COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..307888 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(178..546) product EXLDI protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836466.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS complement(609..1511) product DUF2268 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836465.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS complement(1743..2111) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900419.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 gene rplL CDS complement(2182..2682) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287282.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 gene rplJ CDS complement(3006..3848) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861356.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS complement(3943..4869) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837043.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS complement(5067..5234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS complement(5269..6150) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002935444.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 gene dapA CDS complement(6205..7281) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000542465.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS 7628..8320 product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250491.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS complement(8382..9326) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263595.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS complement(9340..10962) product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836418.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS 11225..11596 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002267509.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS 11720..12610 product LysR family transcriptional regulator MleR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263592.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 gene mleR CDS complement(12783..13448) product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836983.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS complement(13441..13980) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235787673.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS complement(14084..15754) product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836985.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS 15892..16584 product phosphopantothenate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904518.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS 16581..17132 product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836986.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 gene coaC CDS 17116..17679 product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895459.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS 17859..19577 product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836987.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS 19969..20316 product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836988.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS complement(20431..21600) product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836989.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 gene mutY CDS complement(21667..22644) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002909705.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 gene pta CDS complement(22655..23545) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836990.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS complement(23542..24360) product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799056.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS complement(24344..25015) product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904528.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS 25111..25671 product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002935243.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS 25743..26714 product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283813.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS 26724..27845 product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120770190.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS 27846..28193 product DUF1831 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902952.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS 28357..29001 product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002915151.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS 29029..29721 product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743331.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS complement(29718..30398) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009660453.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 gene radC CDS complement(30485..31138) product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895767.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 gene phoU CDS complement(31302..32060) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032909524.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 gene pstB CDS complement(32103..32906) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895769.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 gene pstB CDS complement(32918..33802) product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895770.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 gene pstA CDS complement(33792..34703) product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070903.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 gene pstC CDS complement(34725..35591) product phosphate ABC transporter substrate-binding protein PstS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002265494.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(35697..37001) product RsmF rRNA methyltransferase first C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836815.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS complement(37002..37775) product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900578.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS complement(37759..38052) product UPF0223 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041982.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS complement(38045..38350) product Spx/MgsR family RNA polymerase-binding regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002906786.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS complement(38568..39500) product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836812.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS complement(39526..40404) product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013232.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 gene truB CDS complement(40412..41212) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836810.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS complement(41244..41456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00480 note possible pseudo, frameshifted CDS complement(41516..41680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00490 note possible pseudo, frameshifted CDS complement(41690..42967) product DUF2130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262189.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS complement(43088..43573) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00510 note possible pseudo, internal stop codon CDS complement(43628..44827) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00520 note possible pseudo, internal stop codon CDS complement(44820..46589) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836805.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS complement(47041..47940) product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018365292.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS complement(47965..48363) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836755.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS complement(48383..50665) product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836754.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 gene pcrA CDS 50819..52015 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900658.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS complement(52282..53115) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024379094.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS complement(53125..53754) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891752.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS complement(53764..54405) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120830.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(54548..55105) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836753.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 gene lepB CDS complement(55259..56761) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895918.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 gene pyk CDS complement(56820..57830) product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895919.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 gene pfkA CDS complement(57913..61014) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836752.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS 61169..61534 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119149.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS 61538..62233 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054202.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS 62251..63048 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498759.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS complement(63185..65419) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837125.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 gene recJ CDS complement(65697..65933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00690 note possible pseudo, internal stop codon CDS complement(65911..66648) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837127.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS complement(66658..67413) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837128.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS complement(67423..68031) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008634004.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS complement(68067..68996) product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354332.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 gene rnz CDS complement(69007..69636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005590507.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS complement(69629..70867) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837131.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 gene hflX CDS complement(70860..71744) product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837132.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 gene miaA CDS 71822..71992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS complement(72101..73378) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002903133.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(73378..74070) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002903135.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS complement(74054..75208) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002903136.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 75468..76817 product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023916481.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 gene gorA CDS 77389..77931 product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837199.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS 78078..78551 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027567.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS complement(78635..79252) product DUF4037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349559.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 note possible pseudo, internal stop codon CDS complement(79271..79417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00850 note possible pseudo, internal stop codon CDS complement(79508..81913) product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836792.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 gene pheT CDS complement(82037..82564) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836791.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS complement(82570..83616) product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007519670.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 gene pheS CDS complement(83924..85789) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836912.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS complement(85786..86985) product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836911.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(86982..87749) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897644.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 gene dapB CDS complement(87760..88608) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897645.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS complement(88612..88986) product DUF1149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050086.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS complement(89147..91096) product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701411.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(91093..92004) product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640779.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 gene pfkB CDS complement(92001..92720) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902853.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS complement(92898..93107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00970 note possible pseudo, internal stop codon CDS complement(93132..95441) product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836822.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS 95568..96536 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836730.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS complement(96590..98281) product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106845.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS complement(98456..98740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01010 note possible pseudo, internal stop codon, frameshifted CDS complement(98848..99009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01020 note possible pseudo, internal stop codon, frameshifted CDS complement(99346..100086) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965767.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS complement(100448..102316) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860806.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS complement(102372..102500) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS complement(102777..102998) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775551.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS complement(103223..104116) product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775550.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS complement(104213..105619) product 6-phospho-beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169284.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 gene lacG CDS complement(105706..107412) product lactose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837289.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS complement(107412..107729) product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002923663.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS complement(107750..108583) product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002923661.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS complement(108975..109955) product tagatose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002905075.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 gene lacD CDS complement(109959..110888) product tagatose-6-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837290.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS complement(110901..111416) product galactose-6-phosphate isomerase subunit LacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837291.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 gene lacB CDS complement(111435..111860) product galactose-6-phosphate isomerase subunit LacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032908103.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 gene lacA CDS complement(112059..112814) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837293.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS complement(112976..114853) product SAG1250 family conjugative relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168549381.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS complement(114840..115205) product MobC family plasmid mobilization relaxosome protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922431.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS complement(115215..115574) product SAG1252 family conjugative relaxosome accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529543.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS complement(115913..117055) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS complement(117056..117844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS complement(117841..118623) product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922437.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS complement(118623..119099) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775115.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS complement(119169..119456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024379089.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS complement(119501..119890) product DUF5945 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048064.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS complement(119887..120114) product DUF5965 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110922.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS complement(120169..121257) product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196883.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS complement(121296..121934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775531.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS complement(122030..122320) product DUF5966 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775526.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS complement(122336..122635) product DUF5962 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775525.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS complement(122705..129526) product SNF2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071181.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS complement(129576..130127) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775120.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS complement(130111..130305) product calcium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068445.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS complement(130306..135207) product GbpC/Spa domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167699.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS 135401..135991 product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037239.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS 135988..136833 product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775600.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(136930..139716) product phage tail tip lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656702.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS complement(139713..142064) product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044682503.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS complement(142021..142374) product PrgI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775123.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS complement(142617..143471) product conjugal transfer protein TrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922462.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS complement(143488..143730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001072182.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS complement(143748..145568) product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775517.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS complement(145568..146056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936460.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS complement(146132..146713) product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821307.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS complement(146716..146949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024390011.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS complement(146946..147341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775126.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS complement(147351..147530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS complement(147520..148872) product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074485044.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 gene dcm CDS complement(149021..149839) product replication initiator protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105158881.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS complement(149836..150009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168336.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS complement(150221..151582) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000914581.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 gene rlmD CDS complement(151658..152995) product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837155.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS complement(153008..153841) product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837156.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 gene pheA CDS complement(153838..154314) product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837157.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS complement(154307..155590) product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837158.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 gene aroA CDS complement(155709..156623) product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197060.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS complement(156838..157176) product YlbF/YmcA family competence regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900045.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS complement(157188..158294) product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002920831.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS complement(158304..158684) product DUF1634 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132003.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS complement(158681..159517) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562875.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS complement(159517..160683) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002920830.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 gene aroC CDS complement(160717..161784) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002920829.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 gene aroB CDS complement(161795..162649) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002920828.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS complement(162639..163316) product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002920826.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 gene aroD CDS complement(163313..164476) product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837159.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS 164749..166893 product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837164.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS complement(166952..167674) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837020.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS complement(167707..168417) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972499.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 gene deoD CDS complement(168601..169410) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002935585.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS complement(169596..170285) product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429264.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 gene rpiA CDS 170640..172013 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837022.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 gene mnmE CDS complement(172399..172554) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS complement(172715..175174) product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900005.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS complement(175208..176968) product rhamnan synthesis F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018364630.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS complement(176965..178716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS complement(178741..179961) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261978.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS complement(179961..180767) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027237.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS complement(180770..181705) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837185.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS complement(181702..182850) product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837186.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(182953..183804) product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836759.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 gene rfbD CDS complement(183877..184803) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836757.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS complement(184907..185557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS complement(185583..187127) product DUF2142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963353.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS complement(187161..188162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS complement(188152..189435) product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922136.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS complement(189419..189760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(189767..190462) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985169.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS complement(190581..191171) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140224612.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS complement(191478..192497) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156530.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 gene galE CDS complement(192535..193581) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009659423.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 gene rfbB CDS complement(193612..194205) product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009443641.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS complement(194209..195078) product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904719.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 gene rfbA CDS complement(195269..196096) product ZIP family manganese transporter TmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904720.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 gene tmpA CDS complement(196115..196591) product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837121.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS complement(196592..197689) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904722.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS complement(197702..198499) product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904723.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS complement(198486..199175) product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917062.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS complement(199269..199943) product DnaD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002909462.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS complement(199952..200896) product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837123.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 gene metA CDS complement(200996..201508) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897341.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS complement(201626..202321) product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900665.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS complement(202314..202694) product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900667.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 tRNA complement(202844..202933) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 tmRNA complement(202944..203290) product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(203480..203662) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS 203994..204428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS complement(204804..206576) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836926.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS complement(206589..208328) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836925.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(208618..209463) product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187660.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS complement(209562..209738) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036519.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS complement(209731..211011) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411895.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 gene murA CDS complement(211050..211280) product DUF1146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895990.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS complement(211385..211804) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068050.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS complement(211815..213221) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094354.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 gene atpD CDS complement(213256..214134) product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895995.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS complement(214150..215655) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900741.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 gene atpA CDS complement(215671..216207) product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836717.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS complement(216207..216701) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002925392.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 gene atpF CDS complement(216716..217429) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896002.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 gene atpB CDS complement(217469..217669) product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896005.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS complement(218006..220402) product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917496.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS complement(220424..221857) product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836716.