gene locus_tag LOCUS_41610 264564 265223 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084339.1 protein_id gnl|my_center|LOCUS_41610 266017 265256 gene locus_tag LOCUS_41620 266017 265256 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537627.1 protein_id gnl|my_center|LOCUS_41620 267665 266157 gene locus_tag LOCUS_41630 267665 266157 CDS product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920649.1 protein_id gnl|my_center|LOCUS_41630 270582 267817 gene locus_tag LOCUS_41640 270582 267817 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918334.1 protein_id gnl|my_center|LOCUS_41640 271386 272936 gene locus_tag LOCUS_41650 271386 272936 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920215.1 protein_id gnl|my_center|LOCUS_41650 273636 272998 gene locus_tag LOCUS_41660 273636 272998 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973894.1 protein_id gnl|my_center|LOCUS_41660 273953 276445 gene locus_tag LOCUS_41670 273953 276445 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027033.1 protein_id gnl|my_center|LOCUS_41670 277656 276496 gene locus_tag LOCUS_41680 277656 276496 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174809.1 protein_id gnl|my_center|LOCUS_41680 277915 278892 gene locus_tag LOCUS_41690 277915 278892 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817370.1 protein_id gnl|my_center|LOCUS_41690 279032 280102 gene locus_tag LOCUS_41700 279032 280102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926121.1 protein_id gnl|my_center|LOCUS_41700 280521 280297 gene locus_tag LOCUS_41710 280521 280297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41710 280910 283222 gene locus_tag LOCUS_41720 280910 283222 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221892407.1 protein_id gnl|my_center|LOCUS_41720 283287 284432 gene locus_tag LOCUS_41730 283287 284432 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872371.1 protein_id gnl|my_center|LOCUS_41730 284488 285171 gene locus_tag LOCUS_41740 284488 285171 CDS product Fe2+-dependent dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002163149.1 protein_id gnl|my_center|LOCUS_41740 285307 285576 gene locus_tag LOCUS_41750 285307 285576 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054775.1 protein_id gnl|my_center|LOCUS_41750 285593 286165 gene locus_tag LOCUS_41760 285593 286165 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970806.1 protein_id gnl|my_center|LOCUS_41760 286956 287894 gene locus_tag LOCUS_41770 286956 287894 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198203.1 protein_id gnl|my_center|LOCUS_41770 287911 288645 gene locus_tag LOCUS_41780 287911 288645 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113827.1 protein_id gnl|my_center|LOCUS_41780 288642 289766 gene locus_tag LOCUS_41790 gene nagA 288642 289766 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195336.1 protein_id gnl|my_center|LOCUS_41790 289759 290769 gene locus_tag LOCUS_41800 289759 290769 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003148055.1 protein_id gnl|my_center|LOCUS_41800 290940 292196 gene locus_tag LOCUS_41810 290940 292196 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920974.1 protein_id gnl|my_center|LOCUS_41810 292193 293086 gene locus_tag LOCUS_41820 292193 293086 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056604.1 protein_id gnl|my_center|LOCUS_41820 293089 293910 gene locus_tag LOCUS_41830 293089 293910 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256995.1 protein_id gnl|my_center|LOCUS_41830 293907 295460 gene locus_tag LOCUS_41840 293907 295460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41840 295477 296577 gene locus_tag LOCUS_41850 gene ugpC 295477 296577 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199035.1 protein_id gnl|my_center|LOCUS_41850 296815 296600 gene locus_tag LOCUS_41860 296815 296600 CDS product DUF4287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061368.1 protein_id gnl|my_center|LOCUS_41860 300735 297034 gene locus_tag LOCUS_41870 300735 297034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41870 301821 300904 gene locus_tag LOCUS_41880 301821 300904 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645865.1 protein_id gnl|my_center|LOCUS_41880 301944 302954 gene locus_tag LOCUS_41890 301944 302954 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142257.1 protein_id gnl|my_center|LOCUS_41890 303083 303526 gene locus_tag LOCUS_41900 303083 303526 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892844.1 protein_id gnl|my_center|LOCUS_41900 303592 304068 gene locus_tag LOCUS_41910 303592 304068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41910 304929 304075 gene locus_tag LOCUS_41920 304929 304075 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703477.1 protein_id gnl|my_center|LOCUS_41920 305065 305778 gene locus_tag LOCUS_41930 305065 305778 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526980.1 protein_id gnl|my_center|LOCUS_41930 305928 306371 gene locus_tag LOCUS_41940 305928 306371 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975376.1 protein_id gnl|my_center|LOCUS_41940 307296 306412 gene locus_tag LOCUS_41950 307296 306412 CDS product DUF2306 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918777.1 protein_id gnl|my_center|LOCUS_41950 308269 307463 gene locus_tag LOCUS_41960 308269 307463 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038759.1 protein_id gnl|my_center|LOCUS_41960 309177 308266 gene locus_tag LOCUS_41970 309177 308266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41970 309620 310336 gene locus_tag LOCUS_41980 309620 310336 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120462.1 protein_id gnl|my_center|LOCUS_41980 310807 310385 gene locus_tag LOCUS_41990 310807 310385 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086787.1 protein_id gnl|my_center|LOCUS_41990 312346 311030 gene locus_tag LOCUS_42000 312346 311030 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786054.1 protein_id gnl|my_center|LOCUS_42000 312993 313406 gene locus_tag LOCUS_42010 312993 313406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42010 313627 314292 gene locus_tag LOCUS_42020 313627 314292 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931888.1 protein_id gnl|my_center|LOCUS_42020 314268 315659 gene locus_tag LOCUS_42030 314268 315659 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950993.1 protein_id gnl|my_center|LOCUS_42030 316622 315786 gene locus_tag LOCUS_42040 316622 315786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42040 318597 317293 gene locus_tag LOCUS_42050 318597 317293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42050 318837 319229 gene locus_tag LOCUS_42060 318837 319229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42060 319312 319653 gene locus_tag LOCUS_42070 319312 319653 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037758.1 protein_id gnl|my_center|LOCUS_42070 319983 319672 gene locus_tag LOCUS_42080 319983 319672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42080 320536 320129 gene locus_tag LOCUS_42090 320536 320129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42090 323399 320700 gene locus_tag LOCUS_42100 323399 320700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42100 324403 323600 gene locus_tag LOCUS_42110 324403 323600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42110 324508 325200 gene locus_tag LOCUS_42120 324508 325200 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815911.1 protein_id gnl|my_center|LOCUS_42120 326002 325208 gene locus_tag LOCUS_42130 326002 325208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42130 326406 326774 gene locus_tag LOCUS_42140 326406 326774 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036686.1 protein_id gnl|my_center|LOCUS_42140 326771 327676 gene locus_tag LOCUS_42150 326771 327676 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036685.1 protein_id gnl|my_center|LOCUS_42150 327673 328620 gene locus_tag LOCUS_42160 327673 328620 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036684.1 protein_id gnl|my_center|LOCUS_42160 329572 328682 gene locus_tag LOCUS_42170 329572 328682 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387897.1 protein_id gnl|my_center|LOCUS_42170 330334 329756 gene locus_tag LOCUS_42180 gene sodB 330334 329756 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931119.1 protein_id gnl|my_center|LOCUS_42180 331811 330513 gene locus_tag LOCUS_42190 gene xseA 331811 330513 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522628.1 protein_id gnl|my_center|LOCUS_42190 333046 333651 gene locus_tag LOCUS_42200 333046 333651 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064089.1 protein_id gnl|my_center|LOCUS_42200 333654 334103 gene locus_tag LOCUS_42210 333654 334103 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064090.1 protein_id gnl|my_center|LOCUS_42210 334198 335247 gene locus_tag LOCUS_42220 gene lpxK 334198 335247 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555967.1 protein_id gnl|my_center|LOCUS_42220 335228 335416 gene locus_tag LOCUS_42230 335228 335416 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196455.1 protein_id gnl|my_center|LOCUS_42230 335493 336251 gene locus_tag LOCUS_42240 gene kdsB 335493 336251 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690726.1 protein_id gnl|my_center|LOCUS_42240 336447 337103 gene locus_tag LOCUS_42250 gene adk 336447 337103 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185840.1 protein_id gnl|my_center|LOCUS_42250 337342 339564 gene locus_tag LOCUS_42260 337342 339564 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038412.1 protein_id gnl|my_center|LOCUS_42260 339788 340546 gene locus_tag LOCUS_42270 339788 340546 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537945.1 protein_id gnl|my_center|LOCUS_42270 341084 342247 gene locus_tag LOCUS_42280 341084 342247 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809440.1 protein_id gnl|my_center|LOCUS_42280 342569 342964 gene locus_tag LOCUS_42290 342569 342964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42290 342967 343389 gene locus_tag LOCUS_42300 342967 343389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42300 343499 344104 gene locus_tag LOCUS_42310 gene purN 343499 344104 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522603.1 protein_id gnl|my_center|LOCUS_42310 344302 345561 gene locus_tag LOCUS_42320 344302 345561 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522602.1 protein_id gnl|my_center|LOCUS_42320 345631 346929 gene locus_tag LOCUS_42330 345631 346929 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522601.1 protein_id gnl|my_center|LOCUS_42330 347016 348278 gene locus_tag LOCUS_42340 347016 348278 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186237.1 protein_id gnl|my_center|LOCUS_42340 348730 348563 gene locus_tag LOCUS_42350 gene rpmG 348730 348563 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185395.1 protein_id gnl|my_center|LOCUS_42350 348992 348756 gene locus_tag LOCUS_42360 gene rpmB 348992 348756 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186391.1 protein_id gnl|my_center|LOCUS_42360 349930 349256 gene locus_tag LOCUS_42370 gene radC 349930 349256 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704181.1 protein_id gnl|my_center|LOCUS_42370 350047 350502 gene locus_tag LOCUS_42380 350047 350502 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186190.1 protein_id gnl|my_center|LOCUS_42380 350512 351447 gene locus_tag LOCUS_42390 gene ispH 350512 351447 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930264.1 protein_id gnl|my_center|LOCUS_42390 352028 352957 gene locus_tag LOCUS_42400 352028 352957 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526290.1 protein_id gnl|my_center|LOCUS_42400 352969 354159 gene locus_tag LOCUS_42410 352969 354159 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186310.1 protein_id gnl|my_center|LOCUS_42410 354171 354941 gene locus_tag LOCUS_42420 354171 354941 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194783.1 protein_id gnl|my_center|LOCUS_42420 354941 355666 gene locus_tag LOCUS_42430 354941 355666 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185649.1 protein_id gnl|my_center|LOCUS_42430 355803 356465 gene locus_tag LOCUS_42440 355803 356465 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189255.1 protein_id gnl|my_center|LOCUS_42440 356462 357766 gene locus_tag LOCUS_42450 356462 357766 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526222.1 protein_id gnl|my_center|LOCUS_42450 360046 357869 gene locus_tag LOCUS_42460 360046 357869 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065072.1 protein_id gnl|my_center|LOCUS_42460 360185 360778 gene locus_tag LOCUS_42470 360185 360778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42470 361205 362593 gene locus_tag LOCUS_42480 361205 362593 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531269.1 protein_id gnl|my_center|LOCUS_42480 362602 362745 gene locus_tag LOCUS_42490 362602 362745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42490 363474 362908 gene locus_tag LOCUS_42500 363474 362908 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199567.1 protein_id gnl|my_center|LOCUS_42500 363857 364291 gene locus_tag LOCUS_42510 363857 364291 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193685.1 protein_id gnl|my_center|LOCUS_42510 364378 365070 gene locus_tag LOCUS_42520 364378 365070 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173710.1 protein_id gnl|my_center|LOCUS_42520 365392 366288 gene locus_tag LOCUS_42530 gene pbpG 365392 366288 CDS product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557110.1 protein_id gnl|my_center|LOCUS_42530 366866 367714 gene locus_tag LOCUS_42540 366866 367714 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521465.1 protein_id gnl|my_center|LOCUS_42540 >Feature sequence065 >Feature sequence066 >Feature sequence067 >Feature sequence068 >Feature sequence069 >Feature sequence070 >Feature sequence071 >Feature sequence072 >Feature sequence073 >Feature sequence074 >Feature sequence075 436 302 gene locus_tag LOCUS_42550 436 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42550 685 1554 gene locus_tag LOCUS_42560 685 1554 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140439.1 protein_id gnl|my_center|LOCUS_42560 1551 3128 gene locus_tag LOCUS_42570 1551 3128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140440.1 protein_id gnl|my_center|LOCUS_42570 3566 4834 gene locus_tag LOCUS_42580 3566 4834 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035814.1 protein_id gnl|my_center|LOCUS_42580 4857 5597 gene locus_tag LOCUS_42590 4857 5597 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035813.1 protein_id gnl|my_center|LOCUS_42590 5609 6910 gene locus_tag LOCUS_42600 5609 6910 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035812.1 protein_id gnl|my_center|LOCUS_42600 6918 8165 gene locus_tag LOCUS_42610 6918 8165 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035811.1 protein_id gnl|my_center|LOCUS_42610 8192 9529 gene locus_tag LOCUS_42620 8192 9529 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035809.1 protein_id gnl|my_center|LOCUS_42620 9526 10899 gene locus_tag LOCUS_42630 9526 10899 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035808.1 protein_id gnl|my_center|LOCUS_42630 12136 10949 gene locus_tag LOCUS_42640 12136 10949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42640 12828 12139 gene locus_tag LOCUS_42650 12828 12139 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393381.1 protein_id gnl|my_center|LOCUS_42650 13032 13934 gene locus_tag LOCUS_42660 13032 13934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42660 15476 13971 gene locus_tag LOCUS_42670 15476 13971 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461603.1 protein_id gnl|my_center|LOCUS_42670 16155 15502 gene locus_tag LOCUS_42680 16155 15502 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391572.1 protein_id gnl|my_center|LOCUS_42680 16609 17301 gene locus_tag LOCUS_42690 16609 17301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42690 17396 19033 gene locus_tag LOCUS_42700 17396 19033 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110915.1 protein_id gnl|my_center|LOCUS_42700 19989 19150 gene locus_tag LOCUS_42710 19989 19150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42710 20650 20036 gene locus_tag LOCUS_42720 gene lpoB 20650 20036 CDS product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172966546.1 protein_id gnl|my_center|LOCUS_42720 21106 20705 gene locus_tag LOCUS_42730 21106 20705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42730 22657 21131 gene locus_tag LOCUS_42740 22657 21131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42740 24066 23116 gene locus_tag LOCUS_42750 24066 23116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42750 25370 24168 gene locus_tag LOCUS_42760 25370 24168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42760 25667 28015 gene locus_tag LOCUS_42770 25667 28015 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192485.1 protein_id gnl|my_center|LOCUS_42770 28495 30015 gene locus_tag LOCUS_42780 28495 30015 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556617.1 protein_id gnl|my_center|LOCUS_42780 30359 30748 gene locus_tag LOCUS_42790 30359 30748 CDS product DUF779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057670999.1 protein_id gnl|my_center|LOCUS_42790 32683 30749 gene locus_tag LOCUS_42800 32683 30749 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530092.1 protein_id gnl|my_center|LOCUS_42800 34449 32842 gene locus_tag LOCUS_42810 34449 32842 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551511.1 protein_id gnl|my_center|LOCUS_42810 36820 34670 gene locus_tag LOCUS_42820 36820 34670 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269073.1 protein_id gnl|my_center|LOCUS_42820 37265 37576 gene locus_tag LOCUS_42830 gene grxD 37265 37576 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807622.1 protein_id gnl|my_center|LOCUS_42830 37584 38177 gene locus_tag LOCUS_42840 37584 38177 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186908.1 protein_id gnl|my_center|LOCUS_42840 38297 40384 gene locus_tag LOCUS_42850 38297 40384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42850 41335 40439 gene locus_tag LOCUS_42860 41335 40439 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113743.1 protein_id gnl|my_center|LOCUS_42860 41413 41841 gene locus_tag LOCUS_42870 41413 41841 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400759.1 protein_id gnl|my_center|LOCUS_42870 41856 42518 gene locus_tag LOCUS_42880 41856 42518 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968488.1 protein_id gnl|my_center|LOCUS_42880 44764 42578 gene locus_tag LOCUS_42890 44764 42578 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964428.1 protein_id gnl|my_center|LOCUS_42890 45598 45101 gene locus_tag LOCUS_42900 45598 45101 CDS product spore coat U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024505608.1 protein_id gnl|my_center|LOCUS_42900 46628 46131 gene locus_tag LOCUS_42910 46628 46131 CDS product spore coat U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024505608.1 protein_id gnl|my_center|LOCUS_42910 47343 46870 gene locus_tag LOCUS_42920 47343 46870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42920 49646 47340 gene locus_tag LOCUS_42930 49646 47340 CDS product fimbria/pilus outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543968.1 protein_id gnl|my_center|LOCUS_42930 50353 49643 gene locus_tag LOCUS_42940 50353 49643 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275400.1 protein_id gnl|my_center|LOCUS_42940 50825 50382 gene locus_tag LOCUS_42950 50825 50382 CDS product spore coat U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024505608.1 protein_id gnl|my_center|LOCUS_42950 51217 52686 gene locus_tag LOCUS_42960 51217 52686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42960 52683 53336 gene locus_tag LOCUS_42970 52683 53336 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727243.1 protein_id gnl|my_center|LOCUS_42970 53832 53392 gene locus_tag LOCUS_42980 53832 53392 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061215.1 protein_id gnl|my_center|LOCUS_42980 55570 53825 gene locus_tag LOCUS_42990 55570 53825 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790898.1 protein_id gnl|my_center|LOCUS_42990 55593 55805 gene locus_tag LOCUS_43000 55593 55805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43000 56281 56206 gene locus_tag LOCUS_t00720 56281 56206 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 56828 56340 gene locus_tag LOCUS_43010 56828 56340 CDS product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527881.1 protein_id gnl|my_center|LOCUS_43010 57706 57095 gene locus_tag LOCUS_43020 57706 57095 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185176.1 protein_id gnl|my_center|LOCUS_43020 58620 57856 gene locus_tag LOCUS_43030 58620 57856 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521940.1 protein_id gnl|my_center|LOCUS_43030 60052 58643 gene locus_tag LOCUS_43040 60052 58643 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815816.1 protein_id gnl|my_center|LOCUS_43040 60669 60055 gene locus_tag LOCUS_43050 gene petA 60669 60055 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204996.1 protein_id gnl|my_center|LOCUS_43050 61012 61431 gene locus_tag LOCUS_43060 gene mscL 61012 61431 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974377.1 protein_id gnl|my_center|LOCUS_43060 62261 61500 gene locus_tag LOCUS_43070 62261 61500 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927226.1 protein_id gnl|my_center|LOCUS_43070 62275 63450 gene locus_tag LOCUS_43080 62275 63450 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521939.1 