COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..570379 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(295..1599) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014341.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 gene tyrS CDS complement(1612..2262) product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895202.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS complement(2263..2436) product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861608.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS complement(2493..3932) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014337.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 gene argH CDS complement(3978..5177) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858678.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS complement(5227..5709) product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858683.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS complement(5714..6655) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014335.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 gene argF CDS complement(6662..7867) product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014334.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS complement(7926..8819) product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858695.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 gene argB CDS complement(8841..10049) product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014333.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 gene argJ CDS complement(10046..11095) product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858698.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 gene argC CDS complement(11236..12087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS complement(12115..14607) product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014330.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 gene pheT CDS complement(14640..15689) product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011897202.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 gene pheS CDS complement(15788..16618) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858706.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS complement(16796..17179) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776197.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 gene rplT CDS complement(17257..17451) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858721.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 gene rpmI CDS complement(17528..18079) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014321.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 gene infC CDS 18930..20894 product DUF2339 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112452.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(20896..23748) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014319.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 gene uvrA CDS 23888..24595 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227876.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS 24762..25631 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014318.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS 25766..28282 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208400581.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS 28317..29411 product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013610.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS complement(29496..29936) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014315.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS complement(30069..32201) product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020948572.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 gene uvrB CDS 32231..32512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS 32538..33419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS 33489..34457 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223406.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS 34482..35330 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS 35448..36692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS 36689..37285 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228375.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS 37339..38073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS complement(38066..40666) product bifunctional lysylphosphatidylglycerol flippase/synthetase MprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674838.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 gene mprF CDS complement(40746..42131) product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014014.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS 42325..43515 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013907.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS complement(43567..44187) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014305.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 gene coaE CDS complement(44221..45324) product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878423.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS complement(45690..47153) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014303.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 gene rpsA CDS complement(47437..50067) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014298.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 gene polA CDS 50527..51117 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227507.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS 51315..52292 product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014292.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 tRNA 52343..52417 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS 52667..52876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS complement(52860..53150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00440 note possible pseudo, frameshifted CDS complement(53194..53751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00450 tRNA complement(53827..53912) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS complement(53974..54273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS complement(54603..54932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS complement(54934..55515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS complement(55697..55906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS complement(56354..56944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00500 note possible pseudo, internal stop codon, frameshifted CDS complement(56960..57112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS complement(57315..58586) product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761151.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS 58895..60214 product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015562.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS 60434..61327 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014291.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS 61328..62308 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858824.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS 62309..63082 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858826.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS complement(63132..63881) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857192.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS complement(63990..65333) product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856385.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 gene gdhA CDS complement(65589..65972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS 66084..67433 product DUF4921 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014867.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS 67480..68757 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014868.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS complement(68881..70296) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014873.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 gene pyk CDS complement(70330..71253) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014874.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 gene lgt CDS complement(71261..72040) product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224169.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 gene trpA CDS complement(72041..73276) product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016721143.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 gene trpB CDS complement(73478..74284) product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894608.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 gene trpC CDS complement(74289..74939) product TIGR02234 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014875.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS complement(74947..76524) product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894606.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS complement(76602..77000) product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014876.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 gene hisI CDS complement(76997..77773) product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856413.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 gene hisF CDS complement(77857..78669) product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861968.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS complement(78772..79506) product bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114402.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 gene priA CDS complement(79655..80353) product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014877.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 gene hisH CDS 80542..81165 product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087078053.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS complement(81273..82694) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856421.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS complement(82695..82907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS 82846..83109 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS 83679..84161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00780 note possible pseudo, internal stop codon, frameshifted CDS 84694..85359 product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703862.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS complement(85370..86008) product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861983.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 gene hisB CDS complement(86054..87196) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014880.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS complement(87196..88548) product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014881.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 gene hisD CDS 88845..90551 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS 90592..92418 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS 92469..93044 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS complement(93079..93960) product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898939.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 gene nadC CDS complement(93967..95289) product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111211.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS 95221..95517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS complement(95537..96613) product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224102.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 gene nadA CDS complement(96906..97556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(97560..97862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013366.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS complement(97849..98856) product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057907.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 gene bioB CDS 99054..99716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS complement(99757..101121) product Na+/H+ antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225704.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(101211..101570) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS complement(101642..101947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS complement(101947..103560) product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081020.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS complement(103584..105008) product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261303.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 gene oadA note possible pseudo, frameshifted CDS 105355..107496 product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014885.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 gene glgX CDS complement(107793..108035) product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389772.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS 108359..110002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS 110116..112578 product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014893.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 gene treY CDS 112583..113734 product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856459.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS complement(114075..114341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS 114473..115219 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877685.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS complement(115226..115918) product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014898.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS 116056..117972 product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856468.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 gene treZ CDS complement(117982..121695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014856.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS complement(121802..123097) product threonine ammonia-lyase IlvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862033.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 gene ilvA CDS complement(123154..126711) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856475.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 gene dnaE CDS 126957..127121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS 127201..128490 product amino acid deaminase/aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222035.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS 128487..129914 product D-arabinono-1,4-lactone oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222034.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS complement(129911..130879) product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014902.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 gene rarD CDS complement(131000..131725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014908.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS complement(131722..132705) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856488.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS complement(132702..133271) product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856491.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 gene lspA CDS 133581..134390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014909.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS complement(134559..135338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS 135430..136431 product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860401.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS complement(136433..137095) product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031718.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS complement(137175..138641) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014912.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS complement(138657..141917) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014916.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 gene ileS CDS complement(142338..143369) product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860384.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS complement(143750..144049) product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014917.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS complement(144113..144634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS complement(144757..145479) product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014919.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 gene pgeF CDS complement(145486..146883) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014920.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 gene ftsZ CDS complement(147075..147851) product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228035.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS complement(147856..149349) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066569796.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 gene murC CDS complement(149363..150535) product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228037.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 gene murG CDS complement(150540..152348) product putative peptidoglycan glycosyltransferase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014922.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS complement(152341..153819) product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014923.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 gene murD CDS complement(153816..154922) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014924.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 gene mraY CDS complement(154923..156449) product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014925.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS complement(156582..158156) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856539.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(158295..160223) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014926.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS complement(160151..160333) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS complement(160547..161341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS complement(161407..162447) product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860361.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 gene rsmH CDS complement(162707..163138) product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856549.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 gene mraZ CDS complement(163848..164384) product DUF3040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411231.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS complement(164522..165013) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS 165256..165807 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895631.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS 165857..166462 product DUF3153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877979.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS complement(166466..167392) product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014930.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 gene metF CDS 167352..167522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS 167519..168631 product geranylgeranyl pyrophosphate synthase IdsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856555.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 gene idsA CDS 168650..170350 product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224197.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 gene crtI CDS 170437..172053 product alpha-(1->6)-mannopyranosyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856557.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS 172060..173040 product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225923.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS complement(173069..173434) product Rv2175c family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856558.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS 173523..175895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS complement(175968..177353) product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856581.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS complement(177422..177913) product polyadenylate-specific 3'-exoribonuclease AS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856583.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS complement(178065..178856) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014941.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS complement(178958..179971) product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014942.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS complement(179981..181135) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086655.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS complement(181189..182289) product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014944.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS complement(182606..183184) product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014945.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS complement(183212..183397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS 183698..185344 product DEDD exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124712239.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS complement(185341..186408) product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224077.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 gene trpD CDS 187015..187560 product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014948.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS 187636..188526 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172768931.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS 188523..189734 product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014946.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS 189731..191359 product cytochrome bc1 complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856609.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 gene qcrB CDS 191528..193255 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226759.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS complement(193358..193804) product cytochrome c oxidase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014950.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS complement(193840..195015) product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014951.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS 195516..197441 product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014952.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 gene asnB CDS complement(197623..197964) product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895666.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS 198279..199043 product DUF3043 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856624.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS 199056..199649 product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856625.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS 199752..200789 product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014954.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 gene cobT CDS 200795..201667 product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014955.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS complement(202246..204120) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010190197.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS complement(204610..205725) product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014956.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS 205947..207485 product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856630.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS 207659..209701 product 2-oxoglutarate dehydrogenase, E2 component, dihydrolipoamide succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014958.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 gene sucB CDS 210267..211892 product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411694.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS 212026..212829 product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856633.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 gene lipB CDS 212839..213897 product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856634.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 gene lipA CDS 213992..214771 product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859641.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS 215000..216655 product aspartate:alanine exchanger family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859640.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS complement(216673..217191) product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856936.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS 217337..217570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS 217596..219032 product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014960.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 gene glnA CDS complement(219029..219256) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS 219683..220447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01900 note possible pseudo, internal stop codon CDS 220609..222066 product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014960.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 gene glnA CDS 222239..222433 product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084324.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS 222485..222775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS 223085..223711 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS complement(223809..224426) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015424.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS complement(224479..225366) product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014114.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS 225659..227779 product glucose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390207.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS 227821..229104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS 229193..230884 product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231021.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 gene ptsP CDS 231350..232753 product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015030.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 gene brnQ CDS 232846..234078 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015579.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS 234202..235650 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014964.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 gene thrC CDS complement(235780..235950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS complement(236093..236221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS 236480..237568 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS 237646..239073 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856952.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(239103..241325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS complement(241424..244570) product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014971.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS complement(244663..246054) product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856962.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS 246144..246953 product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085258.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 gene panB CDS 247116..248942 product CYTH and CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856966.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS complement(248955..249158) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856969.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS 249435..250598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS complement(251134..251823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS complement(251824..252567) product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411501.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS complement(252573..253760) product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014977.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS complement(253830..254963) product Rv2231c family pyridoxal phosphate-dependent protein CobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005129968.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 gene cobC CDS 254999..255679 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856980.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS 255733..256251 product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856982.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS complement(256248..256829) product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858634.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS 257105..258091 product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856984.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS complement(258088..258993) product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296485.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS complement(259049..259678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02230 tRNA complement(259725..259797) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS complement(259921..260331) product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859595.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS 260608..263364 product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014985.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 gene aceE CDS 263364..263723 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS complement(263699..264322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS complement(264591..265445) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857011.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS complement(265456..266832) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015206.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS complement(267153..268778) product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777012.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 tRNA 269075..269149 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS complement(269108..270040) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338319.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS complement(270040..270216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS complement(270420..270866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS complement(270859..271668) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS complement(271661..272185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS complement(272178..272447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS complement(272554..272928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS 273109..273528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS complement(273499..274848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS 274993..275250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS complement(275500..276072) product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025862458.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS 276161..277165 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014310.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS complement(277235..277867) product ABC transport system MusEFGK2I component MusI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860887.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 gene musI CDS complement(277983..278897) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015137.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS complement(278898..279743) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567523.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS complement(279923..281323) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015138.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS complement(281733..282956) product DUF4032 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015139.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS complement(283018..284154) product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015140.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 gene ugpC CDS complement(284252..285526) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088595.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS complement(285708..287006) product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776542.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS 286957..287115 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS complement(287141..287857) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776543.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS 287984..288778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS 288775..289500 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974351.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS 289622..291142 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015386.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS complement(291328..291684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS 291671..291883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS 292061..292534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02580 tRNA complement(293281..293353) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS 293638..294795 product S-(hydroxymethyl)mycothiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729747.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS 294792..295424 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013561.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS complement(295474..297423) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857029.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 gene dnaG CDS 297526..298044 product ribonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857030.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS complement(298049..299341) product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015002.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS 299388..301403 product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015004.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS complement(301412..301828) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(301816..302385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS complement(302385..303770) product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857047.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS 303961..304455 product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015007.