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 gene glgA CDS complement(221854..222993) product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917498.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 gene glgD CDS complement(222983..224125) product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904142.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS complement(224129..226039) product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836715.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 gene glgB CDS complement(226560..230240) product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837144.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 gene addA CDS complement(230237..233509) product ATP-dependent nuclease subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837145.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 gene rexB CDS complement(233630..234844) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245373.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS complement(234841..235734) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895282.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS complement(235931..236143) product YdbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897227.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS 236246..236572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897226.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS complement(236588..237346) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837581.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS complement(237343..238209) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837582.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS complement(238254..239258) product tryptophan ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836788.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 gene trpX CDS 239745..241394 product Rqc2 family fibronectin-binding protein FbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836787.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 gene fbpA CDS complement(241632..242351) product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360301.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 gene budA CDS complement(242445..244109) product acetolactate synthase AlsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352333.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 gene alsS CDS complement(244192..245439) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900617.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS complement(245408..246586) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002906828.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS complement(246736..248112) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836780.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS complement(248109..248765) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897805.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS 249118..250131 product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836778.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS complement(250351..252075) product septation ring formation regulator EzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836769.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 gene ezrA CDS complement(252163..254109) product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895870.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 gene gyrB CDS complement(254122..254685) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836768.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS complement(254814..255362) product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836767.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS complement(255375..256607) product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895877.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS complement(256655..257635) product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002906845.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS complement(257757..260219) product bifunctional DnaQ family exonuclease/ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836766.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS 260356..260991 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690854.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS complement(261084..262010) product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625552.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 gene ftsX CDS complement(262003..262695) product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895890.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 gene ftsE CDS complement(262800..263777) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097677707.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 gene prfB CDS complement(264100..264903) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989455.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS 265017..265874 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836763.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS complement(265871..266593) product DUF2785 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002919282.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS complement(266823..266960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS 267184..267474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272212.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS complement(267560..270253) product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032909521.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS complement(270617..271003) product DUF1934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900644.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS 271127..272446 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002919284.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS 272436..273245 product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002919285.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 gene yidA CDS 273245..274459 product aminoacyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900648.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS 274472..275710 product aminoacyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002919288.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS 275776..277314 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000946120.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS complement(277521..280139) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836704.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 gene alaS CDS complement(280194..280745) product LURP-one-related family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900805.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(280901..281839) product peptidylprolyl isomerase PrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836702.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 gene prsA CDS complement(281946..282629) product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972506.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS complement(282631..284433) product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836700.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 gene pepF CDS complement(284385..285416) product competence protein CoiA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836698.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS complement(285738..287081) product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285961.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 gene celB CDS complement(287121..287627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285960.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS complement(287651..287968) product PTS cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070943.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS complement(287981..289972) product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352342.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS complement(290033..290347) product PTS cellobiose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029637.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS complement(290463..290702) product SemiSWEET transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580382.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS complement(291023..292459) product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206473.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS complement(293291..294460) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836697.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS complement(294537..295910) product DUF1958 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836696.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS complement(296027..296734) product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836695.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 gene nagB CDS 297041..298069 product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836693.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 gene queA CDS 298080..298553 product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896068.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS complement(298696..300030) product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009659896.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS complement(300055..301557) product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290378.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS complement(301795..302742) product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009659881.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 gene arcC CDS complement(302896..303912) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900826.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 gene argF CDS complement(303936..305165) product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836692.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 gene arcA CDS complement(305475..306161) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836691.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS complement(306298..307356) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836681.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 sequence02 source 1..300416 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..791 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011836944.1:MATE family efflux transporter locus_tag LOCUS_02890 CDS complement(865..1047) product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117401.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS 1169..1753 product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897586.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS 1772..2851 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897584.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 gene prfA CDS 2851..3681 product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897583.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 gene prmC CDS 3674..4264 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836953.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS 4314..5570 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836954.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS 5572..6546 product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895516.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS 6546..7148 product lysozyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897579.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS 7262..8107 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836955.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS complement(8163..9722) product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065723.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 gene guaA CDS 9864..10562 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895508.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS 10669..11010 product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032910500.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS 11074..12624 product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863638.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 gene ffh CDS 12811..13881 product tyrosine recombinase XerS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836963.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 gene xerS CDS complement(13977..14966) product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895497.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS complement(14975..16660) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836965.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 gene lpdA CDS complement(16710..17753) product dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836966.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS complement(17861..18853) product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900354.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS complement(18873..19841) product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836968.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS complement(20003..21163) product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836969.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS complement(21183..21923) product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895490.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS complement(21958..22782) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836970.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS complement(22915..24249) product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836971.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 gene trmFO CDS complement(24423..24920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836972.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS complement(24984..27068) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836973.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 gene topA CDS complement(27163..28005) product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186865.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 gene dprA CDS complement(28088..28645) product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836974.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS complement(28635..29462) product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836975.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS complement(29459..30241) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836976.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS complement(30228..31079) product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201307.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 gene ylqF CDS complement(31199..32116) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436857.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS complement(32120..32581) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03210 note possible pseudo, frameshifted CDS complement(32544..32777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS 33109..34425 product FAD-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836731.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS complement(34629..35372) product class A sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836996.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS complement(35393..37840) product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032910418.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 gene gyrA CDS 38040..39023 product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984645.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS complement(39155..39559) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836998.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 tRNA complement(39625..39696) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS complement(39779..40978) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897515.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 gene rpsA tRNA complement(41139..41212) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 tRNA complement(41254..41334) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS complement(41387..41617) product DUF2969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837000.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS complement(41721..42740) product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837001.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS complement(42880..45318) product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837002.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 gene parC CDS complement(45549..46370) product aminoglycoside 6-adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837003.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS complement(46390..47124) product DUF6261 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837005.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS complement(47356..48219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS complement(48229..50172) product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837007.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 gene parE CDS 50391..51002 product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002912552.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 gene plsY CDS complement(51040..53193) product cell surface ecto-5'-nucleotidase Nt5e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837008.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 gene nt5e CDS complement(53353..53988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS complement(54036..54503) product deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895042.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS complement(54520..55104) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895666.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS 55239..56084 product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219939.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS complement(56127..56858) product DUF3307 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836846.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS complement(56851..57525) product SatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262282.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS complement(57686..58426) product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837019.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS complement(58505..59809) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022818.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 gene eno CDS 60009..60437 product DUF1694 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836775.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS 60449..60772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836774.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS complement(60858..61607) product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837136.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS complement(61821..63014) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837095.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS complement(63335..64681) product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263717.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 gene asnS CDS complement(64748..64879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS complement(64883..66061) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837099.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS complement(66058..66432) product DUF5590 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837100.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS 66631..67077 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900138.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS 67144..67695 product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837101.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS complement(67743..68468) product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697767.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 gene yaaA CDS 68582..69040 product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002264322.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS 69024..69671 product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900134.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS complement(69781..70737) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836883.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS complement(70739..71803) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000038674.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS complement(71796..73331) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897687.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS complement(73468..74523) product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897688.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS complement(74596..74985) product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002906685.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS complement(74972..75634) product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028213.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 gene deoC CDS complement(75653..76930) product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836881.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS complement(76927..77520) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191444.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS 77615..78535 product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191446.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 gene coaA CDS 78604..78840 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002935285.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 gene rpsT CDS 78904..79413 product DNA topology modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684205.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS complement(79462..81075) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049572.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS 81252..82700 product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836876.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS complement(83089..84435) product two-component system sensor histidine kinase CiaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491801.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 gene ciaH CDS complement(84425..85099) product two-component system response regulator CiaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590640.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 gene ciaR CDS complement(85371..85826) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03740 tRNA complement(86231..86302) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS complement(86342..86689) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068669.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 gene rplS CDS complement(86840..87799) product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009660448.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS complement(87903..91082) product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837069.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 gene carB CDS complement(91110..92198) product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166854.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS complement(92240..93160) product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895276.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS complement(93219..94487) product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837071.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS complement(94492..95013) product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904664.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 gene pyrR CDS complement(95294..96205) product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002925343.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 gene whiA CDS complement(96202..97179) product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895961.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS complement(97176..98066) product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836729.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 gene rapZ CDS complement(98219..98641) product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438298.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 gene ndk CDS complement(98720..99670) product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836909.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS complement(99670..100308) product TIGR01906 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850639.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS complement(100298..101071) product TIGR01457 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836908.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS complement(101094..101825) product acyl-[acyl-carrier-protein] thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009660378.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS complement(101829..102959) product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836907.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 gene hemW CDS complement(103101..103652) product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837075.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS complement(103678..104241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS complement(104258..106246) product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837078.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 gene uvrB CDS complement(106337..107296) product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837079.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS 107459..109642 product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726251.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS 109642..110382 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895249.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS 110406..110591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS 110806..112341 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837092.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS complement(112362..114110) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837093.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS complement(114091..115836) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837094.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS complement(116009..116716) product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836915.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS complement(116838..117425) product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002915299.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 gene yihA CDS complement(117437..118669) product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972566.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 gene clpX CDS complement(118708..118881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442260.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS complement(118881..119393) product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902864.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS complement(119580..120419) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902863.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS complement(120505..121722) product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263157.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS complement(121737..122003) product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362440.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS complement(122042..122551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04090 note possible pseudo, frameshifted CDS complement(122673..122954) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04100 note possible pseudo, frameshifted CDS complement(123083..123718) product Pr6Pr family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033951.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(123727..124065) product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900178.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS complement(124265..125062) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836906.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 gene proC CDS complement(125067..126329) product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255283.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS complement(126343..127452) product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836904.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 gene proB CDS complement(127539..128435) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403233.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS complement(128425..128886) product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917330.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 gene lspA CDS complement(128883..129791) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025693.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS complement(129943..130245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS 130557..130814 product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185155.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS 131226..131714 product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837026.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS complement(131763..132059) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355066.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS complement(132049..133704) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387331.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS complement(133727..134044) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365287.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS complement(134165..134458) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916503.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 gene rpmA CDS complement(134476..134820) product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613699.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS complement(134837..135151) product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904398.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 gene rplU CDS complement(135424..137688) product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202292.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS complement(137688..139256) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS complement(139449..140663) product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836896.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 gene thiI CDS complement(140667..141809) product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836895.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS complement(141922..142872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04320 note possible pseudo, internal stop codon CDS complement(142918..143841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04330 note possible pseudo, internal stop codon CDS complement(143884..144702) product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836893.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS complement(144716..145345) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002915339.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS 145523..148132 product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836892.