protein_id gnl|my_center|LOCUS_43080 63457 64134 gene locus_tag LOCUS_43090 63457 64134 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787603.1 protein_id gnl|my_center|LOCUS_43090 64893 64117 gene locus_tag LOCUS_43100 gene tatC 64893 64117 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815810.1 protein_id gnl|my_center|LOCUS_43100 65423 64938 gene locus_tag LOCUS_43110 gene tatB 65423 64938 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199901.1 protein_id gnl|my_center|LOCUS_43110 65688 65470 gene locus_tag LOCUS_43120 gene tatA 65688 65470 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815808.1 protein_id gnl|my_center|LOCUS_43120 66172 65801 gene locus_tag LOCUS_43130 66172 65801 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222846.1 protein_id gnl|my_center|LOCUS_43130 66603 66250 gene locus_tag LOCUS_43140 66603 66250 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202813.1 protein_id gnl|my_center|LOCUS_43140 67029 66628 gene locus_tag LOCUS_43150 gene hisI 67029 66628 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201279.1 protein_id gnl|my_center|LOCUS_43150 67790 67026 gene locus_tag LOCUS_43160 gene hisF 67790 67026 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550994.1 protein_id gnl|my_center|LOCUS_43160 68578 67787 gene locus_tag LOCUS_43170 gene hisA 68578 67787 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199906.1 protein_id gnl|my_center|LOCUS_43170 69327 68689 gene locus_tag LOCUS_43180 gene hisH 69327 68689 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199907.1 protein_id gnl|my_center|LOCUS_43180 69961 69359 gene locus_tag LOCUS_43190 gene hisB 69961 69359 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815795.1 protein_id gnl|my_center|LOCUS_43190 71034 69958 gene locus_tag LOCUS_43200 gene hisC 71034 69958 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199913.1 protein_id gnl|my_center|LOCUS_43200 71881 71105 gene locus_tag LOCUS_43210 71881 71105 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188032.1 protein_id gnl|my_center|LOCUS_43210 73232 71916 gene locus_tag LOCUS_43220 gene hisD 73232 71916 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527888.1 protein_id gnl|my_center|LOCUS_43220 73915 73250 gene locus_tag LOCUS_43230 gene hisG 73915 73250 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199915.1 protein_id gnl|my_center|LOCUS_43230 75165 73915 gene locus_tag LOCUS_43240 gene murA 75165 73915 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185050.1 protein_id gnl|my_center|LOCUS_43240 75401 75165 gene locus_tag LOCUS_43250 75401 75165 CDS product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199917.1 protein_id gnl|my_center|LOCUS_43250 76279 75515 gene locus_tag LOCUS_43260 76279 75515 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199919.1 protein_id gnl|my_center|LOCUS_43260 77196 76276 gene locus_tag LOCUS_43270 77196 76276 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521934.1 protein_id gnl|my_center|LOCUS_43270 77663 77388 gene locus_tag LOCUS_43280 77663 77388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43280 78362 77715 gene locus_tag LOCUS_43290 78362 77715 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199924.1 protein_id gnl|my_center|LOCUS_43290 79284 78502 gene locus_tag LOCUS_43300 79284 78502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43300 79760 79281 gene locus_tag LOCUS_43310 gene mlaD 79760 79281 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199927.1 protein_id gnl|my_center|LOCUS_43310 80725 79955 gene locus_tag LOCUS_43320 gene mlaE 80725 79955 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199929.1 protein_id gnl|my_center|LOCUS_43320 81468 80722 gene locus_tag LOCUS_43330 81468 80722 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199931.1 protein_id gnl|my_center|LOCUS_43330 83508 82045 gene locus_tag LOCUS_43340 83508 82045 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527896.1 protein_id gnl|my_center|LOCUS_43340 88312 83624 gene locus_tag LOCUS_43350 88312 83624 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196742.1 protein_id gnl|my_center|LOCUS_43350 89344 88718 gene locus_tag LOCUS_43360 89344 88718 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196743.1 protein_id gnl|my_center|LOCUS_43360 89907 89563 gene locus_tag LOCUS_43370 89907 89563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43370 92499 90385 gene locus_tag LOCUS_43380 92499 90385 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113760.1 protein_id gnl|my_center|LOCUS_43380 93279 92572 gene locus_tag LOCUS_43390 93279 92572 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174804.1 protein_id gnl|my_center|LOCUS_43390 93633 95312 gene locus_tag LOCUS_43400 93633 95312 CDS product beta-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100342827.1 protein_id gnl|my_center|LOCUS_43400 95340 96725 gene locus_tag LOCUS_43410 95340 96725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43410 97018 97341 gene locus_tag LOCUS_43420 97018 97341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43420 97428 97784 gene locus_tag LOCUS_43430 97428 97784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43430 99621 97936 gene locus_tag LOCUS_43440 99621 97936 CDS product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055228983.1 protein_id gnl|my_center|LOCUS_43440 102543 99694 gene locus_tag LOCUS_43450 102543 99694 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206610.1 protein_id gnl|my_center|LOCUS_43450 104831 102636 gene locus_tag LOCUS_43460 104831 102636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43460 106300 105101 gene locus_tag LOCUS_43470 106300 105101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43470 107100 106759 gene locus_tag LOCUS_43480 107100 106759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43480 107332 108123 gene locus_tag LOCUS_43490 gene budA 107332 108123 CDS product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966250.1 protein_id gnl|my_center|LOCUS_43490 109004 108177 gene locus_tag LOCUS_43500 109004 108177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43500 115298 109017 gene locus_tag LOCUS_43510 115298 109017 CDS product HAMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085385.1 protein_id gnl|my_center|LOCUS_43510 115598 117223 gene locus_tag LOCUS_43520 115598 117223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43520 118011 117574 gene locus_tag LOCUS_43530 118011 117574 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065974.1 protein_id gnl|my_center|LOCUS_43530 118423 118106 gene locus_tag LOCUS_43540 118423 118106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43540 119622 119089 gene locus_tag LOCUS_43550 119622 119089 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226147.1 protein_id gnl|my_center|LOCUS_43550 121972 119858 gene locus_tag LOCUS_43560 121972 119858 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036309.1 protein_id gnl|my_center|LOCUS_43560 122759 122241 gene locus_tag LOCUS_43570 122759 122241 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392328.1 protein_id gnl|my_center|LOCUS_43570 123242 122826 gene locus_tag LOCUS_43580 123242 122826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43580 123994 124173 gene locus_tag LOCUS_43590 123994 124173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43590 126341 124374 gene locus_tag LOCUS_43600 126341 124374 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225895010.1 protein_id gnl|my_center|LOCUS_43600 128053 126746 gene locus_tag LOCUS_43610 128053 126746 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087276.1 protein_id gnl|my_center|LOCUS_43610 128797 128057 gene locus_tag LOCUS_43620 128797 128057 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391325.1 protein_id gnl|my_center|LOCUS_43620 131237 128808 gene locus_tag LOCUS_43630 131237 128808 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104883.1 protein_id gnl|my_center|LOCUS_43630 132520 131471 gene locus_tag LOCUS_43640 132520 131471 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113764.1 protein_id gnl|my_center|LOCUS_43640 133005 132505 gene locus_tag LOCUS_43650 133005 132505 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198478.1 protein_id gnl|my_center|LOCUS_43650 133468 134664 gene locus_tag LOCUS_43660 133468 134664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43660 134994 134860 gene locus_tag LOCUS_43670 134994 134860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43670 135347 136354 gene locus_tag LOCUS_43680 135347 136354 CDS product ferritin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031466.1 protein_id gnl|my_center|LOCUS_43680 136390 138285 gene locus_tag LOCUS_43690 136390 138285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43690 138403 138741 gene locus_tag LOCUS_43700 138403 138741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_43700 139466 138978 gene locus_tag LOCUS_43710 139466 138978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43710 141625 140186 gene locus_tag LOCUS_43720 141625 140186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43720 142228 141737 gene locus_tag LOCUS_43730 gene ssb 142228 141737 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806953.1 protein_id gnl|my_center|LOCUS_43730 143504 142263 gene locus_tag LOCUS_43740 143504 142263 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195190.1 protein_id gnl|my_center|LOCUS_43740 143635 146574 gene locus_tag LOCUS_43750 gene uvrA 143635 146574 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526066.1 protein_id gnl|my_center|LOCUS_43750 147040 147612 gene locus_tag LOCUS_43760 gene pth 147040 147612 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931308.1 protein_id gnl|my_center|LOCUS_43760 147609 148712 gene locus_tag LOCUS_43770 147609 148712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113385.1 protein_id gnl|my_center|LOCUS_43770 149333 148716 gene locus_tag LOCUS_43780 149333 148716 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093976.1 protein_id gnl|my_center|LOCUS_43780 149644 149393 gene locus_tag LOCUS_43790 149644 149393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43790 150099 149644 gene locus_tag LOCUS_43800 150099 149644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43800 151042 150119 gene locus_tag LOCUS_43810 151042 150119 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973939.1 protein_id gnl|my_center|LOCUS_43810 152582 151263 gene locus_tag LOCUS_43820 152582 151263 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816722.1 protein_id gnl|my_center|LOCUS_43820 152701 154419 gene locus_tag LOCUS_43830 gene sgrR 152701 154419 CDS product HTH-type transcriptional regulator SgrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819251.1 protein_id gnl|my_center|LOCUS_43830 155774 154536 gene locus_tag LOCUS_43840 155774 154536 CDS product glycoside hydrolase family 30 beta sandwich domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036093.1 protein_id gnl|my_center|LOCUS_43840 156087 157460 gene locus_tag LOCUS_43850 gene pmpM 156087 157460 CDS product proton-coupled multidrug efflux MATE transporter PmpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112388.1 protein_id gnl|my_center|LOCUS_43850 158280 157486 gene locus_tag LOCUS_43860 158280 157486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43860 158524 159615 gene locus_tag LOCUS_43870 gene ychF 158524 159615 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186874.1 protein_id gnl|my_center|LOCUS_43870 159794 160975 gene locus_tag LOCUS_43880 159794 160975 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039866.1 protein_id gnl|my_center|LOCUS_43880 161735 161034 gene locus_tag LOCUS_43890 161735 161034 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113808.1 protein_id gnl|my_center|LOCUS_43890 161820 162857 gene locus_tag LOCUS_43900 161820 162857 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113809.1 protein_id gnl|my_center|LOCUS_43900 162978 163835 gene locus_tag LOCUS_43910 162978 163835 CDS product MOSC N-terminal beta barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194630.1 protein_id gnl|my_center|LOCUS_43910 163853 165001 gene locus_tag LOCUS_43920 163853 165001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43920 165349 165098 gene locus_tag LOCUS_43930 165349 165098 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195247.1 protein_id gnl|my_center|LOCUS_43930 165912 165418 gene locus_tag LOCUS_43940 gene coaD 165912 165418 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195249.1 protein_id gnl|my_center|LOCUS_43940 166626 165967 gene locus_tag LOCUS_43950 gene rsmD 166626 165967 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195251.1 protein_id gnl|my_center|LOCUS_43950 166738 167826 gene locus_tag LOCUS_43960 166738 167826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43960 167961 168635 gene locus_tag LOCUS_43970 167961 168635 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815073.1 protein_id gnl|my_center|LOCUS_43970 168676 169590 gene locus_tag LOCUS_43980 168676 169590 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815075.1 protein_id gnl|my_center|LOCUS_43980 169854 170753 gene locus_tag LOCUS_43990 gene rpoH 169854 170753 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522872.1 protein_id gnl|my_center|LOCUS_43990 171432 170842 gene locus_tag LOCUS_44000 171432 170842 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197988.1 protein_id gnl|my_center|LOCUS_44000 172313 171429 gene locus_tag LOCUS_44010 gene cyoE 172313 171429 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064816.1 protein_id gnl|my_center|LOCUS_44010 173395 172310 gene locus_tag LOCUS_44020 173395 172310 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526026.1 protein_id gnl|my_center|LOCUS_44020 173995 173399 gene locus_tag LOCUS_44030 173995 173399 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204230.1 protein_id gnl|my_center|LOCUS_44030 174704 173988 gene locus_tag LOCUS_44040 174704 173988 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023995706.1 protein_id gnl|my_center|LOCUS_44040 174765 174965 gene locus_tag LOCUS_44050 174765 174965 CDS product twin transmembrane helix small protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815736.1 protein_id gnl|my_center|LOCUS_44050 175988 175122 gene locus_tag LOCUS_44060 175988 175122 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815738.1 protein_id gnl|my_center|LOCUS_44060 176237 176022 gene locus_tag LOCUS_44070 176237 176022 CDS product DUF2970 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815740.1 protein_id gnl|my_center|LOCUS_44070 176821 176234 gene locus_tag LOCUS_44080 176821 176234 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185071.1 protein_id gnl|my_center|LOCUS_44080 178583 176988 gene locus_tag LOCUS_44090 gene ctaD 178583 176988 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197996.1 protein_id gnl|my_center|LOCUS_44090 179765 178608 gene locus_tag LOCUS_44100 179765 178608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44100 180930 180016 gene locus_tag LOCUS_44110 180930 180016 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049788683.1 protein_id gnl|my_center|LOCUS_44110 181028 181780 gene locus_tag LOCUS_44120 181028 181780 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526022.1 protein_id gnl|my_center|LOCUS_44120 181749 182264 gene locus_tag LOCUS_44130 gene trmL 181749 182264 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185046.1 protein_id gnl|my_center|LOCUS_44130 182442 184952 gene locus_tag LOCUS_44140 182442 184952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44140 185420 184941 gene locus_tag LOCUS_44150 gene rfaE2 185420 184941 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189202.1 protein_id gnl|my_center|LOCUS_44150 186547 185684 gene locus_tag LOCUS_44160 186547 185684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534300.1 protein_id gnl|my_center|LOCUS_44160 187599 186667 gene locus_tag LOCUS_44170 187599 186667 CDS product CysB family HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193901.1 protein_id gnl|my_center|LOCUS_44170 188672 187608 gene locus_tag LOCUS_44180 188672 187608 CDS product sulfate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821532.1 protein_id gnl|my_center|LOCUS_44180 189586 188684 gene locus_tag LOCUS_44190 gene cysW 189586 188684 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942001.1 protein_id gnl|my_center|LOCUS_44190 190440 189586 gene locus_tag LOCUS_44200 gene cysT 190440 189586 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928930.1 protein_id gnl|my_center|LOCUS_44200 191472 190627 gene locus_tag LOCUS_44210 191472 190627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44210 191716 191501 gene locus_tag LOCUS_44220 191716 191501 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191306.1 protein_id gnl|my_center|LOCUS_44220 192737 191808 gene locus_tag LOCUS_44230 gene ssuB 192737 191808 CDS product aliphatic sulfonates ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102311.1 protein_id gnl|my_center|LOCUS_44230 193624 192740 gene locus_tag LOCUS_44240 gene ssuC 193624 192740 CDS product aliphatic sulfonate ABC transporter permease SsuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120785.1 protein_id gnl|my_center|LOCUS_44240 194784 193633 gene locus_tag LOCUS_44250 gene ssuD 194784 193633 CDS product FMNH2-dependent alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192866.1 protein_id gnl|my_center|LOCUS_44250 195832 194834 gene locus_tag LOCUS_44260 195832 194834 CDS product sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097271.1 protein_id gnl|my_center|LOCUS_44260 196872 195841 gene locus_tag LOCUS_44270 196872 195841 CDS product sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269279.1 protein_id gnl|my_center|LOCUS_44270 197633 197043 gene locus_tag LOCUS_44280 gene ssuE 197633 197043 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142759.1 protein_id gnl|my_center|LOCUS_44280 198680 197667 gene locus_tag LOCUS_44290 198680 197667 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941999.1 protein_id gnl|my_center|LOCUS_44290 199060 199626 gene locus_tag LOCUS_44300 199060 199626 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036687.1 protein_id gnl|my_center|LOCUS_44300 200476 199685 gene locus_tag LOCUS_44310 200476 199685 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808594.1 protein_id gnl|my_center|LOCUS_44310 200706 201707 gene locus_tag LOCUS_44320 200706 201707 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185661.1 protein_id gnl|my_center|LOCUS_44320 201855 203567 gene locus_tag LOCUS_44330 201855 203567 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808489.1 protein_id gnl|my_center|LOCUS_44330 203545 203781 gene locus_tag LOCUS_44340 203545 203781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44340 204398 203778 gene locus_tag LOCUS_44350 204398 203778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44350 204712 206028 gene locus_tag LOCUS_44360 204712 206028 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163651105.1 protein_id gnl|my_center|LOCUS_44360 206033 206881 gene locus_tag LOCUS_44370 206033 206881 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388482.1 protein_id gnl|my_center|LOCUS_44370 206878 208176 gene locus_tag LOCUS_44380 206878 208176 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388483.1 protein_id gnl|my_center|LOCUS_44380 208239 208769 gene locus_tag LOCUS_44390 208239 208769 CDS product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104050.1 protein_id gnl|my_center|LOCUS_44390 208824 209381 gene locus_tag LOCUS_44400 208824 209381 CDS product DUF3833 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407549.1 protein_id gnl|my_center|LOCUS_44400 209378 210145 gene locus_tag LOCUS_44410 209378 210145 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388487.1 protein_id gnl|my_center|LOCUS_44410 210146 210628 gene locus_tag LOCUS_44420 210146 210628 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388486.1 protein_id gnl|my_center|LOCUS_44420 211258 210830 gene locus_tag LOCUS_44430 211258 210830 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102139.1 protein_id gnl|my_center|LOCUS_44430 213467 211452 gene locus_tag LOCUS_44440 213467 211452 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552478.1 protein_id gnl|my_center|LOCUS_44440 213637 214170 gene locus_tag LOCUS_44450 213637 214170 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533080.1 protein_id gnl|my_center|LOCUS_44450 214691 215164 gene locus_tag LOCUS_44460 214691 215164 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388338.1 protein_id gnl|my_center|LOCUS_44460 215244 215828 gene locus_tag LOCUS_44470 gene sodB 215244 215828 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064087.1 protein_id gnl|my_center|LOCUS_44470 216090 217010 gene locus_tag LOCUS_44480 216090 217010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44480 217894 217130 gene locus_tag LOCUS_44490 217894 217130 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463718.1 protein_id gnl|my_center|LOCUS_44490 219084 218059 gene locus_tag LOCUS_44500 219084 218059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44500 220451 219129 gene locus_tag LOCUS_44510 220451 219129 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196429.1 protein_id gnl|my_center|LOCUS_44510 220614 221762 gene locus_tag LOCUS_44520 220614 221762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44520 221765 222520 gene locus_tag LOCUS_44530 221765 222520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44530 224003 222567 gene locus_tag LOCUS_44540 224003 222567 CDS product bifunctional serine/threonine-protein