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS complement(304486..305208) product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015010.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS complement(305237..305986) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859464.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 gene recO CDS complement(305991..306950) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015011.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 gene era CDS complement(306937..308265) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859459.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS complement(308262..308795) product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015012.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 gene ybeY CDS complement(308812..309840) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015013.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS complement(309853..310632) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900509.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS complement(310677..311807) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015015.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 gene dnaJ CDS complement(311810..312847) product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859450.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 gene hrcA CDS complement(312857..314020) product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015017.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 gene hemW CDS complement(314017..314703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859444.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS complement(314928..316760) product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859440.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS 316915..319134 product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015019.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 gene malQ CDS complement(319493..319708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS complement(319784..321940) product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015021.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS 321939..323213 product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484272.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS 323438..323926 product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860754.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS 323927..325306 product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013786.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS 325414..327225 product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897929.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 gene treS CDS 327258..328610 product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731333.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS 328671..330587 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015020.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS complement(330645..331604) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729742.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS 331830..333524 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296700.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS 334210..335793 product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729740.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS 335891..337042 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015029.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS complement(337051..338409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS complement(338690..339556) product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892338.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS complement(339743..340360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS complement(340360..340692) product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405871.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS 340790..341344 product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013406.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS complement(341407..342114) product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975893.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS 342286..343272 product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014113.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS complement(343276..343812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS complement(343893..345386) product GuaB1 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015302.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS 345479..346729 product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860838.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS 346826..347698 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854943.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS 347995..348519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS 348645..349817 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112837.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS 349964..350848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS complement(350947..351441) product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014075.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 351813..352088 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS 352380..352688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS 352975..353508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03110 note possible pseudo, internal stop codon CDS 353509..354696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03120 note possible pseudo, internal stop codon CDS 355055..355180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS 355191..355721 product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063706.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS 356099..356245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS 356328..356687 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776291.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS 356684..358576 product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776290.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS 358781..358945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS complement(359487..359729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03190 note possible pseudo, internal stop codon, frameshifted CDS complement(359750..359968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03200 note possible pseudo, internal stop codon, frameshifted CDS complement(360254..361054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03210 note possible pseudo, frameshifted CDS complement(360993..362240) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03220 note possible pseudo, frameshifted CDS 362250..362489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS complement(362503..362829) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS complement(362944..363732) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03250 note possible pseudo, frameshifted CDS complement(363746..364072) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03260 note possible pseudo, frameshifted CDS complement(364069..364791) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015530.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS 365196..365771 product CueP family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015531.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS 365842..367323 product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859486.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS 367474..367755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03300 note possible pseudo, internal stop codon, frameshifted CDS 367831..368040 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03310 note possible pseudo, internal stop codon, frameshifted CDS 368086..368325 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03320 note possible pseudo, frameshifted CDS 368298..368483 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS complement(368821..369108) product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776288.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS 369343..369471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03350 note possible pseudo, internal stop codon CDS complement(369515..369904) product hypoxia response transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900026.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS 370003..371427 product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296234.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 gene merA CDS 371415..371774 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS complement(371862..372176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS complement(372360..373439) product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014061.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 gene ychF CDS 373534..375084 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015391.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS 375230..376318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS 376426..377661 product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014055.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 gene xseA CDS 377723..378013 product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856839.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS complement(378132..378719) product DUF4245 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014052.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS 379132..380157 product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856830.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 gene glpX CDS 380318..381718 product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856814.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS 381983..382648 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013614.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS 382638..384236 product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859734.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS complement(384267..384899) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014038.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS complement(384964..385716) product LysR family transcriptional regulator substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014037.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS 385736..386149 product DUF5997 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856795.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS 386192..386965 product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223755.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 gene pcaD CDS 387602..388774 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524568.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS 389071..390681 product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856850.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS 390687..390854 product methionine/alanine import NSS transporter subunit MetS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014058.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 gene metS CDS complement(390897..391655) product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222968.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS 391736..392293 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035710.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS 392429..393682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS complement(393754..395055) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856790.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 gene glyA CDS 395205..396140 product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856789.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 gene coaA CDS complement(396171..396956) product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856785.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS complement(396995..398086) product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014031.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS complement(398407..398691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS complement(398719..399522) product mycothiol conjugate amidase Mca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014030.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 gene mca CDS 399835..400302 product DUF4307 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856773.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS 400476..400988 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059312.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 gene greA CDS complement(401018..401236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS complement(401314..402141) product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014027.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS 402379..402711 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS 402783..404366 product succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015326.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 tRNA complement(404431..404505) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS complement(404518..405507) product exopolyphosphatase Ppx2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568167.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 gene ppx2 CDS complement(405508..406044) product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014021.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS complement(406172..406717) product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014020.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS complement(406821..408095) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856756.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 gene eno CDS complement(408181..409041) product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014019.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS complement(409113..410138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS complement(410146..413793) product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856733.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 gene mfd CDS complement(413817..414482) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014009.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 tRNA 414610..414681 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS 414768..416258 product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013993.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 gene glmU CDS 416266..417243 product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860060.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS 417495..418136 product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013990.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS 418281..418889 product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059133.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 gene pth CDS complement(419120..420853) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031834.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS complement(420850..422628) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485997.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS complement(422625..423383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS complement(423416..424153) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS complement(424150..424902) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221978.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS complement(424899..425918) product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221977.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS complement(425915..427093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS complement(427086..433418) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS complement(433429..435201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS complement(435376..437577) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776331.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS complement(437685..438326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS 438822..439649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03950 note possible pseudo, internal stop codon, frameshifted CDS complement(440017..441468) product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013988.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS 441652..442545 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858506.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS 442654..444300 product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013982.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS 444368..446068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS complement(446065..446724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS complement(446735..447454) product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013360.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 gene pnuC CDS 447722..448525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS 448577..449533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS complement(449570..450697) product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013973.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS complement(450788..451693) product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013972.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 gene ppk2 CDS complement(451777..452679) product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858086.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 gene ftsX CDS complement(452728..453417) product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858089.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 gene ftsE CDS 454045..455211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS complement(455214..456326) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863507.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 gene prfB CDS 456374..457234 product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013899.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS 457245..458045 product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013898.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 gene hisN CDS complement(458088..458426) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013515.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS complement(458438..458749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS 458742..459566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS 459582..460010 product low molecular weight phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014415.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS complement(460007..460504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS 460724..461680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS 461683..462756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS complement(463631..464863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS 464995..465405 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS 465547..465774 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS 465771..468881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS 469064..469537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS 469534..469911 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS 470187..470549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS 470530..472140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS 472178..472654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS complement(472824..474383) product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011897243.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS 474553..474957 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487415.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 tRNA complement(475291..475367) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS complement(475568..478555) product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013886.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS 478707..479288 product PPA1309 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858126.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS 479556..480395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04320 tmRNA complement(480771..481153) product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(481255..481758) product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858084.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 gene smpB CDS 481939..483582 product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262003.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS 483746..484513 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS 484534..485496 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014254.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS complement(485526..487355) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013968.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS complement(487339..487854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS complement(487887..488792) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013966.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 gene rsmA CDS complement(488857..489996) product resuscitation-promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858490.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS complement(490174..490998) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013965.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS complement(491014..492840) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013952.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 gene metG CDS 492967..494208 product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003905428.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS complement(494205..495794) product glycine betaine transporter BetP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265645.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 gene betP CDS complement(496042..496896) product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858478.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 gene rsmI CDS 496979..498535 product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013949.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS complement(498532..499314) product zf-HC2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858471.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS complement(499366..499848) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006286612.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS complement(500007..501278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858464.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS complement(501452..501976) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104413.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS complement(502115..503386) product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858461.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS complement(503483..504457) product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858460.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS 504591..505265 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109765.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS 505455..505916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS 506168..506584 product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013943.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 gene mscL CDS complement(506644..506862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS complement(506865..507410) product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858456.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS complement(507505..508824) product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013942.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS complement(508983..510539) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082904.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS complement(510539..511240) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063392.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS complement(511471..511644) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858448.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 gene rpmF CDS complement(511666..511932) product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858446.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS 512408..512644 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858441.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 gene rpmB CDS 512647..512811 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858439.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 gene rpmG CDS 512815..513120 product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013938.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 gene rpsN CDS 513135..513386 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858407.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 gene rpsR CDS 513552..514487 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859408.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS 514542..515267 product TIGR03089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013855.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS 515321..516931 product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285120.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS complement(516959..517504) product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858249.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 gene purE CDS complement(517566..518855) product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013836.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS complement(518886..519347) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059288845.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS complement(519354..520211) product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080805.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS 520431..521978 product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013833.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS 522084..523712 product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863615.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS 523709..523969 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS complement(524112..524648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS complement(524651..524863) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262994.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS complement(524894..525100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS 525021..525623 product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013831.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS complement(525690..526748) product Cj0069 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013828.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS 527113..527997 product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893199.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS 528430..530205 product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013826.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS 530312..530722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013824.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS complement(530753..531601) product precorrin-6A synthase (deacetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109722.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 gene cobF CDS complement(531552..531833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862386.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 tRNA 532109..532182 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS complement(532211..533428) product IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209912946.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 533823..534680 product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014229.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS complement(534695..535273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS complement(535600..535815) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS 535913..536191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS complement(536380..537552) product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223708.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 gene gcvT CDS complement(537832..539484) product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013917.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS complement(539487..539864) product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803959.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS complement(539830..540093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS complement(540094..542547) product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730674.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS complement(542589..543341) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063562.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS complement(543403..544269) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893773.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS 544461..544676 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230147.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS 544679..545248 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS 545314..546219 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230149.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS 546216..547481 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230150.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS complement(547574..548560) product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068827.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS 548669..550150 product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013915.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS complement(550324..550683) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897079.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS complement(550899..552194) product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013914.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS 552919..554055 product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013913.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 gene serC CDS 554279..555403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS 555419..556324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858320.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS complement(556328..557200) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862361.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS complement(557210..558724) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265630.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS complement(558881..559522) product DUF3027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104387.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS 559996..560757 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05130 note possible pseudo, frameshifted CDS 560880..561374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS complement(561446..561877) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858310.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 562748..563368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS complement(563685..563873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063648.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS 563948..566464 product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013909.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS 566613..568316 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858302.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS 568342..568983 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS complement(569115..570284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05210 sequence02 source 1..1067 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 166..315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS 531..680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS 744..929 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05240 sequence03 source 1..538405 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 123..596 product DUF2550 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093041.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS 674..1366 product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014205.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 gene nucS CDS complement(1363..1668) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS complement(1731..2183) product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014207.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 gene mce CDS 2215..2520 product thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854825.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS 2805..3653 product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014209.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS complement(3689..4084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS 4420..5592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS complement(5721..7916) product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014214.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 gene glgB CDS complement(8097..10127) product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014215.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS 10269..11105 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014216.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS 11112..11951 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230560.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS 12005..13189 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014217.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS 13527..14312 product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415921.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS 14367..15311 product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877364.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS 15624..16697 product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014220.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS 16827..17948 product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861382.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 gene mnmA CDS 18054..19016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014226.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS complement(18949..19635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS 19774..22029 product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030524.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS complement(22079..22759) product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861387.