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 gene ppdK CDS 148331..148759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS complement(148742..148984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS complement(148998..150068) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836890.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS complement(150065..150838) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002909868.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS complement(150835..151641) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895634.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS complement(151622..152779) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836889.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS complement(152877..153779) product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836888.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 gene murB CDS complement(153975..154619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837046.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS complement(154728..156551) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023916330.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 gene lepA CDS 156688..157503 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837048.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS 157637..158860 product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837055.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 gene pepT CDS complement(158920..159477) product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836830.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS complement(159640..160275) product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032909529.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 gene udk CDS 160380..161369 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836829.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS 161356..162441 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900552.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS complement(162493..163857) product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836827.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS complement(163959..164345) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157153.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS complement(164623..164982) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124836.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 gene rplT CDS complement(165029..165229) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895038.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 gene rpmI CDS complement(165263..165820) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466297.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 gene infC CDS complement(165965..166642) product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918748.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 gene cmk CDS complement(166663..167115) product LysM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897255.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS 167155..167358 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895033.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS complement(167345..167839) product EbsA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895031.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS complement(168055..169167) product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836773.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS complement(169171..169821) product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836772.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 gene serB CDS complement(169930..171282) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902729.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 gene glmM CDS complement(171307..172038) product CdaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900709.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS complement(172025..172882) product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011063.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 gene cdaA CDS 173053..174333 product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836724.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS 174333..175118 product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002912099.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS 175147..175395 product LapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902722.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS complement(175773..177671) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836721.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS complement(177746..178111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836720.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS complement(178113..178817) product matrixin family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002912084.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS complement(178962..179753) product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263101.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS complement(179850..181511) product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837578.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS complement(182208..183494) product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032909576.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS complement(183625..184554) product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411174.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS 184693..184986 product DUF3270 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894977.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS complement(185084..185551) product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837203.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS complement(185567..185950) product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895039.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS complement(185969..186742) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263626.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 gene lgt CDS complement(186735..187667) product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894971.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 gene hprK CDS complement(187783..188301) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837205.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS complement(188352..188729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS complement(188729..189178) product SprT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897215.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS complement(189165..191294) product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897214.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS complement(191650..192084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS complement(192087..192857) product type-2 restriction enzyme DpnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000418960.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS complement(192877..193071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 193214..193354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS 193351..194256 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897212.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS 194253..195068 product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837206.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS 195183..196547 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837517.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS 196595..198082 product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096094.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 gene zwf CDS complement(198134..199606) product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002916991.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 gene ftsY CDS complement(199619..200431) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837207.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS complement(200431..201225) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837208.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS complement(201227..204760) product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837209.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 gene smc CDS complement(204751..205449) product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002903151.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 gene rnc CDS complement(205835..206194) product DUF454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192874.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS complement(206203..207006) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837210.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS complement(207008..208360) product cell wall metabolism sensor histidine kinase VicK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899938.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 gene vicK CDS complement(208353..209054) product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894937.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 gene yycF CDS complement(209338..209679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044012208.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS complement(209706..211019) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904960.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS complement(211021..212019) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032908752.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS complement(212351..213355) product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837218.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 gene ccpA CDS 213619..214701 product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837219.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS complement(214894..215667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05070 note possible pseudo, internal stop codon CDS complement(215698..218340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05080 note possible pseudo, internal stop codon, frameshifted CDS complement(218407..219165) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900651.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 gene tpiA CDS complement(219321..220517) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895003.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 gene tuf CDS complement(220725..221705) product sigma factor regulator N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598067.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS complement(221692..221919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05120 note possible pseudo, frameshifted CDS complement(221909..222163) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05130 note possible pseudo, frameshifted CDS complement(222310..222834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS complement(222893..225592) product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058155.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 gene ppc CDS complement(225631..226863) product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002903126.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS 227144..227980 product glycoside hydrolase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837195.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS 228107..228949 product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032908757.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS 228949..229431 product aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897235.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS 229444..230085 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897234.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS 230169..231656 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894992.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 gene lysS CDS complement(231778..232209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547433.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS complement(232220..233074) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109290238.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS complement(233116..233745) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762101.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS complement(233882..234331) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837227.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS complement(234398..235234) product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837228.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS complement(235326..238691) product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775222.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS complement(238706..239407) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837230.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS 239541..240095 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837231.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS complement(240284..242236) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262802.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 gene thrS CDS complement(242229..242870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289387.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS complement(243300..244685) product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895377.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 gene sufB CDS complement(244818..245261) product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162128.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS 245413..246351 product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401775.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS 246454..246699 product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357967.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS complement(246829..247119) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895366.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS complement(247145..247843) product LD-carboxypeptidase LdcB/DacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747772.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 gene ldcB CDS complement(248096..248818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05380 note possible pseudo, internal stop codon, frameshifted CDS complement(248925..249644) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008798583.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS complement(249641..251173) product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015979.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS complement(251170..251556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS complement(251864..252445) product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263204.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS complement(252455..253312) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102090.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS complement(253368..254768) product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207301.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 gene pepV CDS complement(254788..255393) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002933547.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS complement(255500..257299) product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837033.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 gene uvrC CDS 257282..257515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS complement(257451..259184) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896016.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 gene ptsP CDS complement(259186..259449) product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262984.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS 259846..260064 product glutaredoxin-like protein NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897920.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 gene nrdH CDS 260320..262479 product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836714.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 gene nrdE CDS 262570..263529 product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084433.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 gene nrdF CDS complement(263660..264361) product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836711.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS complement(264514..265227) product DUF3169 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028278.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS complement(265205..265432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05550 note possible pseudo, frameshifted CDS complement(265622..267721) product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837232.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS complement(268029..268739) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002912008.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS 268889..271243 product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360053.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS 271350..272096 product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002912006.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS 272086..272343 product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775271.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS complement(272377..274605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS complement(274718..276373) product PTS lactose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288634.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS complement(276378..276701) product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288635.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS complement(276714..278114) product 6-phospho-beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288636.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 gene lacG CDS complement(278125..278961) product transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285709.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS complement(279216..279749) product isoprenylcysteine carboxyl methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775293.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS complement(280109..280780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05670 note possible pseudo, internal stop codon CDS 280943..281374 product galactose-6-phosphate isomerase subunit LacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864629.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 gene lacA CDS 281393..281911 product galactose-6-phosphate isomerase subunit LacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684750.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 gene lacB CDS complement(282047..282793) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904081.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 282964..283914 product tagatose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524689.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 gene lacD CDS complement(283979..285535) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900849.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS complement(285934..286842) product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836670.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS complement(287363..288907) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028326.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS complement(289130..289450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS complement(289462..289869) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262616.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS complement(290680..291378) product TIGR02206 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055251.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS complement(291382..291933) product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009910909.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS complement(291923..293293) product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836662.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS complement(293426..294472) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033179127.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS complement(294605..295201) product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897999.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 gene recR CDS complement(295212..297260) product penicillin-binding protein PBP2B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187811.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 gene pbp2b CDS complement(297428..298120) product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900876.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS complement(298261..298722) product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774959.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS complement(298890..299165) product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284640.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS complement(299294..300127) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836657.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 sequence03 source 1..122675 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(568..1293) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836643.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS 1471..3312 product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061563670.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 gene typA CDS 3377..3661 product DUF3165 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898040.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS 3735..5087 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836645.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 gene murD CDS 5089..6159 product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836646.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS 6156..7214 product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836647.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS 7337..8722 product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896169.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 gene ftsA CDS 8741..10015 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836648.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 gene ftsZ CDS 10017..10688 product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900917.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS 10698..11243 product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900916.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS 11248..11511 product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983869.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS 11516..12307 product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002911964.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS 12317..13102 product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898030.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS 13359..16151 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836649.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 gene ileS CDS complement(16387..16800) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900910.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS 16864..17301 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902601.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS 17425..18549 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894636.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS 18801..20450 product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262712.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 20539..21879 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837341.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS complement(22031..22741) product trehalose operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032909640.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 gene treR CDS 22921..24930 product PTS system trehalose-specific EIIBC component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037618357.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 gene treP CDS 25138..26769 product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899776.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 gene treC CDS 26929..29139 product LPXTG cell wall anchor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837330.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS 29308..30105 product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002905907.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 gene pflA CDS 30246..31181 product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036043.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS 31231..31743 product YiiX/YebB-like N1pC/P60 family cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837328.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS 31736..32407 product DUF1803 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837327.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS 32509..33267 product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023916573.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS complement(33381..34826) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837321.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS 34912..36540 product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837320.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS 36781..37875 product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031976.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS 37877..39043 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837318.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 39527..42181 product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837316.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 gene mgtA CDS 42258..42908 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894672.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 gene upp CDS 43021..43611 product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894674.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 43703..43972 product YlbG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462119.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS 44055..45218 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726144.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 45611..46480 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941421.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS 46484..47434 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662291.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS 47434..48198 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837311.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS 48198..48908 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894681.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS 49055..49711 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268673.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS complement(49778..50641) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592064.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS 50796..51434 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002923625.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 gene tmk CDS 51431..52324 product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837308.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS 52326..52676 product DNA replication initiation control protein YabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002909165.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 gene yabA CDS 52679..53545 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166880.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 gene rsmI CDS 53548..54054 product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922203.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS 54074..54427 product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837302.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS 54751..55374 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837301.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 gene nth CDS complement(55399..56226) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767454.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS 56392..56583 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS 56583..57470 product replication initiator protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105158881.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS 57470..57736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS 58075..58395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS 58490..59044 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS 59115..59342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS 59353..60108 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS 60173..60589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS 60561..60851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06460 note possible pseudo, internal stop codon CDS 60864..62843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109621.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS 62861..63541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS 63519..65504 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS 65549..66190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002395055.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS 66204..66458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS 66472..67290 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS 67310..68191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS 68206..68712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS 68800..69318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS 69320..71122 product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069653754.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS 71167..71346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS 71349..71954 product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142413611.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS 71991..72323 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS 72337..74682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS 74740..75018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS 75218..75610 product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367696.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 gene mobC CDS 75601..77241 product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774278.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS 77346..77930 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011241777.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS 78022..78843 product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005717330.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS 78922..79155 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS 79280..80605 product ISLre2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453221.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS 80976..81224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262696.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS 81431..81712 product autorepressor SdpR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262697.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS 81705..82334 product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262698.