kinase/universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088428.1 protein_id gnl|my_center|LOCUS_44540 224795 224052 gene locus_tag LOCUS_44550 224795 224052 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088429.1 protein_id gnl|my_center|LOCUS_44550 225611 224880 gene locus_tag LOCUS_44560 gene queC 225611 224880 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190026.1 protein_id gnl|my_center|LOCUS_44560 225793 227076 gene locus_tag LOCUS_44570 225793 227076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44570 228940 227045 gene locus_tag LOCUS_44580 228940 227045 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174047161.1 protein_id gnl|my_center|LOCUS_44580 231465 228955 gene locus_tag LOCUS_44590 231465 228955 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550889.1 protein_id gnl|my_center|LOCUS_44590 232474 231476 gene locus_tag LOCUS_44600 232474 231476 CDS product DUF1839 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196302.1 protein_id gnl|my_center|LOCUS_44600 233393 232482 gene locus_tag LOCUS_44610 233393 232482 CDS product amino acid--[acyl-carrier-protein] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189723.1 protein_id gnl|my_center|LOCUS_44610 234571 233405 gene locus_tag LOCUS_44620 234571 233405 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972410.1 protein_id gnl|my_center|LOCUS_44620 234812 234573 gene locus_tag LOCUS_44630 234812 234573 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003504852.1 protein_id gnl|my_center|LOCUS_44630 236357 235155 gene locus_tag LOCUS_44640 236357 235155 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152802079.1 protein_id gnl|my_center|LOCUS_44640 236634 237476 gene locus_tag LOCUS_44650 236634 237476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44650 238557 237487 gene locus_tag LOCUS_44660 238557 237487 CDS product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104087.1 protein_id gnl|my_center|LOCUS_44660 239009 239884 gene locus_tag LOCUS_44670 239009 239884 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206541.1 protein_id gnl|my_center|LOCUS_44670 239895 240581 gene locus_tag LOCUS_44680 239895 240581 CDS product DUF1045 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527701.1 protein_id gnl|my_center|LOCUS_44680 240688 240990 gene locus_tag LOCUS_44690 240688 240990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44690 241027 241746 gene locus_tag LOCUS_44700 241027 241746 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206998.1 protein_id gnl|my_center|LOCUS_44700 243141 241753 gene locus_tag LOCUS_44710 243141 241753 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965744.1 protein_id gnl|my_center|LOCUS_44710 243279 244496 gene locus_tag LOCUS_44720 243279 244496 CDS product citrate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080854964.1 protein_id gnl|my_center|LOCUS_44720 244758 244537 gene locus_tag LOCUS_44730 244758 244537 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791339.1 protein_id gnl|my_center|LOCUS_44730 245354 244767 gene locus_tag LOCUS_44740 245354 244767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44740 247927 245537 gene locus_tag LOCUS_44750 247927 245537 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038158.1 protein_id gnl|my_center|LOCUS_44750 248999 248130 gene locus_tag LOCUS_44760 248999 248130 CDS product STM4011 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640248.1 protein_id gnl|my_center|LOCUS_44760 250336 248996 gene locus_tag LOCUS_44770 250336 248996 CDS product STM4012 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202627.1 protein_id gnl|my_center|LOCUS_44770 251148 250333 gene locus_tag LOCUS_44780 251148 250333 CDS product STM4013/SEN3800 family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202626.1 protein_id gnl|my_center|LOCUS_44780 251834 251154 gene locus_tag LOCUS_44790 251834 251154 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475861.1 protein_id gnl|my_center|LOCUS_44790 252963 251821 gene locus_tag LOCUS_44800 252963 251821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44800 254041 252971 gene locus_tag LOCUS_44810 254041 252971 CDS product STM4015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992754.1 protein_id gnl|my_center|LOCUS_44810 254531 254743 gene locus_tag LOCUS_44820 254531 254743 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522324.1 protein_id gnl|my_center|LOCUS_44820 256444 255470 gene locus_tag LOCUS_44830 256444 255470 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114217.1 protein_id gnl|my_center|LOCUS_44830 257103 256555 gene locus_tag LOCUS_44840 257103 256555 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947216.1 protein_id gnl|my_center|LOCUS_44840 257209 257685 gene locus_tag LOCUS_44850 257209 257685 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925670.1 protein_id gnl|my_center|LOCUS_44850 257713 258576 gene locus_tag LOCUS_44860 257713 258576 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396530.1 protein_id gnl|my_center|LOCUS_44860 259478 258573 gene locus_tag LOCUS_44870 259478 258573 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966037.1 protein_id gnl|my_center|LOCUS_44870 259685 260341 gene locus_tag LOCUS_44880 259685 260341 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932930.1 protein_id gnl|my_center|LOCUS_44880 260471 262348 gene locus_tag LOCUS_44890 260471 262348 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973480.1 protein_id gnl|my_center|LOCUS_44890 262345 262755 gene locus_tag LOCUS_44900 262345 262755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44900 263149 263796 gene locus_tag LOCUS_44910 263149 263796 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705540.1 protein_id gnl|my_center|LOCUS_44910 264637 263864 gene locus_tag LOCUS_44920 gene aph(3')-IIIa 264637 263864 CDS product aminoglycoside O-phosphotransferase APH(3')-IIIa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096887.1 protein_id gnl|my_center|LOCUS_44920 264889 264725 gene locus_tag LOCUS_44930 264889 264725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44930 265219 264977 gene locus_tag LOCUS_44940 265219 264977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44940 266138 265275 gene locus_tag LOCUS_44950 266138 265275 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839067.1 protein_id gnl|my_center|LOCUS_44950 266238 266774 gene locus_tag LOCUS_44960 266238 266774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44960 266774 267055 gene locus_tag LOCUS_44970 266774 267055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44970 267139 267933 gene locus_tag LOCUS_44980 267139 267933 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140499.1 protein_id gnl|my_center|LOCUS_44980 268131 268667 gene locus_tag LOCUS_44990 268131 268667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44990 269576 268689 gene locus_tag LOCUS_45000 269576 268689 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094802.1 protein_id gnl|my_center|LOCUS_45000 269767 270216 gene locus_tag LOCUS_45010 269767 270216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45010 271981 270266 gene locus_tag LOCUS_45020 271981 270266 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071101.1 protein_id gnl|my_center|LOCUS_45020 272194 272805 gene locus_tag LOCUS_45030 272194 272805 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920924.1 protein_id gnl|my_center|LOCUS_45030 273083 274426 gene locus_tag LOCUS_45040 273083 274426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45040 274794 274423 gene locus_tag LOCUS_45050 274794 274423 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811293.1 protein_id gnl|my_center|LOCUS_45050 274955 275413 gene locus_tag LOCUS_45060 274955 275413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45060 275410 275904 gene locus_tag LOCUS_45070 275410 275904 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640378.1 protein_id gnl|my_center|LOCUS_45070 279570 275977 gene locus_tag LOCUS_45080 279570 275977 CDS product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523124.1 protein_id gnl|my_center|LOCUS_45080 279895 282222 gene locus_tag LOCUS_45090 279895 282222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45090 282319 283182 gene locus_tag LOCUS_45100 gene dapF 282319 283182 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199067.1 protein_id gnl|my_center|LOCUS_45100 283179 283838 gene locus_tag LOCUS_45110 283179 283838 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199066.1 protein_id gnl|my_center|LOCUS_45110 283891 284811 gene locus_tag LOCUS_45120 gene xerC 283891 284811 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523080.1 protein_id gnl|my_center|LOCUS_45120 285905 284835 gene locus_tag LOCUS_45130 285905 284835 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965435.1 protein_id gnl|my_center|LOCUS_45130 288045 286069 gene locus_tag LOCUS_45140 288045 286069 CDS product DUF839 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550684.1 protein_id gnl|my_center|LOCUS_45140 288518 289048 gene locus_tag LOCUS_45150 288518 289048 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870334.1 protein_id gnl|my_center|LOCUS_45150 289114 290193 gene locus_tag LOCUS_45160 289114 290193 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199061.1 protein_id gnl|my_center|LOCUS_45160 290348 290803 gene locus_tag LOCUS_45170 gene dksA 290348 290803 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198318.1 protein_id gnl|my_center|LOCUS_45170 291106 291507 gene locus_tag LOCUS_45180 291106 291507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45180 291617 293623 gene locus_tag LOCUS_45190 291617 293623 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037788.1 protein_id gnl|my_center|LOCUS_45190 293918 295318 gene locus_tag LOCUS_45200 293918 295318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45200 295543 296079 gene locus_tag LOCUS_45210 gene hslV 295543 296079 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818422.1 protein_id gnl|my_center|LOCUS_45210 296093 297430 gene locus_tag LOCUS_45220 gene hslU 296093 297430 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523084.1 protein_id gnl|my_center|LOCUS_45220 297460 297636 gene locus_tag LOCUS_45230 297460 297636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45230 297660 298169 gene locus_tag LOCUS_45240 297660 298169 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268542.1 protein_id gnl|my_center|LOCUS_45240 298348 298536 gene locus_tag LOCUS_45250 298348 298536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45250 299559 298561 gene locus_tag LOCUS_45260 299559 298561 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536061.1 protein_id gnl|my_center|LOCUS_45260 300138 299689 gene locus_tag LOCUS_45270 300138 299689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45270 300666 300190 gene locus_tag LOCUS_45280 gene secB 300666 300190 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198004.1 protein_id gnl|my_center|LOCUS_45280 301100 300831 gene locus_tag LOCUS_45290 gene grxC 301100 300831 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200200.1 protein_id gnl|my_center|LOCUS_45290 301512 301111 gene locus_tag LOCUS_45300 301512 301111 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158897.1 protein_id gnl|my_center|LOCUS_45300 301639 302385 gene locus_tag LOCUS_45310 gene gpmA 301639 302385 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198007.1 protein_id gnl|my_center|LOCUS_45310 302393 303739 gene locus_tag LOCUS_45320 302393 303739 CDS product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123645.1 protein_id gnl|my_center|LOCUS_45320 303754 305298 gene locus_tag LOCUS_45330 303754 305298 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543824.1 protein_id gnl|my_center|LOCUS_45330 305341 306099 gene locus_tag LOCUS_45340 gene moeB 305341 306099 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198009.1 protein_id gnl|my_center|LOCUS_45340 306164 306811 gene locus_tag LOCUS_45350 306164 306811 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036609.1 protein_id gnl|my_center|LOCUS_45350 306857 307675 gene locus_tag LOCUS_45360 306857 307675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533664.1 protein_id gnl|my_center|LOCUS_45360 308258 307755 gene locus_tag LOCUS_45370 308258 307755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45370 308764 308360 gene locus_tag LOCUS_45380 308764 308360 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530342.1 protein_id gnl|my_center|LOCUS_45380 309585 308779 gene locus_tag LOCUS_45390 309585 308779 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040242.1 protein_id gnl|my_center|LOCUS_45390 311402 309585 gene locus_tag LOCUS_45400 311402 309585 CDS product branched-chain amino acid ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195813.1 protein_id gnl|my_center|LOCUS_45400 312457 311402 gene locus_tag LOCUS_45410 312457 311402 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195812.1 protein_id gnl|my_center|LOCUS_45410 313720 312557 gene locus_tag LOCUS_45420 313720 312557 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200062.1 protein_id gnl|my_center|LOCUS_45420 315895 314012 gene locus_tag LOCUS_45430 315895 314012 CDS product bifunctional anthranilate synthase component I family protein/class IV aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225844.1 protein_id gnl|my_center|LOCUS_45430 316101 315973 gene locus_tag LOCUS_45440 316101 315973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45440 316218 317447 gene locus_tag LOCUS_45450 gene tpbB 316218 317447 CDS product diguanylate cyclase TpbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082256.1 protein_id gnl|my_center|LOCUS_45450 317999 317529 gene locus_tag LOCUS_45460 317999 317529 CDS product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843542.1 protein_id gnl|my_center|LOCUS_45460 318869 318099 gene locus_tag LOCUS_45470 318869 318099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45470 319571 318996 gene locus_tag LOCUS_45480 gene slmA 319571 318996 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198306.1 protein_id gnl|my_center|LOCUS_45480 319601 319804 gene locus_tag LOCUS_45490 319601 319804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45490 320470 319769 gene locus_tag LOCUS_45500 320470 319769 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815194.1 protein_id gnl|my_center|LOCUS_45500 321437 320505 gene locus_tag LOCUS_45510 gene argB 321437 320505 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200214.1 protein_id gnl|my_center|LOCUS_45510 321537 322115 gene locus_tag LOCUS_45520 321537 322115 CDS product RNA polymerase factor sigma-70 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206317.1 protein_id gnl|my_center|LOCUS_45520 322129 322371 gene locus_tag LOCUS_45530 322129 322371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45530 322368 322601 gene locus_tag LOCUS_45540 322368 322601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45540 322627 323334 gene locus_tag LOCUS_45550 322627 323334 CDS product GTP cyclohydrolase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050480010.1 protein_id gnl|my_center|LOCUS_45550 323401 323772 gene locus_tag LOCUS_45560 323401 323772 CDS product BLUF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055933.1 protein_id gnl|my_center|LOCUS_45560 324337 323798 gene locus_tag LOCUS_45570 324337 323798 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989628.1 protein_id gnl|my_center|LOCUS_45570 325134 324484 gene locus_tag LOCUS_45580 325134 324484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45580 325723 325127 gene locus_tag LOCUS_45590 325723 325127 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446211.1 protein_id gnl|my_center|LOCUS_45590 326350 325952 gene locus_tag LOCUS_45600 326350 325952 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024665649.1 protein_id gnl|my_center|LOCUS_45600 326468 327385 gene locus_tag LOCUS_45610 gene rsmI 326468 327385 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525682.1 protein_id gnl|my_center|LOCUS_45610 328550 327429 gene locus_tag LOCUS_45620 328550 327429 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929963.1 protein_id gnl|my_center|LOCUS_45620 329656 328547 gene locus_tag LOCUS_45630 gene rodA 329656 328547 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189171.1 protein_id gnl|my_center|LOCUS_45630 331656 329659 gene locus_tag LOCUS_45640 gene mrdA 331656 329659 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204769.1 protein_id gnl|my_center|LOCUS_45640 332254 331736 gene locus_tag LOCUS_45650 gene mreD 332254 331736 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189260.1 protein_id gnl|my_center|LOCUS_45650 333402 332251 gene locus_tag LOCUS_45660 gene mreC 333402 332251 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189331.1 protein_id gnl|my_center|LOCUS_45660 334618 333575 gene locus_tag LOCUS_45670 334618 333575 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189550.1 protein_id gnl|my_center|LOCUS_45670 335074 335382 gene locus_tag LOCUS_45680 gene gatC 335074 335382 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189769.1 protein_id gnl|my_center|LOCUS_45680 335408 336862 gene locus_tag LOCUS_45690 gene gatA 335408 336862 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525859.1 protein_id gnl|my_center|LOCUS_45690 336859 337338 gene locus_tag LOCUS_45700 336859 337338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45700 337431 338891 gene locus_tag LOCUS_45710 gene gatB 337431 338891 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552444.1 protein_id gnl|my_center|LOCUS_45710 340371 339001 gene locus_tag LOCUS_45720 340371 339001 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405041.1 protein_id gnl|my_center|LOCUS_45720 341732 340374 gene locus_tag LOCUS_45730 341732 340374 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098666.1 protein_id gnl|my_center|LOCUS_45730 343597 341735 gene locus_tag LOCUS_45740 343597 341735 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147968.1 protein_id gnl|my_center|LOCUS_45740 345432 344125 gene locus_tag LOCUS_45750 345432 344125 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338425.1 protein_id gnl|my_center|LOCUS_45750 347155 345530 gene locus_tag LOCUS_45760 347155 345530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45760 347769 347176 gene locus_tag LOCUS_45770 347769 347176 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836185.1 protein_id gnl|my_center|LOCUS_45770 348564 347860 gene locus_tag LOCUS_45780 348564 347860 CDS product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275313.1 protein_id gnl|my_center|LOCUS_45780 350130 348763 gene locus_tag LOCUS_45790 350130 348763 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929319.1 protein_id gnl|my_center|LOCUS_45790 <351325 350412 gene locus_tag LOCUS_45800 <351325 350412 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265658.1:S-layer protein RsaA >Feature sequence076 >Feature sequence077 >Feature sequence078 >Feature sequence079 >Feature sequence080 >Feature sequence081 >Feature sequence082 >Feature sequence083 >Feature sequence084 >Feature sequence085 >Feature sequence086 572 2185 gene locus_tag LOCUS_45810 572 2185 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402342.1 protein_id gnl|my_center|LOCUS_45810 3071 2244 gene locus_tag LOCUS_45820 3071 2244 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024945656.1 protein_id gnl|my_center|LOCUS_45820 3535 4020 gene locus_tag LOCUS_45830 3535 4020 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194139.1 protein_id gnl|my_center|LOCUS_45830 4022 4753 gene locus_tag LOCUS_45840 4022 4753 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244755.1 protein_id gnl|my_center|LOCUS_45840 4762 5775 gene locus_tag LOCUS_45850 4762 5775 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267386.1 protein_id gnl|my_center|LOCUS_45850 5975 6853 gene locus_tag LOCUS_45860 5975 6853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45860 7642 7019 gene locus_tag LOCUS_45870 7642 7019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45870 7928 9016 gene locus_tag LOCUS_45880 7928 9016 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989636.1 protein_id gnl|my_center|LOCUS_45880 9733 9101 gene locus_tag LOCUS_45890 9733 9101 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 protein_id gnl|my_center|LOCUS_45890 10501 9887 gene locus_tag LOCUS_45900 10501 9887 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193001.1 protein_id gnl|my_center|LOCUS_45900 11339 10626 gene locus_tag LOCUS_45910 11339 10626 CDS product 16S rRNA pseudouridine(516) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207102.1 protein_id gnl|my_center|LOCUS_45910 13357 11414 gene locus_tag LOCUS_45920 13357 11414 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171279904.1 protein_id gnl|my_center|LOCUS_45920 14209 13436 gene locus_tag LOCUS_45930 14209 13436 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114733.1 protein_id gnl|my_center|LOCUS_45930 15084 14473 gene locus_tag LOCUS_45940 15084 14473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45940 16469 15276 gene locus_tag LOCUS_45950 16469 15276 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806995.1 protein_id gnl|my_center|LOCUS_45950 16983 16525 gene locus_tag LOCUS_45960 16983 16525 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197479.1 protein_id gnl|my_center|LOCUS_45960 17206 17042 gene locus_tag LOCUS_45970 17206 17042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45970 18098 17226 gene locus_tag LOCUS_45980 18098 17226 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550739.1 protein_id gnl|my_center|LOCUS_45980 18747 18136 gene locus_tag LOCUS_45990 18747 18136 