>Feature sequence1 832 167 gene locus_tag LOCUS_00010 832 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1945 941 gene locus_tag LOCUS_00020 1945 941 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167627999.1 protein_id gnl|my_center|LOCUS_00020 2756 1935 gene locus_tag LOCUS_00030 gene agaW 2756 1935 CDS product PTS N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406214.1 protein_id gnl|my_center|LOCUS_00030 3294 2818 gene locus_tag LOCUS_00040 gene agaV 3294 2818 CDS product PTS N-acetylgalactosamine transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387360.1 protein_id gnl|my_center|LOCUS_00040 3714 4886 gene locus_tag LOCUS_00050 3714 4886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4974 5816 gene locus_tag LOCUS_00060 4974 5816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 6145 5846 gene locus_tag LOCUS_00070 6145 5846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 6584 6156 gene locus_tag LOCUS_00080 6584 6156 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361048.1 protein_id gnl|my_center|LOCUS_00080 7794 6616 gene locus_tag LOCUS_00090 7794 6616 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074782808.1 protein_id gnl|my_center|LOCUS_00090 7978 8520 gene locus_tag LOCUS_00100 7978 8520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 9513 8590 gene locus_tag LOCUS_00110 9513 8590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 9775 9497 gene locus_tag LOCUS_00120 9775 9497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 10146 9844 gene locus_tag LOCUS_00130 10146 9844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 10724 10209 gene locus_tag LOCUS_00140 10724 10209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 11704 10763 gene locus_tag LOCUS_00150 gene whiA 11704 10763 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006558.1 protein_id gnl|my_center|LOCUS_00150 12651 11707 gene locus_tag LOCUS_00160 12651 11707 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248939.1 protein_id gnl|my_center|LOCUS_00160 13510 12656 gene locus_tag LOCUS_00170 gene rapZ 13510 12656 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920236.1 protein_id gnl|my_center|LOCUS_00170 14860 13808 gene locus_tag LOCUS_00180 14860 13808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 15278 14862 gene locus_tag LOCUS_00190 15278 14862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 15660 15286 gene locus_tag LOCUS_00200 15660 15286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 15812 15672 gene locus_tag LOCUS_00210 15812 15672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 16084 15809 gene locus_tag LOCUS_00220 16084 15809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 17183 16053 gene locus_tag LOCUS_00230 17183 16053 CDS product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680154.1 protein_id gnl|my_center|LOCUS_00230 19381 17561 gene locus_tag LOCUS_00240 19381 17561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 20176 19391 gene locus_tag LOCUS_00250 20176 19391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 21302 20169 gene locus_tag LOCUS_00260 21302 20169 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461486.1 protein_id gnl|my_center|LOCUS_00260 21721 21299 gene locus_tag LOCUS_00270 21721 21299 CDS product DUF2634 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861039.1 protein_id gnl|my_center|LOCUS_00270 22257 21703 gene locus_tag LOCUS_00280 22257 21703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 23252 22257 gene locus_tag LOCUS_00290 23252 22257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 23968 23252 gene locus_tag LOCUS_00300 23968 23252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 26681 23973 gene locus_tag LOCUS_00310 26681 23973 CDS product tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861036.1 protein_id gnl|my_center|LOCUS_00310 27300 26854 gene locus_tag LOCUS_00320 27300 26854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 27813 27349 gene locus_tag LOCUS_00330 27813 27349 CDS product phage tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047648.1 protein_id gnl|my_center|LOCUS_00330 29172 27826 gene locus_tag LOCUS_00340 29172 27826 CDS product phage tail sheath family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047647.1 protein_id gnl|my_center|LOCUS_00340 29614 29165 gene locus_tag LOCUS_00350 29614 29165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 30007 29615 gene locus_tag LOCUS_00360 30007 29615 CDS product HK97 gp10 family phage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047645.1 protein_id gnl|my_center|LOCUS_00360 30371 30000 gene locus_tag LOCUS_00370 30371 30000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 30748 30368 gene locus_tag LOCUS_00380 30748 30368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 31136 30738 gene locus_tag LOCUS_00390 31136 30738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 32339 31152 gene locus_tag LOCUS_00400 32339 31152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 32980 32357 gene locus_tag LOCUS_00410 32980 32357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 34168 33107 gene locus_tag LOCUS_00420 34168 33107 CDS product minor capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928179.1 protein_id gnl|my_center|LOCUS_00420 35539 34172 gene locus_tag LOCUS_00430 35539 34172 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861027.1 protein_id gnl|my_center|LOCUS_00430 36954 35551 gene locus_tag LOCUS_00440 gene terL 36954 35551 CDS product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819485.1 protein_id gnl|my_center|LOCUS_00440 37368 36955 gene locus_tag LOCUS_00450 37368 36955 CDS product KGG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002393641.1 protein_id gnl|my_center|LOCUS_00450 37938 37477 gene locus_tag LOCUS_00460 37938 37477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 38209 37895 gene locus_tag LOCUS_00470 38209 37895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 38600 38202 gene locus_tag LOCUS_00480 38600 38202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 39082 38597 gene locus_tag LOCUS_00490 39082 38597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 39449 39072 gene locus_tag LOCUS_00500 39449 39072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 39558 39421 gene locus_tag LOCUS_00510 39558 39421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 39701 39543 gene locus_tag LOCUS_00520 39701 39543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 39892 39698 gene locus_tag LOCUS_00530 39892 39698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 40077 39895 gene locus_tag LOCUS_00540 40077 39895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 40283 40080 gene locus_tag LOCUS_00550 40283 40080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 41725 40286 gene locus_tag LOCUS_00560 41725 40286 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113850176.1 protein_id gnl|my_center|LOCUS_00560 42066 41728 gene locus_tag LOCUS_00570 42066 41728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 42256 42059 gene locus_tag LOCUS_00580 42256 42059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 44977 42593 gene locus_tag LOCUS_00590 44977 42593 CDS product VapE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714181.1 protein_id gnl|my_center|LOCUS_00590 46996 45023 gene locus_tag LOCUS_00600 46996 45023 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399687.1 protein_id gnl|my_center|LOCUS_00600 47584 47009 gene locus_tag LOCUS_00610 47584 47009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 47764 47609 gene locus_tag LOCUS_00620 47764 47609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 48926 47754 gene locus_tag LOCUS_00630 48926 47754 CDS product DUF2800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144597911.1 protein_id gnl|my_center|LOCUS_00630 49305 48913 gene locus_tag LOCUS_00640 49305 48913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 50027 49308 gene locus_tag LOCUS_00650 50027 49308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 50302 50072 gene locus_tag LOCUS_00660 50302 50072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 50663 50274 gene locus_tag LOCUS_00670 50663 50274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 51017 50724 gene locus_tag LOCUS_00680 51017 50724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 51323 51027 gene locus_tag LOCUS_00690 51323 51027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 51598 51329 gene locus_tag LOCUS_00700 51598 51329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 52640 51651 gene locus_tag LOCUS_00710 52640 51651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 53419 52874 gene locus_tag LOCUS_00720 53419 52874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00720 54315 53419 gene locus_tag LOCUS_00730 54315 53419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 54588 54397 gene locus_tag LOCUS_00740 54588 54397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 54918 54691 gene locus_tag LOCUS_00750 54918 54691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 55071 55445 gene locus_tag LOCUS_00760 55071 55445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 55745 56137 gene locus_tag LOCUS_00770 55745 56137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 56262 57437 gene locus_tag LOCUS_00780 56262 57437 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287015.1 protein_id gnl|my_center|LOCUS_00780 59152 58232 gene locus_tag LOCUS_00790 gene trxB 59152 58232 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357780.1 protein_id gnl|my_center|LOCUS_00790 60603 59131 gene locus_tag LOCUS_00800 60603 59131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 61562 60618 gene locus_tag LOCUS_00810 gene hprK 61562 60618 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357309.1 protein_id gnl|my_center|LOCUS_00810 64389 61567 gene locus_tag LOCUS_00820 gene uvrA 64389 61567 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228057.1 protein_id gnl|my_center|LOCUS_00820 64587 64417 gene locus_tag LOCUS_00830 64587 64417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 66115 64523 gene locus_tag LOCUS_00840 66115 64523 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068837.1 protein_id gnl|my_center|LOCUS_00840 67072 66218 gene locus_tag LOCUS_00850 67072 66218 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565486.1 protein_id gnl|my_center|LOCUS_00850 67996 67139 gene locus_tag LOCUS_00860 67996 67139 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762183.1 protein_id gnl|my_center|LOCUS_00860 70241 68121 gene locus_tag LOCUS_00870 gene pulA 70241 68121 CDS product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921725.1 protein_id gnl|my_center|LOCUS_00870 71099 70425 gene locus_tag LOCUS_00880 71099 70425 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243015.1 protein_id gnl|my_center|LOCUS_00880 72152 71172 gene locus_tag LOCUS_00890 72152 71172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 73547 72384 gene locus_tag LOCUS_00900 73547 72384 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000501370.1 protein_id gnl|my_center|LOCUS_00900 76052 73641 gene locus_tag LOCUS_00910 gene glgP 76052 73641 CDS product glycogen phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494109.1 protein_id gnl|my_center|LOCUS_00910 76479 76255 gene locus_tag LOCUS_00920 76479 76255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 77678 76482 gene locus_tag LOCUS_00930 gene lysA 77678 76482 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084201.1 protein_id gnl|my_center|LOCUS_00930 79185 77662 gene locus_tag LOCUS_00940 79185 77662 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858032.1 protein_id gnl|my_center|LOCUS_00940 80321 79188 gene locus_tag LOCUS_00950 80321 79188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 81986 80331 gene locus_tag LOCUS_00960 81986 80331 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_00960 83134 82082 gene locus_tag LOCUS_00970 83134 82082 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000972791.1 protein_id gnl|my_center|LOCUS_00970 83869 83144 gene locus_tag LOCUS_00980 83869 83144 CDS product IspD/TarI family cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981011.1 protein_id gnl|my_center|LOCUS_00980 86666 83940 gene locus_tag LOCUS_00990 86666 83940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 88340 86685 gene locus_tag LOCUS_01000 88340 86685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 89482 88340 gene locus_tag LOCUS_01010 89482 88340 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143333.1 protein_id gnl|my_center|LOCUS_01010 90543 89500 gene locus_tag LOCUS_01020 90543 89500 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139014079.1 protein_id gnl|my_center|LOCUS_01020 91440 90601 gene locus_tag LOCUS_01030 gene tagH 91440 90601 CDS product teichoic acids