COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..552618 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(476..829) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227350.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS 1334..1756 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804885.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS 1753..1983 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857133.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS 2444..2647 product excisionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814511.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS 2729..3946 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291561.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS complement(4213..4461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS complement(4518..4946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS complement(5251..5712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS complement(5781..7085) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392758.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 gene hemL CDS complement(7095..8069) product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392760.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 gene hemB CDS complement(8079..9587) product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943897.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 gene cobA CDS complement(9584..10522) product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943896.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 gene hemC CDS complement(10527..11798) product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399038.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 gene hemA CDS complement(11767..12414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS complement(12472..13257) product photosystem II S4 domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140394.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS complement(13260..14054) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898446.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 gene proC CDS complement(14081..14578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS complement(14632..15318) product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS complement(15492..16346) product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291723.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 gene pgeF CDS complement(16356..18083) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943687.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS complement(18204..18923) product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906307.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS complement(18936..19397) product DUF3290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476157.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS complement(19571..20578) product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942554.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 gene ilvC CDS complement(20720..21505) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232156.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS complement(21517..22005) product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496411.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 gene ilvN CDS complement(22005..23714) product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023692.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS complement(23733..24956) product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017132.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 gene ilvA CDS complement(24999..26669) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 gene ilvD CDS complement(26861..26992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS complement(27205..28608) product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233725.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS complement(28625..29068) product 1-methylthio-xylulose 5-phosphate sulfo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389753.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS complement(29137..29445) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS complement(29460..29702) product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392792.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS complement(29739..30494) product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124996.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 gene pgl CDS complement(30665..31456) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893616.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS complement(31992..32960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS complement(33875..34267) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966378.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 gene rpsI CDS complement(34288..34728) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260793.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 gene rplM CDS complement(34923..35684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS complement(35758..36345) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401493.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 gene rpsD CDS 36643..37542 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964086.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS 37765..38088 product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886445.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 tRNA complement(38133..38208) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 tRNA complement(38212..38286) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 tRNA complement(38295..38370) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 tRNA complement(38378..38452) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 tRNA complement(38456..38531) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 tRNA complement(38537..38611) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA complement(38617..38692) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 tRNA complement(38696..38771) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA complement(38777..38851) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS complement(39052..40170) product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545250.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 gene cobT CDS complement(40167..41204) product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943639.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 gene cobT CDS complement(41328..42215) product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545810.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS complement(42323..43669) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202606.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS complement(43874..44746) product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190154.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS complement(44748..46499) product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625418.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS complement(46795..47580) product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048349.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 gene truA CDS complement(47577..48380) product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS complement(48370..49230) product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048350.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS complement(49230..50138) product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156226187.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(50423..50758) product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393907.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 gene rplQ CDS complement(50771..51775) product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393908.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS complement(51846..52235) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966387.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 gene rpsK CDS complement(52255..52623) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810116.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 gene rpsM CDS complement(52787..53005) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029884.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 gene infA CDS complement(53028..53798) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 gene map CDS complement(53802..54365) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810125.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS complement(54378..55640) product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 gene secY CDS complement(55642..56088) product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936637.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 gene rplO CDS complement(56111..56290) product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085234.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 gene rpmD CDS complement(56305..56808) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 gene rpsE CDS complement(56827..57189) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225816.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 gene rplR CDS complement(57225..57770) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399690.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 gene rplF CDS complement(57795..58181) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894501.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 gene rpsH CDS complement(58209..58478) product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085703.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 gene rpsN CDS complement(58495..59034) product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225809.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 gene rplE CDS complement(59058..59378) product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156486.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 gene rplX CDS complement(59397..59765) product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357295.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 gene rplN CDS complement(59790..60050) product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459100.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 gene rpsQ CDS complement(60090..60293) product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855718.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 gene rpmC CDS complement(60283..60720) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 gene rplP CDS complement(60720..61388) product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235068.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 gene rpsC CDS complement(61405..61740) product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148024.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 gene rplV CDS complement(61754..62035) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102083.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 gene rpsS CDS complement(62059..62889) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393934.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 gene rplB CDS complement(62916..63200) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869926.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 gene rplW CDS complement(63200..63823) product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127258.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 gene rplD CDS complement(63850..64491) product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184218.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 gene rplC CDS complement(64504..64815) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393938.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 gene rpsJ CDS complement(64996..66183) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723640.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 gene tuf CDS complement(66234..68309) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459098.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 gene fusA CDS complement(68325..68795) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137491.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 gene rpsG CDS complement(68848..69222) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393942.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 gene rpsL CDS complement(69299..69544) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS 69900..71921 product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667119.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS complement(72046..76248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS complement(76278..80438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS complement(80769..82184) product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230430.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 gene aspA CDS 82479..83243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00910 note possible pseudo, internal stop codon CDS 83298..84119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS complement(84162..84530) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196965.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 gene rplL CDS complement(84601..85098) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273085.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 gene rplJ CDS complement(85274..85984) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810196.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 gene rplA CDS complement(86061..86486) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156430.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 gene rplK CDS complement(86588..87124) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393950.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 gene nusG CDS complement(87137..87358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS complement(87401..87550) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421192.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 gene rpmG CDS complement(87834..90071) product nitric-oxide reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691589.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS complement(90407..91594) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723640.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 gene tuf tRNA complement(91775..91851) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 tRNA complement(91857..91932) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 tRNA complement(91964..92039) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 tRNA complement(92045..92129) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 tRNA complement(92140..92215) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS complement(92663..93127) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS complement(93156..94577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS complement(94574..95227) product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545559.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 gene hypB CDS complement(95242..95583) product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941042.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 gene hypA CDS complement(95576..96403) product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192079.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS complement(96522..98489) product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392356.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS complement(98489..99907) product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975035.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS complement(99976..100851) product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479580.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 gene sdaAA CDS complement(100860..101522) product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733097.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 gene sdaAB CDS complement(102105..103670) product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433949.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 gene hcp CDS 103943..104668 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811882.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS complement(104825..106588) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS complement(106598..107149) product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136366.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS complement(107321..107881) product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158303423.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS complement(107901..108743) product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048346.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 tRNA 109484..109559 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 tRNA 109564..109638 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 tRNA 109642..109717 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS 109827..110735 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS complement(110780..111187) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641444.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS complement(111191..112615) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 gene atpD CDS complement(112634..113488) product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272788.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 gene atpG CDS complement(113492..115030) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393857.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 gene atpA CDS complement(115047..115598) product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169539095.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS complement(115603..116100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS complement(116119..116346) product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048816.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 gene atpE CDS complement(116370..117044) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462234.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 gene atpB CDS complement(117308..117676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS complement(117687..117866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS complement(117883..119025) product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393864.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 gene wecB CDS complement(119083..120234) product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391762.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS complement(120269..121627) product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861617.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS complement(121637..121912) product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023169.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS complement(122047..123684) product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705434.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 gene pgm CDS complement(123856..124800) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356230.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS 125006..125902 product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545467.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 gene ispE CDS 125899..126591 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS 126731..128191 product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356603.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS 128543..129799 product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682315.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS complement(129938..130429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS complement(130926..131615) product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877949.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 gene queC CDS complement(131782..132537) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989811.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS complement(132675..132902) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS complement(132916..133734) product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056252.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS complement(133966..134424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS 134635..134976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS complement(135036..136328) product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962895.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 gene dcm CDS complement(136474..137859) product Sau3AI family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068548.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS 138136..139065 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS complement(139133..140686) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903785.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS complement(141073..141888) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005975400.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS complement(141881..142678) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903786.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS complement(142691..144259) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903785.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS complement(144413..145234) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903784.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS complement(145234..146172) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015650.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS complement(146907..148238) product putrescine-ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175349.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 gene potE CDS complement(148828..150255) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940832.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 gene argH CDS complement(150255..151466) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393768.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS complement(151801..152502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS complement(152626..153378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS 153764..154042 product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458924.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS complement(154136..154396) product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391564.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS complement(154533..156260) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152804487.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 gene ptsP CDS 156579..157412 product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768322.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 gene dapF CDS 157588..158811 product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964062.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS 158840..159754 product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986316.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 gene pfkB CDS 159788..161782 product PTS fructose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897443.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS 162229..166140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS complement(166416..167351) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117534.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 gene cysK CDS complement(167367..167816) product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552474.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 gene iscR CDS complement(168194..168757) product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367212.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 gene ahpC CDS complement(168759..168959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS complement(168946..169161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS complement(169171..170781) product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947977.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS complement(170797..172530) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227570.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 gene argS CDS complement(172496..172954) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS complement(173006..173404) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS complement(173382..174023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS complement(174250..175158) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS complement(175295..176071) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722653.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS complement(176080..176316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(176361..177434) product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303623.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS complement(177584..178915) product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229322.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 gene brnQ CDS complement(179120..181123) product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941543.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS 181704..182843 product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963887.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS 183139..184776 product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948686.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS 185166..186353 product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757481.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS complement(187216..191472) product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048163.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(191987..192820) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815192.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS complement(193193..194506) product DUF389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932175.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS complement(194516..195553) product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964681.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 gene cobT CDS complement(195843..197162) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946621.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS complement(197323..198159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS complement(198170..199000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS complement(199025..200197) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435962.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS 201360..201905 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS 202188..204470 product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047928.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS 204619..205647 product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987087.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS 205752..206558 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373267.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS complement(206565..206981) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812977.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS 207455..208468 product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964210.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 gene aroF CDS 208543..209595 product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775572.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 gene aroB CDS 209614..210882 product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964213.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 gene aroA CDS 210872..211966 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861346.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 gene aroC CDS 211953..213092 product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417818.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 gene pheA CDS 213217..214452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS complement(214655..215449) product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704389.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 gene aroD CDS complement(215609..216865) product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179313.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(217129..217548) product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479949.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS 217695..219062 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496463.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS complement(219300..220607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS complement(220622..221407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS complement(221643..222155) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674090.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS complement(222191..222634) product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262079.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS complement(222647..223054) product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836459.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS 223335..224777 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964781.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS complement(224809..225381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS complement(225430..226554) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016775.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS complement(226812..227930) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861083.