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS 22855..24975 product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014227.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 gene ligA CDS complement(24972..27338) product maltodextrin phosphorylase MalP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858869.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 gene malP CDS complement(27466..28131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861389.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS 28359..28652 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854761.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 gene gatC CDS 28659..30182 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014228.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 gene gatA CDS 30334..31365 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031517.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS 31366..32166 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092173.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS 32177..33301 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705828.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS 33355..34386 product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854754.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS 34557..35993 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014119.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS complement(36020..36853) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014360.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS 36907..38415 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854737.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 gene gatB CDS complement(38428..39510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS 39572..40951 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014243.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS 41207..41911 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS complement(41927..43771) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854128.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 gene ilvD CDS complement(43906..44439) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS complement(44497..46161) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096455574.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS 46209..46424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS 46529..48439 product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014246.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS 48474..48977 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006286979.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 gene ilvN CDS 49031..50047 product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854117.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 gene ilvC CDS 50329..52053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014256.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS 52293..53888 product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854094.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 gene serA CDS complement(53987..55489) product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015219.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS complement(55641..56717) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013819.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS 56989..58521 product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015219.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 58724..60247 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS 60305..61339 product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014258.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS complement(61385..61969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS 61868..62095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS 62100..63974 product cyclic nucleotide-binding/CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014260.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS 64008..64595 product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014261.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS 64661..65449 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861462.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS complement(65446..66678) product isochorismate synthase MenF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014263.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS complement(66735..67466) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228695.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS 67495..68169 product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804445.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS 68227..69714 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020447895.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 gene gltX CDS complement(69698..71062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05840 tRNA 71303..71375 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 tRNA 71424..71497 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 tRNA 71527..71599 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 tRNA 71650..71723 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS 71799..72578 product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS 72578..73360 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974283.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 tRNA 73445..73518 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS 73646..74602 product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966817.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS 74673..75869 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406347.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS complement(75776..76201) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243700.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS complement(76185..77099) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977210.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS 77232..78107 product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066568686.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS 78160..78747 product glutamine ABC transporter ATP-binding protein GlnQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210237.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 gene glnQ CDS 78744..79388 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS 79385..80593 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420953.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS 80665..82131 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031070.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS 82128..83819 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031071.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS complement(83816..85000) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077087.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS complement(85000..85725) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728309.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS 85791..87218 product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005105840.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 gene leuC CDS 87271..87861 product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893754.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 gene leuD CDS 87909..89300 product 3' terminal RNA ribose 2'-O-methyltransferase Hen1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172865.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS 89303..91771 product polynucleotide kinase-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030575.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS complement(91776..92759) product bifunctional NUDIX hydrolase/histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858854.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS 92869..93867 product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858849.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 93903..95006 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014285.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS complement(95017..95997) product DUF3515 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014286.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS 96109..97065 product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858840.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS 97103..97768 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893765.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS 97775..99301 product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858835.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS 99306..101456 product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014290.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS 101481..101753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS 101754..102320 product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858829.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 gene rsmD CDS 102366..102839 product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858828.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 gene coaD CDS 102850..103611 product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861943.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS 103641..104201 product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861940.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS 104244..104972 product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861938.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 gene rnc CDS 104972..105835 product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087736.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 gene mutM CDS 105845..107314 product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863416.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 107304..107585 product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414811.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 107843..109159 product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014854.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS 109248..112742 product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014857.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 gene smc CDS 112790..114358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS complement(114531..115262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS complement(115786..116625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS 117231..118826 product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014851.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 gene ffh CDS complement(118843..120993) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013830.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS 121292..121774 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS 121897..122412 product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014847.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 gene rimM CDS 122409..123296 product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050816932.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 gene trmD CDS 123296..123943 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS complement(123903..124397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS 124480..126798 product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014841.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS complement(126825..127883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS 128033..129436 product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096457649.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS 129576..129917 product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014838.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 gene rplS CDS 129992..130789 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014836.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 gene lepB CDS 130866..131483 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034982719.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS 131538..131840 product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857573.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS 132051..132473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS 132474..134006 product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014834.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS 134037..135173 product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861752.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 gene dprA CDS 135302..136318 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728395.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS complement(136315..136533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS 136718..136909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS 137189..138034 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014831.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 gene rpsB CDS 138090..138917 product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014830.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 gene tsf CDS 139094..139825 product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006284182.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 gene pyrH CDS 139909..140466 product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014829.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 gene frr CDS 140506..141411 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857552.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS complement(141433..141870) product DUF1049 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031512220.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS 142024..143076 product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861738.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 gene rlmN CDS complement(143178..143579) product DUF2631 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857542.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS 143894..145027 product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014824.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS 145069..146934 product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857527.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS 147003..147914 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172769613.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 gene map CDS 147918..149384 product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093851.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS complement(149381..150805) product mycothione reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014816.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 gene mtr CDS complement(150875..151915) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857515.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS 152081..153577 product malate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014814.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 gene mqo CDS 153665..154822 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06600 note possible pseudo, frameshifted CDS 154929..155606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06610 note possible pseudo, frameshifted CDS 155542..156207 product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893997.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 gene cobO CDS 156201..157577 product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728476.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS 157588..158679 product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893999.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 gene cobA CDS 158672..158953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS complement(158950..159687) product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014808.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 gene yaaA CDS 159748..161520 product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857500.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS complement(161517..162482) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS 162584..163156 product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014804.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 gene rimP CDS 163153..164139 product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861701.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 gene nusA CDS 164311..164703 product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014803.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS 164833..167670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS 167691..168419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS 168875..169306 product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861694.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 gene rbfA CDS 169349..170410 product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296638.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS 170415..171791 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011897397.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS 171788..172483 product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031096.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS complement(172500..173486) product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014799.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 gene truB CDS 173551..174546 product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014798.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS 174688..174957 product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857482.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 gene rpsO CDS 175463..177730 product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014796.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS 177889..178845 product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230161.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS 179134..180789 product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804055.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS 180806..181087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS 181097..183508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS complement(183536..185002) product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015308.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS 185161..185943 product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014794.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 gene dapB CDS 185964..186716 product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014793.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 gene thyX CDS 186775..187680 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014792.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 gene dapA CDS 187680..189779 product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014791.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS 189869..190486 product TIGR03085 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028115.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS 190832..193888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS 194125..195258 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014789.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS 195290..195856 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857464.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 gene pgsA CDS 195881..196423 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS 196475..196909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS 197051..197878 product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857458.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS complement(197884..198504) product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857456.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS complement(198501..199202) product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014785.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS complement(199236..199844) product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857452.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 gene bioY CDS 199933..200166 product DUF3046 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728536.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS 200471..201574 product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857444.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 gene recA CDS 201618..202226 product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857439.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 gene recX CDS 202408..203880 product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857429.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 gene miaB CDS 203858..204622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS complement(204792..206027) product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014775.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS 206000..206134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS 206330..207022 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS 207066..207992 product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014773.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 gene miaA CDS 207982..208947 product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014772.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 gene dapF CDS complement(209008..209787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014770.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS 210068..210325 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS 210541..212355 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS 212851..214404 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857415.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 gene hflX CDS 214441..215784 product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014768.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS complement(215876..216148) product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857409.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS complement(216289..218448) product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726656.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS complement(218484..219455) product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014765.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS complement(219452..220231) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014761.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS complement(220325..221026) product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857389.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 gene lexA CDS 222030..222374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS complement(222371..226426) product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014759.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 gene hrpA CDS complement(226520..227452) product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015551.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS complement(227514..229016) product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015555.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS 229463..231334 product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900995.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS 231478..232695 product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014758.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS complement(232821..233345) product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064032.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS complement(233351..233947) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730169.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS 234053..234985 product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014757.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS complement(235061..237595) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006286432.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS complement(237623..238840) product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859825.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS 239070..240182 product DUF4192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066566054.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS complement(240209..241192) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014754.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 gene galE CDS complement(241189..241869) product iron dependent repressor, metal binding and dimerization domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014753.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS complement(242174..243163) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014752.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS complement(243300..243734) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859832.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 gene dtd CDS complement(243735..245300) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014751.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS complement(245339..245878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS 246053..246301 product DUF3039 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005389816.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS 246298..248043 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859837.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS 248083..248523 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS 248806..250413 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427574.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS complement(250826..252397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS complement(252794..253549) product polyphosphate glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014747.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 gene ppgK CDS 253584..254561 product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908081.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS 254761..254991 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS 255384..255680 product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857344.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS complement(255790..256341) product DUF3093 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859852.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS 256433..256885 product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014744.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 gene dut CDS 257004..257783 product DUF3710 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014743.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS 257918..259183 product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014742.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS complement(259184..260485) product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014740.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS complement(260526..261116) product DUF3000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014739.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS 261251..262360 product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265560.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 gene hemE CDS 262466..263944 product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013650.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS 264031..264729 product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057294.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS complement(264821..265246) product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857328.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 gene msrB CDS complement(265239..266387) product arabinofuranan 3-O-arabinosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014737.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 gene aftC CDS complement(266639..267316) product pyrimidine reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014736.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS 267555..268052 product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777051.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 tRNA complement(268374..268447) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 tRNA complement(268475..268549) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 tRNA complement(268615..268688) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 tRNA complement(268716..268790) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA complement(268822..268893) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 tRNA complement(268959..269032) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA 269392..269466 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS 269652..270242 product copper resistance protein CopC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855865.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS 270247..270855 product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014526.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS 271133..272368 product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859878.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS 272462..274522 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855874.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 gene thrS CDS 274631..275308 product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031511750.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS 275302..276003 product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859882.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS 276015..276917 product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014523.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS 276920..278062 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859886.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS 278116..278619 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855892.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 278759..279661 product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070939476.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 gene pdxS CDS 279664..280542 product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014521.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS 280542..281162 product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111403.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 gene pdxT CDS 281242..281994 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014520.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS complement(282151..282615) product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804014.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS 282731..283288 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS 283371..283991 product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859897.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 gene ruvA CDS 284058..285170 product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855899.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 gene ruvB CDS 285237..285701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS 286011..287936 product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855902.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 gene secD CDS 287943..289160 product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014516.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 gene secF CDS 289271..289807 product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014514.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS 289815..292076 product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855910.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS complement(292199..293038) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014511.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS 293680..294351 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014510.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS 294395..295678 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014509.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 gene hisS CDS complement(295706..296593) product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014499.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS 296877..298706 product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014498.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 gene aspS CDS 298854..300035 product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014497.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS 300043..301509 product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855936.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 301638..304298 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014496.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 gene alaS CDS 304336..304839 product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014495.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 gene ruvX CDS 305098..306324 product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014494.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 gene mltG CDS 306339..307154 product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014493.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS 307181..307792 product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111373.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS 307848..309074 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855968.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 gene aroC CDS 309115..309636 product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855969.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS 309724..310830 product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014486.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 gene aroB CDS 310830..311306 product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204041.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 gene aroQ CDS 311303..312475 product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014485.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS 312564..313127 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855973.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 gene efp CDS 313176..313880 product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014484.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 gene nusB CDS 314132..314701 product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862208.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 gene pyrR CDS 314698..315651 product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862210.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS 315652..317013 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014479.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS 317100..318284 product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014478.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 gene carA CDS 318309..321668 product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862217.