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246986.1 protein_id gnl|my_center|LOCUS_45990 18942 20363 gene locus_tag LOCUS_46000 18942 20363 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185957.1 protein_id gnl|my_center|LOCUS_46000 21076 20420 gene locus_tag LOCUS_46010 gene leuE 21076 20420 CDS product leucine efflux protein LeuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095208.1 protein_id gnl|my_center|LOCUS_46010 22224 21139 gene locus_tag LOCUS_46020 22224 21139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46020 22595 24019 gene locus_tag LOCUS_46030 gene cysS 22595 24019 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584040.1 protein_id gnl|my_center|LOCUS_46030 24110 24730 gene locus_tag LOCUS_46040 24110 24730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46040 26845 24788 gene locus_tag LOCUS_46050 26845 24788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46050 27997 27200 gene locus_tag LOCUS_46060 27997 27200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46060 28279 30189 gene locus_tag LOCUS_46070 gene htpG 28279 30189 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185742.1 protein_id gnl|my_center|LOCUS_46070 30753 30268 gene locus_tag LOCUS_46080 30753 30268 CDS product DUF3016 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070894.1 protein_id gnl|my_center|LOCUS_46080 31476 31024 gene locus_tag LOCUS_46090 31476 31024 CDS product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194406.1 protein_id gnl|my_center|LOCUS_46090 31672 32172 gene locus_tag LOCUS_46100 31672 32172 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185796.1 protein_id gnl|my_center|LOCUS_46100 32379 33197 gene locus_tag LOCUS_46110 32379 33197 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185567.1 protein_id gnl|my_center|LOCUS_46110 33220 35001 gene locus_tag LOCUS_46120 33220 35001 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096276.1 protein_id gnl|my_center|LOCUS_46120 35025 37754 gene locus_tag LOCUS_46130 35025 37754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46130 38596 37679 gene locus_tag LOCUS_46140 38596 37679 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194782.1 protein_id gnl|my_center|LOCUS_46140 40260 38683 gene locus_tag LOCUS_46150 40260 38683 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205414.1 protein_id gnl|my_center|LOCUS_46150 40484 40305 gene locus_tag LOCUS_46160 40484 40305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46160 40827 41852 gene locus_tag LOCUS_46170 40827 41852 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185343.1 protein_id gnl|my_center|LOCUS_46170 42334 43533 gene locus_tag LOCUS_46180 42334 43533 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526293.1 protein_id gnl|my_center|LOCUS_46180 43725 45719 gene locus_tag LOCUS_46190 43725 45719 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810859.1 protein_id gnl|my_center|LOCUS_46190 45996 47009 gene locus_tag LOCUS_46200 45996 47009 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766899.1 protein_id gnl|my_center|LOCUS_46200 48853 47072 gene locus_tag LOCUS_46210 48853 47072 CDS product glycoside hydrolase family 44 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964233.1 protein_id gnl|my_center|LOCUS_46210 49069 52446 gene locus_tag LOCUS_46220 49069 52446 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073269.1 protein_id gnl|my_center|LOCUS_46220 52773 54815 gene locus_tag LOCUS_46230 52773 54815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46230 55651 54833 gene locus_tag LOCUS_46240 55651 54833 CDS product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461722.1 protein_id gnl|my_center|LOCUS_46240 56751 55765 gene locus_tag LOCUS_46250 56751 55765 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267282.1 protein_id gnl|my_center|LOCUS_46250 57388 56804 gene locus_tag LOCUS_46260 57388 56804 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530981.1 protein_id gnl|my_center|LOCUS_46260 57945 57565 gene locus_tag LOCUS_46270 57945 57565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46270 58282 59097 gene locus_tag LOCUS_46280 58282 59097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46280 60222 59101 gene locus_tag LOCUS_46290 60222 59101 CDS product DUF2855 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084188.1 protein_id gnl|my_center|LOCUS_46290 60504 61151 gene locus_tag LOCUS_46300 60504 61151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702730.1 protein_id gnl|my_center|LOCUS_46300 61148 61834 gene locus_tag LOCUS_46310 61148 61834 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481731.1 protein_id gnl|my_center|LOCUS_46310 61831 63048 gene locus_tag LOCUS_46320 61831 63048 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481724.1 protein_id gnl|my_center|LOCUS_46320 63064 63804 gene locus_tag LOCUS_46330 63064 63804 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263564.1 protein_id gnl|my_center|LOCUS_46330 63807 65060 gene locus_tag LOCUS_46340 63807 65060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46340 65135 65743 gene locus_tag LOCUS_46350 65135 65743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46350 66702 65668 gene locus_tag LOCUS_46360 66702 65668 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036633.1 protein_id gnl|my_center|LOCUS_46360 67451 66906 gene locus_tag LOCUS_46370 67451 66906 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231441.1 protein_id gnl|my_center|LOCUS_46370 68580 67474 gene locus_tag LOCUS_46380 68580 67474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46380 69190 69945 gene locus_tag LOCUS_46390 69190 69945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46390 72979 70088 gene locus_tag LOCUS_46400 72979 70088 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921413.1 protein_id gnl|my_center|LOCUS_46400 75311 73197 gene locus_tag LOCUS_46410 gene lpdA 75311 73197 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033459591.1 protein_id gnl|my_center|LOCUS_46410 76675 75326 gene locus_tag LOCUS_46420 76675 75326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46420 79478 76782 gene locus_tag LOCUS_46430 gene aceE 79478 76782 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811941.1 protein_id gnl|my_center|LOCUS_46430 81808 79802 gene locus_tag LOCUS_46440 81808 79802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46440 82270 81950 gene locus_tag LOCUS_46450 82270 81950 CDS product DUF2322 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198082.1 protein_id gnl|my_center|LOCUS_46450 85327 82538 gene locus_tag LOCUS_46460 85327 82538 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206610.1 protein_id gnl|my_center|LOCUS_46460 85693 86538 gene locus_tag LOCUS_46470 gene folD 85693 86538 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524717.1 protein_id gnl|my_center|LOCUS_46470 86540 88603 gene locus_tag LOCUS_46480 86540 88603 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191126.1 protein_id gnl|my_center|LOCUS_46480 88710 89249 gene locus_tag LOCUS_46490 88710 89249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46490 89256 89675 gene locus_tag LOCUS_46500 89256 89675 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522571.1 protein_id gnl|my_center|LOCUS_46500 89677 90057 gene locus_tag LOCUS_46510 89677 90057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46510 90220 91524 gene locus_tag LOCUS_46520 90220 91524 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063961.1 protein_id gnl|my_center|LOCUS_46520 92214 91705 gene locus_tag LOCUS_46530 92214 91705 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947215.1 protein_id gnl|my_center|LOCUS_46530 92362 93507 gene locus_tag LOCUS_46540 92362 93507 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525689.1 protein_id gnl|my_center|LOCUS_46540 93937 93722 gene locus_tag LOCUS_46550 93937 93722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46550 93936 94115 gene locus_tag LOCUS_46560 93936 94115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46560 94273 94506 gene locus_tag LOCUS_46570 94273 94506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46570 94597 95469 gene locus_tag LOCUS_46580 94597 95469 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204927.1 protein_id gnl|my_center|LOCUS_46580 95498 96307 gene locus_tag LOCUS_46590 gene lgt 95498 96307 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126322954.1 protein_id gnl|my_center|LOCUS_46590 96898 98613 gene locus_tag LOCUS_46600 gene leuA 96898 98613 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815908.1 protein_id gnl|my_center|LOCUS_46600 100163 98637 gene locus_tag LOCUS_46610 100163 98637 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555084.1 protein_id gnl|my_center|LOCUS_46610 100278 100739 gene locus_tag LOCUS_46620 100278 100739 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707488.1 protein_id gnl|my_center|LOCUS_46620 100742 101386 gene locus_tag LOCUS_46630 100742 101386 CDS product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112977.1 protein_id gnl|my_center|LOCUS_46630 101407 101877 gene locus_tag LOCUS_46640 101407 101877 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090156.1 protein_id gnl|my_center|LOCUS_46640 102004 104070 gene locus_tag LOCUS_46650 102004 104070 CDS product M13 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073607.1 protein_id gnl|my_center|LOCUS_46650 104348 105643 gene locus_tag LOCUS_46660 104348 105643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46660 106590 105682 gene locus_tag LOCUS_46670 106590 105682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46670 108332 106587 gene locus_tag LOCUS_46680 108332 106587 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974271.1 protein_id gnl|my_center|LOCUS_46680 111696 108466 gene locus_tag LOCUS_46690 111696 108466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46690 114059 111693 gene locus_tag LOCUS_46700 114059 111693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46700 115618 114071 gene locus_tag LOCUS_46710 115618 114071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46710 116075 116452 gene locus_tag LOCUS_46720 116075 116452 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014490264.1 protein_id gnl|my_center|LOCUS_46720 116487 117128 gene locus_tag LOCUS_46730 116487 117128 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261935.1 protein_id gnl|my_center|LOCUS_46730 117637 117167 gene locus_tag LOCUS_46740 117637 117167 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971837.1 protein_id gnl|my_center|LOCUS_46740 120428 117663 gene locus_tag LOCUS_46750 120428 117663 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195268.1 protein_id gnl|my_center|LOCUS_46750 120993 120649 gene locus_tag LOCUS_46760 gene nirD 120993 120649 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936225.1 protein_id gnl|my_center|LOCUS_46760 123450 121021 gene locus_tag LOCUS_46770 gene nirB 123450 121021 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530942.1 protein_id gnl|my_center|LOCUS_46770 123820 125034 gene locus_tag LOCUS_46780 123820 125034 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103940.1 protein_id gnl|my_center|LOCUS_46780 125058 126770 gene locus_tag LOCUS_46790 125058 126770 CDS product bifunctional protein-serine/threonine kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004342954.1 protein_id gnl|my_center|LOCUS_46790 126923 129031 gene locus_tag LOCUS_46800 126923 129031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46800 129041 132478 gene locus_tag LOCUS_46810 129041 132478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46810 132665 135631 gene locus_tag LOCUS_46820 132665 135631 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196173418.1 protein_id gnl|my_center|LOCUS_46820 136746 135712 gene locus_tag LOCUS_46830 136746 135712 CDS product arabinogalactan endo-1,4-beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038708.1 protein_id gnl|my_center|LOCUS_46830 139470 136864 gene locus_tag LOCUS_46840 139470 136864 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036452.1 protein_id gnl|my_center|LOCUS_46840 140923 139910 gene locus_tag LOCUS_46850 140923 139910 CDS product arabinose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194073.1 protein_id gnl|my_center|LOCUS_46850 143747 141150 gene locus_tag LOCUS_46860 143747 141150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46860 144176 144910 gene locus_tag LOCUS_46870 144176 144910 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967508.1 protein_id gnl|my_center|LOCUS_46870 144930 145247 gene locus_tag LOCUS_46880 144930 145247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46880 145258 145893 gene locus_tag LOCUS_46890 145258 145893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46890 147522 146620 gene locus_tag LOCUS_46900 147522 146620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46900 147642 148145 gene locus_tag LOCUS_46910 147642 148145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263468.1 protein_id gnl|my_center|LOCUS_46910 148297 148142 gene locus_tag LOCUS_46920 148297 148142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46920 148607 148257 gene locus_tag LOCUS_46930 148607 148257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46930 149044 149382 gene locus_tag LOCUS_46940 149044 149382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46940 150744 149497 gene locus_tag LOCUS_46950 150744 149497 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811711.1 protein_id gnl|my_center|LOCUS_46950 152200 150767 gene locus_tag LOCUS_46960 gene hydA 152200 150767 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099919.1 protein_id gnl|my_center|LOCUS_46960 153846 152398 gene locus_tag LOCUS_46970 153846 152398 CDS product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920205.1 protein_id gnl|my_center|LOCUS_46970 155533 154259 gene locus_tag LOCUS_46980 gene preA 155533 154259 CDS product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895509.1 protein_id gnl|my_center|LOCUS_46980 156893 155535 gene locus_tag LOCUS_46990 156893 155535 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114904.1 protein_id gnl|my_center|LOCUS_46990 158527 157028 gene locus_tag LOCUS_47000 158527 157028 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808433.1 protein_id gnl|my_center|LOCUS_47000 159851 158541 gene locus_tag LOCUS_47010 159851 158541 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530907.1 protein_id gnl|my_center|LOCUS_47010 160121 161563 gene locus_tag LOCUS_47020 160121 161563 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064488.1 protein_id gnl|my_center|LOCUS_47020 161556 162179 gene locus_tag LOCUS_47030 161556 162179 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770041.1 protein_id gnl|my_center|LOCUS_47030 162662 164296 gene locus_tag LOCUS_47040 162662 164296 CDS product DUF3369 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707269.1 protein_id gnl|my_center|LOCUS_47040 164753 164301 gene locus_tag LOCUS_47050 164753 164301 CDS product MerR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967151.1 protein_id gnl|my_center|LOCUS_47050 164836 167517 gene locus_tag LOCUS_47060 164836 167517 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162006391.1 protein_id gnl|my_center|LOCUS_47060 167665 168585 gene locus_tag LOCUS_47070 167665 168585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47070 168764 169804 gene locus_tag LOCUS_47080 168764 169804 CDS product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217709.1 protein_id gnl|my_center|LOCUS_47080 170248 170997 gene locus_tag LOCUS_47090 170248 170997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47090 171946 171125 gene locus_tag LOCUS_47100 gene tcdA 171946 171125 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190050.1 protein_id gnl|my_center|LOCUS_47100 172170 172712 gene locus_tag LOCUS_47110 172170 172712 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648824.1 protein_id gnl|my_center|LOCUS_47110 172754 173398 gene locus_tag LOCUS_47120 gene pdxH 172754 173398 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188935.1 protein_id gnl|my_center|LOCUS_47120 173480 174616 gene locus_tag LOCUS_47130 173480 174616 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816897.1 protein_id gnl|my_center|LOCUS_47130 174628 175116 gene locus_tag LOCUS_47140 174628 175116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47140 175097 175699 gene locus_tag LOCUS_47150 175097 175699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47150 175696 176328 gene locus_tag LOCUS_47160 175696 176328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47160 177443 176418 gene locus_tag LOCUS_47170 177443 176418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47170 177974 177456 gene locus_tag LOCUS_47180 177974 177456 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095605.1 protein_id gnl|my_center|LOCUS_47180 178786 178346 gene locus_tag LOCUS_47190 178786 178346 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531772.1 protein_id gnl|my_center|LOCUS_47190 179340 178801 gene locus_tag LOCUS_47200 gene msrA 179340 178801 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_47200 180105 179434 gene locus_tag LOCUS_47210 180105 179434 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482835.1 protein_id gnl|my_center|LOCUS_47210 180228 181139 gene locus_tag LOCUS_47220 180228 181139 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083769.1 protein_id gnl|my_center|LOCUS_47220 181463 181795 gene locus_tag LOCUS_47230 181463 181795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47230 182304 181990 gene locus_tag LOCUS_47240 182304 181990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47240 183376 184770 gene locus_tag LOCUS_47250 183376 184770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47250 184767 185549 gene locus_tag LOCUS_47260 184767 185549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47260 185555 188383 gene locus_tag LOCUS_47270 185555 188383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47270 189941 188532 gene locus_tag LOCUS_47280 189941 188532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47280 190275 190889 gene locus_tag LOCUS_47290 190275 190889 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089752.1 protein_id gnl|my_center|LOCUS_47290 190900 192696 gene locus_tag LOCUS_47300 190900 192696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47300 193188 193883 gene locus_tag LOCUS_47310 193188 193883 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072508.1 protein_id gnl|my_center|LOCUS_47310 194007 194972 gene locus_tag LOCUS_47320 gene corA 194007 194972 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521393.1 protein_id gnl|my_center|LOCUS_47320 195277 195110 gene locus_tag LOCUS_47330 195277 195110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47330 195391 196566 gene locus_tag LOCUS_47340 195391 196566 CDS product DUF3667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919988.1 protein_id gnl|my_center|LOCUS_47340 197871 196603 gene locus_tag LOCUS_47350 197871 196603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47350 198238 199890 gene locus_tag LOCUS_47360 198238 199890 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946763.1 protein_id gnl|my_center|LOCUS_47360 201570 200005 gene locus_tag LOCUS_47370 201570 200005 CDS product POT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070418.1 protein_id gnl|my_center|LOCUS_47370 205248 202051 gene locus_tag LOCUS_47380 205248 202051 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974031.1 protein_id gnl|my_center|LOCUS_47380 206484 205252 gene locus_tag LOCUS_47390 206484 205252 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974032.1 protein_id gnl|my_center|LOCUS_47390 206852 206628 gene locus_tag LOCUS_47400 206852 206628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47400 206749 207309 gene locus_tag LOCUS_47410 206749 207309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47410 207549 208580 gene locus_tag LOCUS_47420 207549 208580 CDS product Glu/Leu/Phe/Val dehydrogenase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072585.1 protein_id gnl|my_center|LOCUS_47420 208824 209330 gene locus_tag LOCUS_47430 208824 209330 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705212.1 protein_id gnl|my_center|LOCUS_47430 209436 209960 gene locus_tag LOCUS_47440 209436 209960 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105108.1 protein_id gnl|my_center|LOCUS_47440 211960 210074 gene locus_tag LOCUS_47450 211960 210074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47450 213077 212136 gene locus_tag LOCUS_47460 213077 212136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47460 213391 214170 gene locus_tag LOCUS_47470 213391 214170 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074197.1 protein_id gnl|my_center|LOCUS_47470 214691 214209 gene locus_tag LOCUS_47480 214691 214209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47480 215656 215165 gene locus_tag LOCUS_47490 215656 215165 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126727.1 protein_id gnl|my_center|LOCUS_47490 215975 215649 gene locus_tag LOCUS_47500 215975 215649 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967099.1 protein_id gnl|my_center|LOCUS_47500 216787 216095 gene locus_tag LOCUS_47510 216787 216095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47510 218520 217123 gene locus_tag LOCUS_47520 218520 217123 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971161.1 protein_id gnl|my_center|LOCUS_47520 219865 218672 gene locus_tag LOCUS_47530 219865 218672 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921540.1 protein_id gnl|my_center|LOCUS_47530 220746 219895 gene locus_tag LOCUS_47540 220746 