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS complement(227930..230518) product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948931.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS complement(230531..230782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS complement(230787..231383) product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391578.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 gene recR CDS complement(231384..231713) product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815036.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS complement(231855..234560) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS complement(234942..239525) product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807931.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 gene gltB CDS complement(239844..240710) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814617.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS complement(240712..241905) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897664.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS complement(242102..242995) product phosphatidylglycerol lysyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454768.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS complement(243140..244255) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406318.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS 244367..245218 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080532.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS complement(245368..245706) product branched-chain amino acid transporter AzlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245988.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 gene azlD CDS complement(245699..246316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS complement(246465..247631) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966662.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS 247893..248711 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453767.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS complement(248784..249599) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084558766.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS complement(250346..251899) product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963421.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS complement(252148..253539) product cation:dicarboxylase symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861591.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS complement(253716..254444) product lactate utilization protein LutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228309.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 gene lutC CDS complement(254444..255889) product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061914.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS complement(255902..256639) product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869148.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS 257163..258878 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS 259062..260447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS complement(260540..261385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS complement(261397..263475) product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224746.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS 263924..265279 product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225106.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 gene fumC CDS complement(265377..266558) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431263.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS complement(266575..267672) product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171406.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 gene mutY CDS complement(267876..268397) product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980098.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS 268515..269288 product DUF4931 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381025.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS 269364..270197 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427805.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS 270207..270437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS complement(270681..273179) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS complement(273600..274580) product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948644.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS complement(274665..275045) product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104506.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 gene crcB CDS 275235..275618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS complement(275796..276503) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943981.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS 276712..277653 product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896022.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS complement(277734..281489) product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572274.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 gene addA CDS complement(281479..284973) product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392018.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 gene addB CDS 285325..286317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS complement(286480..287028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS complement(287177..288403) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807816.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS 288546..288710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS complement(288711..289358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS complement(289865..291019) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126564639.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS complement(291055..291768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS 291907..292104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS 292120..292776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS 293077..293319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS 293319..293501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS 293503..293622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS 293828..294403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS 294872..295438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02710 tRNA complement(296545..296633) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS complement(296803..297756) product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810938.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS complement(298202..300331) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379416.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS complement(300586..302118) product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015979.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS complement(302292..302618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS complement(302664..303947) product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102011.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS complement(304201..305559) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420541.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 gene dnaB CDS complement(305629..306075) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 gene rplI CDS complement(306072..308099) product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072710106.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS complement(308116..309075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS complement(309269..311398) product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460381.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS 311482..311670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS complement(311833..312909) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS complement(312963..313760) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533247.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS complement(314170..314943) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393473.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS complement(314955..315707) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393472.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS complement(315718..316671) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826669.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS complement(317159..318790) product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546376.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS complement(318801..319388) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007140.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS complement(319640..320428) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732025.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS complement(320425..321426) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018304962.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS complement(321410..322393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS complement(322456..324519) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449670.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS complement(324684..325487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS complement(325496..325900) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707897.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS complement(325897..326508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS complement(326822..327043) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS complement(327265..327471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS complement(327697..328443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS complement(328904..329779) product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855106.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS complement(329779..330741) product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858567.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS complement(330743..332461) product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930843.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 gene sdhA CDS 333347..334021 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264517.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS 333999..335414 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901931.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS complement(335583..336896) product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461052.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS complement(336893..338086) product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964411.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS complement(338224..338925) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815292.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS complement(339114..339470) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814177.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 339911..340705 product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174107.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 gene ygiD CDS complement(340882..341049) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS complement(341015..341152) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS complement(341184..341978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS complement(342254..342913) product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948383.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 gene ric CDS complement(343177..344175) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627902.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 gene pta CDS 344558..345235 product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435129.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS complement(345213..345488) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS complement(345968..347320) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461086.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS 347940..349127 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016536.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS complement(349437..351080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS complement(351538..352167) product superoxide dismutase SodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974746.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 gene sodA CDS complement(352527..353066) product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814019.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS complement(353280..353792) product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287163.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS complement(353806..354198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS complement(354299..354643) product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330315.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS complement(354753..355121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS complement(355184..355570) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS complement(355814..356311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS 356543..357109 product NAD(P)H-dependent oxidoreductase MdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263120.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 gene mdaB CDS complement(357247..357534) product DUF2695 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899242.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS complement(357548..357709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03300 note possible pseudo, frameshifted CDS complement(357706..358053) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03310 note possible pseudo, frameshifted CDS complement(358157..358750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681674.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS complement(358780..359586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681682.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS complement(359612..360154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681642.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS complement(360191..360697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS complement(360769..361200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS complement(361221..362036) product DUF2262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681628.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS complement(362154..362927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS complement(363022..363930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS complement(363940..364233) product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040666777.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 gene cas2 CDS complement(364281..365177) product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002797819.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 gene cas1 CDS complement(365198..368392) product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864485.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 gene cas9 repeat_region 368472..370155 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttttatcatagcgaaaaattacagagtactaaaac tRNA complement(370622..370698) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS complement(370747..371727) product 5'-nucleotidase, lipoprotein e(P4) family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782748.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS 371993..372874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS complement(373028..374491) product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787371.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS complement(374809..375093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS complement(375182..376654) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119785.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 gene dinB CDS complement(376657..377001) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948466.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS complement(377541..378824) product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434259.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS complement(378940..380118) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031604.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS complement(380349..381644) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942277.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 gene purB CDS 382090..382500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS complement(382654..383484) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS complement(383489..383893) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071947.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS complement(383890..384495) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197537045.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS complement(384521..384736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS complement(384797..385054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS complement(385105..385995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS complement(386291..387544) product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099360647.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 gene meaB CDS complement(387537..389726) product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258367.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 gene scpA CDS complement(389731..391893) product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258368.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS complement(392030..392149) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS 392521..393417 product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535539.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 gene rarD CDS complement(393508..394407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS 394512..394760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS complement(395186..395773) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS complement(396305..399127) product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209611508.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS complement(399596..400390) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228670.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS complement(400416..400865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS complement(400918..402462) product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025189815.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS complement(402832..403983) product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288246.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 gene fucO CDS complement(404221..405369) product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813606.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 gene nagZ CDS complement(405646..405879) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963988.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS complement(406247..406873) product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392875.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS complement(406883..407653) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816623.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS complement(407743..408141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS complement(408296..408814) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028699.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS 409196..409786 product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765867.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS complement(409971..410285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS 410800..412122 product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246460.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 gene glpT CDS complement(412240..413034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS complement(413349..413702) product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760124.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS complement(413789..414109) product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679295.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS complement(414126..414410) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265672.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS complement(414767..415483) product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000232924.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS 415645..415806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS complement(415827..416432) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774893.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS complement(416432..416875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS complement(417568..418104) product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861543.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS complement(418554..419129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS complement(419187..420443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS complement(420818..421219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS complement(421265..422524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS complement(423124..423693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS complement(423702..424286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS 424560..425978 product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100479.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS complement(426625..427986) product C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705380.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 gene dcuC CDS complement(428016..429176) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066054433.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS complement(429356..430042) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250769.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS complement(430418..431524) product M20 peptidase aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704276.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS 431723..432403 product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704274.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS 432390..432854 product YjiG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704275.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS 433223..434527 product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261296.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 gene codB CDS 434533..434697 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04040 repeat_region 435052..436245 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttccgtcccctaatggggattatttaatttaac CDS complement(436563..436838) product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259224.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 gene cas2 CDS complement(436840..437835) product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926120.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 gene cas1 CDS complement(437933..439252) product type III-A CRISPR-associated CARF protein Csm6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899494.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 gene csm6 CDS complement(439249..440019) product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899496.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 gene cas6 CDS complement(440009..441199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS complement(441192..442190) product type III-A CRISPR-associated RAMP protein Csm4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546537.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 gene csm4 CDS complement(442200..442883) product type III-A CRISPR-associated RAMP protein Csm3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021929.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 gene csm3 CDS complement(442896..443408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS complement(443419..445977) product type III-A CRISPR-associated protein Cas10/Csm1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900580.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 gene cas10 repeat_region 446149..447350 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttccgtccccatcaggggattatttagtttaac repeat_region 447473..448512 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttccgtcccctaatggggattatttaatttaac CDS complement(448877..449485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS complement(449805..450671) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS complement(450965..452029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS complement(452465..453613) product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813606.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 gene nagZ CDS complement(453964..455394) product [FeFe] hydrogenase, group A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198738.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS complement(455718..456092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS complement(456187..457230) product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673299.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS complement(457317..457622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS complement(457843..459018) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202296.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS complement(459177..459548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS complement(459627..462095) product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815130.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 gene gyrA CDS complement(462196..462858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS complement(462845..463957) product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202567.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS complement(464003..465799) product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431790.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS complement(465801..468722) product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966800.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS complement(468875..469681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS complement(469904..471166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS 471561..472517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS 472519..473184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986295.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS 473418..473705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS complement(473869..474390) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948568.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS complement(474479..474937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS complement(475218..475595) product spore germination protein GerW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461818.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS complement(475679..476818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS complement(476848..477426) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948638.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 gene cobO CDS complement(477556..478512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS complement(478522..479043) product DUF4446 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966988.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS complement(479251..480516) product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392791.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 gene hydF CDS complement(480852..481781) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562946.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS complement(481961..482731) product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 gene soj CDS 483653..484420 product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986274.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS 484468..486903 product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943552.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS 486925..487782 product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023430.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS complement(488080..488832) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549696.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 gene rsmG CDS complement(488956..490827) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048454.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 gene mnmG CDS complement(490878..492263) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898860.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 gene mnmE CDS complement(492445..493242) product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701001.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS complement(493252..493917) product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393998.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS 494040..494270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS complement(494356..494625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS 494595..494783 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS complement(494795..494929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS 495976..497550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS 497877..498989 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947896.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 gene dnaN CDS 499243..499476 product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583899.