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 gene carB CDS 321670..322539 product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014477.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 gene pyrF CDS 322959..323285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS 323291..323863 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855988.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 gene gmk CDS 323981..324259 product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855993.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 gene rpoZ CDS 324287..325567 product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014475.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 gene coaBC CDS 325686..326903 product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856000.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 gene metK CDS 326953..328989 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014474.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS 329050..329553 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856004.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 gene def CDS 329651..330625 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862229.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 gene fmt CDS 330626..332083 product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014473.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS 332095..332763 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014472.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 gene rpe CDS 332780..333832 product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082329.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 gene ribD CDS 333903..334490 product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057751.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS 334502..335764 product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856016.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS 335765..336247 product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856018.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 gene ribH CDS 336250..336744 product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014469.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS 336774..338822 product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014468.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 gene uvrC CDS 338935..339825 product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856023.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 gene rapZ CDS 340017..340796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS 340988..341986 product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057788.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 gene whiA CDS 342134..343174 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862250.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 gene gap CDS 343285..344496 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862252.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 gene pgk CDS 344551..345354 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014466.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 gene tpiA CDS 345557..348385 product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014465.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 gene ppc CDS 348477..348713 product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014464.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 gene secG CDS complement(348831..349598) product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862263.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 gene pgl CDS complement(349595..350611) product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014458.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS complement(350662..352266) product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856051.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 gene zwf CDS 352401..352763 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804331.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS 352760..353479 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS 353476..354195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS complement(354410..355534) product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856053.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 gene tal CDS complement(355705..357804) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856055.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 gene tkt CDS 358068..359009 product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211271337.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS complement(359429..360232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08410 note possible pseudo, frameshifted CDS complement(360536..361339) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111291.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS complement(361339..362307) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014450.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS complement(362333..364045) product polyprenol phosphomannose-dependent alpha 1,6 mannosyltransferase MptB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265766.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 gene mptB CDS 364259..364957 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862282.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS 364954..366420 product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862284.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 gene sufB CDS 366426..367616 product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014448.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 gene sufD CDS 367710..368471 product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856078.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 gene sufC CDS 368464..369717 product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014447.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS 369738..370253 product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856080.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS 370246..370710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS complement(371117..372502) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114709.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS complement(372679..373887) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS 373908..375539 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014443.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(375536..376294) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227776.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS complement(376287..378563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS complement(378609..379259) product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776999.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS complement(379404..380153) product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014437.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS complement(380296..380862) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075960.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS complement(381086..383872) product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170844367.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 gene can CDS 384240..384749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS 385379..387025 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS 387080..388084 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226781.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS 388084..388932 product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728848.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS 389045..390037 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226779.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS 390154..391212 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014434.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS complement(391253..392110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014433.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS 392176..393030 product DUF3097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014432.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS 393091..393528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS 393620..395002 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014431.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS complement(395007..395579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014430.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS complement(395708..396379) product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856111.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS 396766..398658 product methylmalonyl-CoA mutase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111265.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 gene mutA CDS 398667..400886 product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014427.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 gene scpA CDS 400953..402065 product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014426.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 gene meaB CDS complement(402223..402555) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082150.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS 402744..404237 product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853689.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 tRNA complement(404316..404402) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS 404629..405201 product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856119.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS complement(405340..406440) product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014420.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS complement(406441..407490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208396105.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS complement(407713..408648) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856126.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS 408772..409662 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856127.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS 409681..411063 product cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856128.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 gene mshC CDS 411081..411473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856129.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS 411523..415182 product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014411.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 gene metH CDS complement(415190..416095) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895361.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS 416251..416934 product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014410.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS 416957..417220 product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226745.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS 417235..418080 product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856149.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 gene hisG CDS 418384..419832 product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014409.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 gene aspA CDS 419872..421185 product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095257.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS complement(421364..422296) product RecB family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856159.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS 422358..423200 product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860005.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS 423292..424887 product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086527.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 gene arc CDS 424880..426481 product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014405.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 gene dop CDS 426542..426736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS 426740..428230 product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066565680.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 gene pafA CDS 428273..429304 product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014403.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS 429301..430332 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS 430407..430739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS 430758..431984 product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856179.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 gene tatC CDS 432009..434795 product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014399.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS 434958..435809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS 435879..437495 product long-chain-fatty-acid--CoA ligase FadD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899884.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 gene fadD2 CDS 437543..438658 product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014398.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS 438690..439454 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729389.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS 439451..440677 product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729388.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS 440723..441496 product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075099.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 gene cobM CDS 441484..442224 product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228821.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS complement(442249..442554) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS complement(442535..442834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS complement(442922..443191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS complement(443427..445037) product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086498.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS complement(445041..445691) product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028884.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS complement(445703..446878) product precorrin-3B synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729385.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 gene cobG CDS 447127..448680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS complement(448579..448788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS 448839..452504 product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086495.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 gene cobN CDS 452617..453237 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS 453276..454964 product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014392.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 gene lnt CDS 454977..455792 product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856192.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS complement(456103..456492) product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863735.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS 456631..456963 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS 456981..457691 product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863737.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS 457874..458092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS complement(458370..458564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS 458580..460016 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079373.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS 460020..461057 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777114.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS complement(461122..461619) product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858595.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 gene tpx CDS 461794..462078 product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976675.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS complement(462118..463845) product FAD-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225738.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS complement(463963..465417) product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014384.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS 465604..467025 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863745.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS complement(467118..467690) product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014373.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS 467796..469238 product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856232.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 gene gndA CDS 469286..470899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS 471094..472314 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856236.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS 472318..473703 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014371.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS 473700..474914 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014370.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS 474911..475828 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020309556.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS 475926..477539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS complement(477684..478283) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856248.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS complement(478576..479175) product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863762.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS complement(479221..479907) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856252.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS complement(480051..480476) product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856253.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS complement(480715..482994) product accessory Sec system translocase SecA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014367.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 gene secA2 CDS 483212..483685 product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020948542.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 gene rraA tRNA complement(483767..483841) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS complement(483928..484941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS complement(485112..487421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS complement(487488..488462) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856268.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS complement(488718..489407) product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027666.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 gene bioD CDS complement(489553..490923) product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015243.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS complement(491172..492305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS complement(492702..493316) product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856269.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 gene scpB CDS complement(493490..494332) product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856272.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS complement(494336..495217) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014352.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS complement(495315..496253) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729303.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 gene xerD CDS complement(496250..496903) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014349.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS complement(496952..498472) product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856281.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS complement(498657..498842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS 498924..499478 product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003372548.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS 499519..500277 product LURP-one-related family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015495.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS complement(500333..501448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS 501867..502373 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS complement(502552..503250) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09650 note possible pseudo, frameshifted CDS complement(503247..503465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS complement(503515..504027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09670 note possible pseudo, internal stop codon, frameshifted CDS complement(504062..504535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09680 note possible pseudo, frameshifted CDS 504587..507601 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013860.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS 507611..512170 product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013859.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS 512176..518529 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013858.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS 518553..520898 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006768748.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS complement(521375..523276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS complement(523291..524364) product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760485.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS complement(524380..525288) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS complement(525379..526563) product putative cytokinetic ring protein SteA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014347.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 gene steA CDS complement(526589..528328) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014346.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 gene recN CDS complement(528388..529374) product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856294.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS complement(529367..530206) product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856296.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS complement(530212..530475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS complement(530482..531531) product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014344.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS complement(531632..532828) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS complement(532941..533852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS complement(533897..534655) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013906.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS complement(534652..535668) product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863478.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS complement(535688..536590) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863480.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS complement(536675..537682) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013905.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 sequence04 source 1..516623 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1250..2032) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013466.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS complement(2079..3047) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857646.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS 3519..4787 product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063039.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS complement(4804..5772) product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857642.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 tRNA 5971..6056 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS 6496..7236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS 7229..8125 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS complement(8140..9279) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013481.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 gene hisC tRNA 9491..9582 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 tRNA 9586..9661 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS 10220..13903 product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038431186.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 tRNA 14128..14201 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS 14649..15638 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094369.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS complement(15686..16534) product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888352.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS complement(16544..17491) product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013487.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS 17608..18165 product tRNA adenosine deaminase-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863394.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS 18278..18721 product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056534.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS 18857..19045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS complement(19154..20134) product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015254.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 tRNA 20410..20500 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS 20925..23972 product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013489.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS 24034..25335 product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020309519.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 gene tgt CDS 25440..26477 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015345.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS 26491..27270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS complement(27332..28108) product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863385.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS complement(28223..28498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS 29052..29912 product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013493.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 gene gluQRS CDS complement(29909..30166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS complement(30177..30524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS 30730..31119 product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069385.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS 31221..32426 product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730641.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS 32673..33026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS 33205..34725 product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971329.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 gene amn CDS 34846..36024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS 36062..36271 product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775998.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS 36297..38495 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776000.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS 38499..38846 product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855480.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 tRNA 39045..39131 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS 39304..40443 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899420.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS 40938..41117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS 41152..41292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS 41662..41853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS 41853..42440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS 42563..44092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS complement(44581..44805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS 45158..46498 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222988.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS 46499..47416 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074284.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS 47429..48268 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059671.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS 48287..49444 product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110092.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 gene ugpC CDS 49925..51394 product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011897243.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS 51490..52791 product aspartate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_222431737.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS 52826..53551 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS 53582..56566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS 56680..57003 product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855676.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS 57134..57667 product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013500.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS complement(57724..58536) product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013501.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS complement(58537..59937) product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013502.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS complement(59947..61179) product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013503.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS 61463..62506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS complement(62709..64526) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015439406.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 gene leuA CDS 64915..67488 product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068489.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS 67488..69830 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS complement(69836..70867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS complement(71026..72147) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013505.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS 72688..73953 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855724.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS 73963..75003 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013506.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS 75351..75998 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS 76973..80035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS 80045..80812 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS 80977..81336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS 82141..83625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS 83923..84876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS 84941..85780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS 85780..89013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS complement(89121..89753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886132.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS 90582..91109 product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074067.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS 91175..91372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS 91369..92457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS 92444..92899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS 92896..93447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS complement(93507..94085) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013508.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS complement(94194..95624) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS complement(95611..96348) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140495.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS complement(96358..97461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS 97821..99350 product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013509.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS complement(99507..99863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS complement(100003..100302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS complement(100891..101232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS complement(101257..101547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS complement(101544..102026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS complement(102026..103579) product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211271326.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS complement(103591..104073) product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013520.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS complement(104070..107078) product DUF4040 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013521.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 tRNA complement(107737..107813) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS complement(108019..108954) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013528.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS 108994..109455 product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863321.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS complement(109573..111972) product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013529.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS 112351..112713 product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731112.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS 112785..112946 product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003068074.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS 112991..113467 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897586.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS 113603..114418 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285704.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS complement(115000..115683) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855810.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS 116312..117139 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013539.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 gene nth CDS 117156..117914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS 117911..118765 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS 118762..119958 product MarP family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013542.