export ABC transporter ATP-binding subunit TagH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103231.1 protein_id gnl|my_center|LOCUS_01030 92271 91453 gene locus_tag LOCUS_01040 92271 91453 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722701.1 protein_id gnl|my_center|LOCUS_01040 93365 92412 gene locus_tag LOCUS_01050 93365 92412 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966067.1 protein_id gnl|my_center|LOCUS_01050 94361 93636 gene locus_tag LOCUS_01060 94361 93636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 95383 94376 gene locus_tag LOCUS_01070 95383 94376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 95639 95454 gene locus_tag LOCUS_01080 95639 95454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 96688 95711 gene locus_tag LOCUS_01090 96688 95711 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898508.1 protein_id gnl|my_center|LOCUS_01090 97390 96725 gene locus_tag LOCUS_01100 97390 96725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 97542 97396 gene locus_tag LOCUS_01110 97542 97396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 98714 97629 gene locus_tag LOCUS_01120 98714 97629 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921367.1 protein_id gnl|my_center|LOCUS_01120 99024 98794 gene locus_tag LOCUS_01130 99024 98794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 99209 99883 gene locus_tag LOCUS_01140 99209 99883 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986640.1 protein_id gnl|my_center|LOCUS_01140 99873 100889 gene locus_tag LOCUS_01150 99873 100889 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986639.1 protein_id gnl|my_center|LOCUS_01150 101031 101237 gene locus_tag LOCUS_01160 101031 101237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 101234 102001 gene locus_tag LOCUS_01170 101234 102001 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986651.1 protein_id gnl|my_center|LOCUS_01170 101991 104051 gene locus_tag LOCUS_01180 101991 104051 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986650.1 protein_id gnl|my_center|LOCUS_01180 104739 104080 gene locus_tag LOCUS_01190 104739 104080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 105986 104736 gene locus_tag LOCUS_01200 105986 104736 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478434.1 protein_id gnl|my_center|LOCUS_01200 106957 106157 gene locus_tag LOCUS_01210 106957 106157 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_227020148.1 protein_id gnl|my_center|LOCUS_01210 107838 106954 gene locus_tag LOCUS_01220 107838 106954 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626612.1 protein_id gnl|my_center|LOCUS_01220 108455 107835 gene locus_tag LOCUS_01230 108455 107835 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393623.1 protein_id gnl|my_center|LOCUS_01230 109553 108762 gene locus_tag LOCUS_01240 109553 108762 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722392.1 protein_id gnl|my_center|LOCUS_01240 110269 109640 gene locus_tag LOCUS_01250 110269 109640 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962785.1 protein_id gnl|my_center|LOCUS_01250 111086 110250 gene locus_tag LOCUS_01260 gene sgcQ 111086 110250 CDS product BtpA family protein SgcQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118626.1 protein_id gnl|my_center|LOCUS_01260 111935 111099 gene locus_tag LOCUS_01270 111935 111099 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860838.1 protein_id gnl|my_center|LOCUS_01270 112690 111941 gene locus_tag LOCUS_01280 112690 111941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 113175 112690 gene locus_tag LOCUS_01290 113175 112690 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426364.1 protein_id gnl|my_center|LOCUS_01290 113572 113192 gene locus_tag LOCUS_01300 113572 113192 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860837.1 protein_id gnl|my_center|LOCUS_01300 115760 113904 gene locus_tag LOCUS_01310 gene glgB 115760 113904 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111383.1 protein_id gnl|my_center|LOCUS_01310 116427 116086 gene locus_tag LOCUS_01320 116427 116086 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047981.1 protein_id gnl|my_center|LOCUS_01320 117988 116543 gene locus_tag LOCUS_01330 117988 116543 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021368039.1 protein_id gnl|my_center|LOCUS_01330 118614 117985 gene locus_tag LOCUS_01340 118614 117985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 120066 118630 gene locus_tag LOCUS_01350 120066 118630 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674121.1 protein_id gnl|my_center|LOCUS_01350 120417 120079 gene locus_tag LOCUS_01360 120417 120079 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573646.1 protein_id gnl|my_center|LOCUS_01360 121681 120440 gene locus_tag LOCUS_01370 121681 120440 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013245438.1 protein_id gnl|my_center|LOCUS_01370 122109 121795 gene locus_tag LOCUS_01380 122109 121795 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898152.1 protein_id gnl|my_center|LOCUS_01380 122333 124249 gene locus_tag LOCUS_01390 122333 124249 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674124.1 protein_id gnl|my_center|LOCUS_01390 124759 124289 gene locus_tag LOCUS_01400 124759 124289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 125496 124897 gene locus_tag LOCUS_01410 125496 124897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 125841 125593 gene locus_tag LOCUS_01420 125841 125593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 127593 125899 gene locus_tag LOCUS_01430 gene pgcA 127593 125899 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244986.1 protein_id gnl|my_center|LOCUS_01430 128629 127757 gene locus_tag LOCUS_01440 128629 127757 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030302.1 protein_id gnl|my_center|LOCUS_01440 129197 128601 gene locus_tag LOCUS_01450 129197 128601 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037239.1 protein_id gnl|my_center|LOCUS_01450 129847 134247 gene locus_tag LOCUS_01460 129847 134247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 137764 134402 gene locus_tag LOCUS_01470 137764 134402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 137746 137964 gene locus_tag LOCUS_01480 137746 137964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 139308 137968 gene locus_tag LOCUS_01490 139308 137968 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931271.1 protein_id gnl|my_center|LOCUS_01490 140212 139394 gene locus_tag LOCUS_01500 140212 139394 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963680.1 protein_id gnl|my_center|LOCUS_01500 140293 141021 gene locus_tag LOCUS_01510 140293 141021 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861813.1 protein_id gnl|my_center|LOCUS_01510 142241 141018 gene locus_tag LOCUS_01520 142241 141018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223273.1 protein_id gnl|my_center|LOCUS_01520 143660 142245 gene locus_tag LOCUS_01530 143660 142245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 144596 143766 gene locus_tag LOCUS_01540 144596 143766 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432034.1 protein_id gnl|my_center|LOCUS_01540 146704 144812 gene locus_tag LOCUS_01550 146704 144812 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943600.1 protein_id gnl|my_center|LOCUS_01550 148430 146691 gene locus_tag LOCUS_01560 148430 146691 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966684.1 protein_id gnl|my_center|LOCUS_01560 148918 148490 gene locus_tag LOCUS_01570 148918 148490 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048550.1 protein_id gnl|my_center|LOCUS_01570 151143 149017 gene locus_tag LOCUS_01580 151143 149017 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861604.1 protein_id gnl|my_center|LOCUS_01580 151862 151149 gene locus_tag LOCUS_01590 151862 151149 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861605.1 protein_id gnl|my_center|LOCUS_01590 153985 152003 gene locus_tag LOCUS_01600 gene uvrB 153985 152003 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243787.1 protein_id gnl|my_center|LOCUS_01600 155456 153978 gene locus_tag LOCUS_01610 gene ctpA 155456 153978 CDS product carboxy-terminal processing protease CtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231186.1 protein_id gnl|my_center|LOCUS_01610 155952 155551 gene locus_tag LOCUS_01620 155952 155551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 156467 155958 gene locus_tag LOCUS_01630 156467 155958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 157903 156464 gene locus_tag LOCUS_01640 157903 156464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 158952 158050 gene locus_tag LOCUS_01650 gene ftsX 158952 158050 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732506.1 protein_id gnl|my_center|LOCUS_01650 159634 158945 gene locus_tag LOCUS_01660 gene ftsE 159634 158945 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985455.1 protein_id gnl|my_center|LOCUS_01660 161074 159674 gene locus_tag LOCUS_01670 161074 159674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 161967 161071 gene locus_tag LOCUS_01680 gene ftsX 161967 161071 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968247.1 protein_id gnl|my_center|LOCUS_01680 162649 161960 gene locus_tag LOCUS_01690 gene ftsE 162649 161960 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130964.1 protein_id gnl|my_center|LOCUS_01690 163531 162767 gene locus_tag LOCUS_01700 163531 162767 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836613.1 protein_id gnl|my_center|LOCUS_01700 163652 164095 gene locus_tag LOCUS_01710 163652 164095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 165139 164276 gene locus_tag LOCUS_01720 165139 164276 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391779.1 protein_id gnl|my_center|LOCUS_01720 166279 165236 gene locus_tag LOCUS_01730 gene prfB 166279 165236 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886623.1 protein_id gnl|my_center|LOCUS_01730 168695 166350 gene locus_tag LOCUS_01740 gene secA 168695 166350 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722642.1 protein_id gnl|my_center|LOCUS_01740 169003 168824 gene locus_tag LOCUS_01750 169003 168824 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059082.1 protein_id gnl|my_center|LOCUS_01750 169571 169215 gene locus_tag LOCUS_01760 169571 169215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 169935 169738 gene locus_tag LOCUS_01770 169935 169738 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391770.1 protein_id gnl|my_center|LOCUS_01770 170633 169941 gene locus_tag LOCUS_01780 170633 169941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 171782 170634 gene locus_tag LOCUS_01790 gene comFA 171782 170634 CDS product ATP-dependent helicase ComFA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225367.1 protein_id gnl|my_center|LOCUS_01790 172681 172019 gene locus_tag LOCUS_01800 172681 172019 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475996.1 protein_id gnl|my_center|LOCUS_01800 173011 172682 gene locus_tag LOCUS_01810 173011 172682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 173831 173022 gene locus_tag LOCUS_01820 173831 173022 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367542.1 protein_id gnl|my_center|LOCUS_01820 174242 173865 gene locus_tag LOCUS_01830 174242 173865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 175687 174314 gene locus_tag LOCUS_01840 gene pdaC 175687 174314 CDS product peptidoglycan-N-acetylmuramic acid deacetylase PdaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245023.1 protein_id gnl|my_center|LOCUS_01840 177694 175829 gene locus_tag LOCUS_01850 177694 175829 CDS product PTS transporter subunit IIBCA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860826.1 protein_id gnl|my_center|LOCUS_01850 179369 177705 gene locus_tag LOCUS_01860 179369 177705 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860825.1 protein_id gnl|my_center|LOCUS_01860 180213 179311 gene locus_tag LOCUS_01870 180213 179311 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170324993.1 protein_id gnl|my_center|LOCUS_01870 181084 180317 gene locus_tag LOCUS_01880 181084 180317 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434714.1 protein_id gnl|my_center|LOCUS_01880 181811 181074 gene locus_tag LOCUS_01890 181811 181074 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860824.1 protein_id gnl|my_center|LOCUS_01890 182932 181820 gene locus_tag LOCUS_01900 182932 181820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 183846 183070 gene locus_tag LOCUS_01910 183846 183070 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245153.1 protein_id gnl|my_center|LOCUS_01910 186185 183969 gene locus_tag LOCUS_01920 186185 183969 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454973.1 protein_id gnl|my_center|LOCUS_01920 186954 186229 gene locus_tag LOCUS_01930 186954 