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 gene yaaA CDS 499480..500580 product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359456.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 gene recF CDS 500567..501469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS 501483..501731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS 501809..503710 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815132.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 gene gyrB CDS 503721..505202 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083410.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS 505403..505720 product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359266.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS complement(505929..508991) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024698545.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS complement(508988..510052) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208008.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS complement(510482..511837) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461867.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS 512092..512691 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005627.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS 513134..514312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS 514781..516583 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS 516680..517648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS 517664..518422 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224973.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS 518436..519374 product VirK/YbjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704184.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS 519384..520604 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS 520651..521829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS 522080..523519 product undecaprenyl-phosphate galactose phosphotransferase WbaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368710.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS 523519..524619 product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986979.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 gene glf CDS 524616..525620 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101284.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS 525646..527256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS 527246..528007 product DUF4422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986978.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS 528018..529109 product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476426.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS 529106..530107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS 530120..530914 product phosphorylcholine transferase LicD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199637.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS 530931..531650 product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389752.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 gene ispD CDS 531660..533168 product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101306.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS 533182..534102 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS 534108..535163 product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184376.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 535399..536475 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS 536542..536868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS 537300..539669 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS complement(540299..541708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS 542128..543171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS 543346..544209 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS 544392..551036 product YadA-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052728129.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS 551128..551877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04950 sequence02 source 1..313233 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 252..1262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS 1246..2265 product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142660.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS 2274..3449 product type 4 pilus assembly protein PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216405.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 gene pilG CDS 3486..3932 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS 3986..4528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS 4507..4968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS 4976..5332 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS 5329..5973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS 5954..6361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS 6371..7225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS 7209..7805 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS 7813..8202 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS 8322..9164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS 9136..10050 product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870000.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 gene pfkA CDS 10210..11292 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941163.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS 11305..12027 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS 12020..13231 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS 13459..13923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS 13960..14982 product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393252.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 gene pheS CDS 14992..17436 product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357703.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 gene pheT CDS 17525..19948 product DUF3656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393214.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS 19962..22340 product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458990.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS complement(22524..24614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS 24777..25985 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393211.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 gene tyrS CDS 26225..26866 product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435254.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS 26944..29325 product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646028.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 gene ppsA CDS 29424..30053 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001797828.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS 30064..30885 product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460836.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS 30882..31871 product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816343.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS complement(31957..32145) product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813371.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 gene rpmB CDS 32369..34411 product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 gene recG CDS 34543..34728 product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700404.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS 34804..36258 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264088.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 gene guaB CDS 36274..36996 product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140652.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS 37011..37652 product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327813.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS 37645..38316 product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940239.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 gene pssA CDS 38336..39598 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808136.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS 39616..40377 product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057623.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 gene surE tRNA 40432..40515 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS 40619..41410 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS 41479..41850 product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861979.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 gene acpS CDS 41852..43429 product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924808.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS 43426..44370 product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964264.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS complement(44675..44932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS 44865..45713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS 45717..46277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS 46390..47370 product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234080.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 gene thiL CDS 47360..47854 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048261.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 gene tsaE CDS 47838..48596 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860649.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 gene tsaB CDS 48596..49045 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367197.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 gene rimI CDS 49042..50073 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 gene tsaD CDS 50076..51467 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS 51468..52046 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423977.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS 52178..52459 product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392082.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 gene groES CDS 52572..54197 product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817317.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 gene groL CDS 54530..54946 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811318.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS 55010..56266 product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462285.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 gene lysA CDS 56561..57304 product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966562.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 gene sufC CDS 57313..58722 product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966563.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 gene sufB CDS 58732..59778 product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966564.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 gene sufD CDS 59791..61020 product SufS family cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966565.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS 61035..61460 product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966566.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS 61462..62145 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278485.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS complement(62226..62732) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS 62946..63425 product transcriptional regulator CtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244563.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 gene ctsR CDS 63432..63971 product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391707.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS 63981..65042 product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235007.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS 65277..67724 product ATP-dependent protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235011.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 gene clpC CDS 67888..69261 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399687.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 gene radA CDS 69277..70428 product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393965.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS 70412..71587 product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546162.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 gene ispD CDS 71590..73059 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810213.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 gene gltX CDS 73196..74149 product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042144000.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS 74645..76093 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393961.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 gene cysS CDS 76083..76559 product mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399685.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS 76561..77292 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459087.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 gene rlmB CDS 77295..77828 product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832317.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS 77902..78576 product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942746.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 gene sigH CDS 78582..78818 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS 78877..81240 product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391817.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 gene rnr CDS 81249..81719 product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391819.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 gene smpB CDS 81874..82374 product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200956.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS 82374..83102 product 6-carboxyhexanoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968009.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 gene bioW CDS 83107..84264 product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231837.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 tmRNA 84402..84743 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS 84936..85553 product Type 1 glutamine amidotransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836850.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS 85800..86927 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873809.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS 86942..90124 product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157567585.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS 90280..91221 product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360265.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS 91326..93515 product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233919.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 gene pcrA CDS 93597..95600 product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812372.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 gene ligA CDS 95675..95965 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461445.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 gene gatC CDS 95977..97437 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 gene gatA CDS 97434..98882 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812379.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 gene gatB CDS 99049..99465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS 99529..101367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS 101476..102441 product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081416.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS 102450..103463 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721973.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS 103466..103942 product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816440.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 gene ybeY CDS 103935..104834 product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288753.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 gene era CDS 104889..106220 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460069.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS 106207..106911 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS 107075..107878 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05960 note possible pseudo, frameshifted CDS 107871..108332 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029492212.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS 108457..109776 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439092.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS 109910..111775 product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533256.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS 111762..118712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS 118663..119163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS 119523..120398 product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392140.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 gene glyQ CDS 120400..122451 product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861551.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 gene glyS CDS 122612..123004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 123146..123487 product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813207.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 gene rplS CDS 123719..124624 product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236706.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 gene ylqF CDS 124617..125414 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194268.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS 125708..126106 product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583880.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS 126119..127825 product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902393.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS 127932..129158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS 129148..131523 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892959.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 gene topA CDS 131513..132829 product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989721.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 gene trmFO CDS complement(132946..133770) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461890.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 gene lgt CDS 133927..135609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS 135700..138168 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460890.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 gene leuS CDS 138244..138723 product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS complement(138884..140113) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987074.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS 140225..140794 product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583465.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 140751..142979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 142991..143968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS 143971..147762 product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541505.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 147942..148322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS 148351..148560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 148610..149068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS complement(149157..150899) product ubiquinone-dependent pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994147.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 gene poxB CDS 151376..152590 product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131960.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 gene ribD CDS 152571..153227 product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493908.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 gene ribE CDS 153243..154445 product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987154.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS 154515..154976 product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454467.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 gene ribE CDS 155174..156052 product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148598.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 gene hslO CDS 156162..156956 product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583293.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 gene mtnP CDS 156999..158063 product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943990.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 gene mtnA CDS 158239..159483 product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392227.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS 159602..160891 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583295.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS complement(160962..161711) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023383.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS 161861..162799 product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814288.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS 162940..163848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS 163850..164593 product DUF4241 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681658.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS complement(164700..164849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS 165060..166361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS complement(166543..167160) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948131.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS complement(167356..168666) product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896350.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS 168804..169814 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038093611.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS complement(169721..170074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(170052..171227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS complement(171257..171727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS complement(171748..172146) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS complement(172175..173236) product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681714.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS complement(173350..173829) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948533.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS complement(173846..173971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS complement(174005..174313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS 174568..175239 product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965137.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 gene lexA CDS complement(175289..176230) product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207989.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(176243..177085) product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948190.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 gene panC CDS complement(177156..177548) product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287876.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS complement(177800..178687) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460382.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 gene dapA CDS complement(178709..179740) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460383.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS complement(179763..180560) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583509.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 gene dapB CDS complement(180851..182515) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699855.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 gene recN CDS complement(182520..182975) product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935393.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 gene argR CDS complement(183296..183871) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948135.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS complement(183899..184783) product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS complement(184793..185515) product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965376.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS complement(185593..186072) product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130996.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS complement(186101..186979) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810943.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS complement(186989..187195) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS complement(187170..188393) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358983.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 gene xseA CDS complement(188396..189349) product O-sialoglycoprotein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272419.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS complement(189349..189753) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208665.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 gene nusB CDS complement(189743..190138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS complement(190150..190530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS complement(190666..191223) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 gene efp CDS complement(191239..192312) product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411039.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 gene pepQ CDS complement(192383..193084) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234947.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS complement(193081..193719) product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392619.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 gene cobC CDS complement(193727..194857) product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392618.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 gene cobD CDS complement(194882..195766) product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392617.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS complement(195840..196733) product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095065899.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 gene cobS CDS complement(196733..197725) product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392613.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 gene cbiB CDS complement(197738..199255) product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392612.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS complement(199248..199826) product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891982.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 gene cobU CDS 199890..200225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS complement(200273..200788) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259300.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS complement(200852..201259) product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 gene ndk CDS complement(201282..202157) product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360263.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 gene htpX CDS complement(202213..203127) product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816738.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 gene thrB CDS complement(203130..204419) product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816736.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS complement(204444..204893) product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811150.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS complement(204907..205899) product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869831.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS complement(205896..206750) product hopanoid biosynthesis-associated protein HpnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941812.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 gene hpnK CDS complement(206912..207706) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965655.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS complement(207708..209453) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583043.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS complement(209440..211167) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966041.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS 211575..212090 product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223506.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 gene tpx CDS 212198..212593 product phosphate-starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834704.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 gene psiE CDS complement(212699..214603) product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048401.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS complement(214840..215283) product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460866.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS complement(215366..215545) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS complement(215703..216047) product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880034.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS complement(216059..217354) product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 gene mtaB CDS complement(217379..218110) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430913.