219895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47540 221168 221261 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 225050 221958 gene locus_tag LOCUS_47550 225050 221958 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117740.1 protein_id gnl|my_center|LOCUS_47550 225952 225182 gene locus_tag LOCUS_47560 225952 225182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47560 226591 226013 gene locus_tag LOCUS_47570 226591 226013 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207859.1 protein_id gnl|my_center|LOCUS_47570 228608 227721 gene locus_tag LOCUS_47580 228608 227721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47580 232744 228623 gene locus_tag LOCUS_47590 232744 228623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47590 234141 232741 gene locus_tag LOCUS_47600 234141 232741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47600 234323 234760 gene locus_tag LOCUS_47610 234323 234760 CDS product PGDYG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196097.1 protein_id gnl|my_center|LOCUS_47610 235153 234923 gene locus_tag LOCUS_47620 235153 234923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47620 235698 235862 gene locus_tag LOCUS_47630 235698 235862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47630 236627 236355 gene locus_tag LOCUS_47640 236627 236355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47640 239103 236620 gene locus_tag LOCUS_47650 239103 236620 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941142.1 protein_id gnl|my_center|LOCUS_47650 239600 240562 gene locus_tag LOCUS_47660 gene glyQ 239600 240562 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189444.1 protein_id gnl|my_center|LOCUS_47660 240632 242716 gene locus_tag LOCUS_47670 gene glyS 240632 242716 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189008.1 protein_id gnl|my_center|LOCUS_47670 242826 243389 gene locus_tag LOCUS_47680 gene gmhB 242826 243389 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064982.1 protein_id gnl|my_center|LOCUS_47680 243422 244171 gene locus_tag LOCUS_47690 243422 244171 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190040.1 protein_id gnl|my_center|LOCUS_47690 244345 245259 gene locus_tag LOCUS_47700 244345 245259 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189715.1 protein_id gnl|my_center|LOCUS_47700 246062 245319 gene locus_tag LOCUS_47710 246062 245319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47710 252246 246031 gene locus_tag LOCUS_47720 252246 246031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47720 253896 252283 gene locus_tag LOCUS_47730 253896 252283 CDS product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112718.1 protein_id gnl|my_center|LOCUS_47730 254584 255717 gene locus_tag LOCUS_47740 254584 255717 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428415.1 protein_id gnl|my_center|LOCUS_47740 255748 257415 gene locus_tag LOCUS_47750 255748 257415 CDS product glycoside hydrolase family 10 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231519.1 protein_id gnl|my_center|LOCUS_47750 257811 260651 gene locus_tag LOCUS_47760 257811 260651 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114864.1 protein_id gnl|my_center|LOCUS_47760 262063 260729 gene locus_tag LOCUS_47770 262063 260729 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584016.1 protein_id gnl|my_center|LOCUS_47770 262745 262176 gene locus_tag LOCUS_47780 262745 262176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47780 262948 263838 gene locus_tag LOCUS_47790 gene murQ 262948 263838 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889472.1 protein_id gnl|my_center|LOCUS_47790 263899 264801 gene locus_tag LOCUS_47800 263899 264801 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095930.1 protein_id gnl|my_center|LOCUS_47800 266174 264816 gene locus_tag LOCUS_47810 266174 264816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47810 266892 266278 gene locus_tag LOCUS_47820 266892 266278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47820 268898 267063 gene locus_tag LOCUS_47830 268898 267063 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206612.1 protein_id gnl|my_center|LOCUS_47830 269896 268895 gene locus_tag LOCUS_47840 269896 268895 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930231.1 protein_id gnl|my_center|LOCUS_47840 271195 269900 gene locus_tag LOCUS_47850 271195 269900 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784237.1 protein_id gnl|my_center|LOCUS_47850 271470 272426 gene locus_tag LOCUS_47860 271470 272426 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889450.1 protein_id gnl|my_center|LOCUS_47860 272423 273298 gene locus_tag LOCUS_47870 gene ampDh2 272423 273298 CDS product N-acetylmuramoyl-L-alanine amidase AmpDh2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096970.1 protein_id gnl|my_center|LOCUS_47870 273295 273819 gene locus_tag LOCUS_47880 273295 273819 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003023254.1 protein_id gnl|my_center|LOCUS_47880 274949 273816 gene locus_tag LOCUS_47890 274949 273816 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390877.1 protein_id gnl|my_center|LOCUS_47890 275926 274946 gene locus_tag LOCUS_47900 275926 274946 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088395.1 protein_id gnl|my_center|LOCUS_47900 276963 275923 gene locus_tag LOCUS_47910 276963 275923 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390879.1 protein_id gnl|my_center|LOCUS_47910 277600 276956 gene locus_tag LOCUS_47920 277600 276956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47920 277817 277990 gene locus_tag LOCUS_47930 277817 277990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47930 278003 278197 gene locus_tag LOCUS_47940 278003 278197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47940 279197 278325 gene locus_tag LOCUS_47950 279197 278325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47950 279804 279313 gene locus_tag LOCUS_47960 279804 279313 CDS product CreA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197812.1 protein_id gnl|my_center|LOCUS_47960 281374 279860 gene locus_tag LOCUS_47970 281374 279860 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080450.1 protein_id gnl|my_center|LOCUS_47970 281638 282018 gene locus_tag LOCUS_47980 281638 282018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47980 282111 284417 gene locus_tag LOCUS_47990 282111 284417 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188913.1 protein_id gnl|my_center|LOCUS_47990 284892 284527 gene locus_tag LOCUS_48000 284892 284527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088488.1 protein_id gnl|my_center|LOCUS_48000 285463 284978 gene locus_tag LOCUS_48010 285463 284978 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817484.1 protein_id gnl|my_center|LOCUS_48010 286123 285698 gene locus_tag LOCUS_48020 286123 285698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48020 286333 287019 gene locus_tag LOCUS_48030 286333 287019 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811810.1 protein_id gnl|my_center|LOCUS_48030 287412 287119 gene locus_tag LOCUS_48040 287412 287119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48040 289054 287513 gene locus_tag LOCUS_48050 289054 287513 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099581.1 protein_id gnl|my_center|LOCUS_48050 290334 289063 gene locus_tag LOCUS_48060 290334 289063 CDS product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536181.1 protein_id gnl|my_center|LOCUS_48060 292317 290395 gene locus_tag LOCUS_48070 292317 290395 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192719.1 protein_id gnl|my_center|LOCUS_48070 294965 292752 gene locus_tag LOCUS_48080 294965 292752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48080 295760 296551 gene locus_tag LOCUS_48090 295760 296551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48090 297436 296618 gene locus_tag LOCUS_48100 297436 296618 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096250.1 protein_id gnl|my_center|LOCUS_48100 298335 297433 gene locus_tag LOCUS_48110 gene ntrB 298335 297433 CDS product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096249.1 protein_id gnl|my_center|LOCUS_48110 299640 298345 gene locus_tag LOCUS_48120 299640 298345 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882726.1 protein_id gnl|my_center|LOCUS_48120 300610 299975 gene locus_tag LOCUS_48130 300610 299975 CDS product ANTAR domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113581.1 protein_id gnl|my_center|LOCUS_48130 300802 301830 gene locus_tag LOCUS_48140 gene tsaD 300802 301830 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204325.1 protein_id gnl|my_center|LOCUS_48140 302341 301874 gene locus_tag LOCUS_48150 302341 301874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48150 303360 302743 gene locus_tag LOCUS_48160 gene plsY 303360 302743 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522633.1 protein_id gnl|my_center|LOCUS_48160 303941 303450 gene locus_tag LOCUS_48170 gene ybaK 303941 303450 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189587.1 protein_id gnl|my_center|LOCUS_48170 306089 304092 gene locus_tag LOCUS_48180 306089 304092 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810859.1 protein_id gnl|my_center|LOCUS_48180 308975 306225 gene locus_tag LOCUS_48190 308975 306225 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206610.1 protein_id gnl|my_center|LOCUS_48190 312194 309588 gene locus_tag LOCUS_48200 312194 309588 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840071.1 protein_id gnl|my_center|LOCUS_48200 312854 315739 gene locus_tag LOCUS_48210 312854 315739 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071943.1 protein_id gnl|my_center|LOCUS_48210 315989 317818 gene locus_tag LOCUS_48220 315989 317818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48220 318850 317906 gene locus_tag LOCUS_48230 gene xerD 318850 317906 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535956.1 protein_id gnl|my_center|LOCUS_48230 319362 318841 gene locus_tag LOCUS_48240 319362 318841 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189321.1 protein_id gnl|my_center|LOCUS_48240 321108 320104 gene locus_tag LOCUS_48250 321108 320104 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391425.1 protein_id gnl|my_center|LOCUS_48250 321725 322426 gene locus_tag LOCUS_48260 321725 322426 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391424.1 protein_id gnl|my_center|LOCUS_48260 322426 323814 gene locus_tag LOCUS_48270 322426 323814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_48270 323987 325978 gene locus_tag LOCUS_48280 323987 325978 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338586.1 protein_id gnl|my_center|LOCUS_48280 326006 326596 gene locus_tag LOCUS_48290 326006 326596 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338585.1 protein_id gnl|my_center|LOCUS_48290 326630 327520 gene locus_tag LOCUS_48300 326630 327520 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065020.1 protein_id gnl|my_center|LOCUS_48300 >Feature sequence087 >Feature sequence088 >Feature sequence089 >Feature sequence090 >Feature sequence091 >Feature sequence092 >Feature sequence093 >Feature sequence094 >Feature sequence095 >Feature sequence096 >Feature sequence097 629 2140 gene locus_tag LOCUS_48310 629 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48310 2130 2354 gene locus_tag LOCUS_48320 2130 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48320 3895 3371 gene locus_tag LOCUS_48330 3895 3371 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263911.1 protein_id gnl|my_center|LOCUS_48330 5819 3927 gene locus_tag LOCUS_48340 5819 3927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48340 6268 7134 gene locus_tag LOCUS_48350 6268 7134 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039958.1 protein_id gnl|my_center|LOCUS_48350 7164 7568 gene locus_tag LOCUS_48360 7164 7568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48360 7982 7704 gene locus_tag LOCUS_48370 7982 7704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48370 10520 8220 gene locus_tag LOCUS_48380 gene clpA 10520 8220 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196461.1 protein_id gnl|my_center|LOCUS_48380 10825 10517 gene locus_tag LOCUS_48390 gene clpS 10825 10517 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194131.1 protein_id gnl|my_center|LOCUS_48390 11223 11426 gene locus_tag LOCUS_48400 11223 11426 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196460.1 protein_id gnl|my_center|LOCUS_48400 11573 12940 gene locus_tag LOCUS_48410 11573 12940 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523251.1 protein_id gnl|my_center|LOCUS_48410 12937 13617 gene locus_tag LOCUS_48420 12937 13617 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188734.1 protein_id gnl|my_center|LOCUS_48420 14937 13714 gene locus_tag LOCUS_48430 14937 13714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48430 17814 15046 gene locus_tag LOCUS_48440 17814 15046 CDS product DUF3857 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163456444.1 protein_id gnl|my_center|LOCUS_48440 19541 18288 gene locus_tag LOCUS_48450 gene icd 19541 18288 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189552.1 protein_id gnl|my_center|LOCUS_48450 20156 21145 gene locus_tag LOCUS_48460 20156 21145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48460 21215 21766 gene locus_tag LOCUS_48470 21215 21766 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189780.1 protein_id gnl|my_center|LOCUS_48470 21929 22177 gene locus_tag LOCUS_48480 21929 22177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48480 22697 22431 gene locus_tag LOCUS_48490 gene rpsT 22697 22431 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189743.1 protein_id gnl|my_center|LOCUS_48490 22999 23592 gene locus_tag LOCUS_48500 22999 23592 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037388.1 protein_id gnl|my_center|LOCUS_48500 23639 24808 gene locus_tag LOCUS_48510 23639 24808 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186167.1 protein_id gnl|my_center|LOCUS_48510 24805 25029 gene locus_tag LOCUS_48520 24805 25029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48520 26438 25611 gene locus_tag LOCUS_48530 26438 25611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48530 26588 28579 gene locus_tag LOCUS_48540 gene parE 26588 28579 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185934.1 protein_id gnl|my_center|LOCUS_48540 28637 30964 gene locus_tag LOCUS_48550 gene parC 28637 30964 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522490.1 protein_id gnl|my_center|LOCUS_48550 31194 34238 gene locus_tag LOCUS_48560 31194 34238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48560 34235 34855 gene locus_tag LOCUS_48570 34235 34855 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620669.1 protein_id gnl|my_center|LOCUS_48570 35055 35450 gene locus_tag LOCUS_48580 35055 35450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48580 35563 37281 gene locus_tag LOCUS_48590 35563 37281 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201704.1 protein_id gnl|my_center|LOCUS_48590 37377 38132 gene locus_tag LOCUS_48600 37377 38132 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965276.1 protein_id gnl|my_center|LOCUS_48600 40285 39557 gene locus_tag LOCUS_48610 40285 39557 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016231.1 protein_id gnl|my_center|LOCUS_48610 41346 40282 gene locus_tag LOCUS_48620 41346 40282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48620 41418 42611 gene locus_tag LOCUS_48630 41418 42611 CDS product phosphatase PAP2/dual specificity phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035750.1 protein_id gnl|my_center|LOCUS_48630 42652 43272 gene locus_tag LOCUS_48640 42652 43272 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104477.1 protein_id gnl|my_center|LOCUS_48640 45040 43220 gene locus_tag LOCUS_48650 45040 43220 CDS product bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105550.1 protein_id gnl|my_center|LOCUS_48650 45965 45084 gene locus_tag LOCUS_48660 45965 45084 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000890944.1 protein_id gnl|my_center|LOCUS_48660 47782 46139 gene locus_tag LOCUS_48670 47782 46139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48670 48175 47783 gene locus_tag LOCUS_48680 48175 47783 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259628.1 protein_id gnl|my_center|LOCUS_48680 48588 50228 gene locus_tag LOCUS_48690 48588 50228 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038609.1 protein_id gnl|my_center|LOCUS_48690 54122 50289 gene locus_tag LOCUS_48700 54122 50289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48700 55640 54420 gene locus_tag LOCUS_48710 gene hutI 55640 54420 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191108.1 protein_id gnl|my_center|LOCUS_48710 56215 55640 gene locus_tag LOCUS_48720 56215 55640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48720 57904 56363 gene locus_tag LOCUS_48730 gene hutH 57904 56363 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902906.1 protein_id gnl|my_center|LOCUS_48730 59821 58118 gene locus_tag LOCUS_48740 59821 58118 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174873167.1 protein_id gnl|my_center|LOCUS_48740 60103 60510 gene locus_tag LOCUS_48750 60103 60510 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527911.1 protein_id gnl|my_center|LOCUS_48750 60514 60990 gene locus_tag LOCUS_48760 60514 60990 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199373.1 protein_id gnl|my_center|LOCUS_48760 61820 61053 gene locus_tag LOCUS_48770 61820 61053 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315093.1 protein_id gnl|my_center|LOCUS_48770 61986 62921 gene locus_tag LOCUS_48780 61986 62921 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112652.1 protein_id gnl|my_center|LOCUS_48780 63042 63716 gene locus_tag LOCUS_48790 gene hutC 63042 63716 CDS product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193766.1 protein_id gnl|my_center|LOCUS_48790 64108 64332 gene locus_tag LOCUS_48800 64108 64332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48800 64397 65044 gene locus_tag LOCUS_48810 64397 65044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48810 65066 65281 gene locus_tag LOCUS_48820 65066 65281 CDS product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003341842.1 protein_id gnl|my_center|LOCUS_48820 65767 65378 gene locus_tag LOCUS_48830 65767 65378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48830 66794 65967 gene locus_tag LOCUS_48840 66794 65967 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071665.1 protein_id gnl|my_center|LOCUS_48840 69154 67469 gene locus_tag LOCUS_48850 69154 67469 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925657.1 protein_id gnl|my_center|LOCUS_48850 69464 69255 gene locus_tag LOCUS_48860 69464 69255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48860 71284 69566 gene locus_tag LOCUS_48870 71284 69566 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142469.1 protein_id gnl|my_center|LOCUS_48870 71411 72511 gene locus_tag LOCUS_48880 71411 72511 CDS product beta-eliminating lyase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478461.1 protein_id gnl|my_center|LOCUS_48880 72693 73133 gene locus_tag LOCUS_48890 72693 73133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48890 74559 73117 gene locus_tag LOCUS_48900 74559 73117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48900 75200 74556 gene locus_tag LOCUS_48910 gene creB 75200 74556 CDS product two-component system response regulator CreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188676.1 protein_id gnl|my_center|LOCUS_48910 75398 76519 gene locus_tag LOCUS_48920 75398 76519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48920 76999 76532 gene locus_tag LOCUS_48930 76999 76532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010208159.1 protein_id gnl|my_center|LOCUS_48930 77852 77061 gene locus_tag LOCUS_48940 77852 77061 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235471423.1 protein_id gnl|my_center|LOCUS_48940 77930 78199 gene locus_tag LOCUS_48950 77930 78199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528682.1 protein_id gnl|my_center|LOCUS_48950 79501 78251 gene locus_tag LOCUS_48960 79501 78251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48960 80137 79691 gene locus_tag LOCUS_48970 80137 79691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48970 81570 80224 gene locus_tag LOCUS_48980 81570 80224 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116611749.1 protein_id gnl|my_center|LOCUS_48980 82363 81557 gene locus_tag LOCUS_48990 82363 81557 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192990.1 protein_id gnl|my_center|LOCUS_48990 83261 82431 gene locus_tag LOCUS_49000 83261 82431 CDS product EI24 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533957.1 protein_id gnl|my_center|LOCUS_49000 84238 83258 gene locus_tag LOCUS_49010 84238 83258 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815411.1 protein_id gnl|my_center|LOCUS_49010 85041 84238 gene locus_tag LOCUS_49020 85041 84238 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448285.1 protein_id gnl|my_center|LOCUS_49020 86029 85055 gene locus_tag LOCUS_49030 86029 85055 CDS product beta-propeller fold lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192001.1 protein_id gnl|my_center|LOCUS_49030 86537 86893 gene locus_tag LOCUS_49040 86537 86893 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525093.1 protein_id gnl|my_center|LOCUS_49040 87658 87071 gene locus_tag LOCUS_49050 gene orn 87658 87071 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535917.1 protein_id gnl|my_center|LOCUS_49050 87686 88960 gene locus_tag LOCUS_49060 