186229 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966072.1 protein_id gnl|my_center|LOCUS_01930 187291 188730 gene locus_tag LOCUS_01940 187291 188730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 189032 188745 gene locus_tag LOCUS_01950 189032 188745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 189835 189032 gene locus_tag LOCUS_01960 gene proC 189835 189032 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360723.1 protein_id gnl|my_center|LOCUS_01960 190884 189847 gene locus_tag LOCUS_01970 190884 189847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 191051 191494 gene locus_tag LOCUS_01980 191051 191494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 191510 191716 gene locus_tag LOCUS_01990 191510 191716 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359683.1 protein_id gnl|my_center|LOCUS_01990 191735 193045 gene locus_tag LOCUS_02000 191735 193045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 193956 195401 gene locus_tag LOCUS_02010 gene trpE 193956 195401 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003159249.1 protein_id gnl|my_center|LOCUS_02010 195398 195970 gene locus_tag LOCUS_02020 195398 195970 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880323.1 protein_id gnl|my_center|LOCUS_02020 195964 196986 gene locus_tag LOCUS_02030 gene trpD 195964 196986 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943017.1 protein_id gnl|my_center|LOCUS_02030 196983 197732 gene locus_tag LOCUS_02040 gene trpC 196983 197732 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946569.1 protein_id gnl|my_center|LOCUS_02040 197743 198324 gene locus_tag LOCUS_02050 197743 198324 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966436.1 protein_id gnl|my_center|LOCUS_02050 198321 199505 gene locus_tag LOCUS_02060 gene trpB 198321 199505 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966435.1 protein_id gnl|my_center|LOCUS_02060 199498 200292 gene locus_tag LOCUS_02070 gene trpA 199498 200292 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966434.1 protein_id gnl|my_center|LOCUS_02070 201243 200368 gene locus_tag LOCUS_02080 201243 200368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 201990 201343 gene locus_tag LOCUS_02090 201990 201343 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268654.1 protein_id gnl|my_center|LOCUS_02090 202701 201997 gene locus_tag LOCUS_02100 202701 201997 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081214215.1 protein_id gnl|my_center|LOCUS_02100 203479 202703 gene locus_tag LOCUS_02110 203479 202703 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262678.1 protein_id gnl|my_center|LOCUS_02110 204437 203481 gene locus_tag LOCUS_02120 204437 203481 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002937293.1 protein_id gnl|my_center|LOCUS_02120 205331 204450 gene locus_tag LOCUS_02130 205331 204450 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941421.1 protein_id gnl|my_center|LOCUS_02130 206601 205420 gene locus_tag LOCUS_02140 206601 205420 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101996.1 protein_id gnl|my_center|LOCUS_02140 208229 206832 gene locus_tag LOCUS_02150 208229 206832 CDS product peptidase S24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461851.1 protein_id gnl|my_center|LOCUS_02150 209187 208201 gene locus_tag LOCUS_02160 209187 208201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 209656 209441 gene locus_tag LOCUS_02170 209656 209441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 210241 212055 gene locus_tag LOCUS_02180 gene glmS 210241 212055 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432446.1 protein_id gnl|my_center|LOCUS_02180 212805 212164 gene locus_tag LOCUS_02190 212805 212164 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392875.1 protein_id gnl|my_center|LOCUS_02190 214818 212905 gene locus_tag LOCUS_02200 214818 212905 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837281.1 protein_id gnl|my_center|LOCUS_02200 216773 214824 gene locus_tag LOCUS_02210 216773 214824 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906117.1 protein_id gnl|my_center|LOCUS_02210 217524 216760 gene locus_tag LOCUS_02220 217524 216760 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860752.1 protein_id gnl|my_center|LOCUS_02220 218604 217585 gene locus_tag LOCUS_02230 218604 217585 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986639.1 protein_id gnl|my_center|LOCUS_02230 219266 218601 gene locus_tag LOCUS_02240 219266 218601 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986640.1 protein_id gnl|my_center|LOCUS_02240 219963 219412 gene locus_tag LOCUS_02250 219963 219412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 220129 221811 gene locus_tag LOCUS_02260 gene pdcB 220129 221811 CDS product phosphodiesterase PdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437448.1 protein_id gnl|my_center|LOCUS_02260 222711 221824 gene locus_tag LOCUS_02270 222711 221824 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357090.1 protein_id gnl|my_center|LOCUS_02270 222863 223732 gene locus_tag LOCUS_02280 222863 223732 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976957.1 protein_id gnl|my_center|LOCUS_02280 224177 223722 gene locus_tag LOCUS_02290 224177 223722 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861860.1 protein_id gnl|my_center|LOCUS_02290 224653 224237 gene locus_tag LOCUS_02300 224653 224237 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363016.1 protein_id gnl|my_center|LOCUS_02300 225633 224656 gene locus_tag LOCUS_02310 225633 224656 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387687.1 protein_id gnl|my_center|LOCUS_02310 226534 225635 gene locus_tag LOCUS_02320 gene murQ 226534 225635 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355340.1 protein_id gnl|my_center|LOCUS_02320 227400 226552 gene locus_tag LOCUS_02330 227400 226552 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948948.1 protein_id gnl|my_center|LOCUS_02330 227900 227421 gene locus_tag LOCUS_02340 227900 227421 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355337.1 protein_id gnl|my_center|LOCUS_02340 228746 227919 gene locus_tag LOCUS_02350 228746 227919 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196782459.1 protein_id gnl|my_center|LOCUS_02350 229548 228739 gene locus_tag LOCUS_02360 229548 228739 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377923.1 protein_id gnl|my_center|LOCUS_02360 230602 229775 gene locus_tag LOCUS_02370 230602 229775 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196782459.1 protein_id gnl|my_center|LOCUS_02370 231398 230595 gene locus_tag LOCUS_02380 231398 230595 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377923.1 protein_id gnl|my_center|LOCUS_02380 231992 231597 gene locus_tag LOCUS_02390 231992 231597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 232291 231989 gene locus_tag LOCUS_02400 232291 231989 CDS product DUF2089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116156.1 protein_id gnl|my_center|LOCUS_02400 232592 233683 gene locus_tag LOCUS_02410 232592 233683 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062822309.1 protein_id gnl|my_center|LOCUS_02410 234581 233835 gene locus_tag LOCUS_02420 gene tpiA 234581 233835 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292815.1 protein_id gnl|my_center|LOCUS_02420 235778 234600 gene locus_tag LOCUS_02430 235778 234600 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989997.1 protein_id gnl|my_center|LOCUS_02430 236010 237617 gene locus_tag LOCUS_02440 236010 237617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 238144 237704 gene locus_tag LOCUS_02450 238144 237704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 239217 238195 gene locus_tag LOCUS_02460 239217 238195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 240895 239384 gene locus_tag LOCUS_02470 240895 239384 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728204.1 protein_id gnl|my_center|LOCUS_02470 243347 241956 gene locus_tag LOCUS_02480 243347 241956 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036271.1 protein_id gnl|my_center|LOCUS_02480 244429 243425 gene locus_tag LOCUS_02490 244429 243425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 244601 244431 gene locus_tag LOCUS_02500 244601 244431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 244555 245196 gene locus_tag LOCUS_02510 244555 245196 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002907310.1 protein_id gnl|my_center|LOCUS_02510 245267 245542 gene locus_tag LOCUS_02520 245267 245542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 246687 245566 gene locus_tag LOCUS_02530 246687 245566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 248199 246718 gene locus_tag LOCUS_02540 248199 246718 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931832.1 protein_id gnl|my_center|LOCUS_02540 248481 248218 gene locus_tag LOCUS_02550 248481 248218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02550 249553 248510 gene locus_tag LOCUS_02560 249553 248510 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001355834.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02560 251550 249634 gene locus_tag LOCUS_02570 251550 249634 CDS product transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861840.1 protein_id gnl|my_center|LOCUS_02570 252525 251611 gene locus_tag LOCUS_02580 252525 251611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 254189 252750 gene locus_tag LOCUS_02590 gene glgA 254189 252750 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922502.1 protein_id gnl|my_center|LOCUS_02590 255298 254189 gene locus_tag LOCUS_02600 gene glgD 255298 254189 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418641.1 protein_id gnl|my_center|LOCUS_02600 256437 255301 gene locus_tag LOCUS_02610 256437 255301 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922500.1 protein_id gnl|my_center|LOCUS_02610 257475 256720 gene locus_tag LOCUS_02620 257475 256720 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157662.1 protein_id gnl|my_center|LOCUS_02620 258337 257468 gene locus_tag LOCUS_02630 258337 257468 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461074.1 protein_id gnl|my_center|LOCUS_02630 259315 258368 gene locus_tag LOCUS_02640 259315 258368 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945303.1 protein_id gnl|my_center|LOCUS_02640 259439 259287 gene locus_tag LOCUS_02650 259439 259287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 260502 259825 gene locus_tag LOCUS_02660 260502 259825 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964066.1 protein_id gnl|my_center|LOCUS_02660 260851 260483 gene locus_tag LOCUS_02670 260851 260483 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440040.1 protein_id gnl|my_center|LOCUS_02670 262035 260953 gene locus_tag LOCUS_02680 262035 260953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 262522 262046 gene locus_tag LOCUS_02690 gene rlmH 262522 262046 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702726.1 protein_id gnl|my_center|LOCUS_02690 263034 262519 gene locus_tag LOCUS_02700 263034 262519 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896384.1 protein_id gnl|my_center|LOCUS_02700 264510 263092 gene locus_tag LOCUS_02710 264510 263092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 265363 264698 gene locus_tag LOCUS_02720 265363 264698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 266656 265454 gene locus_tag LOCUS_02730 266656 265454 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987112.1 protein_id gnl|my_center|LOCUS_02730 268576 266669 gene locus_tag LOCUS_02740 268576 266669 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903247.1 protein_id gnl|my_center|LOCUS_02740 269148 268780 gene locus_tag LOCUS_02750 269148 268780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 269922 269296 gene locus_tag LOCUS_02760 269922 269296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 271249 270011 gene locus_tag LOCUS_02770 271249 270011 CDS product DUF3322 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459256.1 protein_id gnl|my_center|LOCUS_02770 274529 271218 gene locus_tag LOCUS_02780 274529 271218 CDS product SbcC/MukB-like Walker B domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392027.1 protein_id gnl|my_center|LOCUS_02780 275133 274501 gene locus_tag LOCUS_02790 275133 274501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 276554 275130 gene locus_tag LOCUS_02800 276554 275130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 277882 276791 gene locus_tag LOCUS_02810 277882 276791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 278634 277885 gene locus_tag LOCUS_02820 278634 277885 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641659.1 protein_id gnl|my_center|LOCUS_02820 279990 278650 gene locus_tag LOCUS_02830 gene dnaB 279990 278650 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375647.1 