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS complement(120043..121020) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731100.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS complement(121114..121614) product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013544.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS 121810..122814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230534.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS complement(122839..123720) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013545.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS 124057..124503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS complement(125012..125236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10920 note possible pseudo, frameshifted CDS complement(125185..125751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10930 note possible pseudo, frameshifted CDS complement(126032..127018) product IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058916821.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS complement(127105..127758) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989573.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS complement(127755..128435) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS 128416..128685 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS 128713..129627 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108987323.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS complement(130021..130185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS 130635..131312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS 131305..132462 product TadA family conjugal transfer-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013547.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS 132518..133408 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS 133405..134055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS 134265..134525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS 134518..134871 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS 134868..135233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS complement(135217..137562) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013550.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS 137870..138073 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862487.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS complement(138438..138773) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS 138840..141800 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013552.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 gene topA CDS complement(141865..143187) product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014749.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS 143422..144012 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS 144013..144216 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978728.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS complement(144304..145737) product class III adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285716.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS 145889..147286 product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083491.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 tRNA 147421..147496 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS 147838..148713 product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774964.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS 149294..150070 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191312799.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS complement(150152..152113) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729863.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS complement(152418..153761) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141748518.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS 154513..155802 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013563.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS 155896..156897 product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013564.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS complement(156959..157954) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS complement(158004..158426) product DUF2304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013565.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS complement(158423..159127) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013566.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS complement(159139..159960) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107914.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS complement(160038..161387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013578.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS complement(161406..162866) product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013579.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS complement(162877..165051) product prolyl oligopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013580.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS 165116..166549 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013602.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 gene lpdA CDS complement(166766..168202) product acetate metabolism transcriptional regulator RamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038629316.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 gene ramB CDS complement(168406..169698) product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859378.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 gene aceA CDS 170716..172926 product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015044.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 gene glcB CDS 173284..174057 product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804566.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS 174073..176688 product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804565.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS 177106..177846 product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855465.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS 177866..179884 product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013606.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS 179884..180633 product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013607.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS 180674..181072 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013608.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS 181263..182612 product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855471.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS 182692..183048 product DUF2516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013613.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS complement(183177..184082) product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013616.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 gene purU CDS complement(184100..184870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS complement(184999..185496) product DUF2505 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892353.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS 185534..186757 product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208396413.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS complement(187053..188888) product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855494.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS 189066..190421 product D-inositol-3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013628.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 gene mshA CDS 190481..190966 product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222390.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS 191037..191783 product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855496.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS 191915..193222 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855497.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS 193226..193921 product two-component sensory transduction protein RegX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402393.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 gene regX CDS complement(193975..194766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS 194987..195880 product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265553.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS 195882..197330 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS 197358..198242 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855505.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 gene proC CDS 198506..198697 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855509.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS 198896..199042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS complement(199300..200385) product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855543.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS 200590..200832 product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855545.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS 201098..202498 product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265556.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS 202514..203446 product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013637.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 gene hemC CDS 203651..205318 product bifunctional uroporphyrinogen-III C-methyltransferase/uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013645.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS 205348..206424 product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013646.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 gene hemB CDS 206470..207114 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS 207111..207491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS 207511..210102 product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013648.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS 210138..211484 product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265562.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 gene hemL CDS 211492..212226 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855583.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS 212280..212894 product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855585.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS 212903..213778 product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013652.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS 213794..215482 product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013653.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS 215658..216668 product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855590.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 gene ccsB CDS 216720..217712 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080535.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 gene rfbB CDS complement(218129..218311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS 218277..218966 product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080532.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS 218987..219862 product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726901.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 gene rfbA CDS complement(219859..220161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS 220356..220715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS complement(220725..221894) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856999.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS complement(221904..222800) product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013659.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS complement(222886..224046) product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013660.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 gene menE CDS 224181..224837 product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015498.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 gene msrA CDS 224937..226118 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014119.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS complement(226153..227586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS complement(227583..228326) product lantibiotic protection ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896245.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS complement(228443..229150) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975444.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS complement(229203..230456) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976650.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS complement(230490..231170) product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013424.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS complement(231187..231969) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015594.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS 232034..232552 product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776269.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 gene arfB CDS 232594..233520 product pyridoxal kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349874.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 gene pdxY CDS complement(233561..234589) product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860502.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS 234564..235580 product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013669.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS 235762..237663 product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402927.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 gene menD CDS 237776..238267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS 238272..239480 product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854169.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS 239536..240183 product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013674.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS complement(240235..241587) product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013675.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS 241706..242761 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013676.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 tRNA 242941..243023 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 tRNA 243384..243457 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 tRNA 243496..243570 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 tRNA 243673..243746 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS 244257..244565 product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013677.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 gene secE CDS 244757..245620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS 245954..246391 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892734.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 gene rplK CDS 246493..247197 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013680.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 gene rplA CDS 247452..248084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS 248472..248984 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013688.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 gene rplJ CDS 249109..249492 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854210.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 gene rplL CDS 249716..250681 product DUF3068 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031512298.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS 251135..254605 product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265569.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS 254754..258725 product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013691.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS 259033..259767 product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223128.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS complement(259854..260681) product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267495.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(260684..261319) product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004390399.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 gene ureG CDS complement(261383..262090) product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446466.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS complement(262100..264232) product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815716.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS complement(264213..265142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS complement(265143..265451) product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058500.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS 265875..267413 product allantoin permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111162.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS complement(267423..268133) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035335.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS 268702..269925 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013737.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS 269998..271302 product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013738.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS 271353..271841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS 272289..272660 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854221.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 gene rpsL CDS 272664..273134 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892787.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 gene rpsG CDS 273433..275565 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854224.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 gene fusA CDS 276069..277259 product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013696.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 gene tuf CDS 277412..277588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS 277931..278236 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102098.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 gene rpsJ CDS 278268..278924 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854292.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 gene rplC CDS 278921..279568 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854293.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 gene rplD CDS 279568..279873 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854294.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 gene rplW CDS 279911..280753 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854295.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 gene rplB CDS 280768..281046 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854296.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 gene rpsS CDS 281050..281412 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854297.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 gene rplV CDS 281412..282152 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854298.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 gene rpsC CDS 282156..282572 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854302.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 gene rplP CDS 282572..282808 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854304.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 gene rpmC CDS 282805..283083 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854306.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 gene rpsQ CDS 283402..284631 product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803803.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 gene mgtE CDS 284694..285341 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729062.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS 285444..286226 product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051851.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS complement(286271..286987) product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015522.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS complement(287117..288358) product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862889.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS 288656..289024 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854312.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 gene rplN CDS 289025..289339 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854314.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 gene rplX CDS 289342..289896 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854317.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 gene rplE CDS 290275..291171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS 291576..291974 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854344.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 gene rpsH CDS 291990..292526 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860588.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 gene rplF CDS 292526..292924 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854346.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 gene rplR CDS 292959..293576 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854347.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 gene rpsE CDS 293582..293767 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860590.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 gene rpmD CDS 293775..294221 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013717.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 gene rplO CDS complement(294324..296204) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS 296538..297869 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854402.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 gene secY CDS 297869..298420 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854403.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS complement(298602..299012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS 299011..299256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS 299407..300210 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013728.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 gene map CDS 300485..300715 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558881.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 gene infA CDS 301012..301380 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854425.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 gene rpsM CDS 301384..301788 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854428.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 gene rpsK CDS 301813..302418 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013730.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 gene rpsD CDS 302492..303517 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013731.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS 303555..304031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS 304117..305214 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854437.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 gene truA CDS 305274..307415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013733.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS 307428..308177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS 308443..308643 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS 309351..310718 product type VII secretion protein EccB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727723.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 gene eccB CDS complement(310677..311933) product type VII secretion system ESX-3 serine protease mycosin MycP3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727074.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 gene mycP3 CDS complement(311930..313345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS 313593..317366 product type VII secretion protein EccC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055990.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS 317366..318754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS 318957..319283 product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013743.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS 319357..319644 product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854533.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS 319961..320407 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854535.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 gene rplM CDS 320404..320964 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854537.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 gene rpsI CDS 321185..323107 product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748733.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS 323151..324839 product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015435.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS 324941..326284 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013744.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 gene glmM CDS 326301..326957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS 326962..327987 product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640469.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 gene mvk CDS 327984..328961 product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703781.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 gene mvaD CDS 328974..330071 product phosphomevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774951.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS 330165..331220 product hydroxymethylglutaryl-CoA reductase (NADPH) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957686.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS 331415..332605 product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922171.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS 332765..333040 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS 333040..334284 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS 334284..334565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS complement(334581..335459) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013747.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS 335544..337418 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466588.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 gene glmS CDS complement(337401..338753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS complement(338973..340061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS 340086..341768 product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013753.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS 341765..343378 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS 343409..344059 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727750.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 gene tsaB CDS 344056..344535 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056042.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 gene rimI CDS 344574..346310 product pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015247.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS 346330..346794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860693.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS 346835..347926 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013752.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 gene tsaD CDS 348049..348228 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS 348385..348684 product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854559.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 gene groES CDS 348704..350308 product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013754.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 gene groL CDS complement(350434..350757) product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222678.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS complement(350895..351263) product DUF5319 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020447882.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS 351527..353056 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013757.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 gene guaB CDS 353107..354255 product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013758.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS 354375..356123 product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893009.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS 356137..357711 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013761.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 gene guaA CDS complement(357716..358393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS 358525..358848 product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230429.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS 359064..359759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094429.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS 360915..361190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS complement(361463..362194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS 362307..363218 product sucrase ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013769.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS complement(363243..363944) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854626.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS complement(363941..364990) product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854632.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS complement(365055..365921) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013784.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS 366148..369408 product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013785.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS 369427..371391 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495724.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS 371423..371962 product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854647.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS 372031..372888 product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860764.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS 372909..373277 product DUF3017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013790.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS complement(373274..374410) product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013793.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS complement(374456..375778) product O-acetylhomoserine/O-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854667.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS complement(376228..378450) product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013800.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS complement(378716..379753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS 380149..381459 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854698.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS 381503..382459 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860808.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS complement(382485..385172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS 385363..385794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS 385875..386993 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013808.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 gene trpS CDS 387056..388081 product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858295.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS complement(388082..389359) product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056119.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS 389489..390718 product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877158.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS complement(390749..391990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013811.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS complement(392123..393166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS complement(393166..393486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS 393834..394469 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858289.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 gene upp CDS complement(394479..394763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS 394795..395196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS 395359..396585 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013814.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS 396661..398070 product NAD(P)H-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013815.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS complement(398193..398540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS complement(398611..399141) product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057139.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS complement(399165..400001) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728518.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS complement(400018..400773) product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862394.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS complement(401168..402805) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013928.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 gene pgi CDS 403030..404511 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730606.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS complement(404534..404908) product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858377.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS 404974..407673 product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222711.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 gene pcrA CDS complement(407741..408232) product hotdog fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229705.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS complement(408385..409092) product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013932.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS 409653..411452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS 411510..412163 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878360.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 gene purN CDS 412160..413707 product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013935.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 gene purH CDS 413907..414500 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112478.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS 414807..416387 product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028579.