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS complement(218107..218970) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964596.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 gene prmA CDS complement(219026..220183) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392123.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 gene dnaJ CDS complement(220200..222041) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392122.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 gene dnaK CDS complement(222069..222614) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392711.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 gene grpE CDS complement(222614..223642) product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392120.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 gene hrcA CDS complement(224040..224642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS complement(224724..225821) product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181861.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 gene hemW CDS complement(225913..227712) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816487.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 gene lepA CDS complement(227751..228812) product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 gene mnmA CDS complement(229011..230249) product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435270.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS complement(230246..231175) product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986379.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 gene miaA CDS complement(231172..231984) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637459.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS complement(231986..234031) product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516269.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 gene mutL CDS complement(234031..236664) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965142.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 gene mutS CDS complement(236691..237491) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494981.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS complement(237720..239033) product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986381.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 gene miaB CDS complement(239042..239917) product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392700.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS complement(239933..240760) product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392599.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS complement(240877..242595) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460410.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS complement(242589..243674) product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541503.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 gene ispG CDS complement(243693..244709) product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810655.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 gene rseP CDS complement(244718..245863) product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921140.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 gene dxr CDS complement(245882..246706) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732813.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS complement(246710..247474) product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440346.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS complement(247455..247706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS complement(247706..248266) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810666.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 gene frr CDS complement(248272..248997) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042668.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 gene pyrH CDS complement(249060..249740) product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460416.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 gene tsf CDS complement(249839..250591) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460417.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 gene rpsB CDS complement(250845..251495) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232058.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 gene rpe CDS complement(251497..252360) product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893669.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 gene rsgA CDS complement(252369..254303) product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965035.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 gene pknB CDS complement(254322..255023) product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392426.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS complement(255016..256062) product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986842.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 gene rlmN CDS complement(256081..257436) product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440956.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 gene rsmB CDS complement(257417..258211) product DUF116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940807.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS complement(258195..259205) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232070.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 gene fmt CDS complement(259198..259686) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392416.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 gene def CDS complement(259700..261883) product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 gene priA CDS complement(261946..263136) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163123.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 gene metK CDS complement(263331..264995) product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946538.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 gene sulP CDS complement(265047..266246) product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460556.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 gene coaBC CDS complement(266299..266514) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811864.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 gene rpoZ CDS complement(266519..267148) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460557.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 gene gmk CDS complement(267157..267426) product extracellular matrix/biofilm regulator RemA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154355.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 gene remA CDS complement(267441..268322) product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416240.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS 268450..270165 product tRNA modification protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886504.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 gene rqcH CDS complement(270333..270800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS complement(270812..271303) product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583503.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 gene coaD CDS complement(271308..271859) product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986836.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 gene rsmD CDS complement(271927..272925) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426955.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS complement(272929..273525) product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392834.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 gene plsY CDS complement(273525..274859) product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460200.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 gene der CDS complement(274973..276871) product bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811135.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS complement(276862..277482) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460203.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS complement(277475..278158) product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700259.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 gene cmk CDS complement(278167..279414) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460214.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS complement(279411..280139) product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440556.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 gene rluB CDS complement(280141..280650) product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402814.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 gene scpB CDS complement(280663..281388) product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831064.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS 281558..283390 product phosphoethanolamine transferase CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000556285.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS complement(283306..283488) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS complement(283485..283940) product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965636.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 tRNA complement(284047..284135) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 tRNA complement(284150..284224) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 tRNA complement(284234..284308) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 tRNA complement(284316..284391) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 tRNA complement(284397..284472) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS complement(284523..285119) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048078.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS complement(285135..286622) product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812212.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS complement(286635..287975) product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459869.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 gene trkA CDS complement(287981..288889) product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281259.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS complement(288891..289253) product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229971.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 gene rsfS CDS complement(289270..290391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS complement(290404..290976) product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964575.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 gene yqeK CDS complement(290977..291591) product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392101.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 gene nadD CDS complement(291731..292990) product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS complement(293000..294121) product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392099.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 gene proB CDS complement(294193..294477) product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129828.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 gene yhbY CDS complement(294486..295757) product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724114.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 gene obgE CDS complement(295775..296914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS complement(296916..298103) product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391790.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS complement(298103..298990) product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198720.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 gene ftsX CDS complement(298980..299666) product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963819.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 gene ftsE CDS complement(299681..300613) product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903779.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS complement(300613..301449) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003389978.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS complement(301483..302583) product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391759.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 gene csaB CDS complement(302576..304618) product DUF5693 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391758.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS complement(304631..305326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS complement(305335..306327) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096948712.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 gene prfB CDS complement(306563..308998) product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945439.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 gene secA CDS complement(309217..309744) product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671185.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 gene raiA CDS complement(309986..310183) product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391770.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS complement(310700..311425) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140959.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS complement(311422..312078) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392641.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS complement(312090..312896) product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392640.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 sequence03 source 1..258677 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 447..556 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 tRNA 1715..1790 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 tRNA 1903..1979 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS complement(2105..2383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS 2552..4252 product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924853.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS 4340..5314 product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812256.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS 5324..7123 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812261.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS 7120..8232 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812264.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS 8232..9347 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812266.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 tRNA 10241..10325 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS 10513..13809 product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579713.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 gene mfd CDS 13806..15413 product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS 15397..16167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS 16219..16518 product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284639.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS 16601..17755 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947974.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS complement(17799..18119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS 18301..20247 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948735.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS 20380..21849 product [FeFe] hydrogenase, group A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198738.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS 22080..22709 product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816806.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS 22702..23700 product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816804.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS 24130..24303 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS complement(24536..25540) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948657.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS complement(25562..26308) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682019.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS complement(26335..27342) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986194.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS 27594..28049 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986654.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS 28070..28345 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003361919.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS 28377..29744 product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358211.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS 29744..30139 product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986162.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS 30398..31288 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986747.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS 31589..36541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS 36728..41806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS 41842..42459 product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141387.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS 42462..42869 product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707897.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS 42872..43675 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS 43704..44222 product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682427.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS 44244..45884 product heme anaerobic degradation radical SAM methyltransferase ChuW/HutW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479251.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 gene hutW CDS 46224..47228 product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256595.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS 47235..48596 product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062283476.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS 48632..49282 product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000514290.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS 49395..50201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861791.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS 50214..51314 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861790.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS 51450..53093 product VWA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861789.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS complement(53200..53877) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245964.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS 53986..54498 product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134526.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 gene moaC CDS 54527..55012 product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429657.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 gene trmL CDS 55118..55483 product YlbF/YmcA family competence regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290301.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS 55458..56387 product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894000.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 gene murB CDS 56526..56870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08360 note possible pseudo, internal stop codon CDS 57144..57473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS 57671..59482 product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183842.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 gene typA CDS 59748..60467 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS 60613..62856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS 62956..63414 product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 tRNA 63544..63618 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS complement(63723..64142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS 64252..65103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS 65211..65816 product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898080.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS 66168..66983 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS 66993..67340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS 67330..67830 product folate family ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288403.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS complement(67908..68186) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS 68379..70106 product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458814.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 gene ilvB CDS 70115..70627 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006862451.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 gene ilvN CDS 70812..71402 product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941475.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS 71409..72731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS 72960..74144 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393460.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS 74176..75186 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095369.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 gene argF CDS 75297..76247 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197909.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 gene argC CDS 76258..77115 product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057248.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 gene argB CDS 77201..78388 product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS 78526..78708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS 78899..80077 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861090.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS 80245..81438 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816585.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS complement(81576..82562) product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244278.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 gene guaC CDS 82746..83276 product energy-coupled thiamine transporter ThiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228966.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 gene thiT CDS 83269..84393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS 84374..85609 product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880216.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 gene moeA CDS 85967..86302 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943224.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS 86352..86630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS 86645..87667 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101255.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS 88038..88304 product SemiSWEET family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291476.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS 88497..89525 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101255.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS 89910..90812 product L(+)-tartrate dehydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045349.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 gene ttdA CDS 90812..91423 product L(+)-tartrate dehydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703618.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 gene ttdB CDS 91526..92794 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703620.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS 93071..94741 product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966477.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS 94771..95388 product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108450.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS 95569..96897 product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006718507.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS 97112..97552 product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986477.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS 97579..98544 product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371204.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 gene moaA CDS 98546..98848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08780 tRNA 98932..99007 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS 99290..100231 product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674220.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS 100416..101915 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836325.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 gene thrC CDS 102126..103013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS 103186..104853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS 105138..105605 product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932912.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 gene mscL CDS 105729..106778 product bifunctional glyoxylate/hydroxypyruvate reductase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886621.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS 106861..108549 product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428989.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS 108740..109372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS 109477..110064 product DUF3793 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681044.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS 110075..110494 product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666607.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS 110893..111525 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381503.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS 111535..112746 product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819571.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 gene dpaL CDS 112759..114069 product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362247.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS 114222..115415 product knotted carbamoyltransferase YgeW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379712.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 gene ygeW CDS 115484..116419 product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000038002.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 gene arcC CDS 116474..117802 product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359625.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 gene ssnA CDS 117831..119522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS 119519..120868 product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861449.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 gene hydA CDS 120886..123435 product selenium-dependent xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356597.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 gene xdh CDS 123581..124966 product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006718507.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS 125171..126358 product 5-methylthioribulose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389751.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS 126464..127270 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435698.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS 127273..127752 product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243164.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 gene rlmH CDS 127864..128319 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198843.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS 128483..129787 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830810.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 gene tig CDS 129824..130417 product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036184.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 gene clpP CDS 130430..131683 product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816893.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 gene clpX CDS 131749..134058 product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392068.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 gene lon CDS 134058..134756 product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933808.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 gene yihA CDS 134753..135724 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527775.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS 135726..136616 product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392793.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 gene tatC CDS 136637..139294 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460907.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS 139307..140614 product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392070.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS 140624..141862 product IctB family putative bicarbonate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143733.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS 142387..143892 product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869054.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS 143921..145567 product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869041.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS 145596..145991 product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942223.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS 146070..147008 product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249284.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 gene meaB CDS 147060..147482 product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869043.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 gene mce CDS 147633..149162 product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869044.