protein_id gnl|my_center|LOCUS_02830 280446 280000 gene locus_tag LOCUS_02840 gene rplI 280446 280000 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864228.1 protein_id gnl|my_center|LOCUS_02840 282415 280424 gene locus_tag LOCUS_02850 282415 280424 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673985.1 protein_id gnl|my_center|LOCUS_02850 283316 282393 gene locus_tag LOCUS_02860 283316 282393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 283607 283377 gene locus_tag LOCUS_02870 gene rpsR 283607 283377 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831354.1 protein_id gnl|my_center|LOCUS_02870 284098 283625 gene locus_tag LOCUS_02880 gene ssb 284098 283625 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288368.1 protein_id gnl|my_center|LOCUS_02880 284417 284124 gene locus_tag LOCUS_02890 gene rpsF 284417 284124 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233779.1 protein_id gnl|my_center|LOCUS_02890 286125 284563 gene locus_tag LOCUS_02900 286125 284563 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_02900 287412 286243 gene locus_tag LOCUS_02910 287412 286243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 288161 287436 gene locus_tag LOCUS_02920 288161 287436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 290773 288158 gene locus_tag LOCUS_02930 290773 288158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 292056 290965 gene locus_tag LOCUS_02940 292056 290965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 292658 292050 gene locus_tag LOCUS_02950 292658 292050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02950 293529 292855 gene locus_tag LOCUS_02960 293529 292855 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704149.1 protein_id gnl|my_center|LOCUS_02960 294265 293513 gene locus_tag LOCUS_02970 294265 293513 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476103.1 protein_id gnl|my_center|LOCUS_02970 295081 294614 gene locus_tag LOCUS_02980 295081 294614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 295105 295344 gene locus_tag LOCUS_02990 295105 295344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02990 295471 296475 gene locus_tag LOCUS_03000 295471 296475 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085938409.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03000 297034 296810 gene locus_tag LOCUS_03010 297034 296810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 298032 297064 gene locus_tag LOCUS_03020 298032 297064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 299446 298016 gene locus_tag LOCUS_03030 299446 298016 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091276.1 protein_id gnl|my_center|LOCUS_03030 300591 299443 gene locus_tag LOCUS_03040 300591 299443 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203004.1 protein_id gnl|my_center|LOCUS_03040 301542 300601 gene locus_tag LOCUS_03050 301542 300601 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383750.1 protein_id gnl|my_center|LOCUS_03050 302466 301546 gene locus_tag LOCUS_03060 302466 301546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 304081 302855 gene locus_tag LOCUS_03070 304081 302855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 305340 304180 gene locus_tag LOCUS_03080 305340 304180 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267353.1 protein_id gnl|my_center|LOCUS_03080 306404 305367 gene locus_tag LOCUS_03090 306404 305367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 307306 306416 gene locus_tag LOCUS_03100 307306 306416 CDS product ATP-grasp fold amidoligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107724.1 protein_id gnl|my_center|LOCUS_03100 307785 307312 gene locus_tag LOCUS_03110 307785 307312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 308886 307792 gene locus_tag LOCUS_03120 gene alr 308886 307792 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963814.1 protein_id gnl|my_center|LOCUS_03120 309353 308886 gene locus_tag LOCUS_03130 309353 308886 CDS product UDP-N-acetylglucosamine--LPS N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686635.1 protein_id gnl|my_center|LOCUS_03130 310279 309353 gene locus_tag LOCUS_03140 310279 309353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03140 310590 310429 gene locus_tag LOCUS_03150 310590 310429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03150 311734 310622 gene locus_tag LOCUS_03160 311734 310622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 312064 311756 gene locus_tag LOCUS_03170 312064 311756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 312627 312061 gene locus_tag LOCUS_03180 312627 312061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 313368 312643 gene locus_tag LOCUS_03190 313368 312643 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986981.1 protein_id gnl|my_center|LOCUS_03190 314161 313370 gene locus_tag LOCUS_03200 314161 313370 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966343.1 protein_id gnl|my_center|LOCUS_03200 314857 314165 gene locus_tag LOCUS_03210 314857 314165 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393128.1 protein_id gnl|my_center|LOCUS_03210 315520 314993 gene locus_tag LOCUS_03220 gene rfaH 315520 314993 CDS product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192407.1 protein_id gnl|my_center|LOCUS_03220 316701 315520 gene locus_tag LOCUS_03230 316701 315520 CDS product undecaprenyl-phosphate galactose phosphotransferase WbaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097853.1 protein_id gnl|my_center|LOCUS_03230 317129 316920 gene locus_tag LOCUS_03240 317129 316920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 317476 318837 gene locus_tag LOCUS_03250 317476 318837 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015727.1 protein_id gnl|my_center|LOCUS_03250 318908 319228 gene locus_tag LOCUS_03260 318908 319228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 320614 319235 gene locus_tag LOCUS_03270 320614 319235 CDS product ISNCY family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589001.1 protein_id gnl|my_center|LOCUS_03270 320814 320981 gene locus_tag LOCUS_03280 320814 320981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03280 321107 321877 gene locus_tag LOCUS_03290 321107 321877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03290 323232 322591 gene locus_tag LOCUS_03300 gene ispD 323232 322591 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235019.1 protein_id gnl|my_center|LOCUS_03300 323367 324617 gene locus_tag LOCUS_03310 323367 324617 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948284.1 protein_id gnl|my_center|LOCUS_03310 324622 325083 gene locus_tag LOCUS_03320 gene mscL 324622 325083 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814614.1 protein_id gnl|my_center|LOCUS_03320 326000 325251 gene locus_tag LOCUS_03330 326000 325251 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208843.1 protein_id gnl|my_center|LOCUS_03330 326972 326079 gene locus_tag LOCUS_03340 326972 326079 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721732.1 protein_id gnl|my_center|LOCUS_03340 328399 326969 gene locus_tag LOCUS_03350 328399 326969 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206473.1 protein_id gnl|my_center|LOCUS_03350 328984 328415 gene locus_tag LOCUS_03360 328984 328415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 330394 329012 gene locus_tag LOCUS_03370 330394 329012 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003725316.1 protein_id gnl|my_center|LOCUS_03370 331299 330568 gene locus_tag LOCUS_03380 331299 330568 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208843.1 protein_id gnl|my_center|LOCUS_03380 332062 331289 gene locus_tag LOCUS_03390 332062 331289 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966274.1 protein_id gnl|my_center|LOCUS_03390 332365 332222 gene locus_tag LOCUS_03400 332365 332222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 333844 332504 gene locus_tag LOCUS_03410 gene mgtE 333844 332504 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392647.1 protein_id gnl|my_center|LOCUS_03410 335936 334011 gene locus_tag LOCUS_03420 335936 334011 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172629.1 protein_id gnl|my_center|LOCUS_03420 336076 336426 gene locus_tag LOCUS_03430 336076 336426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 336687 336505 gene locus_tag LOCUS_03440 336687 336505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 337985 336744 gene locus_tag LOCUS_03450 gene dinB 337985 336744 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392743.1 protein_id gnl|my_center|LOCUS_03450 338137 338715 gene locus_tag LOCUS_03460 338137 338715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 338770 338997 gene locus_tag LOCUS_03470 338770 338997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 340015 339041 gene locus_tag LOCUS_03480 gene pta 340015 339041 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067221.1 protein_id gnl|my_center|LOCUS_03480 343336 340196 gene locus_tag LOCUS_03490 343336 340196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 343828 343562 gene locus_tag LOCUS_03500 343828 343562 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566007.1 protein_id gnl|my_center|LOCUS_03500 344393 343962 gene locus_tag LOCUS_03510 344393 343962 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809665.1 protein_id gnl|my_center|LOCUS_03510 345145 344390 gene locus_tag LOCUS_03520 gene yaaA 345145 344390 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861343.1 protein_id gnl|my_center|LOCUS_03520 345340 346719 gene locus_tag LOCUS_03530 345340 346719 CDS product ISNCY family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589001.1 protein_id gnl|my_center|LOCUS_03530 348437 346926 gene locus_tag LOCUS_03540 348437 346926 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064987.1 protein_id gnl|my_center|LOCUS_03540 349994 348564 gene locus_tag LOCUS_03550 349994 348564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 351926 350025 gene locus_tag LOCUS_03560 351926 350025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 353023 352154 gene locus_tag LOCUS_03570 353023 352154 CDS product beta-1,6-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767582.1 protein_id gnl|my_center|LOCUS_03570 354499 353036 gene locus_tag LOCUS_03580 354499 353036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 355580 354492 gene locus_tag LOCUS_03590 355580 354492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 356635 355598 gene locus_tag LOCUS_03600 356635 355598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 357931 356822 gene locus_tag LOCUS_03610 357931 356822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 359028 357940 gene locus_tag LOCUS_03620 359028 357940 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476426.1 protein_id gnl|my_center|LOCUS_03620 360087 359044 gene locus_tag LOCUS_03630 360087 359044 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101653.1 protein_id gnl|my_center|LOCUS_03630 361203 360109 gene locus_tag LOCUS_03640 361203 360109 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476099.1 protein_id gnl|my_center|LOCUS_03640 362131 361196 gene locus_tag LOCUS_03650 362131 361196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 362715 362128 gene locus_tag LOCUS_03660 362715 362128 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902061.1 protein_id gnl|my_center|LOCUS_03660 364186 362726 gene locus_tag LOCUS_03670 364186 362726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 364828 365703 gene locus_tag LOCUS_03680 gene galU 364828 365703 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890959.1 protein_id gnl|my_center|LOCUS_03680 365797 366639 gene locus_tag LOCUS_03690 365797 366639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 367548 366691 gene locus_tag LOCUS_03700 gene prmC 367548 366691 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267042.1 protein_id gnl|my_center|LOCUS_03700 368620 367541 gene locus_tag LOCUS_03710 gene prfA 368620 367541 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183530.1 protein_id gnl|my_center|LOCUS_03710 369374 368784 gene locus_tag LOCUS_03720 369374 368784 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243018.1 protein_id gnl|my_center|LOCUS_03720 369568 370793 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttaaatccactagctcatatagagctagac 371242 370952 gene locus_tag LOCUS_03730 gene cas2 371242 370952 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002989044.1 protein_id gnl|my_center|LOCUS_03730 372280 371249 gene locus_tag LOCUS_03740 gene cas1c 372280 371249 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176711.1 protein_id gnl|my_center|LOCUS_03740 372947 372285 gene locus_tag LOCUS_03750 gene cas4 372947 372285 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003060901.1 protein_id gnl|my_center|LOCUS_03750 373797 372934 gene locus_tag LOCUS_03760 gene