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS 82524..82979 product DUF3290 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837296.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS 82976..83608 product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899814.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS complement(83974..84234) product SemiSWEET family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291476.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS 84476..86473 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263617.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 gene metG CDS 86694..87995 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030754.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS 88064..88945 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030753.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS 88947..89774 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030752.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS 89798..90361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS 90378..92603 product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836501.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS 92665..93378 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105270.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS 93398..94285 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002302918.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS 94269..94925 product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288769.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS 94903..95868 product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109290171.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS 95869..97278 product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922527.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS complement(97786..98967) product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837286.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS 99061..99747 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837285.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS 99731..100711 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837284.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS 100834..101592 product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837282.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS 101796..102575 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899832.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS 102556..104532 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837281.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS 104685..105551 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837280.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS 105631..106416 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263702.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS 106442..106897 product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002905974.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS 106909..107313 product DUF3021 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263700.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS 107477..107605 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS 107744..108511 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894797.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS 108504..110492 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837267.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS 110639..112027 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837266.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS 112096..112524 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002903184.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS 112528..112851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07000 note possible pseudo, frameshifted CDS 112994..113632 product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262444.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS complement(113777..113983) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195223.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS 114171..114407 product DUF2829 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002874474.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS 114400..115098 product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167117.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS 115112..116314 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS 116408..117787 product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899862.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 gene glmU CDS 117796..118347 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002913314.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS 118358..118666 product cell wall synthase accessory phosphoprotein MacP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517854.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 gene macP CDS 118718..119410 product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897135.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS 119733..121274 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002905024.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS complement(121464..122267) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000731920.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 sequence04 source 1..120185 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(329..1021) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444654.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS complement(1022..2083) product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000085677.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS complement(2076..3449) product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000465975.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS complement(3536..4387) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000694521.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS complement(4544..5368) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724947.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS complement(5524..6240) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000532885.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS complement(6356..7447) product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836606.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS complement(7505..9244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS complement(9304..10056) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972581.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS complement(10126..10491) product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898109.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 gene rsfS CDS complement(10492..11004) product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948629.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS complement(11001..11597) product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836603.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 gene yqeK CDS complement(11587..12228) product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836602.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS complement(12241..12522) product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896287.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 gene yhbY CDS complement(12712..13818) product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836601.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 gene yqeH CDS complement(13821..14348) product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963733.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS 14498..15124 product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836599.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS complement(15156..16019) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071680.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS complement(16145..17578) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901040.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 gene gatB CDS complement(17578..19044) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836596.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 gene gatA CDS complement(19044..19346) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896305.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 gene gatC CDS complement(19423..21162) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836595.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 gene aspS CDS complement(21673..22248) product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002911884.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS complement(22248..23036) product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896308.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 gene codY CDS complement(23201..24415) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836593.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS 24567..25019 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896311.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS complement(25063..26451) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901047.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS 26516..27478 product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836584.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS complement(27581..27757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS complement(27810..29825) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836583.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 gene recG CDS complement(29929..31035) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836582.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 gene alr CDS complement(31022..31387) product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836581.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 gene acpS CDS complement(31496..32539) product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901054.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS complement(32562..35081) product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836579.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 gene secA CDS complement(35209..37056) product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045634338.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS complement(37309..38253) product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294309.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 gene manA CDS complement(38286..39011) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296966.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS complement(39045..40313) product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748651.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 gene celB CDS 40458..41855 product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156264865.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS complement(41982..42302) product PTS cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070943.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS complement(42313..42627) product PTS cellobiose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029637.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS complement(42839..44599) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836527.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS complement(44589..46355) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836526.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS complement(46348..46806) product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002913878.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS complement(46962..47372) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836525.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS complement(47440..48339) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002907200.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS complement(48773..50671) product sucrose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836524.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS 50863..52320 product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836523.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS 52301..53266 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226009.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS complement(53421..54164) product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963948.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 gene yidA CDS complement(54307..55230) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893618.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS complement(55241..56308) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159554.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS complement(56317..57243) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893621.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS complement(57243..58739) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902452.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS complement(59113..61092) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842604.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS complement(61289..63265) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742225.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS complement(63430..64116) product phenylalanine--tRNA ligase beta subunit-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837483.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS complement(64279..65889) product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105242.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS complement(66074..66667) product DNA-directed RNA polymerase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898937.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 gene rpoE CDS complement(66907..68190) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837486.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 gene tig CDS complement(68308..68871) product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837487.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS complement(68968..69435) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814973.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS complement(69413..70186) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837489.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS complement(70176..70925) product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837490.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 gene truA CDS complement(71772..72065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS complement(72153..72410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS 72682..77154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS complement(77468..78607) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263418.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 gene dnaJ CDS complement(79057..80889) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837493.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 gene dnaK CDS complement(81102..81632) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002905347.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 gene grpE CDS complement(81693..82727) product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837494.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 gene hrcA CDS complement(83855..84169) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045612791.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS complement(84327..85016) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893724.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS complement(85212..85847) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002925991.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS complement(86047..87384) product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354889.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS complement(87397..87663) product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644124.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS 88736..90970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS 91444..92025 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896832.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS complement(92057..96328) product GH32 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837502.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS complement(97035..97379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS complement(97760..98227) product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262592.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS complement(99013..99537) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476584.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS complement(99724..101412) product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989494.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS 101535..102104 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459303.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS complement(102349..102741) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075973.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 gene rpsI CDS complement(102761..103207) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893769.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 gene rplM CDS complement(103389..104258) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837508.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS complement(104422..104772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07990 note possible pseudo, internal stop codon CDS complement(104769..105497) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192371.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 gene rlmB CDS complement(106009..106482) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261902.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS complement(106561..106899) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS complement(106892..107233) product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108709.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS complement(107713..108843) product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896829.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 gene ugpC CDS complement(108954..109700) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837512.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS complement(109813..110217) product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837513.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS complement(110210..111553) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837514.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 gene cysS CDS complement(111624..112208) product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000539991.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 gene cysE CDS complement(112258..114438) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837516.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 gene pnp CDS 114887..116686 product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435576.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 gene pepF CDS complement(116867..117184) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837519.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 gene trxA CDS complement(117197..117418) product DUF4649 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570244.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS complement(117581..117850) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018251.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 gene rpsO CDS complement(117980..118462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08140 note possible pseudo, internal stop codon CDS complement(118728..119870) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837525.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 sequence05 source 1..98019 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(264..698) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08160 note possible pseudo, internal stop codon, frameshifted CDS 1282..2013 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002903717.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS complement(2067..3239) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836433.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS 3385..3879 product DUF536 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896624.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS 3892..4116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS 4204..5961 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836434.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS complement(6017..6316) product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002919734.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS complement(6353..8632) product Xaa-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836436.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS 8741..9592 product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348097.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS 9809..11074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836438.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS 11156..11896 product CppA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836439.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS 11893..12828 product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836440.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS 12994..13872 product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836441.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 gene mvk CDS 13854..14798 product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373457.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 gene mvaD CDS 14791..15795 product phosphomevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836443.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS 15788..16804 product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263658.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 gene fni CDS complement(16833..18113) product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704388.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS complement(18115..19287) product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836446.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS complement(19419..19859) product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836447.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS complement(19872..20648) product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901514.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS complement(20749..23064) product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896602.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 gene pflB CDS 23314..24381 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836448.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 gene dinB CDS complement(24418..26772) product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836452.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS complement(27158..27772) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004245100.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 gene lepB CDS complement(27776..28666) product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146887.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 gene rnhC CDS 28752..29057 product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002019.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 gene zapA CDS 29054..29602 product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896592.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS 29663..31993 product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836455.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS 32056..33474 product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836456.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS 33710..34024 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037617870.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 gene trxA CDS 34787..35644 product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836463.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS 35662..36249 product DUF4352 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014635842.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS complement(36321..37667) product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836469.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 gene gdhA CDS 38220..39155 product dihydroorotate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255162.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS 39272..40207 product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901472.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 gene msrB CDS complement(40394..40627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS 40656..41921 product TRZ/ATZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836472.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS complement(42108..43286) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836399.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS 43460..44725 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254169.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS 44738..45634 product PEP phosphonomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901609.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS 45669..45989 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901606.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS 45999..46322 product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287579.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS 46671..48593 product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836473.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS 48751..50016 product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836474.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS complement(50097..50606) product HXXEE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261919.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS complement(50621..51490) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002932053.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS 51602..53041 product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836476.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS 53031..53417 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016864.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS complement(53915..55060) product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263061.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS 55422..56252 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836481.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS 56252..56884 product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836482.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS 57032..57904 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000537003.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS complement(58559..58732) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS 58749..58970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS 59005..61146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS 61403..63208 product pyruvate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476310.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 gene spxB CDS 63599..64600 product L-lactate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120714.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 gene lctO CDS 64855..66294 product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836484.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS 66495..67172 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836489.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS 67175..68041 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836490.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS complement(68092..68850) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262302.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS complement(68864..69772) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836495.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS 70052..71602 product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156813.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS complement(71805..72353) product Type 1 glutamine amidotransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836850.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS complement(72443..72688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08800 note possible pseudo, frameshifted CDS complement(72840..73478) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836849.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS complement(73513..73929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08820 note possible pseudo, internal stop codon CDS complement(74144..74797) product CbiQ family ECF transporter T component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362491.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS complement(74794..76128) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365067.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS complement(76130..76690) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000915286.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS 77125..79374 product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836499.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 gene metE CDS 79713..80567 product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901421.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 gene metF CDS 80764..82233 product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931832.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS 82246..83088 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061603534.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS 83100..83693 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898317.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS 83694..84299 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836503.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS complement(84534..84764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS complement(84919..85824) product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836504.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS complement(85811..86863) product bifunctional glycosyltransferase family 2/GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918104.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 87131..87421 product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896497.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 gene rpsF CDS 87433..87924 product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896496.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS 87961..88200 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068664.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 gene rpsR CDS complement(88382..89059) product DUF1129 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836517.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS complement(89075..90019) product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898284.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS 90133..92967 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836518.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 gene uvrA CDS complement(93005..93760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 93908..94969 product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836519.