87686 88960 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555861.1 protein_id gnl|my_center|LOCUS_49060 88971 89321 gene locus_tag LOCUS_49070 88971 89321 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037236.1 protein_id gnl|my_center|LOCUS_49070 89321 90226 gene locus_tag LOCUS_49080 gene rsgA 89321 90226 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550124.1 protein_id gnl|my_center|LOCUS_49080 90576 91223 gene locus_tag LOCUS_49090 90576 91223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49090 91207 91446 gene locus_tag LOCUS_49100 91207 91446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49100 92011 93429 gene locus_tag LOCUS_49110 92011 93429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49110 93729 95417 gene locus_tag LOCUS_49120 93729 95417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49120 96045 95572 gene locus_tag LOCUS_49130 96045 95572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49130 96851 96150 gene locus_tag LOCUS_49140 96851 96150 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791915.1 protein_id gnl|my_center|LOCUS_49140 97304 96984 gene locus_tag LOCUS_49150 97304 96984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49150 97707 97294 gene locus_tag LOCUS_49160 97707 97294 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383864.1 protein_id gnl|my_center|LOCUS_49160 98469 97726 gene locus_tag LOCUS_49170 98469 97726 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268506.1 protein_id gnl|my_center|LOCUS_49170 98618 99505 gene locus_tag LOCUS_49180 98618 99505 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268507.1 protein_id gnl|my_center|LOCUS_49180 100171 99821 gene locus_tag LOCUS_49190 100171 99821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49190 101313 100171 gene locus_tag LOCUS_49200 101313 100171 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770934.1 protein_id gnl|my_center|LOCUS_49200 102720 101323 gene locus_tag LOCUS_49210 102720 101323 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770932.1 protein_id gnl|my_center|LOCUS_49210 103405 102746 gene locus_tag LOCUS_49220 103405 102746 CDS product alginate O-acetyltransferase AlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770931.1 protein_id gnl|my_center|LOCUS_49220 104088 103429 gene locus_tag LOCUS_49230 104088 103429 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556137.1 protein_id gnl|my_center|LOCUS_49230 104524 105480 gene locus_tag LOCUS_49240 gene argF 104524 105480 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190177.1 protein_id gnl|my_center|LOCUS_49240 105775 107007 gene locus_tag LOCUS_49250 105775 107007 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092065.1 protein_id gnl|my_center|LOCUS_49250 107080 107394 gene locus_tag LOCUS_49260 107080 107394 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115102.1 protein_id gnl|my_center|LOCUS_49260 110686 107543 gene locus_tag LOCUS_49270 110686 107543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49270 111548 110937 gene locus_tag LOCUS_49280 111548 110937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49280 112052 114211 gene locus_tag LOCUS_49290 112052 114211 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969597.1 protein_id gnl|my_center|LOCUS_49290 114814 114302 gene locus_tag LOCUS_49300 114814 114302 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528237.1 protein_id gnl|my_center|LOCUS_49300 115037 114882 gene locus_tag LOCUS_49310 115037 114882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49310 115658 115173 gene locus_tag LOCUS_49320 115658 115173 CDS product glutaredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941229.1 protein_id gnl|my_center|LOCUS_49320 117168 115900 gene locus_tag LOCUS_49330 117168 115900 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640418.1 protein_id gnl|my_center|LOCUS_49330 118513 117206 gene locus_tag LOCUS_49340 118513 117206 CDS product glucarate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267913.1 protein_id gnl|my_center|LOCUS_49340 121447 118559 gene locus_tag LOCUS_49350 121447 118559 CDS product glycosyl hydrolase 115 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226354.1 protein_id gnl|my_center|LOCUS_49350 122483 122082 gene locus_tag LOCUS_49360 122483 122082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49360 123389 122664 gene locus_tag LOCUS_49370 123389 122664 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003369710.1 protein_id gnl|my_center|LOCUS_49370 123828 123424 gene locus_tag LOCUS_49380 123828 123424 CDS product DCC1-like thiol-disulfide oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530151.1 protein_id gnl|my_center|LOCUS_49380 123927 124247 gene locus_tag LOCUS_49390 123927 124247 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037758.1 protein_id gnl|my_center|LOCUS_49390 125184 124450 gene locus_tag LOCUS_49400 125184 124450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49400 125893 126882 gene locus_tag LOCUS_49410 125893 126882 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717004.1 protein_id gnl|my_center|LOCUS_49410 128032 126983 gene locus_tag LOCUS_49420 128032 126983 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225221.1 protein_id gnl|my_center|LOCUS_49420 129269 128022 gene locus_tag LOCUS_49430 129269 128022 CDS product XylR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764391.1 protein_id gnl|my_center|LOCUS_49430 131871 129445 gene locus_tag LOCUS_49440 131871 129445 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920890.1 protein_id gnl|my_center|LOCUS_49440 133329 132187 gene locus_tag LOCUS_49450 gene gguB 133329 132187 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400873.1 protein_id gnl|my_center|LOCUS_49450 134949 133372 gene locus_tag LOCUS_49460 gene xylG 134949 133372 CDS product D-xylose ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268061.1 protein_id gnl|my_center|LOCUS_49460 136088 135075 gene locus_tag LOCUS_49470 gene xylF 136088 135075 CDS product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764395.1 protein_id gnl|my_center|LOCUS_49470 138009 136225 gene locus_tag LOCUS_49480 gene xylD 138009 136225 CDS product xylonate dehydratase XylD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640069.1 protein_id gnl|my_center|LOCUS_49480 138893 138006 gene locus_tag LOCUS_49490 138893 138006 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918705.1 protein_id gnl|my_center|LOCUS_49490 139657 138890 gene locus_tag LOCUS_49500 gene xylB 139657 138890 CDS product D-xylose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918706.1 protein_id gnl|my_center|LOCUS_49500 140961 139747 gene locus_tag LOCUS_49510 140961 139747 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205727.1 protein_id gnl|my_center|LOCUS_49510 141976 141305 gene locus_tag LOCUS_49520 141976 141305 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226070.1 protein_id gnl|my_center|LOCUS_49520 142179 143366 gene locus_tag LOCUS_49530 gene tet 142179 143366 CDS product tetracycline efflux MFS transporter Tet(30) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973639.1 protein_id gnl|my_center|LOCUS_49530 144485 143382 gene locus_tag LOCUS_49540 144485 143382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49540 144765 146831 gene locus_tag LOCUS_49550 144765 146831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49550 147114 147896 gene locus_tag LOCUS_49560 147114 147896 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705597.1 protein_id gnl|my_center|LOCUS_49560 148137 149030 gene locus_tag LOCUS_49570 148137 149030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49570 149260 150312 gene locus_tag LOCUS_49580 149260 150312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49580 152627 150498 gene locus_tag LOCUS_49590 152627 150498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49590 154171 152663 gene locus_tag LOCUS_49600 154171 152663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49600 154800 155015 gene locus_tag LOCUS_49610 154800 155015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49610 155274 155059 gene locus_tag LOCUS_49620 155274 155059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49620 156375 155389 gene locus_tag LOCUS_49630 156375 155389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49630 159099 156628 gene locus_tag LOCUS_49640 159099 156628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49640 161484 160402 gene locus_tag LOCUS_49650 161484 160402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49650 161781 161984 gene locus_tag LOCUS_49660 161781 161984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49660 162148 162447 gene locus_tag LOCUS_49670 162148 162447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49670 162451 162930 gene locus_tag LOCUS_49680 162451 162930 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039401.1 protein_id gnl|my_center|LOCUS_49680 163607 163020 gene locus_tag LOCUS_49690 163607 163020 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967188.1 protein_id gnl|my_center|LOCUS_49690 164261 163650 gene locus_tag LOCUS_49700 164261 163650 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206680.1 protein_id gnl|my_center|LOCUS_49700 164400 165302 gene locus_tag LOCUS_49710 164400 165302 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967190.1 protein_id gnl|my_center|LOCUS_49710 166325 165699 gene locus_tag LOCUS_49720 166325 165699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49720 167836 166544 gene locus_tag LOCUS_49730 167836 166544 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922385.1 protein_id gnl|my_center|LOCUS_49730 168111 168629 gene locus_tag LOCUS_49740 168111 168629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49740 169254 168718 gene locus_tag LOCUS_49750 169254 168718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49750 170209 169244 gene locus_tag LOCUS_49760 170209 169244 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090584.1 protein_id gnl|my_center|LOCUS_49760 170360 171034 gene locus_tag LOCUS_49770 170360 171034 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090583.1 protein_id gnl|my_center|LOCUS_49770 172590 171241 gene locus_tag LOCUS_49780 172590 171241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49780 174300 172633 gene locus_tag LOCUS_49790 174300 172633 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011997001.1 protein_id gnl|my_center|LOCUS_49790 174611 175000 gene locus_tag LOCUS_49800 174611 175000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49800 175188 177950 gene locus_tag LOCUS_49810 175188 177950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49810 178083 179723 gene locus_tag LOCUS_49820 178083 179723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49820 179720 180493 gene locus_tag LOCUS_49830 179720 180493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49830 180503 185191 gene locus_tag LOCUS_49840 gene magD 180503 185191 CDS product alpha-2-macroglobulin MagD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112866.1 protein_id gnl|my_center|LOCUS_49840 185253 186980 gene locus_tag LOCUS_49850 185253 186980 CDS product DUF2300 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003455629.1 protein_id gnl|my_center|LOCUS_49850 186977 187762 gene locus_tag LOCUS_49860 186977 187762 CDS product YfaP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225852.1 protein_id gnl|my_center|LOCUS_49860 187773 188606 gene locus_tag LOCUS_49870 187773 188606 CDS product YfaP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094417.1 protein_id gnl|my_center|LOCUS_49870 188657 189868 gene locus_tag LOCUS_49880 188657 189868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49880 192103 189890 gene locus_tag LOCUS_49890 192103 189890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49890 192296 193282 gene locus_tag LOCUS_49900 192296 193282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49900 193914 193516 gene locus_tag LOCUS_49910 193914 193516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49910 194448 193999 gene locus_tag LOCUS_49920 194448 193999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49920 194986 194519 gene locus_tag LOCUS_49930 194986 194519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49930 195263 196675 gene locus_tag LOCUS_49940 195263 196675 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268044.1 protein_id gnl|my_center|LOCUS_49940 196696 197919 gene locus_tag LOCUS_49950 196696 197919 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704711.1 protein_id gnl|my_center|LOCUS_49950 197922 199874 gene locus_tag LOCUS_49960 197922 199874 CDS product MacB family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071115.1 protein_id gnl|my_center|LOCUS_49960 200011 200889 gene locus_tag LOCUS_49970 200011 200889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49970 202404 201019 gene locus_tag LOCUS_49980 202404 201019 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108638.1 protein_id gnl|my_center|LOCUS_49980 202784 202479 gene locus_tag LOCUS_49990 202784 202479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265779.1 protein_id gnl|my_center|LOCUS_49990 204389 203076 gene locus_tag LOCUS_50000 204389 203076 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266670.1 protein_id gnl|my_center|LOCUS_50000 205821 204520 gene locus_tag LOCUS_50010 205821 204520 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229166.1 protein_id gnl|my_center|LOCUS_50010 206410 206081 gene locus_tag LOCUS_50020 206410 206081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50020 207525 206692 gene locus_tag LOCUS_50030 207525 206692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50030 209132 207579 gene locus_tag LOCUS_50040 gene murJ 209132 207579 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550789.1 protein_id gnl|my_center|LOCUS_50040 210709 209270 gene locus_tag LOCUS_50050 210709 209270 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942194.1 protein_id gnl|my_center|LOCUS_50050 211135 211722 gene locus_tag LOCUS_50060 211135 211722 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529959.1 protein_id gnl|my_center|LOCUS_50060 211952 213028 gene locus_tag LOCUS_50070 211952 213028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50070 213104 213514 gene locus_tag LOCUS_50080 213104 213514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50080 213776 214108 gene locus_tag LOCUS_50090 213776 214108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50090 215059 214352 gene locus_tag LOCUS_50100 215059 214352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50100 216401 215469 gene locus_tag LOCUS_50110 216401 215469 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089835.1 protein_id gnl|my_center|LOCUS_50110 216503 217180 gene locus_tag LOCUS_50120 216503 217180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50120 217173 217706 gene locus_tag LOCUS_50130 217173 217706 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809303.1 protein_id gnl|my_center|LOCUS_50130 217745 217981 gene locus_tag LOCUS_50140 217745 217981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50140 218447 218025 gene locus_tag LOCUS_50150 218447 218025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50150 218598 218431 gene locus_tag LOCUS_50160 218598 218431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50160 219417 219187 gene locus_tag LOCUS_50170 219417 219187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50170 220657 220124 gene locus_tag LOCUS_50180 220657 220124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50180 221451 221065 gene locus_tag LOCUS_50190 221451 221065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50190 222470 221931 gene locus_tag LOCUS_50200 222470 221931 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933033.1 protein_id gnl|my_center|LOCUS_50200 223716 222580 gene locus_tag LOCUS_50210 223716 222580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50210 224228 225235 gene locus_tag LOCUS_50220 224228 225235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50220 225264 225713 gene locus_tag LOCUS_50230 225264 225713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50230 225970 226533 gene locus_tag LOCUS_50240 225970 226533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50240 226557 227330 gene locus_tag LOCUS_50250 226557 227330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50250 227437 229314 gene locus_tag LOCUS_50260 227437 229314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50260 229353 229844 gene locus_tag LOCUS_50270 229353 229844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50270 230418 229894 gene locus_tag LOCUS_50280 230418 229894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50280 230729 230923 gene locus_tag LOCUS_50290 230729 230923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50290 231432 230995 gene locus_tag LOCUS_50300 231432 230995 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057552266.1 protein_id gnl|my_center|LOCUS_50300 231860 231432 gene locus_tag LOCUS_50310 231860 231432 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946442.1 protein_id gnl|my_center|LOCUS_50310 233174 231960 gene locus_tag LOCUS_50320 233174 231960 CDS product OmpP1/FadL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938840.1 protein_id gnl|my_center|LOCUS_50320 234729 233602 gene locus_tag LOCUS_50330 234729 233602 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118454.1 protein_id gnl|my_center|LOCUS_50330 235814 234795 gene locus_tag LOCUS_50340 235814 234795 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640075.1 protein_id gnl|my_center|LOCUS_50340 236762 235917 gene locus_tag LOCUS_50350 236762 235917 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919375.1 protein_id gnl|my_center|LOCUS_50350 237753 237073 gene locus_tag LOCUS_50360 237753 237073 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992244.1 protein_id gnl|my_center|LOCUS_50360 239045 237978 gene locus_tag LOCUS_50370 gene rsgA 239045 237978 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458373.1 protein_id gnl|my_center|LOCUS_50370 239999 239487 gene locus_tag LOCUS_50380 239999 239487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50380 241238 240561 gene locus_tag LOCUS_50390 241238 240561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50390 241637 242494 gene locus_tag LOCUS_50400 241637 242494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50400 244075 243107 gene locus_tag LOCUS_50410 244075 243107 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020668.1 protein_id gnl|my_center|LOCUS_50410 244910 244152 gene locus_tag LOCUS_50420 244910 244152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50420 245458 244946 gene locus_tag LOCUS_50430 245458 244946 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366244.1 protein_id gnl|my_center|LOCUS_50430 245963 245484 gene locus_tag LOCUS_50440 245963 245484 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189016.1 protein_id gnl|my_center|LOCUS_50440 246534 247181 gene locus_tag LOCUS_50450 gene kynB 246534 247181 CDS product arylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198883.1 protein_id gnl|my_center|LOCUS_50450 247181 248434 gene locus_tag LOCUS_50460 gene kynU 247181 248434 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189663.1 protein_id gnl|my_center|LOCUS_50460 248621 249472 gene locus_tag LOCUS_50470 gene kynA 248621 249472 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530854.1 protein_id gnl|my_center|LOCUS_50470 250321 249542 gene locus_tag LOCUS_50480 250321 249542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50480 251002 250481 gene locus_tag LOCUS_50490 251002 250481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50490 251828 251070 gene locus_tag LOCUS_50500 251828 251070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50500 252510 251821 gene locus_tag LOCUS_50510 252510 251821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50510 253198 252770 gene locus_tag LOCUS_50520 253198 252770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50520 253467 253201 gene locus_tag LOCUS_50530 253467 253201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50530 254114 253779 gene locus_tag LOCUS_50540 254114 253779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50540 254431 254117 gene locus_tag LOCUS_50550 254431 254117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50550 254690 254442 gene locus_tag LOCUS_50560 254690 254442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50560 256365 254683 gene locus_tag LOCUS_50570 256365 254683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50570 258347 256689 gene locus_tag LOCUS_50580 258347 256689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50580 258847 258380 gene locus_tag LOCUS_50590 258847 258380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50590 259857 258847 gene locus_tag LOCUS_50600 259857 258847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50600 260293 259859 gene locus_tag LOCUS_50610 260293 259859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50610 262917 260290 gene locus_tag LOCUS_50620 262917 260290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50620 263328 263074 gene locus_tag LOCUS_50630 263328 263074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50630 263835 263398 gene locus_tag LOCUS_50640 263835 263398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50640 264011 263820 gene locus_tag LOCUS_50650 264011 263820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50650 264486 264004 gene locus_tag LOCUS_50660 264486 264004 CDS product glycoside hydrolase family 108 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225286.1 protein_id gnl|my_center|LOCUS_50660 264677 264483 gene