cas7c 373797 372934 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263666.1 protein_id gnl|my_center|LOCUS_03760 375625 373778 gene locus_tag LOCUS_03770 gene cas8c 375625 373778 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922511.1 protein_id gnl|my_center|LOCUS_03770 376349 375609 gene locus_tag LOCUS_03780 gene cas5c 376349 375609 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922512.1 protein_id gnl|my_center|LOCUS_03780 378766 376364 gene locus_tag LOCUS_03790 378766 376364 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263668.1 protein_id gnl|my_center|LOCUS_03790 380384 380172 gene locus_tag LOCUS_03800 380384 380172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 381035 380832 gene locus_tag LOCUS_03810 gene rpmE 381035 380832 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151132.1 protein_id gnl|my_center|LOCUS_03810 382219 381161 gene locus_tag LOCUS_03820 382219 381161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 383510 383403 gene locus_tag LOCUS_r00010 383510 383403 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 386460 383562 gene locus_tag LOCUS_r00020 386460 383562 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 388227 386691 gene locus_tag LOCUS_r00030 388227 386691 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 390122 388641 gene locus_tag LOCUS_03830 gene lysS 390122 388641 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242743.1 protein_id gnl|my_center|LOCUS_03830 390542 390868 gene locus_tag LOCUS_03840 390542 390868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 390906 391394 gene locus_tag LOCUS_03850 390906 391394 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459411.1 protein_id gnl|my_center|LOCUS_03850 391387 392139 gene locus_tag LOCUS_03860 391387 392139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 392218 392763 gene locus_tag LOCUS_03870 392218 392763 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041381.1 protein_id gnl|my_center|LOCUS_03870 393262 392807 gene locus_tag LOCUS_03880 393262 392807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 393880 393275 gene locus_tag LOCUS_03890 393880 393275 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948000.1 protein_id gnl|my_center|LOCUS_03890 394790 394185 gene locus_tag LOCUS_03900 394790 394185 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198805.1 protein_id gnl|my_center|LOCUS_03900 395788 394787 gene locus_tag LOCUS_03910 gene dusB 395788 394787 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243741.1 protein_id gnl|my_center|LOCUS_03910 396662 395778 gene locus_tag LOCUS_03920 gene hslO 396662 395778 CDS product redox-regulated molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656366.1 protein_id gnl|my_center|LOCUS_03920 396860 398131 gene locus_tag LOCUS_03930 396860 398131 CDS product ISNCY family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589001.1 protein_id gnl|my_center|LOCUS_03930 398388 399144 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq attgaaatccacaagttcatgagaaacttgac 400580 399294 gene locus_tag LOCUS_03940 400580 399294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 401277 400594 gene locus_tag LOCUS_03950 401277 400594 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829999.1 protein_id gnl|my_center|LOCUS_03950 401499 404162 gene locus_tag LOCUS_03960 401499 404162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 404146 407355 gene locus_tag LOCUS_03970 404146 407355 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020226099.1 protein_id gnl|my_center|LOCUS_03970 407818 407366 gene locus_tag LOCUS_03980 407818 407366 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_03980 408926 408459 gene locus_tag LOCUS_03990 408926 408459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861726.1 protein_id gnl|my_center|LOCUS_03990 409794 408904 gene locus_tag LOCUS_04000 409794 408904 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438032.1 protein_id gnl|my_center|LOCUS_04000 410486 409926 gene locus_tag LOCUS_04010 410486 409926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 411489 410869 gene locus_tag LOCUS_04020 411489 410869 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_04020 412475 411594 gene locus_tag LOCUS_04030 412475 411594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 412938 412459 gene locus_tag LOCUS_04040 412938 412459 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944439.1 protein_id gnl|my_center|LOCUS_04040 413083 413733 gene locus_tag LOCUS_04050 413083 413733 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898027.1 protein_id gnl|my_center|LOCUS_04050 415606 413750 gene locus_tag LOCUS_04060 gene mnmG 415606 413750 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183567.1 protein_id gnl|my_center|LOCUS_04060 415957 415622 gene locus_tag LOCUS_04070 415957 415622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 417452 416100 gene locus_tag LOCUS_04080 417452 416100 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289277.1 protein_id gnl|my_center|LOCUS_04080 418272 417508 gene locus_tag LOCUS_04090 418272 417508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 420445 418400 gene locus_tag LOCUS_04100 gene ftsH 420445 418400 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733155.1 protein_id gnl|my_center|LOCUS_04100 421003 420464 gene locus_tag LOCUS_04110 gene hpt 421003 420464 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905038.1 protein_id gnl|my_center|LOCUS_04110 422251 421031 gene locus_tag LOCUS_04120 422251 421031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04120 424153 422297 gene locus_tag LOCUS_04130 424153 422297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 424648 424265 gene locus_tag LOCUS_04140 424648 424265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 424811 424635 gene locus_tag LOCUS_04150 424811 424635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 426153 425155 gene locus_tag LOCUS_04160 426153 425155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 426572 426156 gene locus_tag LOCUS_04170 426572 426156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 426986 426576 gene locus_tag LOCUS_04180 426986 426576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 433214 427011 gene locus_tag LOCUS_04190 433214 427011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 433632 433246 gene locus_tag LOCUS_04200 433632 433246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 433895 433635 gene locus_tag LOCUS_04210 433895 433635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 434600 433914 gene locus_tag LOCUS_04220 434600 433914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 437437 434600 gene locus_tag LOCUS_04230 437437 434600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 438050 437751 gene locus_tag LOCUS_04240 438050 437751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 438616 438050 gene locus_tag LOCUS_04250 438616 438050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 438970 438617 gene locus_tag LOCUS_04260 438970 438617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 439380 438967 gene locus_tag LOCUS_04270 439380 438967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 439673 439374 gene locus_tag LOCUS_04280 439673 439374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 440005 439688 gene locus_tag LOCUS_04290 440005 439688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 440197 440036 gene locus_tag LOCUS_04300 440197 440036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 441139 440201 gene locus_tag LOCUS_04310 441139 440201 CDS product DUF5309 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093935635.1 protein_id gnl|my_center|LOCUS_04310 441763 441143 gene locus_tag LOCUS_04320 441763 441143 CDS product phage scaffolding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002403766.1 protein_id gnl|my_center|LOCUS_04320 442501 442037 gene locus_tag LOCUS_04330 442501 442037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 442751 442557 gene locus_tag LOCUS_04340 442751 442557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 443997 442756 gene locus_tag LOCUS_04350 443997 442756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 445429 443990 gene locus_tag LOCUS_04360 445429 443990 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047637.1 protein_id gnl|my_center|LOCUS_04360 446685 445426 gene locus_tag LOCUS_04370 446685 445426 CDS product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674653.1 protein_id gnl|my_center|LOCUS_04370 447586 446672 gene locus_tag LOCUS_04380 447586 446672 CDS product terminase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099686546.1 protein_id gnl|my_center|LOCUS_04380 447988 447608 gene locus_tag LOCUS_04390 447988 447608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 448164 447985 gene locus_tag LOCUS_04400 448164 447985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 448756 448298 gene locus_tag LOCUS_04410 448756 448298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 450112 449528 gene locus_tag LOCUS_04420 450112 449528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 450317 450117 gene locus_tag LOCUS_04430 450317 450117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 450645 450310 gene locus_tag LOCUS_04440 450645 450310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 451120 450662 gene locus_tag LOCUS_04450 gene ssb 451120 450662 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722552.1 protein_id gnl|my_center|LOCUS_04450 451847 451137 gene locus_tag LOCUS_04460 451847 451137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 452492 451866 gene locus_tag LOCUS_04470 452492 451866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 453331 452489 gene locus_tag LOCUS_04480 453331 452489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 453959 453300 gene locus_tag LOCUS_04490 453959 453300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 454306 453965 gene locus_tag LOCUS_04500 454306 453965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 455279 454308 gene locus_tag LOCUS_04510 455279 454308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 455461 455276 gene locus_tag LOCUS_04520 455461 455276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 456472 455474 gene locus_tag LOCUS_04530 456472 455474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 457407 456502 gene locus_tag LOCUS_04540 457407 456502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 457923 457435 gene locus_tag LOCUS_04550 457923 457435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 458453 457932 gene locus_tag LOCUS_04560 458453 457932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 458742 458446 gene locus_tag LOCUS_04570 458742 458446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 459458 458727 gene locus_tag LOCUS_04580 459458 458727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 460270 459458 gene locus_tag LOCUS_04590 460270 459458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 460678 460271 gene locus_tag LOCUS_04600 460678 460271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 460826 460653 gene locus_tag LOCUS_04610 460826 460653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 461588 460887 gene locus_tag LOCUS_04620 461588 460887 CDS product Rha family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057801863.1 protein_id gnl|my_center|LOCUS_04620 461811 461632 gene locus_tag LOCUS_04630 461811 461632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 462048 461848 gene locus_tag LOCUS_04640 462048 461848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 462326 462075 gene locus_tag LOCUS_04650 462326 462075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 462462 463097 gene locus_tag LOCUS_04660 462462 463097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 463150 463464 gene locus_tag LOCUS_04670 463150 463464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 463597 464937 gene locus_tag LOCUS_04680 463597 464937 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861760.1 protein_id gnl|my_center|LOCUS_04680 465232 464951 gene locus_tag LOCUS_04690 465232 464951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 465830 465405 gene locus_tag LOCUS_04700 465830 465405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 466403 465846 gene locus_tag LOCUS_04710 466403 465846 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860666.1 protein_id gnl|my_center|LOCUS_04710 467008 466400 gene locus_tag LOCUS_04720 467008 466400 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763312.1 protein_id gnl|my_center|LOCUS_04720 467121 468014 gene locus_tag LOCUS_04730 467121 468014 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359341.1 protein_id gnl|my_center|LOCUS_04730 469362 468250 gene locus_tag LOCUS_04740 469362 468250 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258150.1 protein_id gnl|my_center|LOCUS_04740 