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS 95028..95588 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262662.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 gene efp CDS 95704..96093 product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896484.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS 96086..96511 product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901371.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 gene nusB CDS complement(96671..97147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09060 note possible pseudo, internal stop codon, frameshifted CDS complement(97174..97311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09070 note possible pseudo, internal stop codon, frameshifted CDS complement(97287..97442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09080 note possible pseudo, internal stop codon CDS complement(97449..97823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09090 note possible pseudo, internal stop codon sequence06 source 1..77692 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(141..401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS complement(584..952) product EXLDI protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836466.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS complement(1089..1655) product NAD(P)H-dependent oxidoreductase MdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263120.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 gene mdaB CDS complement(1652..2293) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263121.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS complement(2515..3114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS complement(3390..5891) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011806.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 gene leuS CDS 6038..6622 product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476320.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS complement(6909..7715) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09170 note possible pseudo, frameshifted CDS complement(8033..9700) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775490.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS complement(9690..11453) product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011018172.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS complement(11678..13573) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262350.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS 13749..14468 product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619149.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS 14470..15318 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901613.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS 15353..16282 product metal ABC transporter substrate-binding lipoprotein/adhesin SsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836396.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 gene ssaB CDS 16439..17089 product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188498.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS complement(17208..17651) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691419.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 gene dtd CDS complement(17739..19955) product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896695.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS complement(20130..20276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS complement(20442..21185) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188180.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS complement(21186..22139) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002903455.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 gene prmA CDS complement(22144..23589) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS complement(23649..24119) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002903456.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS complement(24116..24559) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836383.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS complement(24609..25079) product DUF3013 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836382.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS 25181..26452 product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002911107.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 tRNA 26724..26799 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS 27262..27777 product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836381.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS complement(27849..28502) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355190.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS complement(28574..29212) product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643169.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS complement(29399..30166) product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567572.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS complement(30497..32119) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914472.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 gene groL CDS complement(32152..32433) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836375.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 gene groES CDS complement(32578..32868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002928974.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS complement(32884..33714) product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262151.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS complement(33716..34567) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262152.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS complement(34600..35094) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896729.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS complement(35118..35552) product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002919851.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS complement(35749..37008) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002903469.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS complement(37032..37715) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896732.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS complement(37708..39021) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002907421.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS complement(39021..40007) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002903471.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS complement(40300..40695) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836374.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS complement(40776..41402) product DUF4479 and tRNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002903477.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS complement(41419..41736) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002903478.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS complement(41733..42020) product DUF4651 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013971.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS 42140..43204 product glutamyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209199.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 gene pepA CDS complement(43267..43827) product folate family ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263248.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS complement(44005..45309) product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836368.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS complement(46279..48138) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837531.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS complement(48172..49443) product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837532.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 gene rseP CDS complement(49885..50688) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837534.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS complement(50697..51446) product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837535.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS complement(51791..52129) product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893835.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 gene yajC CDS complement(52232..52720) product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289239.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS complement(52814..54790) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837536.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 gene tkt CDS complement(54901..55992) product L-ascorbate 6-phosphate lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902226.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 gene ulaG CDS complement(56153..57823) product transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837538.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS complement(58020..58721) product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262722.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS complement(58723..59583) product L-ribulose-5-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027939.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS complement(59587..60252) product 3-keto-L-gulonate-6-phosphate decarboxylase UlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837547.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS complement(60299..60784) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032909924.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS complement(60987..61268) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899074.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS complement(61299..62759) product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899076.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS complement(62927..65056) product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837549.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS complement(65488..67302) product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837556.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 gene glmS CDS complement(67695..68894) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002911070.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS complement(68941..69894) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002910847.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS complement(69966..70292) product competence type IV pilus minor pilin ComGG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000265641.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 gene comGG CDS complement(70273..70710) product competence type IV pilus minor pilin ComGF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250521.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 gene comGF CDS complement(70694..70987) product competence type IV pilus minor pilin ComGE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601737.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 gene comGE CDS complement(70959..71357) product competence type IV pilus minor pilin ComGD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901717.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 gene comGD CDS complement(71347..71664) product competence type IV pilus major pilin ComGC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836360.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 gene comGC CDS complement(71661..72662) product competence type IV pilus assembly protein ComGB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914479.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 gene comGB CDS complement(72625..73566) product competence type IV pilus ATPase ComGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836358.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 gene comGA CDS complement(73636..74001) product DUF1033 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836357.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS complement(74189..75535) product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122904.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 gene glnA CDS complement(75573..75932) product transcriptional repressor GlnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659547.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 gene glnR CDS complement(76009..76539) product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119916.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS complement(76689..77372) product CHAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188880.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 sequence07 source 1..68268 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(365..718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09880 note possible pseudo, internal stop codon, frameshifted CDS 999..1985 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774928.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS 2007..2660 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837010.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS 2697..3167 product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904550.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS 3180..4457 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837009.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS 4717..5916 product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837180.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 gene metK CDS 6407..7666 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895048.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS 7745..8296 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897261.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS 8289..9566 product CBS-HotDog domain-containing transcription factor SpxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009659239.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 gene spxR CDS 9591..10448 product methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837179.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS 10499..11407 product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900016.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS 11479..11928 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837176.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS 11939..12646 product B3/4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837175.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS complement(12712..13155) product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000746188.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS 13290..13799 product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737072.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS complement(13935..14882) product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905887.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS 15093..17039 product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837172.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 gene ligA CDS 17075..18007 product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837171.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS 18021..20321 product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837170.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 gene pulA CDS 20440..20712 product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895310.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 gene rpsP CDS 20725..20970 product RNA-binding protein KphA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379628.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 gene kphA CDS complement(21029..21538) product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900176.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS complement(21577..22101) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904666.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS 22245..23111 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897353.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS 23163..23795 product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032910394.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS 23808..24479 product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837118.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS 24575..26314 product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837117.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS 26317..28059 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837116.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS complement(28243..29529) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837115.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS 29726..33106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS 33267..34178 product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352326.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 gene cas1 CDS 34178..34501 product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263547.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 gene cas2 CDS 34498..35541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10200 repeat_region 35614..36309 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttttgtactctcaagatttaagtaactgtacaac CDS 36439..38754 product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837037.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS 38981..39319 product ATP cone domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196049.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS 39456..39632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS complement(39874..40254) product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904176.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 gene mscL CDS 40410..42185 product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836736.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 gene dnaG CDS 42188..43300 product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897871.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 gene rpoD CDS 43319..43648 product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331925.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS 43803..45131 product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836927.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 gene brnQ CDS 45416..46126 product thiol-disulfide oxidoreductase-associated membrane protein CcdA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002921253.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 gene ccdA2 CDS 46140..46703 product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983778.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS 46713..47834 product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917246.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 gene msrB CDS 47892..48623 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917245.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS 48623..50332 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836931.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS complement(50360..51139) product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775488.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS complement(51142..51921) product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774940.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS complement(51914..52900) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922607.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS complement(53049..54296) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836934.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS complement(54316..54924) product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262251.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS complement(54944..55876) product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836936.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS 56159..57532 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036771.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS complement(57829..59139) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262199.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS complement(59140..59829) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003024592.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS 60001..60909 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476318.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS 60909..61649 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703143.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS 61646..62374 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476317.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS 62602..64158 product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392538.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS 64353..65336 product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931162.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS 65526..66107 product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000770415.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS 66107..67372 product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194464.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS 67472..68164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10500 sequence08 source 1..60133 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(270..650) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836641.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS complement(644..868) product YqgQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898045.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS complement(1142..1669) product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002911956.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS complement(2328..2630) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS complement(2642..3838) product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836632.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 gene trpB CDS complement(4223..4762) product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836631.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS complement(4746..5828) product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002911938.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 gene rlmN CDS complement(5867..6430) product DUF1027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836630.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS complement(6570..7625) product SepM family pheromone-processing serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972442.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS complement(7606..8103) product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002921993.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 gene coaD CDS complement(8093..8632) product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900954.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 gene rsmD CDS complement(8830..9372) product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599100.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 gene raiA CDS complement(9450..10115) product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837399.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS complement(10112..11413) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837400.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS 11470..12105 product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395739.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS 12204..13133 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893488.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 gene cysK CDS complement(13724..14575) product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989683.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS complement(14568..16385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS complement(16463..19114) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032177.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS complement(19127..19864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286126.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 note possible pseudo, frameshifted CDS complement(19819..20085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10710 note possible pseudo, frameshifted CDS complement(20088..20516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS complement(20488..20739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS complement(20736..21800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS complement(21793..22803) product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964264.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS complement(22796..24778) product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476616.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS complement(24753..25370) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124550.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS complement(25357..25542) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10780 note possible pseudo, internal stop codon CDS complement(25546..25938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10790 note possible pseudo, internal stop codon CDS complement(26281..26535) product DUF1912 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837392.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(26546..27910) product DUF438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837393.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS complement(27910..28143) product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368739.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS 28453..29385 product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931899.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS complement(29665..29991) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10840 note possible pseudo, internal stop codon, frameshifted CDS complement(30151..31509) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837396.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 gene rlmD CDS 31547..32323 product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837398.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 gene recX CDS 32410..32943 product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775316.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS 32970..33380 product DUF960 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894524.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS complement(33509..33880) product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901252.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS complement(33882..35282) product bifunctional Cof-type HAD-IIB family hydrolase/peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837402.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS complement(35323..35955) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893493.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS complement(35957..36952) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893495.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS complement(36949..37647) product cell wall-active antibiotics response protein LiaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893496.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 gene liaF CDS complement(37903..39771) product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837403.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 gene pknB CDS complement(39768..40508) product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896965.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS complement(40526..41839) product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901266.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 gene rsmB CDS complement(41829..42764) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837405.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 gene fmt CDS complement(42839..45238) product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837406.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS complement(45279..45593) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS complement(45619..46245) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775041.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 gene gmk CDS complement(46410..48017) product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893506.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS 48233..48715 product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032547.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS complement(48762..50294) product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263619.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 gene ahpF CDS complement(50305..50871) product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002982304.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 gene ahpC CDS complement(50975..52471) product cell division site-positioning protein MapZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837409.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS complement(52484..53638) product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837410.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS complement(54074..54415) product cell division regulator GpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002911299.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 gene gpsB CDS complement(54485..55012) product DUF1273 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837412.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS 55082..55684 product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002905196.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 gene recU CDS 55677..57839 product penicillin-binding protein PBP1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837413.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 gene pbp1a CDS complement(58149..59486) product aminopeptidase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837414.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 gene pepC sequence09 source 1..59728 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(36..401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11120 tRNA complement(530..615) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS complement(759..1169) product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837481.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS complement(1220..1717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11140 tRNA complement(1798..1883) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS complement(2074..4032) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836902.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS complement(4559..5542) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914280.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 gene mraY CDS complement(5544..7799) product penicillin-binding protein PBP2X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837420.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 gene pbp2X CDS complement(7803..8123) product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227821.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 gene ftsL CDS complement(8132..9082) product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002903293.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 gene rsmH CDS 9232..9465 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082470.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS 9590..10015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS 10258..11613 product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897705.