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS 149236..149583 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS 149607..149774 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS 149875..150264 product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149793471.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS 150335..151456 product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869047.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS 151650..151907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS 151946..153247 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703620.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS 153487..153750 product SemiSWEET family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563849.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS 154242..154406 product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963626.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS 154515..154955 product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454916.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 gene lspA CDS 155042..155965 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949041.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS 155931..156080 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS 156059..156580 product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431186.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 gene pyrR CDS complement(156705..158018) product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902445.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS 158205..158768 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS 158772..159977 product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986808.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS 160130..160750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS 160837..161403 product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226275.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS 161576..162274 product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392073.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 gene radC CDS 162554..163591 product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107906544.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS 163593..164510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS 164507..165001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS 165021..166943 product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 gene mrdA CDS 166945..167868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS 167874..168980 product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392081.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 gene rodA CDS 169036..170919 product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460899.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS 170891..171586 product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460898.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS 171621..173048 product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546353.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS 173077..173652 product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814509.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS 173853..174164 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460896.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 gene rplU CDS 174167..174481 product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392095.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS 174494..174778 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053095207.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 gene rpmA CDS 174923..175579 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121094.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS 175576..176340 product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012390.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 gene fetB CDS 176634..177656 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388278.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS 177658..178656 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072771516.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS 178671..179480 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861723.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS 179482..180570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS 180851..182299 product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964665.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 gene hydG CDS 182494..184476 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS 184488..186728 product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768340.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS 186728..187363 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393180.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS 187405..187893 product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812063.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS 187886..189313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS 189313..190584 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460333.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 gene hisS CDS 190593..192398 product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393178.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 gene aspS CDS 192895..194196 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393158.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS 194279..197023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS 197072..197524 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS 197564..199510 product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437073.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS 199567..200604 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948802.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS 200660..202006 product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 gene rimO CDS 202044..203291 product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966849.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS 203296..204336 product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 gene recA CDS 204339..204782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS 204940..206502 product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812942.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 gene rny CDS 206758..208530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS 208559..209719 product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816337.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 gene rpoD CDS 209925..210263 product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790409.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 gene queD CDS 210250..210993 product putative 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949101.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 gene queE CDS 211075..211638 product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966889.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 gene folE tRNA 211704..211778 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS 211971..212702 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889262.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS 212718..213821 product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036219.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS 214279..214608 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545412.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 gene trxA CDS 214882..216021 product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880392.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS 216021..217922 product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880393.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS 217937..218746 product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880394.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 gene cybH CDS 218739..219317 product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880396.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS 219386..219763 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS 220140..221150 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170714.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS 221235..222047 product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811530.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS 222325..224940 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889064.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 gene alaS CDS 225095..225355 product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385813.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS 225364..225774 product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810863.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 gene ruvX CDS 225801..226097 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS 226341..227774 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS 227798..228406 product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986882.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS 228406..229650 product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438167.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS 229654..229929 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS 230085..231020 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS 231538..233448 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888359.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 gene thrS CDS 233604..234809 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693428.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS complement(234974..236467) product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002431748.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS 236819..237373 product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808206.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 gene infC CDS 237394..237591 product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357520.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 gene rpmI CDS 237638..237988 product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808209.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 gene rplT CDS 238132..238695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS 238955..239596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS complement(239722..239991) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS 240108..241325 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS 241484..243925 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS 243906..245444 product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948400.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS 245466..246572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS 246616..247587 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047820.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS 247612..248655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS 248720..252079 product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948403.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS 252233..253762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS complement(253787..254479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10150 note possible pseudo, internal stop codon CDS 255423..257237 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS 257239..258480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS complement(258477..258641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10180 sequence04 source 1..195577 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 803..1405 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS complement(1447..2142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS complement(2142..4295) product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947993.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS complement(4295..5059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS complement(5072..6004) product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438310.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS complement(6007..6948) product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986789.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 gene truB CDS complement(6951..7892) product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808862.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS complement(7910..8266) product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460392.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 gene rbfA CDS complement(8276..10723) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS complement(10739..11044) product YlxQ family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286523.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS complement(11057..11326) product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388362.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS complement(11329..12405) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 gene nusA CDS complement(12423..12881) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438303.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS complement(13144..13839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS complement(13823..14149) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10330 note possible pseudo, frameshifted CDS complement(14091..14378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS complement(14540..15142) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288324.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 gene coaE CDS complement(15172..17793) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412819.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 gene polA CDS 18061..18321 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229989.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 gene rpsT CDS 18485..20671 product RNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897225.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS complement(20967..22139) product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046079.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 gene deoB CDS complement(22270..22803) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080176.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS complement(22812..24437) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114935398.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS complement(24584..25033) product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002986111.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS complement(25044..27113) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076750.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 gene pnp CDS complement(27225..27491) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814361.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 gene rpsO CDS complement(27664..28461) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289388.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS complement(28472..29344) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811777.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS complement(29356..30336) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811776.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS complement(30361..31338) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811776.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS complement(31470..31847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS complement(31898..33289) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964406.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS complement(33360..34343) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS complement(34348..35388) product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 gene waaF CDS complement(35388..36407) product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055064632.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS complement(36477..36971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS complement(36971..37936) product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707885.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 gene rfaD CDS complement(37933..39411) product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942727.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 gene rfaE1 CDS complement(39505..40074) product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858021.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 gene gmhA CDS complement(40074..41000) product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434938.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS complement(41061..41552) product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399430.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 gene nrdR CDS complement(41751..45197) product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244778.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 gene pyc CDS complement(45479..46828) product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434194.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS complement(46996..47829) product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461116.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS complement(47950..49143) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454722.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS complement(49295..50032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS 50283..50675 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459934.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS complement(50820..51842) product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964788.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS 52128..52790 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS complement(52963..53460) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902015.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS complement(53457..54329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681887.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS complement(54301..55080) product protein-ADP-ribose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681886.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS complement(55189..55956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS complement(55971..56456) product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428667.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS complement(56580..57602) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS complement(57729..58307) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS complement(58493..60025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS complement(60055..60525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS complement(60637..61056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS complement(61085..62146) product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681714.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS complement(62263..62910) product DUF4304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681734.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS complement(62951..63391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(63570..64049) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948533.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS complement(64059..64709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS complement(64867..65307) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS complement(65572..67059) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105059.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 gene rlmD CDS complement(67059..67727) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346925.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS complement(67903..68562) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346925.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS 68829..70172 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836944.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS complement(70221..72047) product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391800.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 gene uvrC CDS complement(72182..75034) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228057.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 gene uvrA CDS complement(75169..77346) product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 gene uvrB CDS complement(77346..77729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS complement(77719..78654) product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035249530.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 gene ftsY CDS complement(78654..82208) product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361019.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 gene smc CDS complement(82254..83444) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047864.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS complement(83616..84356) product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428341.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 gene rnc CDS complement(84356..85600) product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 gene fabF CDS complement(85636..86592) product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813418.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS complement(86670..86900) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388176.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS complement(86952..87695) product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911773.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 gene fabG CDS complement(87697..88638) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245314.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 gene fabD CDS complement(88650..89594) product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460502.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 gene fabK CDS complement(89610..90605) product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460503.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS complement(90589..91617) product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 gene plsX CDS complement(91621..92181) product transcription factor FapR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419115.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 gene fapR CDS complement(92487..92663) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419113.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 gene rpmF CDS complement(92689..93201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS complement(93302..93436) product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966063.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS 93984..94937 product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419125.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 gene fabK CDS 94959..95507 product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869802.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS complement(95600..96838) product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229369.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS complement(96841..97338) product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901774.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 gene nrdG CDS complement(97587..99737) product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802773.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 gene nrdD CDS complement(99982..100785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS complement(101076..101510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS complement(101547..102713) product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706040.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 gene ugd CDS complement(102714..103811) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288210.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS complement(103834..105288) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS complement(105288..106427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS complement(106405..107337) product ATP-grasp fold amidoligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107724.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS complement(107315..108556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS complement(108575..109642) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531351.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS complement(109639..110688) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184376.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS complement(110681..111403) product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389752.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 gene ispD CDS complement(111413..112279) product LicD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379609.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS complement(112291..112977) product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922186.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS complement(112971..114170) product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609547.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS complement(114248..114859) product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986981.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS complement(114861..116306) product GumC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583709.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS complement(116457..118283) product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272023.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS complement(118321..119064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS complement(119473..120183) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080267.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS complement(120185..120946) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931109.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS complement(120958..121971) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944004.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS complement(121971..122852) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944005.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS complement(122867..124015) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944012.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS complement(124137..126056) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379727.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS complement(126085..127407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS complement(127389..128237) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(128363..129352) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966243.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 gene galE CDS complement(129362..130798) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258044.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS complement(130882..131160) product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836838.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS complement(131181..132104) product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986613.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS complement(132127..132852) product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889235.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS complement(132862..133353) product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002404288.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 gene ybaK CDS complement(133435..133632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS complement(133644..134432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS complement(134460..135755) product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861764.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS complement(135757..136863) product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921988.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS complement(136926..137438) product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891255.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS complement(137447..138013) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS complement(138187..139050) product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048121.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 gene galU CDS complement(139064..140617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS complement(140655..141767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS complement(141876..142322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925185.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(142584..143591) product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940978.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 gene hypE CDS complement(143593..144711) product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937632.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 gene hypD CDS complement(144671..144922) product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250951.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS complement(145156..147435) product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258631.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 gene hypF CDS complement(147471..148880) product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene scfB CDS complement(149047..149190) product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815210.