470367 469381 gene locus_tag LOCUS_04750 gene mbl 470367 469381 CDS product cell shape-determining protein Mbl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227776.1 protein_id gnl|my_center|LOCUS_04750 471117 470497 gene locus_tag LOCUS_04760 471117 470497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 472761 471181 gene locus_tag LOCUS_04770 472761 471181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 474280 472781 gene locus_tag LOCUS_04780 474280 472781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 474616 474419 gene locus_tag LOCUS_04790 474616 474419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 475304 474744 gene locus_tag LOCUS_04800 475304 474744 CDS product YdeI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969624.1 protein_id gnl|my_center|LOCUS_04800 476556 475375 gene locus_tag LOCUS_04810 476556 475375 CDS product O-antigen ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835622.1 protein_id gnl|my_center|LOCUS_04810 477367 476681 gene locus_tag LOCUS_04820 477367 476681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 478071 477385 gene locus_tag LOCUS_04830 478071 477385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 478792 478103 gene locus_tag LOCUS_04840 478792 478103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 480103 478862 gene locus_tag LOCUS_04850 480103 478862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 480804 480100 gene locus_tag LOCUS_04860 gene rgbR 480804 480100 CDS product two-component system response regulator RgbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438019.1 protein_id gnl|my_center|LOCUS_04860 482172 480931 gene locus_tag LOCUS_04870 482172 480931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 482748 482548 gene locus_tag LOCUS_04880 482748 482548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 484377 483166 gene locus_tag LOCUS_04890 484377 483166 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090602.1 protein_id gnl|my_center|LOCUS_04890 485528 484374 gene locus_tag LOCUS_04900 485528 484374 CDS product YhfX family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674095.1 protein_id gnl|my_center|LOCUS_04900 486631 485510 gene locus_tag LOCUS_04910 486631 485510 CDS product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674094.1 protein_id gnl|my_center|LOCUS_04910 487616 486654 gene locus_tag LOCUS_04920 487616 486654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 488488 487613 gene locus_tag LOCUS_04930 488488 487613 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003597368.1 protein_id gnl|my_center|LOCUS_04930 489803 488499 gene locus_tag LOCUS_04940 489803 488499 CDS product YhfT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573503.1 protein_id gnl|my_center|LOCUS_04940 490176 489808 gene locus_tag LOCUS_04950 490176 489808 CDS product DUF2620 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573501.1 protein_id gnl|my_center|LOCUS_04950 490542 490201 gene locus_tag LOCUS_04960 490542 490201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 491634 490711 gene locus_tag LOCUS_04970 gene yhfZ 491634 490711 CDS product GntR family transcriptional regulator YhfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674092.1 protein_id gnl|my_center|LOCUS_04970 491855 492763 gene locus_tag LOCUS_04980 491855 492763 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949138.1 protein_id gnl|my_center|LOCUS_04980 493064 492780 gene locus_tag LOCUS_04990 493064 492780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 493758 493126 gene locus_tag LOCUS_05000 gene lepB 493758 493126 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246166.1 protein_id gnl|my_center|LOCUS_05000 494124 496703 gene locus_tag LOCUS_05010 494124 496703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 498008 496737 gene locus_tag LOCUS_05020 498008 496737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 498485 498093 gene locus_tag LOCUS_05030 498485 498093 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699947.1 protein_id gnl|my_center|LOCUS_05030 499892 498489 gene locus_tag LOCUS_05040 gene atpD 499892 498489 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425850.1 protein_id gnl|my_center|LOCUS_05040 500744 499896 gene locus_tag LOCUS_05050 gene atpG 500744 499896 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437835.1 protein_id gnl|my_center|LOCUS_05050 502268 500748 gene locus_tag LOCUS_05060 gene atpA 502268 500748 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462231.1 protein_id gnl|my_center|LOCUS_05060 502824 502279 gene locus_tag LOCUS_05070 502824 502279 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425856.1 protein_id gnl|my_center|LOCUS_05070 503330 502812 gene locus_tag LOCUS_05080 gene atpF 503330 502812 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462233.1 protein_id gnl|my_center|LOCUS_05080 503602 503363 gene locus_tag LOCUS_05090 gene atpE 503602 503363 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902609.1 protein_id gnl|my_center|LOCUS_05090 504331 503639 gene locus_tag LOCUS_05100 504331 503639 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356899.1 protein_id gnl|my_center|LOCUS_05100 504699 504331 gene locus_tag LOCUS_05110 504699 504331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 505500 504880 gene locus_tag LOCUS_05120 gene upp 505500 504880 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294095.1 protein_id gnl|my_center|LOCUS_05120 506487 505849 gene locus_tag LOCUS_05130 506487 505849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 507940 506642 gene locus_tag LOCUS_05140 507940 506642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 508634 507897 gene locus_tag LOCUS_05150 508634 507897 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002655975.1 protein_id gnl|my_center|LOCUS_05150 508993 508649 gene locus_tag LOCUS_05160 508993 508649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 510087 509422 gene locus_tag LOCUS_05170 510087 509422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 510617 510477 gene locus_tag LOCUS_05180 510617 510477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 511925 510714 gene locus_tag LOCUS_05190 511925 510714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 512609 512031 gene locus_tag LOCUS_05200 512609 512031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 514043 512757 gene locus_tag LOCUS_05210 514043 512757 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460406.1 protein_id gnl|my_center|LOCUS_05210 514301 514996 gene locus_tag LOCUS_05220 514301 514996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05220 514953 515618 gene locus_tag LOCUS_05230 514953 515618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05230 516625 516173 gene locus_tag LOCUS_05240 516625 516173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 518605 517379 gene locus_tag LOCUS_05250 518605 517379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 519290 518598 gene locus_tag LOCUS_05260 519290 518598 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286278.1 protein_id gnl|my_center|LOCUS_05260 519781 519527 gene locus_tag LOCUS_05270 519781 519527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 520087 519896 gene locus_tag LOCUS_05280 520087 519896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 522055 520088 gene locus_tag LOCUS_05290 gene metG 522055 520088 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947939.1 protein_id gnl|my_center|LOCUS_05290 522722 522345 gene locus_tag LOCUS_05300 522722 522345 CDS product DUF4186 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705325.1 protein_id gnl|my_center|LOCUS_05300 523509 522757 gene locus_tag LOCUS_05310 523509 522757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 524134 523496 gene locus_tag LOCUS_05320 524134 523496 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243153.1 protein_id gnl|my_center|LOCUS_05320 525408 524149 gene locus_tag LOCUS_05330 525408 524149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 526219 525395 gene locus_tag LOCUS_05340 526219 525395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 526779 526354 gene locus_tag LOCUS_05350 526779 526354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 527745 526993 gene locus_tag LOCUS_05360 527745 526993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 528370 527732 gene locus_tag LOCUS_05370 528370 527732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 528963 529193 gene locus_tag LOCUS_05380 528963 529193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 530462 529638 gene locus_tag LOCUS_05390 530462 529638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 530932 530537 gene locus_tag LOCUS_05400 530932 530537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 531079 530942 gene locus_tag LOCUS_05410 531079 530942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 531635 531036 gene locus_tag LOCUS_05420 531635 531036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 533012 531726 gene locus_tag LOCUS_05430 533012 531726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 533703 533017 gene locus_tag LOCUS_05440 533703 533017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 535671 533815 gene locus_tag LOCUS_05450 535671 533815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 537805 535664 gene locus_tag LOCUS_05460 537805 535664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 539455 537950 gene locus_tag LOCUS_05470 539455 537950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 539669 539460 gene locus_tag LOCUS_05480 539669 539460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 539928 540638 gene locus_tag LOCUS_05490 539928 540638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 540923 540657 gene locus_tag LOCUS_05500 540923 540657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 541896 540991 gene locus_tag LOCUS_05510 541896 540991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 542977 541976 gene locus_tag LOCUS_05520 542977 541976 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412453.1 protein_id gnl|my_center|LOCUS_05520 543718 543041 gene locus_tag LOCUS_05530 543718 543041 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674091.1 protein_id gnl|my_center|LOCUS_05530 545730 543769 gene locus_tag LOCUS_05540 545730 543769 CDS product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000657079.1 protein_id gnl|my_center|LOCUS_05540 548586 545788 gene locus_tag LOCUS_05550 548586 545788 CDS product polysaccharide lyase 8 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399773.1 protein_id gnl|my_center|LOCUS_05550 549462 548641 gene locus_tag LOCUS_05560 549462 548641 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148019.1 protein_id gnl|my_center|LOCUS_05560 550240 549449 gene locus_tag LOCUS_05570 550240 549449 CDS product PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026610.1 protein_id gnl|my_center|LOCUS_05570 550750 550259 gene locus_tag LOCUS_05580 550750 550259 CDS product PTS system mannose/fructose/N-acetylgalactosamine-transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178620.1 protein_id gnl|my_center|LOCUS_05580 551953 550763 gene locus_tag LOCUS_05590 551953 550763 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592948.1 protein_id gnl|my_center|LOCUS_05590 552251 553234 gene locus_tag LOCUS_05600 552251 553234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 553236 554255 gene locus_tag LOCUS_05610 553236 554255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 554266 555075 gene locus_tag LOCUS_05620 554266 555075 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027182.1 protein_id gnl|my_center|LOCUS_05620 555091 555726 gene locus_tag LOCUS_05630 gene dhuI 555091 555726 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase DhuI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684791.1 protein_id gnl|my_center|LOCUS_05630 555964 556317 gene locus_tag LOCUS_05640 555964 556317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 556319 557656 gene locus_tag LOCUS_05650 556319 557656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 558601 557732 gene locus_tag LOCUS_05660 gene fba 558601 557732 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964145.1 protein_id gnl|my_center|LOCUS_05660 559080 558751 gene locus_tag LOCUS_05670 559080 558751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 560740 559097 gene locus_tag LOCUS_05680 gene argS 560740 559097 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227570.1 protein_id gnl|my_center|LOCUS_05680 561129 560737 gene locus_tag LOCUS_05690 561129 560737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 561664 563529 gene locus_tag LOCUS_05700 561664 563529 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372988.1 protein_id gnl|my_center|LOCUS_05700 563794 564978 gene locus_tag LOCUS_05710 563794 564978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 