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS 416442..418535 product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878115.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS 418598..419767 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412771.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS 419769..420311 product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412768.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS 420319..421197 product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412766.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 gene citE CDS 421301..423055 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230221.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS 423060..423812 product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889327.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS 423813..424481 product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722856.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS 424540..425748 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030221.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS 425878..426741 product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013936.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS complement(426742..427893) product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728537.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 gene hypD CDS complement(427910..428218) product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894089.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 gene hypC CDS 428303..429445 product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728538.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 gene hypE CDS complement(429442..431832) product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728273.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 gene hypF CDS complement(432011..432244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS complement(432237..432470) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS 432387..433049 product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728271.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 gene hypB CDS 433383..434621 product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545343.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS 434633..436381 product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012502532.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS 436378..437646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS 437654..438292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS complement(438289..438723) product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889575.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS 438689..440044 product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943056.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS 440049..440309 product hydrogenase maturation factor HybG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817175.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 gene hybG CDS complement(440306..441802) product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013861.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS 442109..443083 product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893216.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 gene rfbD CDS 443095..444018 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013862.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS 444060..445217 product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013863.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS 445538..445906 product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014300514.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS complement(446030..446362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS 446772..447092 product DUF3499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863575.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS complement(447116..447328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS 447233..448588 product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863574.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS 448627..449643 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS 449730..450932 product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013865.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 gene manA CDS complement(450929..451705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS 452056..452430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS 452498..453952 product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858195.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 gene ahcY CDS 453998..454627 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907920.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS 454682..455224 product two-component system response regulator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013867.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 gene mtrA note possible pseudo, internal stop codon CDS 455435..457108 product two-component system sensor histidine kinase MtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186458538.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 gene mtrB CDS 457109..458950 product MtrAB system accessory lipoprotein LpqB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013869.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 gene lpqB CDS 459207..459701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS 459863..460522 product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858182.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 gene raiA CDS 460684..463386 product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013871.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 gene secA CDS complement(463390..464013) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS 464299..464709 product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863558.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS 464709..465200 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858173.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS 465207..465398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS 465528..466592 product ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727980.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS 466662..468002 product NADPH-dependent stearoyl-CoA 9-desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416919.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 gene desA3 CDS complement(467999..469384) product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855412.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS complement(469371..470300) product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863555.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 gene rsgA CDS complement(470420..471814) product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013873.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 gene aroA CDS 471969..472664 product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031511933.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS complement(472704..473216) product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186627.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 gene ybaK CDS 473314..473943 product sigma-70 family RNA polymerase sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416897.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 gene sigH CDS 473940..474248 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14140 tRNA complement(474378..474451) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 CDS complement(474967..475236) product WhiB family transcriptional regulator WhcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858159.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 gene whcE CDS complement(475722..476720) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS 477004..477387 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858157.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS complement(477384..478715) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013875.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS complement(478785..480149) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013876.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS 480244..480468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS 480468..481376 product DUF3152 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858148.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS 481386..482237 product TIGR02569 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893318.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS 482332..485691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS 485694..489188 product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013880.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS 489304..490371 product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863539.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS 490407..492560 product ATP-dependent DNA helicase UvrD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013882.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS complement(492587..493522) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS 493591..494121 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013884.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS complement(494126..495628) product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858132.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS 495759..496841 product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013885.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS complement(496879..498306) product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705185.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS complement(498376..498801) product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860253.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS complement(498798..499217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS 499508..501163 product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015199.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 gene pgm CDS 501236..501658 product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223188.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS 501792..502523 product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857927.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 tRNA 502699..502774 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 CDS 502909..503343 product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015196.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS 503592..504119 product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014268.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS complement(504157..505008) product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889460.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 gene nadE CDS 505212..506528 product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704224.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS 506780..506902 product type B 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857945.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 gene ykgO CDS 507642..507866 product redoxin NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893665.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS 507916..508374 product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857951.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 gene nrdI CDS 508540..510693 product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857952.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 gene nrdE CDS 510929..511654 product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843292.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 gene deoD CDS 511705..513162 product tetracycline efflux MFS transporter Tet(38) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100299.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 gene tet(38) CDS 513445..514518 product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015189.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 gene nrdF CDS 514847..516547 product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015188.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 gene ctaD sequence05 source 1..385155 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(153..1433) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015212.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 gene murA CDS 1463..2083 product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015213.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS complement(2124..2960) product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857068.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS complement(3887..4678) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030564.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS complement(4714..5451) product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030565.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 gene cbiQ CDS complement(5448..5825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS complement(5864..6646) product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030567.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS 7283..8215 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066567803.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 gene cysK CDS 8330..8923 product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006286028.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 gene cysE CDS complement(9026..9349) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015215.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS complement(9415..9870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14590 tRNA complement(10028..10101) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 tRNA complement(10121..10197) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA complement(10734..10808) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 tRNA complement(10823..10898) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 CDS 11099..11629 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859635.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 tRNA complement(11704..11777) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 CDS 12015..13172 product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858945.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 gene dusB CDS 13263..14000 product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015220.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 gene phoU CDS complement(14443..15219) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015221.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 gene pstB CDS complement(15268..16206) product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015222.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 gene pstA CDS complement(16239..17282) product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858938.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 gene pstC CDS complement(17519..18616) product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015224.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 gene pstS CDS complement(18965..19873) product mycothiol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015225.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 gene mshD CDS 19955..20812 product LmeA family phospholipid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015226.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS 20914..21594 product FABP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863137.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS complement(21689..22582) product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015228.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS 22657..23811 product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015229.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS 24071..24253 product DUF3073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863131.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS complement(24597..25661) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863129.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 gene purM CDS complement(25820..27388) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265975.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 gene purF CDS complement(27442..27882) product sterol carrier family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087146.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS 27984..28919 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015231.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS complement(28916..29623) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856330.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS 29854..30756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS complement(30763..31263) product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223545.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS complement(31301..32095) product DUF2334 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854006.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS complement(32203..32874) product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077141.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 gene bluB CDS complement(32879..35107) product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015237.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS complement(35104..35997) product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863110.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS 36294..37616 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102247.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS 37664..39022 product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776345.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS 39076..40038 product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776344.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS 40556..40858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS 40855..41859 product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776779.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 gene nrdF CDS 41902..42477 product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704526.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS 42598..43293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS complement(43296..45116) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014053.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS complement(45738..46667) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102581.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS complement(46865..48295) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173328348.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 gene purB CDS complement(48330..48779) product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014091.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS 49039..50325 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014408.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS 50404..51189 product glutamate ABC transporter ATP-binding protein GluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857431.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 gene gluA CDS 51322..52146 product glutamate ABC transporter substrate-binding protein GluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014779.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 gene gluB CDS 52166..52852 product glutamate ABC transporter permease GluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014780.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 gene gluC CDS 52834..53790 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014781.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS complement(54006..55817) product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015032.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS 56002..57612 product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111991.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS complement(57649..58851) product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899922.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 gene moeB CDS complement(58851..59723) product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727197.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS complement(59726..59959) product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803830.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 gene thiS CDS complement(59973..61301) product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994451.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 gene thiO CDS 61337..62095 product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402115.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 gene thiE CDS complement(62384..63085) product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776430.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS complement(63078..64334) product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776429.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS 64931..66256 product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567953.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 gene trpB CDS complement(66323..66478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS complement(66647..66814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS complement(66860..67135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS complement(67295..68566) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113200.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS complement(68670..69944) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863105.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 gene purD CDS 70025..70447 product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087112.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS 70615..71334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15160 note possible pseudo, frameshifted CDS complement(71381..71635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS 71627..72097 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS complement(72107..72949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS complement(73076..73450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS 73997..75499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15210 tRNA complement(75629..75704) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 CDS 76065..77717 product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853939.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS 77939..78316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS 78331..78807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS complement(78789..79412) product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224396.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS complement(79514..80620) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015259.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS 80938..81954 product metal ABC transporter solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015260.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS 81957..82637 product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015261.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS 82637..83509 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015262.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS complement(84066..85010) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863034.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 gene rlmB CDS complement(85068..86537) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015271.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 gene cysS CDS complement(86611..87186) product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853867.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS 87341..88027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS 88317..89876 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015292.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 gene radA CDS complement(89873..90583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015294.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS complement(90588..91178) product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853851.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS 91271..92182 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015296.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS 92641..93507 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15380 note possible pseudo, internal stop codon, frameshifted CDS complement(93547..93723) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS complement(94058..94891) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS 95022..95582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS 95582..96427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS complement(96554..99286) product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015301.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS complement(99541..99999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS 100231..100425 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS complement(100422..101222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS complement(101269..102864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS complement(102861..103454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS complement(103454..105073) product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963794.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS complement(105189..106088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS complement(106075..107376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS complement(107373..108131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS 108324..109073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS 109076..109783 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS complement(109892..110164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS 110353..112071 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS complement(112184..113011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS complement(113161..114624) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS complement(114839..116050) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229645.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS complement(116093..117499) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094221.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS complement(117622..118914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS complement(119241..120773) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015310.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 gene lysS CDS complement(120844..122406) product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899392.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS complement(122407..122916) product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015321.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS complement(122919..123383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS complement(123388..123939) product DUF2617 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413444.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS complement(123939..124553) product DUF4178 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413441.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS complement(124724..126919) product PhoX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029237.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS complement(127166..127588) product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230457.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS complement(127726..128844) product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731036.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 gene panC CDS complement(128942..129727) product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113142.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS complement(129927..131177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS complement(131174..131680) product DUF3180 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897501.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS complement(131683..132195) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015314.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 gene folK CDS complement(132192..132596) product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897503.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 gene folB CDS complement(132602..133609) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173664572.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 gene folP CDS complement(133630..134205) product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015316.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 gene folE CDS complement(134215..136887) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015317.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 gene ftsH CDS complement(137157..137741) product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285928.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 gene hpt CDS complement(137864..138859) product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092153.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 gene tilS CDS complement(138930..140210) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049745905.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS complement(140259..141749) product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899610.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 gene dacB CDS 141862..142335 product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015320.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS 142476..142790 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776541.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS 142948..143802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS 143799..147848 product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015325.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS complement(148155..150464) product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014148.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 gene metE CDS 150890..152011 product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859878.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS complement(152251..153150) product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853756.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 gene ppk2 CDS 153304..153780 product DIP1984 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479829.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS complement(154237..155862) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862917.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 gene groL CDS 156229..157614 product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015336.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS 157840..158394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862907.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS 158617..161751 product Na+/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015337.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS 161748..162263 product Na(+)/H(+) antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853720.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS 162253..163956 product Na+/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853718.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS 163956..164609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS 164590..165000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS 164997..165347 product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853711.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 gene mnhG CDS complement(165521..166744) product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853704.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS complement(166762..167319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS complement(167544..168488) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS complement(168531..168887) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS 169074..169655 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862894.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS 169659..170831 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015341.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS complement(170878..171705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS 171887..172624 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853692.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS 172867..173430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS 173464..173790 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014230.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS complement(173828..174331) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853671.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS 174467..176125 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020309579.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS 176122..177201 product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015348.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS 177198..179663 product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015349.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS 179776..180627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS complement(180868..182064) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862874.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS complement(182070..183596) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853660.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 gene pta CDS 184111..185499 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015351.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS complement(185533..186303) product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228436.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS complement(186359..187660) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862775.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS complement(187660..188586) product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015403.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS complement(188739..189503) product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853541.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS complement(189754..191460) product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015405.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS complement(191634..192659) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729296.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS 192912..194417 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015351.