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS 11625..12290 product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002938014.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS complement(12339..12596) product DUF896 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371287.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS complement(12612..14651) product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837424.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 gene glyS CDS complement(14655..15569) product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008808562.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 gene glyQ CDS complement(16286..20803) product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837426.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS complement(21075..22226) product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837433.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 gene nagA CDS complement(22433..24064) product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026641.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS complement(24222..24572) product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893555.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 gene rbfA CDS complement(24653..27472) product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837434.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 gene infB CDS complement(27489..27788) product YlxQ-related RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041387.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS complement(27781..28077) product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837436.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS complement(28090..29283) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173309684.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 gene nusA CDS complement(29334..29786) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002908122.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 gene rimP CDS complement(30070..30762) product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901576.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS complement(31426..32061) product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893561.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 gene trmB CDS complement(32058..32855) product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837438.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(32906..33952) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918065.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS complement(33949..34680) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032908079.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS 34749..35159 product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918069.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS 35169..35456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896907.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS complement(35503..36618) product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002927574.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS complement(36625..37146) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918072.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS complement(37139..37579) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918074.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 gene tsaE CDS complement(37822..39261) product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262613.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS complement(39381..39980) product DUF1361 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901350.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS 40087..40899 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162342.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS 41376..42365 product mannose/fructose/sorbose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901356.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS 42383..43186 product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280328.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS 43206..44117 product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139227.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS 44204..44575 product DUF956 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027688.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS 44788..46065 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837449.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 gene serS CDS complement(46106..46765) product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262115.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(46878..47648) product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837453.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS complement(47645..48508) product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901174.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 gene accD CDS complement(48529..49896) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901175.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS complement(49913..50335) product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002922202.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 gene fabZ CDS complement(50332..50811) product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837454.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene accB CDS complement(50812..52044) product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002269672.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 gene fabF CDS complement(52107..52841) product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176108.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 gene fabG CDS complement(52844..53770) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837457.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 gene fabD CDS complement(53763..54737) product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902460.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 gene fabK CDS complement(54950..55174) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893611.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS complement(55228..56202) product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192131.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS complement(56202..56636) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386347.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS complement(56728..57519) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893616.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS 57687..59036 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869662.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 tRNA complement(59532..59605) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 sequence10 source 1..54588 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(565..1170) product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262378.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 gene nrdG CDS complement(1175..1678) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775395.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS complement(1688..2185) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423414.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS complement(2245..2385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521615.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS complement(2394..4604) product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837630.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 gene nrdD CDS complement(4711..6252) product heme transporter CcmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837631.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS complement(6307..6441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS complement(6505..8037) product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837633.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 gene cls CDS complement(8430..8867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS complement(8916..10157) product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837634.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS complement(10358..10669) product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894073.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS complement(10687..11097) product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837635.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 gene ruvX CDS complement(11106..11372) product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894075.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS complement(11495..12052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS complement(12157..12726) product SP0191 family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725123.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS complement(12809..13207) product transcriptional regulator Spx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894078.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 gene spx CDS complement(13294..14427) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837638.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 gene recA CDS complement(14475..15743) product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032910581.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS complement(16064..19537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS 19674..19874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS 20110..20526 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262969.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS complement(20629..21207) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262394.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS complement(21218..21808) product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837647.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 gene ruvA CDS complement(21942..23888) product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837650.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 gene mutL CDS 24166..24588 product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861965.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS 24585..25043 product DUF3021 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745054.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS complement(25231..27789) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837653.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 gene mutS CDS complement(28162..28602) product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001231476.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 gene argR CDS 28706..30394 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837654.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 gene argS CDS complement(30449..30904) product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837655.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 gene nrdI CDS complement(30980..31489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729029.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS complement(31649..33907) product glycogen/starch/alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837657.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 gene glgP CDS complement(33933..35456) product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917858.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 gene malQ CDS 35786..37048 product maltodextrin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095484.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS 37122..38417 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414968.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS 38419..39261 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065643.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS 39357..40169 product DUF1189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938246.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS 40180..41166 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145423.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS 41180..43255 product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837658.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 gene pulA CDS complement(43360..44295) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837659.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS complement(44282..46036) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837660.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 gene aspS CDS complement(46155..46361) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837661.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(46442..47722) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837670.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 gene hisS CDS 47951..48133 product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290417.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 gene rpmF CDS 48149..48298 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001265622.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 gene rpmG CDS 48579..49193 product CadD family cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004245676.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS 49205..49543 product Cd(II)/Zn(II)-sensing metalloregulatory transcriptional regulator CadX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711088.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 gene cadX CDS 49586..51001 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045610915.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS 51325..51774 product sigma factor-like helix-turn-helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837674.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS 51976..52296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549327.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS 52296..53396 product type IV secretion system DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003032336.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS 53393..53998 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006268963.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 sequence11 source 1..48350 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(389..925) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894018.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 gene nusG CDS complement(1070..1246) product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002940255.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 gene secE CDS complement(1458..3677) product penicillin-binding protein PBP2A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837617.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 gene pbp2a CDS 3816..4676 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914141.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS complement(4961..5170) product heavy metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898697.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS complement(5183..7435) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836341.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS complement(7439..7906) product CopY/TcrY family copper transport repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836340.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS complement(8050..9552) product zinc ABC transporter substrate-binding protein AdcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836339.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS complement(9562..10368) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836338.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS complement(10361..11068) product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269474.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS complement(11065..11508) product zinc-dependent MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009659703.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS complement(11620..11829) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS complement(11924..13498) product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963362.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS complement(13608..13886) product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963363.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS complement(13979..15313) product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261924.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS complement(15415..15666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12360 note possible pseudo, internal stop codon CDS complement(15790..16224) product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976657.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS complement(16317..16928) product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836327.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS complement(16925..18202) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836326.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS complement(18338..19822) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836325.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 gene thrC CDS complement(20100..20735) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262757.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS complement(20761..21945) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074494.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS complement(21945..22664) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262755.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS complement(23204..23827) product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009754243.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS complement(23840..25231) product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836323.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS complement(25218..27008) product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033179094.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS complement(27113..27802) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836321.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS complement(27816..28136) product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898763.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS complement(28126..29136) product V-type ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902000.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS complement(29148..29738) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901999.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS complement(29785..30264) product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898768.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS complement(30361..32319) product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836320.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS complement(32309..32632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185368.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS 32920..33534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12540 note possible pseudo, frameshifted CDS complement(33833..34717) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894437.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS complement(34736..35653) product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281520.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS complement(35679..36326) product YesL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057475.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS complement(36351..36806) product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575438.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS complement(36820..37080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS complement(37077..37412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS complement(37459..38163) product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836315.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS complement(38980..40131) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190397.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS complement(40232..40360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS complement(40559..43210) product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763967.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 gene adhE CDS complement(43572..45389) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184456.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS complement(45379..45801) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184457.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS complement(45801..46229) product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914217.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS complement(46420..46914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12680 note possible pseudo, frameshifted CDS complement(46986..47711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12690 note possible pseudo, frameshifted sequence12 source 1..47621 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 508..1356 product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896272.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS 1375..1920 product ECF-type riboflavin transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795928.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS 2592..3353 product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836613.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS 3364..5043 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836614.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS 5036..5872 product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836615.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS 5905..6657 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009854121.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS 6679..7506 product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262299.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS complement(7546..8262) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836617.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 gene rsmG CDS 8407..8967 product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219823.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS 8969..9865 product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836621.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 gene htpX CDS complement(9962..11191) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836623.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS complement(11381..12238) product Rgg/GadR/MutR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836624.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS 12351..12887 product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900960.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS 12979..14403 product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837381.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 gene gndA CDS 14412..15101 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837380.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS 15312..17501 product PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837379.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS 17518..18333 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837378.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS 19157..19630 product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894570.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 gene nrdR CDS 19631..20779 product replication initiation and membrane attachment family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802398.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS 20780..21679 product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894572.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 gene dnaI CDS 21676..22389 product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837376.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS 22728..24038 product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837375.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 gene der CDS 24127..24465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027639.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS 24546..27656 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837374.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS 27697..28341 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808215.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS 28422..29753 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837372.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 gene murC CDS 29743..30267 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837371.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS 30264..30758 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837370.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS 30873..32477 product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837369.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 gene mltG CDS 32821..33303 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818760.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 gene greA CDS 33401..33865 product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261965.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS complement(33968..34282) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002265780.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS 34384..34998 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289703.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS complement(35474..36391) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837365.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 gene yidC CDS complement(36471..36749) product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897016.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS 36781..37521 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002903251.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS 37567..38058 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837364.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS 38084..38767 product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837363.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS 38852..40102 product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837362.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS 40157..40405 product YneF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364990.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS 40499..41293 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837360.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 gene racE CDS 41290..42276 product nucleoside-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837359.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS 42252..42773 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837358.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS 42770..43231 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837357.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS 43228..43959 product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837356.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 gene xerD CDS 43959..44669 product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002909093.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS 44662..45228 product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837355.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 gene scpB CDS 45215..45940 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222228.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS 45937..46194 product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972444.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 gene yidD CDS 46541..47026 product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259155.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 sequence13 source 1..44064 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(276..599) product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836431.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS complement(589..1284) product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208222.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS complement(1287..2300) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655056.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 gene tsaD CDS complement(2293..2733) product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896631.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 gene rimI CDS complement(2730..3413) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836429.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 gene tsaB CDS 3670..3921 product DNA-dependent RNA polymerase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836427.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS 3925..5607 product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836426.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS complement(5831..6838) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899102.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 gene gap CDS complement(7083..9164) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002905422.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 gene fusA CDS complement(9601..10071) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087873.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 gene rpsG CDS complement(10091..10504) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893867.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 gene rpsL CDS complement(10706..10987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS complement(11304..12098) product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001809310.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 gene purR CDS complement(12215..13159) product 3'-5' exoribonuclease YhaM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893873.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS complement(13149..14405) product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837560.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 gene rmuC CDS complement(14407..15039) product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184306.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS complement(15032..15691) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893879.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 gene rpe CDS complement(15704..16582) product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902190.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 gene rsgA tRNA 16693..16775 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 tRNA 16901..16989 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS complement(17049..17924) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837565.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 gene rsmA CDS complement(17943..18659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS complement(18983..19837) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002905435.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS complement(19847..20419) product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660021.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 gene rnmV CDS complement(20419..21198) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002267315.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS complement(21327..21461) product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893904.