566231 565122 gene locus_tag LOCUS_05720 gene nagA 566231 565122 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987105.1 protein_id gnl|my_center|LOCUS_05720 566541 567242 gene locus_tag LOCUS_05730 566541 567242 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861605.1 protein_id gnl|my_center|LOCUS_05730 567255 569417 gene locus_tag LOCUS_05740 567255 569417 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861604.1 protein_id gnl|my_center|LOCUS_05740 569525 571738 gene locus_tag LOCUS_05750 569525 571738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 572087 571764 gene locus_tag LOCUS_05760 572087 571764 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384432.1 protein_id gnl|my_center|LOCUS_05760 572266 573114 gene locus_tag LOCUS_05770 572266 573114 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892675.1 protein_id gnl|my_center|LOCUS_05770 574080 573187 gene locus_tag LOCUS_05780 574080 573187 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234240.1 protein_id gnl|my_center|LOCUS_05780 574179 575054 gene locus_tag LOCUS_05790 574179 575054 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392655.1 protein_id gnl|my_center|LOCUS_05790 576073 575201 gene locus_tag LOCUS_05800 576073 575201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 576183 577355 gene locus_tag LOCUS_05810 576183 577355 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016873.1 protein_id gnl|my_center|LOCUS_05810 577665 577390 gene locus_tag LOCUS_05820 577665 577390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 577963 577757 gene locus_tag LOCUS_05830 577963 577757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 579166 578111 gene locus_tag LOCUS_05840 579166 578111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 579287 579138 gene locus_tag LOCUS_05850 579287 579138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 580414 579311 gene locus_tag LOCUS_05860 gene ychF 580414 579311 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293105.1 protein_id gnl|my_center|LOCUS_05860 581518 580604 gene locus_tag LOCUS_05870 581518 580604 CDS product PEP phosphonomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901609.1 protein_id gnl|my_center|LOCUS_05870 582365 581577 gene locus_tag LOCUS_05880 582365 581577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 582927 582358 gene locus_tag LOCUS_05890 582927 582358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 583336 582929 gene locus_tag LOCUS_05900 583336 582929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 583819 583388 gene locus_tag LOCUS_05910 583819 583388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 584033 583836 gene locus_tag LOCUS_05920 584033 583836 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002982695.1 protein_id gnl|my_center|LOCUS_05920 584986 584192 gene locus_tag LOCUS_05930 584986 584192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 585355 585140 gene locus_tag LOCUS_05940 585355 585140 CDS product DUF951 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226838.1 protein_id gnl|my_center|LOCUS_05940 586222 585368 gene locus_tag LOCUS_05950 gene folD 586222 585368 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722487.1 protein_id gnl|my_center|LOCUS_05950 586682 586227 gene locus_tag LOCUS_05960 586682 586227 CDS product D-tyrosyl-tRNA(Tyr) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266954.1 protein_id gnl|my_center|LOCUS_05960 587773 586763 gene locus_tag LOCUS_05970 587773 586763 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732166.1 protein_id gnl|my_center|LOCUS_05970 587896 589362 gene locus_tag LOCUS_05980 587896 589362 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931832.1 protein_id gnl|my_center|LOCUS_05980 589367 591163 gene locus_tag LOCUS_05990 gene bglP 589367 591163 CDS product PTS beta-glucoside transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242943.1 protein_id gnl|my_center|LOCUS_05990 592081 591212 gene locus_tag LOCUS_06000 592081 591212 CDS product methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430012.1 protein_id gnl|my_center|LOCUS_06000 592445 593908 gene locus_tag LOCUS_06010 592445 593908 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_06010 594328 595677 gene locus_tag LOCUS_06020 594328 595677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 597105 595855 gene locus_tag LOCUS_06030 597105 595855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 598030 597152 gene locus_tag LOCUS_06040 598030 597152 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721732.1 protein_id gnl|my_center|LOCUS_06040 598442 599044 gene locus_tag LOCUS_06050 598442 599044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 599044 599727 gene locus_tag LOCUS_06060 599044 599727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 599724 600485 gene locus_tag LOCUS_06070 599724 600485 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470536.1 protein_id gnl|my_center|LOCUS_06070 600641 601177 gene locus_tag LOCUS_06080 600641 601177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 602115 601228 gene locus_tag LOCUS_06090 602115 601228 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549701.1 protein_id gnl|my_center|LOCUS_06090 602903 602127 gene locus_tag LOCUS_06100 gene soj 602903 602127 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516114.1 protein_id gnl|my_center|LOCUS_06100 603681 602917 gene locus_tag LOCUS_06110 gene noc 603681 602917 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254588.1 protein_id gnl|my_center|LOCUS_06110 604403 603693 gene locus_tag LOCUS_06120 gene rsmG 604403 603693 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215587.1 protein_id gnl|my_center|LOCUS_06120 605705 605959 gene locus_tag LOCUS_06130 605705 605959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 605976 606437 gene locus_tag LOCUS_06140 605976 606437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 607174 606491 gene locus_tag LOCUS_06150 607174 606491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 607910 607188 gene locus_tag LOCUS_06160 gene chbG 607910 607188 CDS product chitin disaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861727.1 protein_id gnl|my_center|LOCUS_06160 608047 608358 gene locus_tag LOCUS_06170 608047 608358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 609015 608383 gene locus_tag LOCUS_06180 609015 608383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 610424 609018 gene locus_tag LOCUS_06190 610424 609018 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964714.1 protein_id gnl|my_center|LOCUS_06190 612289 610439 gene locus_tag LOCUS_06200 612289 610439 CDS product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146623251.1 protein_id gnl|my_center|LOCUS_06200 613337 612450 gene locus_tag LOCUS_06210 613337 612450 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289172.1 protein_id gnl|my_center|LOCUS_06210 614646 613411 gene locus_tag LOCUS_06220 614646 613411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 615467 614643 gene locus_tag LOCUS_06230 615467 614643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 616011 616238 gene locus_tag LOCUS_06240 616011 616238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 616244 617191 gene locus_tag LOCUS_06250 616244 617191 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945539.1 protein_id gnl|my_center|LOCUS_06250 617361 617693 gene locus_tag LOCUS_06260 617361 617693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 618008 618217 gene locus_tag LOCUS_06270 618008 618217 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860795.1 protein_id gnl|my_center|LOCUS_06270 618396 618704 gene locus_tag LOCUS_06280 618396 618704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06280 620144 619110 gene locus_tag LOCUS_06290 620144 619110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 620308 620745 gene locus_tag LOCUS_06300 620308 620745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 622153 620993 gene locus_tag LOCUS_06310 622153 620993 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010680900.1 protein_id gnl|my_center|LOCUS_06310 622458 622781 gene locus_tag LOCUS_06320 622458 622781 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262616.1 protein_id gnl|my_center|LOCUS_06320 622794 622991 gene locus_tag LOCUS_06330 622794 622991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 623267 624271 gene locus_tag LOCUS_06340 gene aroB 623267 624271 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893310.1 protein_id gnl|my_center|LOCUS_06340 624276 625394 gene locus_tag LOCUS_06350 gene aroC 624276 625394 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861346.1 protein_id gnl|my_center|LOCUS_06350 625408 626424 gene locus_tag LOCUS_06360 gene aroF 625408 626424 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964210.1 protein_id gnl|my_center|LOCUS_06360 626424 627686 gene locus_tag LOCUS_06370 gene aroA 626424 627686 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964213.1 protein_id gnl|my_center|LOCUS_06370 627683 628531 gene locus_tag LOCUS_06380 627683 628531 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428643.1 protein_id gnl|my_center|LOCUS_06380 628652 629089 gene locus_tag LOCUS_06390 628652 629089 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002266702.1 protein_id gnl|my_center|LOCUS_06390 629103 629516 gene locus_tag LOCUS_06400 629103 629516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 629596 629730 gene locus_tag LOCUS_06410 629596 629730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 631059 629875 gene locus_tag LOCUS_06420 631059 629875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 631431 631066 gene locus_tag LOCUS_06430 631431 631066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 633088 631532 gene locus_tag LOCUS_06440 633088 631532 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_06440 633273 634163 gene locus_tag LOCUS_06450 633273 634163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 634232 634975 gene locus_tag LOCUS_06460 634232 634975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 635908 634991 gene locus_tag LOCUS_06470 635908 634991 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017180.1 protein_id gnl|my_center|LOCUS_06470 636371 635889 gene locus_tag LOCUS_06480 636371 635889 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029492147.1 protein_id gnl|my_center|LOCUS_06480 637343 636414 gene locus_tag LOCUS_06490 gene nanA 637343 636414 CDS product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224706.1 protein_id gnl|my_center|LOCUS_06490 638779 637355 gene locus_tag LOCUS_06500 638779 637355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198142920.1 protein_id gnl|my_center|LOCUS_06500 639782 638772 gene locus_tag LOCUS_06510 639782 638772 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583525.1 protein_id gnl|my_center|LOCUS_06510 640792 639785 gene locus_tag LOCUS_06520 640792 639785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06520 641671 640805 gene locus_tag LOCUS_06530 641671 640805 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803875.1 protein_id gnl|my_center|LOCUS_06530 642643 641687 gene locus_tag LOCUS_06540 642643 641687 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001856206.1 protein_id gnl|my_center|LOCUS_06540 644313 642703 gene locus_tag LOCUS_06550 644313 642703 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724915.1 protein_id gnl|my_center|LOCUS_06550 645014 644310 gene locus_tag LOCUS_06560 645014 644310 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130140.1 protein_id gnl|my_center|LOCUS_06560 645250 646104 gene locus_tag LOCUS_06570 645250 646104 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861630.1 protein_id gnl|my_center|LOCUS_06570 646941 646129 gene locus_tag LOCUS_06580 646941 646129 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289254.1 protein_id gnl|my_center|LOCUS_06580 647448 647032 gene locus_tag LOCUS_06590 647448 647032 CDS product DUF2871 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111798.1 protein_id gnl|my_center|LOCUS_06590 648026 647448 gene locus_tag LOCUS_06600 648026 647448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 648726 648127 gene locus_tag LOCUS_06610 648726 648127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 649053 648754 gene locus_tag LOCUS_06620 649053 648754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 649607 649197 gene locus_tag LOCUS_06630 649607 649197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 650259 649708 gene locus_tag LOCUS_06640 650259 649708 CDS product DUF1851 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964950.1 protein_id gnl|my_center|LOCUS_06640 650989 650639 gene locus_tag LOCUS_06650 650989 650639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 651705 651238 gene locus_tag LOCUS_06660 651705 651238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100254.1 