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS 194482..194985 product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776234.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS complement(195076..196296) product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853648.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 gene purT CDS complement(196413..197429) product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015421.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS complement(197541..198797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS complement(199003..199641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS complement(199805..200395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS complement(200653..201942) product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015361.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS 202138..202938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853637.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS 203067..203759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS complement(203847..205250) product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853634.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS complement(205348..205743) product DUF3151 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898414.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS 205742..205882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS complement(205893..207110) product glycoside hydrolase family 76 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167382136.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS complement(207181..207852) product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031511861.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS complement(207839..208684) product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013553.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS complement(208784..209344) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862850.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 gene pyrE CDS complement(209396..211435) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS complement(211641..212471) product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015366.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS 212552..212896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS complement(212913..214460) product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092091.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS complement(214688..215335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS complement(215522..218053) product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015370.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 gene clpB CDS 218461..219348 product fructose bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729118.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS complement(219463..220080) product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854700.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS complement(220196..221044) product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015383.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS 221188..221505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS 221493..223055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS complement(223150..223572) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015387.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS complement(223572..224768) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085701.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 gene dnaJ CDS complement(224828..225415) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015389.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 gene grpE CDS complement(225418..227259) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015390.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 gene dnaK CDS 227776..228507 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS complement(228895..229443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16570 note possible pseudo, internal stop codon CDS complement(229453..229755) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16580 note possible pseudo, internal stop codon CDS 229907..230683 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533693.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS complement(230943..231278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16600 note possible pseudo, frameshifted CDS complement(231272..232675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16610 note possible pseudo, frameshifted CDS 233192..233701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS complement(233724..234785) product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015397.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 gene adhP CDS 235159..238551 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS 238795..239904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS 240041..240694 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007388333.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS complement(240850..241449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS complement(241458..242132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS complement(242180..242773) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS 243292..243483 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS complement(243531..243899) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS complement(243785..244285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16720 note possible pseudo, frameshifted CDS complement(244282..245406) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014504.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS 245545..246081 product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854913.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS 246193..247599 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862691.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS 248200..249648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS complement(249645..251027) product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015433.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS complement(251229..251810) product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853460.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 gene dcd tRNA 252018..252089 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 CDS complement(252173..252328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS complement(252298..252939) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974351.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS complement(252936..254105) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS complement(254162..255493) product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013946.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS 255679..256158 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015437.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS 256355..256549 product DUF2613 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853449.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS 256579..260190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS complement(260197..261369) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401260.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS 261350..261508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS 261650..262810 product DUF3068 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401257.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS 262903..264735 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095415.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS complement(264715..265827) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015443.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS 265900..266877 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015445.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS complement(267055..267186) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS 267203..268129 product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013805.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS 268213..269172 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013804.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS 269169..270224 product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013803.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS 270261..271067 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013802.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS 271108..272097 product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013801.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS complement(272372..272791) product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063604.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS 273125..274360 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730738.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS 274435..276666 product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083313.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS complement(277518..277829) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS 277914..278387 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS 278515..279177 product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262987.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS 279226..280842 product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086915.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS 281370..283115 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014806.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS 283120..284046 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857497.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS 284039..285019 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006284211.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS 285016..286698 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014807.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS complement(286908..287651) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081527.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS complement(287658..290261) product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030507.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS complement(290308..290898) product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039225.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 gene kdpC CDS complement(290980..293088) product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730505.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 gene kdpB CDS complement(293085..294737) product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029188.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 gene kdpA CDS complement(294734..294925) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS complement(295503..296174) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS complement(296251..297735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS 297988..298950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS complement(298947..299774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS complement(299917..301485) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208292971.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS complement(301486..303666) product choline BCCT transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704693.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 gene betT CDS 304005..305744 product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229316.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 gene betA CDS 305917..306960 product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228448.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS complement(307076..308272) product globin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776222.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS complement(308464..308937) product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031657.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 gene nsrR CDS complement(309050..310885) product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015446.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS complement(311184..311609) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS complement(311644..312672) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS complement(312654..313127) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS 313586..314371 product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015448.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 gene trmB CDS 314377..315060 product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857880.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS 315180..316151 product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015450.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS 316214..316585 product DUF3054 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857875.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS 316673..318199 product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855213.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS 318434..318703 product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856097.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS 318718..320082 product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856096.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS complement(320101..320658) product NINE protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782692.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS complement(320878..321816) product cutinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015453.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS complement(321810..322298) product DUF732 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015454.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS complement(322336..324384) product protein PS1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015455.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS complement(324899..325942) product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015457.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS complement(326415..327467) product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015459.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS complement(327464..328054) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015460.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS complement(328038..330098) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006284777.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS complement(330301..331314) product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015457.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS complement(331498..332418) product threonine/homoserine exporter RhtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086919.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 gene rhtA CDS complement(332455..333708) product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015466.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 gene glf CDS 333982..335487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS 335573..338008 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS complement(338083..338916) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015468.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS complement(338923..340572) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS 341015..342751 product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080751.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS 343000..343749 product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742072.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS 343834..345390 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857839.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 gene glpK CDS 345533..346705 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459069.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS 346963..347298 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393829.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS 347295..348137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS complement(348343..349236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS complement(349233..349856) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014540.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS complement(350387..351649) product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857828.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 gene serS CDS complement(351697..352347) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015055.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS 352695..353792 product septum formation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857824.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS 353840..354184 product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862613.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS 354326..354808 product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856246.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS complement(354843..355634) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084122.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS complement(355638..356573) product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862609.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 gene pheA CDS 356607..357995 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066568791.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS complement(357992..358801) product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777040.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS 359045..359197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS 359446..360336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS complement(360440..361357) product DUF5926 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006284785.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS complement(361406..362284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS complement(362403..364370) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015482.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS complement(364509..365456) product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015483.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS 365567..367543 product alpha/beta-hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929867.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS 367680..368276 product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862560.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS 368447..369292 product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071548.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS complement(369297..370991) product TM0106 family RecB-like putative nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015502.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS 371291..372070 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS 372231..373988 product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014996.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS 374337..374690 product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230453.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS 374887..376245 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015508.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 gene yidC CDS complement(376298..376918) product TetR/AcrR family transcriptional regulator MbcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015509.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 gene mcbR CDS complement(377294..377587) product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015510.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS complement(377932..378831) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015511.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS 379129..380160 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015513.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS 380179..380973 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860245.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS 380994..383618 product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857914.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS complement(383730..384173) product DUF2871 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001836564.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS complement(384264..384698) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17890 sequence06 source 1..256209 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 256..1548 product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082353449.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 gene serB CDS 1548..2348 product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066567712.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS complement(2356..3933) product 4-coumarate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728294.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS complement(4098..6203) product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015186.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS complement(6218..7528) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015184.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS 7634..7903 product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011897801.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 gene clpS CDS 7934..8485 product DUF2017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857980.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS 8570..9673 product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015182.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS 9690..10364 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860306.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS 10457..11323 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066567685.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 gene murI CDS 11430..12179 product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857989.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 gene cdpA CDS 12248..13009 product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857993.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 gene rph CDS 13006..13707 product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066929.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 gene rdgB CDS complement(13754..14107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS complement(14141..14536) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18040 tRNA 14760..14842 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 CDS complement(15129..15596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS complement(15739..15999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS complement(16164..16328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS 16315..16839 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS 16844..17263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS 17293..17706 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS 17889..18086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS 18438..27584 product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015170.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS 27581..27985 product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015166.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS complement(27998..29746) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS complement(29906..30481) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857691.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS complement(30641..31168) product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015164.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 gene bcp CDS 31318..31599 product DUF3618 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015163.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 tRNA complement(31760..31833) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 CDS 32496..33665 product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015151.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS complement(33720..34403) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014822.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS complement(34465..35670) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857531.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS 35820..36836 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014823.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS 36935..37729 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857536.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 tRNA complement(37874..37949) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 CDS complement(38093..38746) product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831683.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 gene orn CDS 39016..39660 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978194.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 tRNA complement(39715..39788) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 CDS 39878..42046 product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015135.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS 42280..42819 product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110156.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 gene ssb CDS 43123..44793 product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015133.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 gene ettA CDS 44930..45373 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567531.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS 45380..46186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110159.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS complement(46206..46604) product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015129.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS complement(46672..49374) product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015108.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 gene pepN CDS 49504..50148 product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015107.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS complement(50176..51381) product TIGR04053 family radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046898.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS 51610..52083 product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859211.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS 52186..52803 product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228312.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS complement(52820..53686) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS complement(53834..54067) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859215.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 tRNA complement(54178..54252) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 tRNA 54815..54891 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 CDS 54951..56327 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567596.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 gene tig CDS 56468..57040 product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859220.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS 57081..57710 product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859221.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS 57884..59146 product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412634.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 gene clpX CDS complement(59209..59994) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015080.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS 60225..61208 product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015079.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS 61425..64160 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015075.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS 64157..65890 product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567661.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS 65887..66402 product DUF4233 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567665.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS 66490..66912 product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859294.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 gene ndk CDS 67483..71556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS 71940..72248 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859302.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 gene rplU CDS 72289..72546 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859304.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 gene rpmA CDS 72804..74318 product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015064.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 gene obgE CDS 74417..75766 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015063.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 gene proB CDS 75926..76639 product class E sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015507.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS 76640..76792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858985.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS 76795..78150 product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859321.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS 78172..78942 product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015061.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 gene nadD CDS 79032..79490 product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003067112.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 gene rsfS CDS 79493..80200 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859329.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS 80190..81551 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS 81615..82448 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS 82633..84432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18610 note possible pseudo, frameshifted CDS 84498..85487 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015057.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 gene holA CDS complement(85568..86002) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393392.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS complement(86433..86699) product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859343.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 gene rpsT CDS complement(86956..87570) product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859345.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS 87733..89580 product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015054.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 gene lepA CDS 89593..90609 product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681626.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS 90701..92284 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706470.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS 92563..93348 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS 93398..93970 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067204.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS 94050..95015 product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026837.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS complement(95177..96232) product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014101.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS 96305..96922 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530543.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS complement(96985..97770) product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015274.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 gene nagB CDS complement(98022..98333) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS complement(98415..98729) product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196156.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS complement(98805..99584) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015246.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS complement(99705..101480) product ABC-ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804193.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS 101621..102946 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013994.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS complement(102976..103575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS complement(103605..104639) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222377.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS complement(104810..105406) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014279.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS 105455..106558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS 106574..107869 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027368.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS complement(107916..109760) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141301.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS complement(109762..111594) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856381.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS complement(111615..112640) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948657.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS complement(112753..113613) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS complement(113610..114170) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS 114084..114440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS 114462..114746 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS complement(114849..115034) product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856746.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS complement(115159..116556) product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001010111.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 gene glpT CDS complement(116754..117098) product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092775.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 gene arsC CDS 117374..118504 product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115334.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS 118501..119196 product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399558.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS 119186..120016 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111894.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS 120009..120827 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111893.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS 120831..121523 product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854638.