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 gene rpmH CDS complement(21616..22248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837572.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS complement(22341..23378) product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837573.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS complement(23391..24206) product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893913.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS complement(24190..24549) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893914.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 gene rnpA CDS complement(24794..26305) product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076776.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 gene glpK CDS complement(26459..27808) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018268.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS complement(28047..29294) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836623.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS complement(29476..30342) product quorum-sensing system transcriptional regulator Rgg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434945.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 gene rgg CDS complement(30685..31119) product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837601.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 gene tadA CDS complement(31149..31367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13530 note possible pseudo, internal stop codon, frameshifted CDS complement(31433..32062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13540 note possible pseudo, internal stop codon, frameshifted CDS complement(32333..33625) product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837602.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS 33915..36167 product bifunctional glutamate--cysteine ligase GshA/glutathione synthetase GshB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032910596.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 gene gshAB CDS complement(36264..36821) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895565.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS complement(36946..37983) product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642147.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS 38307..39044 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899214.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS 39062..40333 product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184347.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS 40554..41426 product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012130969.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 gene hslO CDS 41413..42393 product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183308.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 gene dusB CDS complement(42481..43029) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964042.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS 43168..43671 product HXXEE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263123.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 sequence14 source 1..34960 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 170..328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS complement(472..1155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS complement(1239..3251) product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836678.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS complement(3451..4155) product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836677.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS complement(4337..4804) product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051750.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 gene smpB CDS complement(4767..7100) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837242.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 gene rnr CDS complement(7192..7425) product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894878.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 gene secG CDS complement(7465..7614) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001809104.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 gene rpmG CDS complement(7598..8722) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837243.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS complement(9040..10005) product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643856.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS complement(9983..10594) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002310474.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 gene coaE CDS complement(10598..11422) product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837245.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 gene mutM CDS complement(11430..11885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS complement(11882..12406) product DUF664 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289384.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS complement(12460..12930) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262774.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS complement(12933..13652) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461573.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS complement(13722..14621) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894867.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 gene era CDS complement(14689..15093) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894866.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS complement(15074..15571) product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837247.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 gene ybeY CDS complement(15689..17425) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027346.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS complement(17422..19152) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028347.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS complement(19437..19781) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13860 note possible pseudo, internal stop codon, frameshifted tRNA complement(20186..20260) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS complement(20404..20973) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443760.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS 21104..21469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS complement(21689..22669) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899882.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS complement(22744..22959) product YozE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894860.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS complement(22956..24485) product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837012.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS complement(24563..25036) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS complement(25024..25653) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837013.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 gene pyrE CDS complement(25664..25828) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13940 note possible pseudo, frameshifted CDS complement(25982..26677) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904555.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 gene pyrF CDS complement(26870..27811) product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002909666.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS complement(27821..28576) product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837014.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS 28820..29728 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917171.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS complement(29964..30359) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13990 note possible pseudo, internal stop codon, frameshifted CDS complement(30614..31054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14000 note possible pseudo, internal stop codon CDS complement(31079..31822) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816623.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS complement(31917..32798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS complement(32893..34131) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922401.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 misc_feature complement(34389..>34960) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003138385.1:IS256-like element IS905 family transposase locus_tag LOCUS_14040 sequence15 source 1..32995 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(370..756) product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331493.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 gene rplQ CDS complement(768..1706) product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894519.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS complement(1751..2134) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118385.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 gene rpsK CDS complement(2154..2519) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262317.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 gene rpsM CDS complement(2676..2894) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029883.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 gene infA CDS complement(3010..3648) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836337.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS complement(3890..5197) product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894513.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 gene secY CDS complement(5210..5650) product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901833.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 gene rplO CDS complement(5810..5992) product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894509.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 gene rpmD CDS complement(6007..6501) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894506.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 gene rpsE CDS complement(6520..6876) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262324.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 gene rplR CDS complement(6958..7494) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894503.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 gene rplF CDS complement(7684..8082) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068989811.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 gene rpsH CDS complement(8406..8591) product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085697.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS complement(8609..9151) product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836336.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 gene rplE CDS complement(9175..9480) product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894497.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 gene rplX CDS complement(9556..9924) product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894494.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 gene rplN CDS complement(9950..10210) product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440811.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 gene rpsQ CDS complement(10238..10444) product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894488.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 gene rpmC CDS complement(10454..10867) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262333.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 gene rplP CDS complement(10871..11524) product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894486.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 gene rpsC CDS complement(11537..11881) product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894484.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 gene rplV CDS complement(11896..12174) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262336.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 gene rpsS CDS complement(12417..13250) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512900.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 gene rplB CDS complement(13268..13564) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055347.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS complement(13564..14187) product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894480.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 gene rplD CDS complement(14212..14838) product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894479.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 gene rplC CDS complement(15045..15353) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894478.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 gene rpsJ CDS complement(15665..15874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS complement(16306..16941) product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836334.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS complement(16942..18084) product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836333.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 gene tgt CDS 18263..19108 product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836332.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS complement(19358..19861) product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836331.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS complement(19862..20299) product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836330.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS complement(20465..23110) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836329.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 gene polA CDS 23209..23751 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066185.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS complement(23824..24591) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002026273.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS complement(24594..26288) product glucose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838205.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 gene ptsG CDS 26444..26686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS 26836..27198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS complement(27246..28277) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836930.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS complement(28279..28965) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000520637.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS complement(29063..30691) product YSIRK signal domain/LPXTG anchor domain surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836928.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS 30844..31380 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066185.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 sequence16 source 1..32908 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2239..3438) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896645.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS complement(3570..7208) product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836355.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 gene rpoC CDS complement(7253..10819) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033179096.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 gene rpoB CDS complement(11108..13447) product penicillin-binding protein PBP1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901744.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 gene pbp1b CDS 13630..14886 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000546885.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 gene tyrS CDS 15132..15968 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836351.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS complement(16026..16706) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002908584.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS complement(16690..17226) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837593.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS complement(17271..18401) product N-acetyldiaminopimelate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837594.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS complement(18414..19112) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002905478.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 gene dapD CDS complement(19227..20684) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837577.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 gene gltX CDS complement(20771..21601) product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363003.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 gene rhaD CDS complement(21598..21780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS complement(21781..23124) product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102243.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS complement(23149..23427) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722354.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS complement(23450..23908) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288286.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS complement(23928..25856) product mannose transport/utilization transcriptional regulator ManR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245617.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 gene manR CDS complement(26185..27582) product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080553375.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 gene radA CDS complement(27563..28006) product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837586.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS complement(28100..29131) product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120770826.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS complement(29355..30044) product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893948.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS 30296..31312 product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899188.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS 31341..32240 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004298345.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 gene galU sequence17 source 1..31305 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 579..1394 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777246.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS 1387..2349 product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193676.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS 2351..3103 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764310.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS 3126..4100 product siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858246.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS complement(4163..4894) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917529.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS complement(4941..6599) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917530.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 gene recN CDS complement(6607..7038) product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836656.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS complement(7031..7846) product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836655.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS complement(7812..8714) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836654.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS complement(8711..8923) product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896137.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS complement(8901..10241) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836653.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 gene xseA CDS complement(10369..10617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14830 note possible pseudo, internal stop codon CDS complement(10813..11172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14840 note possible pseudo, internal stop codon CDS 11351..11812 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261909.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS 11857..13086 product acyl-CoA thioesterase/bile acid-CoA:amino acid N-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261908.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS complement(13181..14557) product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608887.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS complement(14652..15503) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819520.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS complement(15505..16389) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032532.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS complement(16477..17790) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225468.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS complement(17940..18920) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230210.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS complement(18995..19840) product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836652.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS complement(19926..20780) product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902603.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS 21048..22340 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594360.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS 22352..22999 product ABC transporter ATP-binding subunit Vex2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173749.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 gene vex2 CDS 23023..24411 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369224.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS complement(24895..25437) product ClbS/DfsB family four-helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837148.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS complement(25511..25645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS complement(25654..27798) product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263563.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 gene feoB CDS complement(27795..28271) product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263564.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS complement(28436..28666) product DUF1797 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896146.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS 28905..31184 product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902602.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 sequence18 source 1..30834 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 313..386 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 tRNA 391..465 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS complement(552..2180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS 2203..2490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS complement(3195..4817) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899531.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS 4973..5512 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789193.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS 5534..6223 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS 6243..7238 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167827.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 gene galE CDS 7320..8345 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837726.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 gene trpS CDS 8477..9958 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837725.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 gene guaB CDS complement(10047..11144) product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837724.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 gene recF CDS complement(11146..11526) product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894275.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 gene yaaA CDS 11789..12949 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837723.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS 12949..14244 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837722.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS 14303..15124 product cytoskeleton protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227988.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 gene rodZ CDS 15135..15674 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837720.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 gene pgsA CDS 15676..16503 product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033179246.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS 16488..17327 product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837718.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS 17320..18114 product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837717.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS 18271..18891 product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894257.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS complement(19029..19685) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837716.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS complement(19738..20610) product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837715.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 gene sdaAA CDS complement(20619..21290) product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002908339.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 gene sdaAB CDS 21538..22065 product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029068.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS 22425..23546 product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282936.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 gene mnmA CDS 23682..25598 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837713.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 gene mnmG CDS 25851..27827 product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899548.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS 27824..28276 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864219.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 gene rplI CDS 28308..29660 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894241.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 gene dnaB CDS 29664..29936 product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894239.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS 29995..30621 product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037615095.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 sequence19 source 1..28826 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 225..833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS 811..1197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002310800.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS 1217..1453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS 1450..2004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS 2017..2496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS 2508..3500 product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010708082.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS 3517..3744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055037.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS 3746..4162 product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390747.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS 4173..6692 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279020.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS 6705..7199 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15410 note possible pseudo, frameshifted CDS 7171..8631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15420 note possible pseudo, frameshifted CDS 8628..8855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS 8864..9907 product phage tail tip lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002310786.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS 10172..10510 product DUF771 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188031.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS 10566..11711 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257255.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS 11838..12215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15470 note possible pseudo, internal stop codon, frameshifted CDS 12333..12500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15480 note possible pseudo, internal stop codon CDS 12723..13145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15490 note possible pseudo, internal stop codon, frameshifted CDS complement(13517..14206) product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836295.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS complement(14668..15075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS complement(16133..18481) product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286325.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS complement(18561..19127) product NAD(P)H-dependent oxidoreductase MdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263120.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 gene mdaB CDS complement(19124..19720) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263121.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS complement(19876..21204) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263484.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS 21333..22703 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261901.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS 23296..23961 product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005592074.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS 24039..24644 product DUF998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262508.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS complement(25449..25721) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15590 note possible pseudo, internal stop codon, frameshifted CDS complement(25782..26111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15600 note possible pseudo, internal stop codon CDS 26265..27512 product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120770310.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 tRNA complement(27619..27704) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 tRNA complement(27712..27785) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 tRNA complement(27797..27871) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 tRNA complement(27884..27956) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA complement(27963..28043) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 tRNA complement(28060..28132) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA complement(28139..28212) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 tRNA complement(28225..28314) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 tRNA complement(28327..28400) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 tRNA complement(28412..28487) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 tRNA complement(28525..28597) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 tRNA complement(28605..28679) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 sequence20 source 1..24630 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 228..1151 product zinc-binding lipoprotein AdcAII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744526.