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 gene scfA CDS complement(149291..150052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS complement(150102..150944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS complement(150937..151341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS complement(151458..153596) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860870.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS complement(153613..153873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS complement(153978..154184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS complement(154416..156788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS complement(156798..157031) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS 157571..158869 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983287.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS complement(158992..161313) product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461760.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS 161492..163087 product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963949.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS 163532..164779 product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903453.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 gene gltS CDS complement(164870..165724) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892086.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 gene rsmA CDS complement(165738..166265) product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437901.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 gene rnmV CDS 166372..167310 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263217.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS 167564..168685 product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812397.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS 168686..169624 product bifunctional peptide-methionine (S)-S-oxide reductase MsrA/peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995985.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 gene msrAB CDS complement(169747..170724) product G5 and 3D domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966270.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS complement(171150..173267) product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814149.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS complement(173257..174822) product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020142.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS complement(174822..176369) product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963940.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 gene ppx CDS complement(176592..177362) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435866.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS complement(177362..179308) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947939.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 gene metG CDS complement(179343..180191) product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000267808.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 gene rsmI CDS complement(180181..180906) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544975.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS complement(180899..181744) product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963624.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS complement(181745..182785) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640966.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 gene holB CDS complement(182861..183547) product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947925.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS complement(183550..185031) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048125.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS complement(185089..185667) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287401.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 gene pth CDS complement(185678..186631) product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814952.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS complement(186759..188132) product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071030.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 gene glmU CDS complement(188267..189049) product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078543208.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 gene purR CDS complement(189307..189915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS complement(190177..191349) product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528071.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 gene nhaA CDS complement(191385..192323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS 192421..192561 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS complement(192640..193971) product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920764.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 tRNA 194110..194183 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS 194272..194481 product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005631673.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 rRNA complement(195169..195277) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 sequence05 source 1..181516 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 458..2647 product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768251.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 gene cooS CDS 3247..3609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS complement(3730..4758) product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942229.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 gene bioB CDS 5081..6352 product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065381.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS 6342..9236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS 9433..10476 product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966929.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 gene hemE CDS 10481..11380 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244736.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 gene hemH CDS 11377..13038 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS 13262..13993 product heme-dependent peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832113.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS complement(14697..16034) product NarK family nitrate/nitrite MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459021.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS 16398..17084 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013859.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS 17156..20833 product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729064.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS 20823..22256 product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244173.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 gene narH CDS 22249..22773 product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242466.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 gene narJ CDS 22770..23441 product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242665.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 gene narI CDS 23766..24368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS 24633..25904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS 26043..26648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS 26940..28136 product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179313.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS 28341..29225 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101944.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS complement(29378..29992) product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902979.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS complement(30128..31168) product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262368.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS 31516..32061 product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886620.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS 32808..33560 product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012476.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 gene bioD CDS 33765..35153 product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048655595.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 gene bioA CDS 35341..36681 product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852014.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS complement(36763..37173) product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458892.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS complement(37404..38222) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948965.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS complement(38215..38976) product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948966.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS 39124..40038 product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964901.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS 40390..41061 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS 41361..42044 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS 42117..42746 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS complement(42803..43585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS 43869..44432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS 44948..45568 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS 45727..46005 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS complement(46537..47649) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181633.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 gene alr CDS 47960..48910 product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966228.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS complement(48925..49488) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002910979.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS 49689..51584 product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458920.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS complement(51704..52480) product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921923.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 gene pflA CDS complement(52493..52729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS complement(52805..54922) product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195485.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 gene pflB CDS 55442..56314 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002267623.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS 56634..57500 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156015265.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS 57754..58776 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817462.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS 58776..59447 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019084191.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS 59502..60326 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687141.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS 60389..60706 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS 60639..60848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS complement(60832..61143) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS 61354..62820 product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366800.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS 62996..63400 product PACE efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167512737.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS 63460..63963 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS 64116..65249 product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963712.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS 65260..66444 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948998.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS 66488..67447 product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965131.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 gene metA CDS 67738..69009 product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101818.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS complement(69489..70076) product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644295.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS 70471..71037 product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868997.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS complement(71218..71982) product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409953.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS complement(72041..73576) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815046.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS complement(73573..74442) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815048.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS complement(74866..76314) product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436882.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS 76616..78067 product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965086.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS 78076..78843 product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869673.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 gene nadE CDS 78882..79859 product L-asparaginase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262105.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 gene ansB CDS complement(80135..80911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS 81087..82016 product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796397.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS 82042..82899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS 82982..83515 product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813854.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 gene yfbR CDS complement(83663..84547) product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438992.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 gene queG CDS 84703..85485 product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861448.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS 85485..85937 product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902988.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS 85937..88234 product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897245.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS 88276..89034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS 89041..89763 product molybdenum cofactor cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047953.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 gene mocA CDS 89760..90572 product selenium-dependent molybdenum cofactor biosynthesis protein YqeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047954.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 gene yqeB CDS 90556..91284 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS 91274..91588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12800 note possible pseudo, frameshifted CDS 91706..92518 product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007069.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 gene cdaA CDS 92515..93441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS 93658..95256 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905801.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS 95443..96795 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461863.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 gene glmM CDS 97120..97815 product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440228.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS 98060..99172 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS complement(99295..100692) product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860226.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS 101217..103049 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808420.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 gene glmS CDS 103106..104092 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814203.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 gene trpS CDS 104129..104605 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS 104865..105677 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811433.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS 105801..106457 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811435.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS 106596..107351 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815786.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS 107360..108631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS 108801..109247 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810241.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS 109440..109730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS 109838..110725 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877777.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS complement(110783..111772) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876994.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS complement(112020..112178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS 112141..112929 product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243706.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 gene modA CDS 113183..113851 product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815806.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 gene modB CDS 113860..114486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS complement(114470..115654) product putative hydroxymethylpyrimidine transporter CytX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225706.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 gene cytX CDS 116053..116532 product energy coupling factor transporter S component ThiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829480.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 gene thiW CDS 116532..117365 product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221739.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 gene thiD CDS 117379..118899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS complement(119055..119600) product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS 120351..120554 product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773685.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS 120564..121595 product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768338.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 gene selD CDS 121710..122309 product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391672.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 gene yedF CDS 122434..122691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS 122810..123517 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185732.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS 123675..123911 product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893931.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS 123977..124213 product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837579.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS complement(124292..125398) product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524657.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 gene ychF CDS 125752..126924 product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434490.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS complement(127036..128007) product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808153.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS 128299..130521 product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815957.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS complement(130777..132006) product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461084.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS 132344..133426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS 133436..134611 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS 134934..136118 product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706371.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS 136261..136545 product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966984.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 gene rpsF CDS 136565..136963 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS 137003..137233 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462317.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 gene rpsR CDS complement(137322..137819) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890791.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS 138029..139786 product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107752.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS 140116..140802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS 141003..141662 product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266024.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 gene trmB CDS 141664..142989 product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392361.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 gene ftsW CDS 143118..144401 product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815817.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 gene uraA CDS 144599..145063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS 145100..146056 product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812222.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 gene floA CDS 146065..146721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS 146974..147705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS 147760..148698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS 148847..149440 product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225483.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS 149700..150950 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356101.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS complement(151028..152251) product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016614.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 gene pepT CDS 152501..154438 product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763503.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS 154790..155575 product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392640.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS 155652..156677 product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246467.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 gene mmuM tRNA complement(156774..156864) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS complement(157087..158322) product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987112.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS complement(158488..162228) product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272602.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS 162496..163401 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948372.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS 163656..164231 product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119547.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS 164259..164705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS 164717..165157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS 165245..165412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS 165591..166082 product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147124.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 gene purE CDS 166202..166930 product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964700.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS 166942..168360 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461475.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 gene purF CDS 168347..169408 product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393542.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 gene purM CDS 169401..170024 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545849.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 gene purN CDS 170049..171578 product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722242.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 gene purH CDS 171725..172987 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242993.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 gene purD CDS 173250..174392 product isochorismate synthase MenF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165379822.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS 174433..176331 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS 176328..177188 product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810064.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 gene menH CDS 177193..178035 product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132444.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 gene menB CDS 178236..179714 product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905533.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 gene menE CDS 179728..180879 product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905532.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 gene menC CDS 180876..181253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13630 sequence06 source 1..169993 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(195..1100) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246430.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS complement(1349..3040) product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643005.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS complement(3345..4961) product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005916172.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS complement(5191..5538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS complement(5549..5926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS 6391..7332 product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458881.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS 7443..8174 product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458882.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS 8171..9136 product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458883.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS 9133..10233 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458884.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS complement(10419..11198) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065320.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS complement(11195..12244) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065319.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS complement(12261..13433) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022139.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS complement(13536..14708) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022139.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS complement(15157..15639) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385459.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS complement(15669..16112) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890794.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS complement(16149..16979) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022983.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS complement(16995..17297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS complement(17300..17623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS complement(17766..18275) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681727.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS complement(18379..18552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS complement(18561..18971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678829.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS complement(19158..19850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205180329.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS complement(19816..20481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS 20798..21124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13870 note possible pseudo, internal stop codon CDS 21290..21736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13880 note possible pseudo, internal stop codon CDS complement(21794..23884) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350638.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS complement(24097..24534) product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280500.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS complement(24534..25619) product HpaII family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964363.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS complement(25661..26653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS complement(26833..28368) product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679432.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 gene guaA CDS complement(28630..28827) product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963626.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS complement(28983..30134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS complement(30164..31345) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868916.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS 31519..32301 product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392640.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS 32613..34985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS complement(35067..37901) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392382.