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS 121490..121933 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS 121930..122451 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS complement(122465..123436) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804480.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS complement(123458..124147) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074594838.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS 124296..125507 product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014042.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS 125597..126370 product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230111.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS 126442..127095 product allophanate hydrolase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104243.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS 127114..127998 product 5-oxoprolinase/urea amidolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079952.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS 128086..128553 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427501.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS complement(128602..130077) product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729555.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 gene pntB CDS complement(130084..131673) product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726673.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS 132061..133263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS complement(133270..133404) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS complement(133429..133815) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19130 note possible pseudo, internal stop codon CDS complement(133802..135178) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015248.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS complement(135536..135835) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS 136722..136889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS complement(137380..138033) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS 138414..140120 product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900143.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 gene thiC CDS 140420..141484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS 141911..143140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS complement(143143..143340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS 143605..144987 product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285177.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS 145123..146538 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095769.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS 146543..147886 product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013948.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS complement(148056..148253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS complement(148342..150393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296325.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS 150537..151160 product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858584.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS 151170..152786 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731492.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS 152783..153601 product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014105.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS 153621..154136 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898102.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS 154466..154981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS 155089..156273 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080817.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS complement(156424..156636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS complement(156803..157300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS complement(157408..158019) product suppressor of fused domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110093.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS complement(158050..158694) product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858618.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS complement(158791..159483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS 160119..162032 product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014121.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 gene typA CDS 162206..164260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS 164269..165222 product N-acetyl-1-D-myo-inositol-2-amino-2-deoxy-alpha-D-glucopyranoside deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858626.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 gene mshB CDS 165215..165736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS 165981..166304 product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858631.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS 166358..167485 product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003903345.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 gene dapC CDS 167575..168519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS complement(168512..169483) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730317.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 gene dapD CDS complement(169600..171018) product aromatic amino acid transport protein AroP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014125.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 gene aroP CDS complement(171127..172119) product DapH/DapD/GlmU-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014126.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS 172170..173093 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS 173099..174235 product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014127.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 gene dapE CDS 174305..175132 product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863794.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS 175139..175990 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855021.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 gene folP CDS 176213..176380 product DUF3117 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222969.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS 176684..177559 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014130.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS complement(177563..178246) product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244457.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 gene budA CDS complement(178455..179978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS complement(180179..181375) product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855006.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 gene glgA CDS 181509..182705 product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855005.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 gene glgC CDS complement(183017..183691) product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863800.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS 183850..184503 product RNA polymerase sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855001.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 gene sigE CDS 184581..184946 product anti-sigma E factor RseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088067.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 gene rseA CDS 184946..186265 product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110085.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS 186378..186962 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS complement(187244..188377) product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854996.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS 188646..189179 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406290.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS complement(189223..190251) product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223003.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 gene corA CDS 190268..190474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS 190682..191245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014136.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS complement(191663..195331) product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014138.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS complement(195435..199280) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014139.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS complement(199372..200238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014140.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 CDS 200377..201189 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19710 CDS 201388..202221 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014144.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS complement(202250..202804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS 203304..204164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS 204420..205559 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS complement(205658..208546) product DUF3427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014158.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS complement(208588..209001) product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854931.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS 209101..210483 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014146.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS complement(210480..211544) product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859383.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS 212124..214271 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014161.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS complement(214468..214968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014165.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS complement(215077..215718) product HNH endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014166.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS complement(215815..217338) product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014167.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 gene putP CDS 217932..221171 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014168.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS 221171..222229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS 222232..223407 product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090007.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS 223411..226068 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110116.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS 226083..226574 product MarR family transcriptional regulator RosR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861276.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 gene rosR CDS 226644..227096 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS 227266..228468 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972998.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS 228499..229674 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243562.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS 229674..230465 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061358.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 tRNA 230559..230632 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 CDS complement(230781..231512) product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804907.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS complement(231515..233089) product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727053.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS complement(233089..233745) product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804909.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS 234090..235742 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014179.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 gene argS CDS 235808..237226 product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014180.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 gene lysA CDS 237223..238557 product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854900.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS 238558..239484 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014183.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 gene thrB CDS complement(239530..241236) product long-chain fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854869.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS 241763..243745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS 243860..244933 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854866.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 gene prfA CDS 244920..245864 product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014198.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 gene prmC CDS 245902..246558 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861324.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS 246623..247873 product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014199.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS 247870..248319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854858.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS 248710..249504 product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854856.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 gene atpB CDS 249645..249896 product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854855.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS 249929..250492 product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014201.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS 250498..251316 product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854845.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS 251371..253014 product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014202.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 gene atpA CDS 253068..254048 product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014203.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS 254051..255490 product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014204.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 gene atpD CDS 255502..255873 product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861337.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 sequence07 source 1..175606 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(144..1433) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027932.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS 1683..3254 product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015516.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS complement(3433..4260) product rod-shaped morphology protein RsmP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855053.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 gene rsmP CDS 4422..5723 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS complement(5817..6197) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861174.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 gene trxA CDS complement(6340..7188) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567937.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS complement(7278..8474) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967713.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS complement(8617..10209) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015543.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 gene dnaB CDS complement(10946..11398) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015544.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 gene rplI CDS complement(11499..12065) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015545.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS complement(12187..12474) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855074.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 gene rpsF CDS complement(12786..12977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS complement(12978..15458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS 16114..17199 product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731620.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS 17722..18213 product MarR family transcriptional regulator CarR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855083.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 gene carR CDS 18373..19305 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855086.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS 19349..19765 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS complement(19922..22840) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015573.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 gene leuS CDS 22901..23512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS 23584..24567 product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855200.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS 24676..25806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS 25821..26735 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS complement(26789..27139) product branched-chain amino acid transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015618.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS complement(27136..27912) product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015619.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS complement(27913..28554) product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855283.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS complement(28554..29996) product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855284.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS 30511..31014 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS 31252..33558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015621.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS 33586..37188 product virulence factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015622.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS 37337..37987 product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731635.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 gene sigM CDS 38156..39094 product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855300.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 gene trxB CDS 39488..39808 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855302.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 gene trxA CDS 40220..41404 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855304.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS complement(41431..42384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS complement(42396..43673) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855307.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS complement(43695..44513) product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855308.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS complement(44931..45614) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855311.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 gene rsmG CDS complement(45887..47035) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855313.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 gene yidC CDS complement(47122..47454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS complement(47414..47794) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860977.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 gene rnpA CDS complement(47815..47952) product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975051.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 gene rpmH CDS 48647..50395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS 50909..52099 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855336.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 gene dnaN CDS 52109..53308 product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013310.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 gene recF CDS 53314..53976 product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855338.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS 54266..56305 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855339.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 gene gyrB CDS 56401..57288 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066563158.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS 57513..59288 product phospholipase C, phosphocholine-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230673.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS complement(59302..59640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS complement(59637..59864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS 60049..62652 product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855346.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 gene gyrA CDS 62657..62989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20660 tRNA 63193..63267 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 tRNA 63298..63371 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 CDS complement(63489..64637) product IS1249 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053543917.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS 64974..65156 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS 65387..65890 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS complement(66233..67114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS 67389..67955 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891350.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS complement(68651..68920) product cell division protein CrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861074.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 gene crgA CDS 69056..69727 product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907466.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS complement(69731..71785) product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013340.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 gene pknB CDS complement(71839..73317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS complement(73323..74756) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013342.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS complement(74757..76118) product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013343.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS complement(76115..77470) product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726619.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS complement(77467..77928) product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861086.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS complement(78077..78976) product DUF3662 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861088.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 tRNA 79262..79346 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 CDS complement(79638..79835) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS complement(79896..80312) product iron chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989448.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS 80353..81735 product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775824.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS complement(81719..82411) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015413.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS complement(82408..83421) product App1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014988.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS 83515..83841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS complement(83838..85088) product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066564999.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS 85349..85666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20880 note possible pseudo, frameshifted CDS 85656..85871 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20890 note possible pseudo, frameshifted CDS complement(85828..86781) product ArsO family NAD(P)H-dependent flavin-containing monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014413.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS 86836..87819 product LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122374.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS complement(87803..88840) product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014239.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 gene mgrA CDS 89146..90315 product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567734.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS 90573..91808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20940 note possible pseudo, internal stop codon CDS 91902..93383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20950 note possible pseudo, internal stop codon CDS 93380..95014 product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229116.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 gene casA CDS 95017..95640 product type I-E CRISPR-associated protein Cse2/CasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227613.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 gene casB CDS 95661..96782 product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674072.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 gene cas7e CDS 96782..97483 product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674073.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 gene cas5e CDS 97487..98188 product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227610.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 gene cas6e CDS 98806..99150 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS 99144..99509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21020 repeat_region 99554..100373 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttttccccgcgtgagcggggatgttcc CDS 100429..100929 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS complement(100959..101294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS complement(101297..101650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21050 CDS 101689..102024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS complement(102038..102889) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088003.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS complement(102886..104103) product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064064.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS 104210..105418 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015500.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS 105603..106841 product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813597.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS complement(106832..107218) product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855195.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS complement(107249..107971) product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811326.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS 108023..109222 product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086840295.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS complement(109235..111652) product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013422.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS 111696..112589 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804404.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS 112699..113646 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526565.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS 113659..114159 product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015559.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS 114163..114825 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013575.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS complement(114831..116891) product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222260.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS 117075..117836 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402359.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS 117862..118593 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776539.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS complement(118624..120321) product long-chain-fatty-acid--CoA ligase FadD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899884.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 gene fadD2 CDS complement(120862..121707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS 122015..126655 product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013453.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 gene gltB CDS 126648..128189 product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013454.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS complement(128198..130762) product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082793861.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS 131466..132773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21270 note possible pseudo, frameshifted CDS 132782..133342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21280 note possible pseudo, frameshifted CDS 133361..134605 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS 134609..135799 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462479.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS 135799..136977 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013588.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS 136974..138536 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS 138547..139212 product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582959.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS complement(139196..139891) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013601.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS complement(139950..140249) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS 140137..140409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS 140554..140847 product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857164.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS 140851..141732 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857162.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS complement(141745..142929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS complement(142974..143522) product thiamine biosynthesis protein ThiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015045.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 gene thiX CDS 143725..144834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS 144846..145925 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028242.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS 145925..146707 product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013622.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS 146740..147426 product heme oxygenase (biliverdin-producing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014970.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS complement(147466..147762) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS complement(147767..148108) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS complement(148315..150078) product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495362.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS complement(150089..150739) product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776136.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 gene deoC CDS complement(150859..152145) product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776139.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS 152315..152734 product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357963.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS 152780..153997 product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051831.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS complement(153992..155089) product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013999.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS complement(155233..156252) product DNA-binding transcriptional repressor DeoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227124.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 gene deoR CDS complement(156516..158468) product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013430.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS 158647..159621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS complement(159653..160681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS complement(160722..164039) product arabinosyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013456.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 tRNA complement(161479..161565) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 CDS complement(164253..166274) product galactan 5-O-arabinofuranosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857673.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS complement(166385..167146) product decaprenylphospho-beta-D-erythro-pentofuranosid-2-ulose 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731251.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 CDS complement(167172..168641) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863441.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS complement(168755..169027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857667.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 CDS 169143..169655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS 169707..170690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013461.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 CDS 170769..171302 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS 171321..173243 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222182.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS 173254..173925 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS 174092..175222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21670 sequence08 source 1..3641 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(906..1049) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21680 rRNA complement(1696..3212) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 sequence09 source 1..2206 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 318..1766 product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006718507.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 sequence10 source 1..2095 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA complement(96..205) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 rRNA complement(328..2077) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 54 percent of the 23S ribosomal RNA locus_tag LOCUS_r00030