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 gene adcAII CDS 1160..3724 product pneumococcal histidine triad protein PhtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700331.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 gene phtD CDS 4170..4820 product SAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262591.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS 4826..5383 product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836852.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS 5383..7047 product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904344.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 gene dnaX CDS 7086..7280 product DUF3272 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895701.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS 7512..7928 product YjdF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005591162.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS complement(7989..8924) product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836853.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 gene birA CDS complement(8927..9928) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836854.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS 10170..11348 product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836861.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS 11421..12902 product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836862.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 gene galT CDS 12940..13209 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS 13353..13487 product DUF4044 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895969.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS 13545..14855 product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836728.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 gene obgE CDS 14870..15031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261955.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS complement(15064..16014) product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836884.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS 16195..17481 product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836885.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS 17483..18349 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836886.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 gene thrB CDS 18710..19639 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836887.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS 19751..21109 product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476037.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS 21102..21944 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476036.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS 22143..22991 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107747.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS complement(23841..24344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15840 sequence21 source 1..23814 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 248..2398 product peptide cleavage/export ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082313.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS 2409..3770 product competence pheromone export protein ComB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801613.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 gene comB CDS complement(4043..4648) product superoxide dismutase SodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896081.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 gene sodA CDS complement(4719..5756) product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836680.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 gene holA CDS complement(5810..8854) product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228826.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS complement(8910..9452) product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162926761.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS complement(9527..10675) product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209435792.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS complement(10672..11679) product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262593.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS complement(11669..13252) product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146974.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS complement(13327..14181) product RNA-binding virulence regulatory protein CvfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095445.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 gene cvfB CDS complement(14294..14851) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894858.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 gene frr CDS complement(14855..15595) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894857.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 gene pyrH CDS complement(15879..16568) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894855.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 gene rplA CDS complement(16659..17084) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085809.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 gene rplK CDS 17241..17600 product DUF3397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897148.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS complement(17643..19994) product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130514.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS complement(20342..22639) product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837253.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS complement(22725..22928) product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899876.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS complement(23048..23479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386980.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 sequence22 source 1..22073 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 437..4831 product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837528.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS 5095..5292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS 5310..5540 product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893807.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS complement(6026..6640) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902258.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 gene def CDS 6920..8701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS 8802..9605 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS 9639..11450 product DUF2194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964051.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS 11483..12871 product GT4 family glycosyltransferase PelF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964052.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 gene pelF CDS 12871..14316 product exopolysaccharide Pel transporter PelG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964053.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 gene pelG CDS 14309..14779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS 14873..16084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS 16071..16805 product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006715.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS 16820..17491 product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861070.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS 17593..18879 product DUF4832 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704479.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 sequence23 source 1..21656 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 33..107 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 tRNA 132..204 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA 232..304 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 tRNA 314..395 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 tRNA 406..478 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 tRNA 498..569 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 tRNA 577..662 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 tRNA 672..745 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 tRNA 804..877 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 tRNA 918..991 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 tRNA 997..1072 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 tRNA 1085..1160 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 tRNA 1173..1262 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA 1275..1348 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 tRNA 1355..1427 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 tRNA 1443..1515 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 tRNA 1553..1628 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 tRNA 1638..1727 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 CDS 1802..2617 product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894316.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 gene mreC CDS 2619..3119 product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263141.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 gene mreD CDS 3229..4449 product CHAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836283.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS 4582..5550 product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894321.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS 5705..6892 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836286.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS 6870..7643 product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002920493.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 gene recO CDS 7640..8638 product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717437.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 gene plsX CDS 8635..8880 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136447.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS 9040..9747 product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263133.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS 9794..13519 product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263132.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS 13604..15073 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921773.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 gene purF CDS 15309..16328 product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263128.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 gene purM CDS 16328..16879 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836289.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 gene purN CDS 16934..17098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS 17106..18653 product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166538.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 gene purH CDS complement(18712..20646) product murein hydrolase LytF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836292.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 gene lytF CDS 21003..21218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS 21248..21490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16350 sequence24 source 1..21243 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(296..1045) product competence system response regulator transcription factor ComE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899529.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 gene comE CDS complement(1045..2367) product competence system sensor histidine kinase ComD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837729.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 gene comD CDS complement(2388..2534) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16380 tRNA complement(2699..2774) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 CDS complement(2816..3295) product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028058.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 gene rlmH CDS 3488..4678 product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681606.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS 4733..5500 product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899523.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS 5729..7072 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836274.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 gene dnaA CDS 7229..8365 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836275.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 gene dnaN CDS 8365..8562 product DUF951 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002981933.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS complement(8586..9086) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS 9232..10347 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836277.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 gene ychF CDS 10420..10989 product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836278.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 gene pth CDS 10982..14488 product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836279.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 gene mfd CDS 14568..14834 product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234967.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS 14827..15195 product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894303.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS 15319..16599 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836280.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS 16596..17873 product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836281.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 gene tilS CDS 17879..18421 product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032909165.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 gene hpt CDS 18442..20412 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894312.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 gene ftsH CDS 20617..21090 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836282.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 sequence25 source 1..19115 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 491..1102 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092756.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 gene rpsD CDS complement(1214..1747) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899570.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS 1921..4719 product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472055.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS complement(4759..5532) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363786.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS complement(5550..6431) product Rgg/GadR/MutR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837644.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS 7044..7715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS 8358..9092 product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837702.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS 9073..9753 product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814522.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS 9765..11225 product carbohydrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899577.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS complement(11277..11549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS complement(11455..12069) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS complement(12308..12904) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775255.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS complement(12914..13909) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS complement(13896..14222) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273857.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS 14666..16216 product D-alanine--poly(phosphoribitol) ligase subunit DltA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972622.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 gene dltA CDS 16213..17457 product D-alanyl-lipoteichoic acid biosynthesis protein DltB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009659556.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 gene dltB CDS 17473..17712 product D-alanine--poly(phosphoribitol) ligase subunit DltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894204.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 gene dltC CDS 17705..18973 product D-alanyl-lipoteichoic acid biosynthesis protein DltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002919976.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 gene dltD sequence26 source 1..16853 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(130..972) product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837466.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS complement(1039..2859) product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837467.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS 3055..4620 product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837468.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS 4617..5357 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189477.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS complement(5873..6088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893653.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS complement(6198..7085) product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898882.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS complement(7211..7810) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893668.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS complement(7807..8904) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837470.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS complement(8908..9642) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009660063.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS complement(9656..10531) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837471.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS complement(10817..12484) product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898897.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS complement(12487..12852) product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893676.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS complement(13028..13216) product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002982870.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 gene rpmB CDS complement(13351..14013) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837472.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS complement(14019..14465) product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893678.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 tRNA complement(14686..14761) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 CDS complement(14976..15272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16890 note possible pseudo, internal stop codon CDS complement(15377..16258) product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263577.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 sequence27 source 1..15485 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(308..1153) product class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837256.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS complement(1241..2704) product isopeptide-forming domain-containing fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837257.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS complement(2758..5205) product SHIRT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018372426.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS complement(5537..6100) product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014017192.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS complement(6102..7088) product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002908428.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 gene ruvB CDS complement(7275..8312) product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836308.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS complement(8355..9356) product tagatose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836307.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 gene lacD CDS complement(9367..10536) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903539.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS complement(10703..11107) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836305.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS complement(11125..11952) product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774989.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS complement(11939..12832) product PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894386.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS complement(12851..13327) product PTS system mannose/fructose/N-acetylgalactosamine-transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898809.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS complement(13324..15129) product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836303.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 sequence28 source 1..12412 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 302..1018 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901967.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS 1100..1801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS complement(1858..3153) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263398.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 gene purB CDS complement(3314..3541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614701.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS complement(3550..4500) product 2-dehydropantoate 2-reductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263532.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS complement(4501..5589) product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263391.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 gene purK CDS complement(5576..6013) product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002274410.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 gene purE CDS complement(6387..7568) product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263388.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS complement(7628..8887) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263387.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 gene purD CDS complement(9095..10192) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS complement(10192..11136) product sce7725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295913.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS complement(11153..11764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17150 sequence29 source 1..10067 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 443..955 product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009659168.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS 1397..1960 product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185837.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS 1950..2600 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837350.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS 2631..2957 product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837349.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS 2999..3943 product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867029.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS 3937..4485 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837348.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS 4498..4752 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361076.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS 4764..6818 product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421662.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS complement(6889..7188) product DUF1827 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767189.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS complement(7252..7701) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900905.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS complement(7777..8901) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703012.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS 9291..9899 product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900899.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 sequence30 source 1..9170 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(191..1015) product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837416.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 gene nadE CDS complement(1012..2472) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837417.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS complement(2690..4066) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070842508.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS complement(4464..5375) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272320.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 gene trxB CDS complement(5439..5663) product DUF4059 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893522.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS complement(5774..6517) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590982.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS complement(6517..7326) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103449.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS complement(7486..8829) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837419.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 sequence31 source 1..8032 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 316..1557 product D-alanyl-D-alanine carboxypeptidase PBP3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000720654.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 gene pbp3 CDS complement(1917..2372) product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917692.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS complement(2359..3591) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917693.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS complement(3607..4869) product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185458.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 gene sufD CDS complement(4909..5706) product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114489.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 gene sufC CDS complement(5770..6936) product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837464.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS complement(6927..7682) product adaptor protein MecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837465.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 gene mecA sequence32 source 1..7088 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 638..1420 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894015.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 gene rpsB CDS 1503..2546 product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894014.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 gene tsf CDS complement(2633..2983) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS 3207..3704 product CtsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899234.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS 3708..6137 product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837612.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS 6180..6620 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673332.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 sequence33 source 1..5615 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 326..1330 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228428.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS 2297..3154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17500 note possible pseudo, internal stop codon, frameshifted CDS 3147..3344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17510 note possible pseudo, internal stop codon, frameshifted CDS 3387..3872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17520 note possible pseudo, internal stop codon, frameshifted CDS 4109..4627 product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837039.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 gene rimM CDS 4617..5342 product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837038.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 gene trmD sequence34 source 1..5410 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 207..1759 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 tRNA 1812..1886 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 rRNA 2152..5049 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 sequence35 source 1..5372 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 280..4101 product pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836521.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS 4279..5136 product 5'-nucleotidase, lipoprotein e(P4) family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844831.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 sequence36 source 1..5163 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(443..1267) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837697.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS 1521..2105 product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032910354.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS complement(2172..3341) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837692.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS complement(3407..3931) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002910979.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS 4099..4962 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917983.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 sequence37 source 1..4705 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(679..1119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17620 note possible pseudo, internal stop codon, frameshifted CDS complement(1421..1807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17630 note possible pseudo, internal stop codon CDS complement(1886..2860) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17640 note possible pseudo, internal stop codon CDS complement(2864..4213) product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837353.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 gene trkA sequence38 source 1..1791 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence39 source 1..1005 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 575..645 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 sequence40 source 1..963 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(12..875) product IS982 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116878224.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 sequence41 source 1..844 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence42 source 1..785 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence43 source 1..762 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(245..517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17670 note possible pseudo, internal stop codon, frameshifted sequence44 source 1..648 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@