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 gene ileS CDS complement(38367..38891) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS complement(39031..39666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS complement(39885..40454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS complement(40458..41345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS 41519..41809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS complement(41951..42742) product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673965.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 gene trpA CDS complement(42735..43928) product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966435.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 gene trpB CDS complement(43971..45425) product bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650575.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 gene trpCF CDS complement(45429..46439) product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673966.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 gene trpD CDS complement(47028..47594) product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933229.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS complement(47594..49063) product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880347.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 gene trpE CDS complement(49469..50398) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS 50739..51917 product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179313.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS complement(52041..53294) product C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418812.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 gene dcuC CDS complement(53519..54763) product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694560.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS complement(54826..56121) product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705259.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS complement(56345..57289) product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016040.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS complement(57291..57767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS complement(58050..60116) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 gene fusA CDS complement(60634..61752) product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964939.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 gene hydE CDS complement(61757..62503) product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125119833.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 gene yaaA CDS complement(62481..63083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS complement(63390..64649) product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788100.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS complement(64669..65418) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14230 tRNA complement(65629..65719) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS complement(65770..66204) product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902929.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS complement(66607..67218) product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069591551.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 gene cysE CDS complement(67382..68296) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436514.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 gene cysK CDS complement(68511..69371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS complement(69373..69870) product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218613.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 gene queF CDS complement(69962..70789) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS complement(71023..71424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS complement(71430..71636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS 71748..71903 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS complement(72048..72584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS complement(72581..74107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS complement(74886..75227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS complement(75227..75841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS complement(75877..76218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS complement(76375..76848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS 77304..78035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS complement(78203..79828) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS complement(80052..81884) product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393461.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS complement(82166..82792) product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101826.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 gene hisH CDS complement(82871..83947) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101825.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 gene hisC CDS complement(84057..84383) product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721355.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 gene hisE CDS complement(84386..84703) product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646591.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 gene hisI CDS complement(84879..85637) product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646590.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 gene hisF CDS complement(85722..86444) product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642716.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 gene hisA CDS complement(86458..87048) product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837141.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 gene hisB CDS complement(87171..88448) product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101827.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 gene hisD CDS complement(88521..90125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS complement(90416..90880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS complement(90885..91748) product histidinol-phosphatase HisJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642710.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 gene hisJ CDS complement(91849..92349) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528179.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS complement(92693..93361) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS complement(93371..94183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS complement(94176..95801) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14560 note possible pseudo, frameshifted CDS complement(95942..96262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS complement(96265..96510) product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812819.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS 96794..97315 product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966733.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS 97424..98080 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475477.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS 98318..98599 product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018213496.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS 98604..98930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS 99271..100158 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968280.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 gene rbsK CDS 100185..100598 product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244175.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 gene rbsD CDS 100644..102125 product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244379.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 gene rbsA CDS 102125..103060 product ribose ABC transporter permease RbsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968282.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 gene rbsC CDS 103070..103972 product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242760.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 gene rbsB CDS complement(104081..104563) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722589.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS complement(104697..105470) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949000.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS complement(105467..106183) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243465.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS complement(106190..106906) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255026.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS complement(106962..107801) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722588.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS complement(107794..109119) product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243743.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS complement(109151..110266) product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167582487.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS complement(110632..111927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS complement(112150..112803) product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859738.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 gene pcp CDS complement(112918..113847) product DUF979 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869191.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS complement(113849..114598) product DUF969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869190.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS complement(114805..115290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS complement(115701..117431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS 117957..118097 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS complement(118124..119311) product anaerobic nitric oxide reductase flavorubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948785.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS complement(119621..120160) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097402.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS 120102..120341 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS complement(120392..121462) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966448.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 gene leuB CDS complement(121667..122158) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868466.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 gene leuD CDS complement(122160..123419) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393737.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 gene leuC CDS complement(123421..124968) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393738.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS complement(125398..125805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS complement(126165..126794) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS 127025..127372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018213024.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS complement(127428..127898) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185130035.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS complement(128047..128754) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS complement(128879..129619) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016905.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS complement(129621..130388) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS complement(130381..131904) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626195.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS complement(131971..132780) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016908.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS complement(132773..133840) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015650.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS complement(133987..134448) product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014124664.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 gene tnpA CDS 134561..134695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS complement(134711..135298) product DUF4367 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367181.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS complement(135345..135944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS complement(136036..136794) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107784.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS complement(137140..138141) product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417347.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS complement(138141..139130) product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427760.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 gene etfB CDS complement(139135..139413) product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461741.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS complement(139410..140717) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814000.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS 141106..141567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS complement(141725..143047) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776370.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS complement(143459..145327) product TonB-dependent vitamin B12 receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001172310.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 gene btuB CDS complement(145350..146261) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367304.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS complement(146263..149886) product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496657.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 gene cobN CDS complement(149890..151917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS complement(151920..152849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS complement(152946..153791) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901765.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS complement(153791..154828) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901766.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS complement(154821..155774) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002391812.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS complement(155818..157800) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695098.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS complement(157944..159887) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545775.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS complement(159906..160667) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682019.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS complement(160667..161713) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669987.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS complement(161726..162748) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682022.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS complement(162748..165198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS complement(165329..166078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS complement(166083..166487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS complement(166484..167095) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197537045.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS complement(167714..168886) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS complement(169071..169442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15280 sequence07 source 1..136718 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 889..1749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS 1758..2252 product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398479.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS 2472..2903 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358712.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS 2988..4376 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461542.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS 4367..5386 product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393586.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 gene cydB CDS 5587..9174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS 9447..10616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS complement(10746..11330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS complement(11352..12185) product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764616.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS 12321..13253 product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245554.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 gene oppB CDS 13246..14145 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966900.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS 14145..15125 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812003.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS 15125..16072 product oligopeptide ABC transporter ATP-binding protein AppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232964.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 gene appF CDS 16085..16903 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015684.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS 16900..18501 product dipeptide ABC transporter substrate-binding protein DppE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886494.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 gene dppE CDS 18623..19561 product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392232.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS 19688..20827 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893603.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS 20938..22494 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812879.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS 22503..23072 product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001133588.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 gene folE CDS 23065..23898 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029492526.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 gene folP CDS 23898..24260 product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861219.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 gene folB CDS 24260..24730 product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582990.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 gene folK CDS 24832..25647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS 25742..26689 product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861477.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS 26867..27199 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS 27269..27670 product S1 domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287412.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS 27768..28664 product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894028.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS 28633..29631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS 29655..30200 product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359412.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 gene hpt CDS 30289..32217 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391653.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 gene ftsH CDS complement(32271..33614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS 33787..34761 product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768282.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS 34771..35538 product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519040.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS 35633..36619 product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 gene dusB CDS 36743..37216 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966474.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 gene greA CDS 37246..38763 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809769.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 gene lysS CDS 39354..40697 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792073.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS 40799..42079 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896806.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS 42322..43275 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210228.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS 43401..44681 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722107.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 gene serS CDS 44695..45339 product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722103.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 gene fsa CDS 45399..46361 product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214469.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 gene glpX CDS 46563..47828 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393852.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 gene murA CDS 47809..49194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS 49440..50762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS 50851..51135 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS 51148..53130 product SpoIVB peptidase S55 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869562.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS 53161..53922 product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920880.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS 53944..54702 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390659.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS 54702..55961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS 56004..57464 product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942128.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS 57644..61933 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS 62110..64275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS 64382..64870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS 64900..65871 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS 65883..66410 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS 66442..67473 product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942906.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 gene lpxD CDS 67480..68382 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869059.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS 68646..69485 product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094111.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 gene lpxC CDS 69482..69907 product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420731.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 gene fabZ CDS 69928..70740 product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921189.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 gene lpxA CDS 71071..71907 product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546653.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 gene lpxI CDS 71907..73049 product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 gene lpxB CDS 73042..74772 product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405539.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS 74775..76079 product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942899.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS 76134..77246 product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121336.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 gene lpxK CDS 77291..78022 product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030761.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 gene kdsB CDS 78023..78841 product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942539.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 gene kdsA CDS 78853..79824 product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942538.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS 79824..80345 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016229.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS 80360..81292 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925457.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS 81279..81815 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS 81831..82550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS 82560..83279 product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 gene lptB CDS 83288..84379 product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140933.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS 84413..85627 product DUF3084 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925128.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS 85745..86272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS 86262..87131 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964635.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS 87141..87725 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948309.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 gene lepB CDS 88304..89584 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS 90207..91448 product S-layer homology domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870016.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS 91735..92547 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391801.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS 92560..93474 product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048306.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 gene rapZ CDS 93487..94836 product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391803.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS 94852..95799 product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963835.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 gene whiA CDS 95812..98859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS 99212..100162 product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768321.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS 100146..101432 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392399.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS 101432..102499 product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429883.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 gene carA CDS 102501..105701 product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126101.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 gene carB CDS 105706..106473 product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393618.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS 106473..107423 product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942399.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS complement(107612..108502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS 108698..108883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS complement(108907..109560) product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905752.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS 109972..112146 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832365.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS 112348..112881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS complement(113070..114395) product FAD-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775632.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS 114723..115058 product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891062.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS 115048..116400 product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861160.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 gene ffh CDS 116461..116724 product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813195.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 gene rpsP CDS 116746..116973 product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965063.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS 116988..117395 product YlqD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141484.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS 117467..117892 product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699991.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 gene rimM CDS 118013..118828 product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687330.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 gene trmD CDS 118825..119871 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS 119916..120488 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS 120503..121810 product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084952.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS 121913..122977 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS 122994..123425 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS 123437..123997 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS 124056..124628 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813203.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS 124638..125375 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460362.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS 125579..126073 product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810732.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 gene ruvC CDS 126073..126681 product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271550.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 gene ruvA CDS 126684..127688 product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941738.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 gene ruvB CDS 127691..129481 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS 129493..130518 product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861694.