locus_tag LOCUS_50670 264677 264483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50670 265311 264808 gene locus_tag LOCUS_50680 265311 264808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50680 266176 265316 gene locus_tag LOCUS_50690 266176 265316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50690 266640 266227 gene locus_tag LOCUS_50700 266640 266227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50700 267177 266650 gene locus_tag LOCUS_50710 267177 266650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50710 269232 267187 gene locus_tag LOCUS_50720 269232 267187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50720 269909 269229 gene locus_tag LOCUS_50730 269909 269229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50730 270398 269913 gene locus_tag LOCUS_50740 270398 269913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50740 270842 270474 gene locus_tag LOCUS_50750 270842 270474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50750 271064 270852 gene locus_tag LOCUS_50760 271064 270852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50760 272135 271080 gene locus_tag LOCUS_50770 272135 271080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50770 273108 272146 gene locus_tag LOCUS_50780 273108 272146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50780 273424 273191 gene locus_tag LOCUS_50790 273424 273191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50790 276229 273434 gene locus_tag LOCUS_50800 276229 273434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50800 276703 276329 gene locus_tag LOCUS_50810 276703 276329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50810 278232 276748 gene locus_tag LOCUS_50820 278232 276748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939012.1 protein_id gnl|my_center|LOCUS_50820 278884 278213 gene locus_tag LOCUS_50830 278884 278213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705883.1 protein_id gnl|my_center|LOCUS_50830 279233 278928 gene locus_tag LOCUS_50840 279233 278928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50840 279571 279233 gene locus_tag LOCUS_50850 279571 279233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50850 280981 279836 gene locus_tag LOCUS_50860 280981 279836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50860 281502 282245 gene locus_tag LOCUS_50870 281502 282245 CDS product acetoacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089765.1 protein_id gnl|my_center|LOCUS_50870 282283 283065 gene locus_tag LOCUS_50880 282283 283065 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948022.1 protein_id gnl|my_center|LOCUS_50880 284547 283297 gene locus_tag LOCUS_50890 284547 283297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50890 285023 284619 gene locus_tag LOCUS_50900 285023 284619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50900 285860 285219 gene locus_tag LOCUS_50910 285860 285219 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003343108.1 protein_id gnl|my_center|LOCUS_50910 286807 285941 gene locus_tag LOCUS_50920 286807 285941 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226808.1 protein_id gnl|my_center|LOCUS_50920 286939 287385 gene locus_tag LOCUS_50930 286939 287385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50930 289772 287409 gene locus_tag LOCUS_50940 289772 287409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50940 290599 289775 gene locus_tag LOCUS_50950 290599 289775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50950 290730 291098 gene locus_tag LOCUS_50960 290730 291098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50960 291290 291631 gene locus_tag LOCUS_50970 291290 291631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50970 292409 291741 gene locus_tag LOCUS_50980 292409 291741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50980 293121 292399 gene locus_tag LOCUS_50990 293121 292399 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764971.1 protein_id gnl|my_center|LOCUS_50990 294964 293363 gene locus_tag LOCUS_51000 294964 293363 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368514.1 protein_id gnl|my_center|LOCUS_51000 295983 295429 gene locus_tag LOCUS_51010 295983 295429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51010 296261 295980 gene locus_tag LOCUS_51020 296261 295980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51020 296689 296261 gene locus_tag LOCUS_51030 296689 296261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51030 297847 297053 gene locus_tag LOCUS_51040 297847 297053 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988183.1 protein_id gnl|my_center|LOCUS_51040 298823 297831 gene locus_tag LOCUS_51050 298823 297831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51050 299760 299975 gene locus_tag LOCUS_51060 299760 299975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51060 300143 299982 gene locus_tag LOCUS_51070 300143 299982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51070 300294 300968 gene locus_tag LOCUS_51080 300294 300968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51080 301755 301021 gene locus_tag LOCUS_51090 301755 301021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51090 302300 301809 gene locus_tag LOCUS_51100 302300 301809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51100 302700 304439 gene locus_tag LOCUS_51110 302700 304439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51110 304543 304749 gene locus_tag LOCUS_51120 304543 304749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51120 305710 304793 gene locus_tag LOCUS_51130 gene gcvA 305710 304793 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640150.1 protein_id gnl|my_center|LOCUS_51130 305810 306784 gene locus_tag LOCUS_51140 305810 306784 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187502.1 protein_id gnl|my_center|LOCUS_51140 306906 307370 gene locus_tag LOCUS_51150 306906 307370 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242201.1 protein_id gnl|my_center|LOCUS_51150 307367 308578 gene locus_tag LOCUS_51160 307367 308578 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391648.1 protein_id gnl|my_center|LOCUS_51160 >Feature sequence098 >Feature sequence099 >Feature sequence100 >Feature sequence101 >Feature sequence102 >Feature sequence103 >Feature sequence104 >Feature sequence105 >Feature sequence106 >Feature sequence107 >Feature sequence108 394 53 gene locus_tag LOCUS_51170 394 53 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038005.1 protein_id gnl|my_center|LOCUS_51170 899 396 gene locus_tag LOCUS_51180 899 396 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105578.1 protein_id gnl|my_center|LOCUS_51180 995 1282 gene locus_tag LOCUS_51190 995 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51190 1269 1649 gene locus_tag LOCUS_51200 1269 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51200 1591 1845 gene locus_tag LOCUS_51210 1591 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51210 2543 1830 gene locus_tag LOCUS_51220 gene arsH 2543 1830 CDS product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926640.1 protein_id gnl|my_center|LOCUS_51220 2964 2533 gene locus_tag LOCUS_51230 gene arsC 2964 2533 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530551.1 protein_id gnl|my_center|LOCUS_51230 3688 2984 gene locus_tag LOCUS_51240 3688 2984 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919378.1 protein_id gnl|my_center|LOCUS_51240 4191 3691 gene locus_tag LOCUS_51250 4191 3691 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140066.1 protein_id gnl|my_center|LOCUS_51250 4727 4245 gene locus_tag LOCUS_51260 4727 4245 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095198.1 protein_id gnl|my_center|LOCUS_51260 5101 4769 gene locus_tag LOCUS_51270 5101 4769 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198701.1 protein_id gnl|my_center|LOCUS_51270 6351 5344 gene locus_tag LOCUS_51280 6351 5344 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941760.1 protein_id gnl|my_center|LOCUS_51280 7257 6424 gene locus_tag LOCUS_51290 7257 6424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51290 7512 7360 gene locus_tag LOCUS_51300 7512 7360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51300 7553 7897 gene locus_tag LOCUS_51310 7553 7897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51310 8311 7925 gene locus_tag LOCUS_51320 8311 7925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51320 10899 9631 gene locus_tag LOCUS_51330 10899 9631 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986828.1 protein_id gnl|my_center|LOCUS_51330 11677 10946 gene locus_tag LOCUS_51340 11677 10946 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014858053.1 protein_id gnl|my_center|LOCUS_51340 11921 12235 gene locus_tag LOCUS_51350 11921 12235 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140006.1 protein_id gnl|my_center|LOCUS_51350 12309 13778 gene locus_tag LOCUS_51360 12309 13778 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827458.1 protein_id gnl|my_center|LOCUS_51360 13800 15014 gene locus_tag LOCUS_51370 gene arsK 13800 15014 CDS product arsenite efflux MFS transporter ArsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975858.1 protein_id gnl|my_center|LOCUS_51370 15042 15527 gene locus_tag LOCUS_51380 15042 15527 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267057.1 protein_id gnl|my_center|LOCUS_51380 15544 15783 gene locus_tag LOCUS_51390 15544 15783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51390 16970 15834 gene locus_tag LOCUS_51400 16970 15834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51400 18148 17144 gene locus_tag LOCUS_51410 18148 17144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51410 18605 18309 gene locus_tag LOCUS_51420 18605 18309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51420 19452 18724 gene locus_tag LOCUS_51430 19452 18724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51430 20773 19511 gene locus_tag LOCUS_51440 20773 19511 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209929.1 protein_id gnl|my_center|LOCUS_51440 21010 20926 gene locus_tag LOCUS_t00730 21010 20926 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 22516 21092 gene locus_tag LOCUS_51450 22516 21092 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550337.1 protein_id gnl|my_center|LOCUS_51450 24192 22519 gene locus_tag LOCUS_51460 24192 22519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191882.1 protein_id gnl|my_center|LOCUS_51460 24804 24535 gene locus_tag LOCUS_51470 24804 24535 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193070.1 protein_id gnl|my_center|LOCUS_51470 25339 25968 gene locus_tag LOCUS_51480 25339 25968 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186100.1 protein_id gnl|my_center|LOCUS_51480 26645 25965 gene locus_tag LOCUS_51490 26645 25965 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768695.1 protein_id gnl|my_center|LOCUS_51490 27381 28727 gene locus_tag LOCUS_51500 27381 28727 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937371.1 protein_id gnl|my_center|LOCUS_51500 28801 31956 gene locus_tag LOCUS_51510 28801 31956 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937372.1 protein_id gnl|my_center|LOCUS_51510 31956 33401 gene locus_tag LOCUS_51520 31956 33401 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937373.1 protein_id gnl|my_center|LOCUS_51520 33881 35902 gene locus_tag LOCUS_51530 33881 35902 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918700.1 protein_id gnl|my_center|LOCUS_51530 36106 36690 gene locus_tag LOCUS_51540 36106 36690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51540 38091 36829 gene locus_tag LOCUS_51550 gene rho 38091 36829 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521321.1 protein_id gnl|my_center|LOCUS_51550 38653 38327 gene locus_tag LOCUS_51560 gene trxA 38653 38327 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191795.1 protein_id gnl|my_center|LOCUS_51560 38984 41779 gene locus_tag LOCUS_51570 38984 41779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51570 41779 45180 gene locus_tag LOCUS_51580 gene addA 41779 45180 CDS product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336808.1 protein_id gnl|my_center|LOCUS_51580 45236 45457 gene locus_tag LOCUS_51590 45236 45457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51590 45454 45780 gene locus_tag LOCUS_51600 45454 45780 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814611.1 protein_id gnl|my_center|LOCUS_51600 46336 46797 gene locus_tag LOCUS_51610 46336 46797 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193808.1 protein_id gnl|my_center|LOCUS_51610 46758 47804 gene locus_tag LOCUS_51620 gene ybiB 46758 47804 CDS product DNA-binding protein YbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522867.1 protein_id gnl|my_center|LOCUS_51620 47842 48378 gene locus_tag LOCUS_51630 47842 48378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51630 50770 48500 gene locus_tag LOCUS_51640 50770 48500 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036237.1 protein_id gnl|my_center|LOCUS_51640 51405 52601 gene locus_tag LOCUS_51650 51405 52601 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190760.1 protein_id gnl|my_center|LOCUS_51650 52881 53093 gene locus_tag LOCUS_51660 gene rpsU 52881 53093 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190342.1 protein_id gnl|my_center|LOCUS_51660 53258 53704 gene locus_tag LOCUS_51670 53258 53704 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190948.1 protein_id gnl|my_center|LOCUS_51670 53750 55543 gene locus_tag LOCUS_51680 gene dnaG 53750 55543 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190679.1 protein_id gnl|my_center|LOCUS_51680 56113 58938 gene locus_tag LOCUS_51690 56113 58938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51690 59118 59195 gene locus_tag LOCUS_t00740 59118 59195 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 59202 60689 gene locus_tag LOCUS_51700 59202 60689 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929121.1 protein_id gnl|my_center|LOCUS_51700 61720 60758 gene locus_tag LOCUS_51710 61720 60758 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037434787.1 protein_id gnl|my_center|LOCUS_51710 62615 61914 gene locus_tag LOCUS_51720 62615 61914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51720 63114 62617 gene locus_tag LOCUS_51730 63114 62617 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037773.1 protein_id gnl|my_center|LOCUS_51730 64369 63116 gene locus_tag LOCUS_51740 64369 63116 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921540.1 protein_id gnl|my_center|LOCUS_51740 65155 64406 gene locus_tag LOCUS_51750 65155 64406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51750 65774 65466 gene locus_tag LOCUS_51760 65774 65466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51760 65946 66542 gene locus_tag LOCUS_51770 65946 66542 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007249559.1 protein_id gnl|my_center|LOCUS_51770 66607 67059 gene locus_tag LOCUS_51780 66607 67059 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007249558.1 protein_id gnl|my_center|LOCUS_51780 67164 67685 gene locus_tag LOCUS_51790 67164 67685 CDS product DUF1775 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966290.1 protein_id gnl|my_center|LOCUS_51790 68226 67807 gene locus_tag LOCUS_51800 gene ohrR 68226 67807 CDS product organic hydroperoxide resistance protein OhrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104171.1 protein_id gnl|my_center|LOCUS_51800 69059 68607 gene locus_tag LOCUS_51810 69059 68607 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095464.1 protein_id gnl|my_center|LOCUS_51810 69264 70082 gene locus_tag LOCUS_51820 gene pyrF 69264 70082 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808606.1 protein_id gnl|my_center|LOCUS_51820 71497 70418 gene locus_tag LOCUS_51830 71497 70418 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195141.1 protein_id gnl|my_center|LOCUS_51830 75619 71978 gene locus_tag LOCUS_51840 75619 71978 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039974.1 protein_id gnl|my_center|LOCUS_51840 76121 77068 gene locus_tag LOCUS_51850 76121 77068 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930616.1 protein_id gnl|my_center|LOCUS_51850 77193 78470 gene locus_tag LOCUS_51860 77193 78470 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965775.1 protein_id gnl|my_center|LOCUS_51860 78606 79472 gene locus_tag LOCUS_51870 78606 79472 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172393.1 protein_id gnl|my_center|LOCUS_51870 79494 80579 gene locus_tag LOCUS_51880 79494 80579 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965773.1 protein_id gnl|my_center|LOCUS_51880 80576 81289 gene locus_tag LOCUS_51890 80576 81289 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085709.1 protein_id gnl|my_center|LOCUS_51890 81289 81993 gene locus_tag LOCUS_51900 81289 81993 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080267.1 protein_id gnl|my_center|LOCUS_51900 82117 83727 gene locus_tag LOCUS_51910 82117 83727 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205414.1 protein_id gnl|my_center|LOCUS_51910 83914 84468 gene locus_tag LOCUS_51920 83914 84468 CDS product winged helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106702718.1 protein_id gnl|my_center|LOCUS_51920 84652 84470 gene locus_tag LOCUS_51930 84652 84470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51930 85017 85874 gene locus_tag LOCUS_51940 85017 85874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51940 86713 85922 gene locus_tag LOCUS_51950 86713 85922 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405048.1 protein_id gnl|my_center|LOCUS_51950 87777 86710 gene locus_tag LOCUS_51960 87777 86710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51960 88479 87793 gene locus_tag LOCUS_51970 88479 87793 CDS product DUF5668 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109111.1 protein_id gnl|my_center|LOCUS_51970 88858 88508 gene locus_tag LOCUS_51980 88858 88508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51980 89528 89157 gene locus_tag LOCUS_51990 89528 89157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51990 90134 89682 gene locus_tag LOCUS_52000 90134 89682 CDS product DUF2214 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920775.1 protein_id gnl|my_center|LOCUS_52000 91050 90280 gene locus_tag LOCUS_52010 91050 90280 CDS product DUF1223 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195184.1 protein_id gnl|my_center|LOCUS_52010 92027 91101 gene locus_tag LOCUS_52020 92027 91101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52020 92896 92078 gene locus_tag LOCUS_52030 92896 92078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014508038.1 protein_id gnl|my_center|LOCUS_52030 93160 93420 gene locus_tag LOCUS_52040 93160 93420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52040 93434 94279 gene locus_tag LOCUS_52050 93434 94279 CDS product RIO1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705970.1 protein_id gnl|my_center|LOCUS_52050 94421 94948 gene locus_tag LOCUS_52060 94421 94948 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245116.1 protein_id gnl|my_center|LOCUS_52060 95712 95002 gene locus_tag LOCUS_52070 95712 95002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52070 97021 95915 gene locus_tag LOCUS_52080 97021 95915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52080 97903 97253 gene locus_tag LOCUS_52090 97903 97253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52090 98143 100416 gene locus_tag LOCUS_52100 98143 100416 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036237.1 protein_id gnl|my_center|LOCUS_52100 100443 101435 gene locus_tag LOCUS_52110 100443 101435 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085616.1 protein_id gnl|my_center|LOCUS_52110 102314 101532 gene locus_tag LOCUS_52120 102314 101532 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230307.1 protein_id gnl|my_center|LOCUS_52120 102916 105378 gene locus_tag LOCUS_52130 102916 105378 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038151.1 protein_id gnl|my_center|LOCUS_52130 105617 106744 gene locus_tag LOCUS_52140 105617 106744 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383860.1 protein_id gnl|my_center|LOCUS_52140 106761 108365 gene locus_tag LOCUS_52150 106761 108365 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383861.1 protein_id gnl|my_center|LOCUS_52150 108362 109534 gene locus_tag LOCUS_52160 108362 109534 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383862.1 protein_id gnl|my_center|LOCUS_52160 109531 110499 gene locus_tag LOCUS_52170 109531 110499 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537587.1 protein_id gnl|my_center|LOCUS_52170 110515 111588 gene locus_tag LOCUS_52180 110515 111588 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557877.1 protein_id gnl|my_center|LOCUS_52180 111796 112536 gene locus_tag LOCUS_52190 111796 112536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52190 112635 113831 gene locus_tag LOCUS_52200 112635 113831 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231036.1 protein_id gnl|my_center|LOCUS_52200 115617 113935 gene locus_tag LOCUS_52210 115617 113935 CDS product acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205295.1 protein_id gnl|my_center|LOCUS_52210 116029 116229 gene locus_tag LOCUS_52220 116029 116229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52220 116586 117068 gene locus_tag LOCUS_52230 116586 117068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52230 118381 117191 gene locus_tag LOCUS_52240 118381 117191 CDS product heparan-alpha-glucosaminide N-acetyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925640.1 protein_id gnl|my_center|LOCUS_52240 120497 118386 gene locus_tag