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 gene queA CDS 130527..131642 product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723534.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 gene tgt CDS 131720..132010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS 132010..132576 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS 132595..133869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16500 note possible pseudo, internal stop codon, frameshifted CDS 133866..134759 product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393192.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 gene secF CDS 134991..136166 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190330.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 sequence08 source 1..72853 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(177..1460) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964032.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 gene eno CDS complement(1578..3104) product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861866.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 gene gpmI CDS complement(3118..3888) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643975.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 gene tpiA CDS complement(3890..5068) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391807.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS complement(5082..6092) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391806.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 gene gap CDS complement(6160..7185) product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964027.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS complement(7425..8051) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815407.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 gene upp CDS complement(8236..9468) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120494.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS complement(9515..9952) product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161952859.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 gene rpiB CDS complement(9964..10410) product protein arginine phosphatase PrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227664.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 gene prpB CDS complement(10523..11554) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557336.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS complement(11556..12425) product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437849.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 gene prmC CDS complement(12418..13500) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869569.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 gene prfA CDS complement(13503..14393) product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943726.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS complement(14466..14663) product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151132.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 gene rpmE CDS complement(14743..15012) product YdbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963866.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS complement(15117..16562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS complement(16564..17199) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964008.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 gene nth CDS 17323..17592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS complement(17652..18899) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454678.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS complement(19148..19717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS complement(19798..20838) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811376.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 gene ftsZ CDS complement(20977..21321) product small basic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811377.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS complement(21318..21953) product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393732.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS complement(22014..22895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS complement(22924..23856) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392654.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS complement(23853..25235) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 gene murC CDS complement(25250..26359) product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460696.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 gene murG CDS complement(26359..27729) product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454967.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 gene murD CDS complement(27813..28799) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232192.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 gene mraY CDS complement(28856..30214) product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943698.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS complement(30216..31700) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS complement(31756..32160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS complement(32182..33114) product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861627.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 gene rsmH CDS complement(33124..33555) product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392353.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 gene mraZ CDS complement(33958..34278) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966364.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 gene trxA CDS complement(34288..34662) product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812273.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS complement(34795..35769) product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792234.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 gene gluQRS CDS complement(35850..38759) product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048254.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS complement(38900..39217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS complement(39225..40454) product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392817.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS complement(40774..41163) product class II SORL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868764.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS complement(41303..41845) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812393.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 gene cobO CDS complement(42017..43393) product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392614.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS complement(43423..44130) product cobalt-factor II C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836533.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS complement(44218..45072) product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964682.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS complement(45279..46160) product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898260.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS 46621..47610 product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948636.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS 47662..48603 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156774516.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS complement(48672..49454) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243882.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS complement(49454..50449) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018304962.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS complement(50649..51314) product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812307.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS complement(51301..52089) product precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812303.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 gene cobK CDS complement(52086..52910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS complement(52805..53950) product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461547.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS complement(53955..54716) product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871103.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 gene cobM CDS complement(54718..55305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17090 note possible pseudo, frameshifted CDS complement(55302..55928) product cobalt-precorrin-7 (C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877124.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS complement(55904..57022) product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461551.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 gene cbiD CDS complement(57094..57588) product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943822.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS complement(58003..59598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS 59824..60789 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886481.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS 61038..61967 product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582459.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 gene fba CDS 61971..63527 product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS complement(63624..64667) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263595.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS 64888..65628 product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254611.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS 65644..66951 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861814.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS complement(67102..67944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS complement(67946..69289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS 69414..70073 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785068.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS complement(70275..70871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS 71511..72722 product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938460.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 sequence09 source 1..66396 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(297..372) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 tRNA complement(377..451) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 tRNA complement(476..551) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 CDS complement(770..1609) product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424696.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 gene speE CDS complement(1693..2322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS complement(2327..2761) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223931.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS complement(2758..3456) product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016610.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS complement(3465..3839) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419037.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS complement(3932..7015) product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247622.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS complement(7016..8248) product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072763.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS complement(8466..9302) product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438990.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS complement(9513..9932) product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965922.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS complement(10104..11651) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206587.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS complement(11749..12177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS complement(12282..12674) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS complement(12696..13646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS 13939..14514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS complement(14578..16062) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379222.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS complement(16321..18636) product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461496.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS complement(18633..19127) product dihydrofolate reductase DfrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230799.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 gene dfrA CDS complement(19259..20050) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966285.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS complement(20176..22044) product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272332.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 gene recQ CDS 22362..23849 product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020062.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 gene putP CDS complement(23896..24924) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389640.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS complement(25285..26901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS complement(27161..30697) product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987043.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 gene nifJ CDS 31084..32007 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272589.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS 32007..32426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS complement(32585..33202) product SAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262591.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS complement(33349..34662) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089309.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS complement(34904..35260) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003465043.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS complement(35289..36164) product DUF4261 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681717.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS complement(36180..36683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS complement(36932..38479) product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355996.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 gene citF CDS complement(38469..39434) product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898727.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 gene citE CDS complement(39434..39703) product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816323.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 gene citD CDS complement(39826..41229) product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208963.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS complement(41623..42534) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001987174.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS complement(42548..43291) product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939740.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS complement(43327..45075) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 gene pyk CDS complement(45276..48683) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS complement(48696..49463) product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963651.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS complement(49600..49965) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS complement(50137..50514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS complement(50624..51040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS complement(51046..51432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS complement(51497..52069) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS 52586..52900 product YdcP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000420682.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS 52916..53302 product YdcP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985015.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS 53331..54716 product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813488.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS 54894..56099 product MobT family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000398284.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 gene mobT CDS 56142..56363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009056.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS 56480..56977 product antirestriction protein ArdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342539.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS 57066..57458 product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506270.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS 57442..59889 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331160.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS 59892..62069 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804748.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS 62066..63067 product bifunctional lysozyme/C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769868.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS 63064..63996 product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001224318.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS 64373..66295 product tetracycline resistance ribosomal protection protein Tet(M) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691727.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 gene tet(M) sequence10 source 1..51085 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 263..904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS 1087..2523 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS 2578..2790 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS complement(2897..3688) product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262133.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS 4044..4457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS 4526..5329 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947933.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS 5341..6279 product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948238.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS 6288..7235 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS 7350..8483 product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545405.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS 8470..8796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS 9341..10693 product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355994.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS 11143..12483 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS 12480..13169 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195828.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS 13838..14935 product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943178.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS 15090..15359 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS 15295..15624 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198376.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS 15611..16186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS 16196..16624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS complement(16901..17488) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460653.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 gene pyrE CDS complement(17485..18204) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156274057.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 gene pyrF CDS 18393..19022 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS 19037..19699 product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439345.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 gene deoC CDS 19753..21054 product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896135.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS 21065..21460 product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230049.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS complement(21500..22318) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815192.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS complement(22461..23363) product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425747.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS 23606..24550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS 24552..25331 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS 25464..25835 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812106.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS 25837..27084 product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814309.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS 27232..27882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS complement(27888..28040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS complement(28098..29297) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243467.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 tRNA complement(29356..29446) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 CDS complement(29400..29945) product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545402.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 gene tadA CDS 30029..30655 product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979664.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS 30804..32618 product DUF4127 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393817.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS 32635..33750 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395264.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS 34036..34893 product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411084.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 gene dat CDS 34949..35995 product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047863666.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 gene metN CDS 35976..36629 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388547.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS 36639..36935 product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830443.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS 37001..37795 product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366895.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS 37807..38574 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257740.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS 38701..39552 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS 39575..39919 product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528816.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS 40036..40455 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938185.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS 40448..41251 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317207.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 gene racE CDS 41264..41803 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS 41816..42466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392507.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS 42662..44374 product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022839.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS 44364..45788 product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392504.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS 45952..46707 product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246039.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS 46709..47284 product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815943.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS 47351..47848 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645445.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS 47926..48708 product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461599.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 gene speD CDS 48997..50202 product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948019.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 tRNA 50583..50659 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA 50670..50743 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 tRNA 50845..50921 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 sequence11 source 1..31731 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 738..1469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS complement(1450..2196) product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392794.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 gene ubiE CDS 2543..3763 product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811470.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 gene sstT CDS 4010..5527 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021657.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS complement(5717..6373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS complement(6501..7622) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002989837.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS complement(7849..8886) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS complement(9107..9250) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS complement(9439..10848) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867488.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS complement(11104..12207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS complement(12240..12617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS complement(12618..15137) product trimeric autotransporter adhesin BpaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199699.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 gene bpaE CDS complement(15664..16686) product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016387.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS complement(16673..17416) product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494307.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 gene pxpB CDS complement(17491..18687) product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016389.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS complement(18830..19597) product LamB/YcsF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016390.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS complement(19779..20426) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939368.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 gene thiE CDS complement(20430..21065) product sulfur carrier protein ThiS adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584006.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 gene thiF CDS complement(21078..22178) product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393166.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 gene thiH CDS complement(22188..22958) product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393165.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS complement(22960..23157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS complement(23181..24485) product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047970.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 gene thiC CDS complement(24749..26902) product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775500.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS complement(27203..28399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS 28994..29854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18610 note possible pseudo, frameshifted CDS complement(30240..30974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS complement(30987..31544) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18630 sequence12 source 1..1504 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 18..1486 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 sequence13 source 1..2652 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence14 source 1..1603 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(161..246) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 tRNA complement(259..334) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 tRNA complement(356..431) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 CDS 767..1387 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18640 sequence15 source 1..1180 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 254..330 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 tRNA 461..536 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 CDS 980..1099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18650 sequence16 source 1..1071 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(32..970) product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055164393.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 sequence17 source 1..1002 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 727..921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18670 sequence18 source 1..752 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(146..616) product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966797.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 gene tnpA sequence19 source 1..673 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(286..361) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 tRNA complement(372..448) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 sequence20 source 1..623 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 193..480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18690