LOCUS_52250 120497 118386 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038797.1 protein_id gnl|my_center|LOCUS_52250 121780 120569 gene locus_tag LOCUS_52260 121780 120569 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266685.1 protein_id gnl|my_center|LOCUS_52260 122516 121833 gene locus_tag LOCUS_52270 122516 121833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52270 123826 122552 gene locus_tag LOCUS_52280 123826 122552 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113046.1 protein_id gnl|my_center|LOCUS_52280 124533 123826 gene locus_tag LOCUS_52290 124533 123826 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093325.1 protein_id gnl|my_center|LOCUS_52290 125081 124539 gene locus_tag LOCUS_52300 125081 124539 CDS product DUF2796 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113048.1 protein_id gnl|my_center|LOCUS_52300 126486 125113 gene locus_tag LOCUS_52310 126486 125113 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097095.1 protein_id gnl|my_center|LOCUS_52310 127430 126483 gene locus_tag LOCUS_52320 gene folE2 127430 126483 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408083.1 protein_id gnl|my_center|LOCUS_52320 127858 127427 gene locus_tag LOCUS_52330 gene queD 127858 127427 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845978.1 protein_id gnl|my_center|LOCUS_52330 129143 127851 gene locus_tag LOCUS_52340 gene zigA 129143 127851 CDS product zinc metallochaperone GTPase ZigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207983.1 protein_id gnl|my_center|LOCUS_52340 129770 130141 gene locus_tag LOCUS_52350 129770 130141 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810206.1 protein_id gnl|my_center|LOCUS_52350 131400 130204 gene locus_tag LOCUS_52360 131400 130204 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337698.1 protein_id gnl|my_center|LOCUS_52360 132093 131563 gene locus_tag LOCUS_52370 132093 131563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52370 132931 132236 gene locus_tag LOCUS_52380 132931 132236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52380 133066 133260 gene locus_tag LOCUS_52390 133066 133260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52390 133741 133241 gene locus_tag LOCUS_52400 133741 133241 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529580.1 protein_id gnl|my_center|LOCUS_52400 134106 133744 gene locus_tag LOCUS_52410 134106 133744 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704051.1 protein_id gnl|my_center|LOCUS_52410 136360 134348 gene locus_tag LOCUS_52420 136360 134348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52420 137624 136431 gene locus_tag LOCUS_52430 gene solA 137624 136431 CDS product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259547.1 protein_id gnl|my_center|LOCUS_52430 138519 137683 gene locus_tag LOCUS_52440 138519 137683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52440 140190 138916 gene locus_tag LOCUS_52450 140190 138916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52450 141142 140441 gene locus_tag LOCUS_52460 141142 140441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52460 141405 142016 gene locus_tag LOCUS_52470 141405 142016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52470 142346 142918 gene locus_tag LOCUS_52480 142346 142918 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464189.1 protein_id gnl|my_center|LOCUS_52480 143330 142983 gene locus_tag LOCUS_52490 143330 142983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52490 143878 143366 gene locus_tag LOCUS_52500 143878 143366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52500 144660 144181 gene locus_tag LOCUS_52510 144660 144181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52510 145643 144771 gene locus_tag LOCUS_52520 145643 144771 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786960.1 protein_id gnl|my_center|LOCUS_52520 146460 145663 gene locus_tag LOCUS_52530 146460 145663 CDS product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930607.1 protein_id gnl|my_center|LOCUS_52530 146593 147516 gene locus_tag LOCUS_52540 146593 147516 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821275.1 protein_id gnl|my_center|LOCUS_52540 147868 148968 gene locus_tag LOCUS_52550 147868 148968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52550 149428 149877 gene locus_tag LOCUS_52560 149428 149877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52560 150110 150721 gene locus_tag LOCUS_52570 150110 150721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52570 151349 150804 gene locus_tag LOCUS_52580 151349 150804 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112472.1 protein_id gnl|my_center|LOCUS_52580 151764 151597 gene locus_tag LOCUS_52590 151764 151597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52590 152643 151936 gene locus_tag LOCUS_52600 152643 151936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52600 154544 152805 gene locus_tag LOCUS_52610 154544 152805 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193654.1 protein_id gnl|my_center|LOCUS_52610 156201 154858 gene locus_tag LOCUS_52620 156201 154858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52620 157193 156198 gene locus_tag LOCUS_52630 157193 156198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52630 159152 157197 gene locus_tag LOCUS_52640 159152 157197 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114252.1 protein_id gnl|my_center|LOCUS_52640 159530 163048 gene locus_tag LOCUS_52650 gene dnaE 159530 163048 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522462.1 protein_id gnl|my_center|LOCUS_52650 163053 164363 gene locus_tag LOCUS_52660 163053 164363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52660 164571 166289 gene locus_tag LOCUS_52670 gene msbA 164571 166289 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186431.1 protein_id gnl|my_center|LOCUS_52670 166326 166907 gene locus_tag LOCUS_52680 166326 166907 CDS product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086598.1 protein_id gnl|my_center|LOCUS_52680 166904 167950 gene locus_tag LOCUS_52690 gene waaF 166904 167950 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526219.1 protein_id gnl|my_center|LOCUS_52690 168231 170369 gene locus_tag LOCUS_52700 168231 170369 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706766.1 protein_id gnl|my_center|LOCUS_52700 170723 170403 gene locus_tag LOCUS_52710 170723 170403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52710 171538 171179 gene locus_tag LOCUS_52720 171538 171179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284373.1 protein_id gnl|my_center|LOCUS_52720 172100 171717 gene locus_tag LOCUS_52730 172100 171717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52730 172635 172090 gene locus_tag LOCUS_52740 172635 172090 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207703.1 protein_id gnl|my_center|LOCUS_52740 173297 172638 gene locus_tag LOCUS_52750 173297 172638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52750 173542 173787 gene locus_tag LOCUS_52760 173542 173787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52760 174551 173943 gene locus_tag LOCUS_52770 174551 173943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52770 176161 174689 gene locus_tag LOCUS_52780 gene rng 176161 174689 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522445.1 protein_id gnl|my_center|LOCUS_52780 176802 176185 gene locus_tag LOCUS_52790 176802 176185 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064139.1 protein_id gnl|my_center|LOCUS_52790 177306 176836 gene locus_tag LOCUS_52800 gene rlmH 177306 176836 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186098.1 protein_id gnl|my_center|LOCUS_52800 178158 177406 gene locus_tag LOCUS_52810 178158 177406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52810 178836 178162 gene locus_tag LOCUS_52820 178836 178162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52820 179726 178827 gene locus_tag LOCUS_52830 gene hemF 179726 178827 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930863.1 protein_id gnl|my_center|LOCUS_52830 181138 179864 gene locus_tag LOCUS_52840 gene purD 181138 179864 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186246.1 protein_id gnl|my_center|LOCUS_52840 181865 181140 gene locus_tag LOCUS_52850 181865 181140 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185607.1 protein_id gnl|my_center|LOCUS_52850 181996 183630 gene locus_tag LOCUS_52860 181996 183630 CDS product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853666.1 protein_id gnl|my_center|LOCUS_52860 183843 183679 gene locus_tag LOCUS_52870 183843 183679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52870 184085 185014 gene locus_tag LOCUS_52880 184085 185014 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813145.1 protein_id gnl|my_center|LOCUS_52880 185116 186072 gene locus_tag LOCUS_52890 185116 186072 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186471.1 protein_id gnl|my_center|LOCUS_52890 186069 186227 gene locus_tag LOCUS_52900 186069 186227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52900 186429 188672 gene locus_tag LOCUS_52910 186429 188672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52910 189403 188768 gene locus_tag LOCUS_52920 189403 188768 CDS product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189569.1 protein_id gnl|my_center|LOCUS_52920 189738 192416 gene locus_tag LOCUS_52930 gene pepN 189738 192416 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522336.1 protein_id gnl|my_center|LOCUS_52930 192627 193628 gene locus_tag LOCUS_52940 192627 193628 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189384.1 protein_id gnl|my_center|LOCUS_52940 193908 194603 gene locus_tag LOCUS_52950 193908 194603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52950 194789 196666 gene locus_tag LOCUS_52960 gene ilvD 194789 196666 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819105.1 protein_id gnl|my_center|LOCUS_52960 197336 197968 gene locus_tag LOCUS_52970 gene ribA 197336 197968 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004412070.1 protein_id gnl|my_center|LOCUS_52970 198845 198003 gene locus_tag LOCUS_52980 198845 198003 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869527.1 protein_id gnl|my_center|LOCUS_52980 199118 200077 gene locus_tag LOCUS_52990 199118 200077 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057556.1 protein_id gnl|my_center|LOCUS_52990 200738 201457 gene locus_tag LOCUS_53000 200738 201457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220886.1 protein_id gnl|my_center|LOCUS_53000 201510 201713 gene locus_tag LOCUS_53010 201510 201713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53010 203321 201690 gene locus_tag LOCUS_53020 203321 201690 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035397.1 protein_id gnl|my_center|LOCUS_53020 203608 203318 gene locus_tag LOCUS_53030 203608 203318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035396.1 protein_id gnl|my_center|LOCUS_53030 203873 203598 gene locus_tag LOCUS_53040 203873 203598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53040 206207 203976 gene locus_tag LOCUS_53050 206207 203976 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140331.1 protein_id gnl|my_center|LOCUS_53050 206469 208670 gene locus_tag LOCUS_53060 206469 208670 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206648.1 protein_id gnl|my_center|LOCUS_53060 208686 209918 gene locus_tag LOCUS_53070 208686 209918 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087276.1 protein_id gnl|my_center|LOCUS_53070 210841 209945 gene locus_tag LOCUS_53080 210841 209945 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527743.1 protein_id gnl|my_center|LOCUS_53080 211533 210853 gene locus_tag LOCUS_53090 gene pgl 211533 210853 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919919.1 protein_id gnl|my_center|LOCUS_53090 213002 211542 gene locus_tag LOCUS_53100 gene zwf 213002 211542 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186165.1 protein_id gnl|my_center|LOCUS_53100 213294 215135 gene locus_tag LOCUS_53110 gene edd 213294 215135 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208327.1 protein_id gnl|my_center|LOCUS_53110 215216 215869 gene locus_tag LOCUS_53120 215216 215869 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003695341.1 protein_id gnl|my_center|LOCUS_53120 215978 217612 gene locus_tag LOCUS_53130 gene pgi 215978 217612 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888377.1 protein_id gnl|my_center|LOCUS_53130 217891 220677 gene locus_tag LOCUS_53140 gene ppc 217891 220677 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085739.1 protein_id gnl|my_center|LOCUS_53140 221808 220768 gene locus_tag LOCUS_53150 221808 220768 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156863042.1 protein_id gnl|my_center|LOCUS_53150 223553 222153 gene locus_tag LOCUS_53160 223553 222153 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967746.1 protein_id gnl|my_center|LOCUS_53160 223951 225546 gene locus_tag LOCUS_53170 223951 225546 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033452234.1 protein_id gnl|my_center|LOCUS_53170 225733 226284 gene locus_tag LOCUS_53180 225733 226284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53180 226325 226525 gene locus_tag LOCUS_53190 226325 226525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53190 226702 227160 gene locus_tag LOCUS_53200 226702 227160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53200 227366 227148 gene locus_tag LOCUS_53210 227366 227148 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037775.1 protein_id gnl|my_center|LOCUS_53210 227688 227413 gene locus_tag LOCUS_53220 227688 227413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53220 227906 228160 gene locus_tag LOCUS_53230 227906 228160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53230 228197 229090 gene locus_tag LOCUS_53240 228197 229090 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173508789.1 protein_id gnl|my_center|LOCUS_53240 229098 229895 gene locus_tag LOCUS_53250 229098 229895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53250 229950 230411 gene locus_tag LOCUS_53260 229950 230411 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706875.1 protein_id gnl|my_center|LOCUS_53260 230775 230533 gene locus_tag LOCUS_53270 230775 230533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53270 231035 230775 gene locus_tag LOCUS_53280 231035 230775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53280 232954 232445 gene locus_tag LOCUS_53290 232954 232445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53290 233611 235137 gene locus_tag LOCUS_53300 233611 235137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53300 235152 235823 gene locus_tag LOCUS_53310 gene ompW 235152 235823 CDS product outer membrane protein OmpW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925667.1 protein_id gnl|my_center|LOCUS_53310 236138 236740 gene locus_tag LOCUS_53320 236138 236740 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086729.1 protein_id gnl|my_center|LOCUS_53320 236863 237672 gene locus_tag LOCUS_53330 236863 237672 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530513.1 protein_id gnl|my_center|LOCUS_53330 237801 238805 gene locus_tag LOCUS_53340 237801 238805 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228202.1 protein_id gnl|my_center|LOCUS_53340 239875 238871 gene locus_tag LOCUS_53350 239875 238871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53350 240747 239893 gene locus_tag LOCUS_53360 240747 239893 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942704.1 protein_id gnl|my_center|LOCUS_53360 241064 240744 gene locus_tag LOCUS_53370 241064 240744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53370 241429 242043 gene locus_tag LOCUS_53380 241429 242043 CDS product DUF1345 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404973.1 protein_id gnl|my_center|LOCUS_53380 242489 242055 gene locus_tag LOCUS_53390 242489 242055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53390 242703 243941 gene locus_tag LOCUS_53400 242703 243941 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783728.1 protein_id gnl|my_center|LOCUS_53400 245791 243992 gene locus_tag LOCUS_53410 245791 243992 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036596.1 protein_id gnl|my_center|LOCUS_53410 247121 245814 gene locus_tag LOCUS_53420 247121 245814 CDS product TRZ/ATZ family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957634.1 protein_id gnl|my_center|LOCUS_53420 248550 247366 gene locus_tag LOCUS_53430 248550 247366 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447280.1 protein_id gnl|my_center|LOCUS_53430 248814 249443 gene locus_tag LOCUS_53440 248814 249443 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812272.1 protein_id gnl|my_center|LOCUS_53440 249653 250348 gene locus_tag LOCUS_53450 249653 250348 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812732.1 protein_id gnl|my_center|LOCUS_53450 250360 251019 gene locus_tag LOCUS_53460 gene maiA 250360 251019 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810527.1 protein_id gnl|my_center|LOCUS_53460 251815 251165 gene locus_tag LOCUS_53470 251815 251165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53470 252344 255091 gene locus_tag LOCUS_53480 252344 255091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53480 255227 255799 gene locus_tag LOCUS_53490 255227 255799 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366547.1 protein_id gnl|my_center|LOCUS_53490 255815 256162 gene locus_tag LOCUS_53500 255815 256162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53500 256164 256460 gene locus_tag LOCUS_53510 256164 256460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53510 256761 257057 gene locus_tag LOCUS_53520 256761 257057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53520 258845 257124 gene locus_tag LOCUS_53530 258845 257124 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528518.1 protein_id gnl|my_center|LOCUS_53530 259497 259165 gene locus_tag LOCUS_53540 259497 259165 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814037.1 protein_id gnl|my_center|LOCUS_53540 259880 261463 gene locus_tag LOCUS_53550 259880 261463 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535875.1 protein_id gnl|my_center|LOCUS_53550 262484 261606 gene locus_tag LOCUS_53560 262484 261606 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061777.1 protein_id gnl|my_center|LOCUS_53560 263317 262496 gene locus_tag LOCUS_53570 263317 262496 CDS product taurine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975810.1 protein_id gnl|my_center|LOCUS_53570 264240 263293 gene locus_tag LOCUS_53580 gene tauA 264240 263293 CDS product taurine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528706.1 protein_id gnl|my_center|LOCUS_53580 265431 264622 gene locus_tag LOCUS_53590 265431 264622 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816849.1 protein_id gnl|my_center|LOCUS_53590 265903 265409 gene locus_tag LOCUS_53600 265903 265409 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298503.1 protein_id gnl|my_center|LOCUS_53600 267018 265939 gene locus_tag LOCUS_53610 267018 265939 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019081212.1 protein_id gnl|my_center|LOCUS_53610 267276 268187 gene locus_tag LOCUS_53620 267276 268187 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024698613.1 protein_id gnl|my_center|LOCUS_53620 268450 268361 gene locus_tag LOCUS_t00750 268450 268361 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 269012 268548 gene locus_tag LOCUS_53630 269012 268548 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191860.1 protein_id gnl|my_center|LOCUS_53630 271364 269043 gene locus_tag LOCUS_53640 271364 269043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53640 272028 273443 gene locus_tag LOCUS_53650 gene glnA 272028 273443 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192601.1 protein_id gnl|my_center|LOCUS_53650 273582 274058 gene locus_tag LOCUS_53660 273582 274058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53660 274154 275227 gene locus_tag LOCUS_53670 gene glnL 274154 275227 CDS product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135202727.1 protein_id gnl|my_center|LOCUS_53670 275291 276817 gene locus_tag LOCUS_53680 gene ntrC 275291 276817 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192209.1 protein_id gnl|my_center|LOCUS_53680 277454 276930 gene locus_tag LOCUS_53690 277454 276930 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194201.1 protein_id gnl|my_center|LOCUS_53690 278419 277451 gene locus_tag LOCUS_53700 gene thiL 278419 277451 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194308.1 protein_id gnl|my_center|LOCUS_53700 279721 278525 gene locus_tag LOCUS_53710 gene rubB 279721 278525 CDS product rubredoxin reductase RubB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206071.1 protein_id gnl|my_center|LOCUS_53710 279894 279730 gene locus_tag LOCUS_53720 279894 279730 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098329.1 protein_id gnl|my_center|LOCUS_53720 280428 279949 gene locus_tag LOCUS_53730 280428 279949 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143723.1 protein_id gnl|my_center|LOCUS_53730 280701 283010 gene locus_tag LOCUS_53740 280701 283010 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938729.1 protein_id gnl|my_center|LOCUS_53740 283991 283086 gene locus_tag LOCUS_53750 283991 283086 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005617359.1 protein_id gnl|my_center|LOCUS_53750 284705 284052 gene locus_tag LOCUS_53760 gene alkB 284705 284052 CDS product DNA oxidative demethylase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965755.1 protein_id gnl|my_center|LOCUS_53760