protein_id gnl|my_center|LOCUS_06660 652636 652163 gene locus_tag LOCUS_06670 652636 652163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 653246 652878 gene locus_tag LOCUS_06680 653246 652878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 653723 653376 gene locus_tag LOCUS_06690 653723 653376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 654368 653925 gene locus_tag LOCUS_06700 654368 653925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 655442 654459 gene locus_tag LOCUS_06710 655442 654459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 656092 655811 gene locus_tag LOCUS_06720 656092 655811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 656730 656494 gene locus_tag LOCUS_06730 656730 656494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 657911 657357 gene locus_tag LOCUS_06740 657911 657357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 658252 658052 gene locus_tag LOCUS_06750 658252 658052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 659159 658425 gene locus_tag LOCUS_06760 659159 658425 CDS product DUF1911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942841.1 protein_id gnl|my_center|LOCUS_06760 659999 659616 gene locus_tag LOCUS_06770 659999 659616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 661349 660582 gene locus_tag LOCUS_06780 661349 660582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 662034 661339 gene locus_tag LOCUS_06790 662034 661339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 662523 662149 gene locus_tag LOCUS_06800 662523 662149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 664017 662560 gene locus_tag LOCUS_06810 664017 662560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 664570 664163 gene locus_tag LOCUS_06820 664570 664163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 667125 664573 gene locus_tag LOCUS_06830 667125 664573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 667434 667258 gene locus_tag LOCUS_06840 667434 667258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 668140 667532 gene locus_tag LOCUS_06850 668140 667532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 668533 668384 gene locus_tag LOCUS_06860 668533 668384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 669648 668632 gene locus_tag LOCUS_06870 669648 668632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 670251 669922 gene locus_tag LOCUS_06880 670251 669922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 671120 670503 gene locus_tag LOCUS_06890 671120 670503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 671440 671162 gene locus_tag LOCUS_06900 671440 671162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 671869 671519 gene locus_tag LOCUS_06910 671869 671519 CDS product DUF2185 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061130545.1 protein_id gnl|my_center|LOCUS_06910 672236 671880 gene locus_tag LOCUS_06920 672236 671880 CDS product DUF2185 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061130545.1 protein_id gnl|my_center|LOCUS_06920 672589 672948 gene locus_tag LOCUS_06930 672589 672948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 673393 673001 gene locus_tag LOCUS_06940 673393 673001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 673567 674292 gene locus_tag LOCUS_06950 673567 674292 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861321.1 protein_id gnl|my_center|LOCUS_06950 674289 675566 gene locus_tag LOCUS_06960 674289 675566 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021361811.1 protein_id gnl|my_center|LOCUS_06960 676528 675620 gene locus_tag LOCUS_06970 676528 675620 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462197.1 protein_id gnl|my_center|LOCUS_06970 677339 676521 gene locus_tag LOCUS_06980 677339 676521 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430704.1 protein_id gnl|my_center|LOCUS_06980 677971 677336 gene locus_tag LOCUS_06990 677971 677336 CDS product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862015.1 protein_id gnl|my_center|LOCUS_06990 678464 677964 gene locus_tag LOCUS_07000 678464 677964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 679358 678480 gene locus_tag LOCUS_07010 gene dapA 679358 678480 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435760.1 protein_id gnl|my_center|LOCUS_07010 679978 679355 gene locus_tag LOCUS_07020 679978 679355 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373863.1 protein_id gnl|my_center|LOCUS_07020 680742 679975 gene locus_tag LOCUS_07030 680742 679975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 682082 680802 gene locus_tag LOCUS_07040 682082 680802 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435758.1 protein_id gnl|my_center|LOCUS_07040 682397 682119 gene locus_tag LOCUS_07050 682397 682119 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435756.1 protein_id gnl|my_center|LOCUS_07050 682852 682412 gene locus_tag LOCUS_07060 682852 682412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 683213 685306 gene locus_tag LOCUS_07070 683213 685306 CDS product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862017.1 protein_id gnl|my_center|LOCUS_07070 685457 686716 gene locus_tag LOCUS_07080 gene femB 685457 686716 CDS product glycine glycyltransferase FemB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673098.1 protein_id gnl|my_center|LOCUS_07080 687659 686760 gene locus_tag LOCUS_07090 687659 686760 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435856.1 protein_id gnl|my_center|LOCUS_07090 687803 688099 gene locus_tag LOCUS_07100 687803 688099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 688653 688138 gene locus_tag LOCUS_07110 688653 688138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 690235 689042 gene locus_tag LOCUS_07120 690235 689042 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610375.1 protein_id gnl|my_center|LOCUS_07120 690519 690316 gene locus_tag LOCUS_07130 690519 690316 CDS product excisionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009905235.1 protein_id gnl|my_center|LOCUS_07130 691180 690929 gene locus_tag LOCUS_07140 691180 690929 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009905237.1 protein_id gnl|my_center|LOCUS_07140 691604 691164 gene locus_tag LOCUS_07150 691604 691164 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009905239.1 protein_id gnl|my_center|LOCUS_07150 692270 692097 gene locus_tag LOCUS_07160 692270 692097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 693645 692617 gene locus_tag LOCUS_07170 693645 692617 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986639.1 protein_id gnl|my_center|LOCUS_07170 694325 693642 gene locus_tag LOCUS_07180 694325 693642 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986640.1 protein_id gnl|my_center|LOCUS_07180 696513 694363 gene locus_tag LOCUS_07190 696513 694363 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986644.1 protein_id gnl|my_center|LOCUS_07190 697285 696503 gene locus_tag LOCUS_07200 697285 696503 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948989.1 protein_id gnl|my_center|LOCUS_07200 697576 697391 gene locus_tag LOCUS_07210 697576 697391 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434206.1 protein_id gnl|my_center|LOCUS_07210 697737 698096 gene locus_tag LOCUS_07220 697737 698096 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002324548.1 protein_id gnl|my_center|LOCUS_07220 698340 698669 gene locus_tag LOCUS_07230 gene mobC 698340 698669 CDS product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861100.1 protein_id gnl|my_center|LOCUS_07230 698630 699976 gene locus_tag LOCUS_07240 698630 699976 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861101.1 protein_id gnl|my_center|LOCUS_07240 699979 700236 gene locus_tag LOCUS_07250 699979 700236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 700981 700775 gene locus_tag LOCUS_07260 700981 700775 CDS product transposon-transfer assisting family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861106.1 protein_id gnl|my_center|LOCUS_07260 701520 700984 gene locus_tag LOCUS_07270 701520 700984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 701494 701646 gene locus_tag LOCUS_07280 701494 701646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 701681 701908 gene locus_tag LOCUS_07290 701681 701908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 702752 701964 gene locus_tag LOCUS_07300 702752 701964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 702924 704009 gene locus_tag LOCUS_07310 gene serC 702924 704009 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_07310 704006 705160 gene locus_tag LOCUS_07320 704006 705160 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009918143.1 protein_id gnl|my_center|LOCUS_07320 705876 705205 gene locus_tag LOCUS_07330 705876 705205 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963951.1 protein_id gnl|my_center|LOCUS_07330 706691 705873 gene locus_tag LOCUS_07340 gene sgcQ 706691 705873 CDS product BtpA family protein SgcQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118626.1 protein_id gnl|my_center|LOCUS_07340 707561 706764 gene locus_tag LOCUS_07350 gene sgcQ 707561 706764 CDS product BtpA family protein SgcQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118626.1 protein_id gnl|my_center|LOCUS_07350 708428 707583 gene locus_tag LOCUS_07360 708428 707583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 709176 708430 gene locus_tag LOCUS_07370 709176 708430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 709661 709197 gene locus_tag LOCUS_07380 709661 709197 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426364.1 protein_id gnl|my_center|LOCUS_07380 710103 709690 gene locus_tag LOCUS_07390 710103 709690 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860837.1 protein_id gnl|my_center|LOCUS_07390 710375 712849 gene locus_tag LOCUS_07400 710375 712849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 713424 713035 gene locus_tag LOCUS_07410 713424 713035 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812484.1 protein_id gnl|my_center|LOCUS_07410 713796 715850 gene locus_tag LOCUS_07420 713796 715850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 715926 717362 gene locus_tag LOCUS_07430 715926 717362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 718437 717406 gene locus_tag LOCUS_07440 718437 717406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 719177 718815 gene locus_tag LOCUS_07450 gene rplQ 719177 718815 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225836.1 protein_id gnl|my_center|LOCUS_07450 720158 719199 gene locus_tag LOCUS_07460 720158 719199 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427733.1 protein_id gnl|my_center|LOCUS_07460 720587 720186 gene locus_tag LOCUS_07470 gene rpsK 720587 720186 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101625.1 protein_id gnl|my_center|LOCUS_07470 720972 720607 gene locus_tag LOCUS_07480 gene rpsM 720972 720607 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288713.1 protein_id gnl|my_center|LOCUS_07480 721346 721128 gene locus_tag LOCUS_07490 gene infA 721346 721128 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118443.1 protein_id gnl|my_center|LOCUS_07490 722112 721339 gene locus_tag LOCUS_07500 gene map 722112 721339 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582539.1 protein_id gnl|my_center|LOCUS_07500 722757 722113 gene locus_tag LOCUS_07510 722757 722113 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966391.1 protein_id gnl|my_center|LOCUS_07510 724063 722771 gene locus_tag LOCUS_07520 gene secY 724063 722771 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723679.1 protein_id gnl|my_center|LOCUS_07520 724505 724065 gene locus_tag LOCUS_07530 gene rplO 724505 724065 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723680.1 protein_id gnl|my_center|LOCUS_07530 725032 724520 gene locus_tag LOCUS_07540 gene rpsE 725032 724520 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003328273.1 protein_id gnl|my_center|LOCUS_07540 725405 725049 gene locus_tag LOCUS_07550 gene rplR 725405 725049 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225816.1 protein_id gnl|my_center|LOCUS_07550 728079 725476 gene locus_tag LOCUS_07560 728079 725476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 730324 728234 gene locus_tag LOCUS_07570 730324 728234 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861108.1 protein_id gnl|my_center|LOCUS_07570 730529 730341 gene locus_tag LOCUS_07580 730529 730341 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861109.1 protein_id gnl|my_center|LOCUS_07580 731254 730526 gene locus_tag LOCUS_07590 731254 730526 CDS product DUF4366 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035394374.1 protein_id gnl|my_center|LOCUS_07590 731501 731244 gene locus_tag LOCUS_07600 731501 731244 CDS product DUF4315 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861111.1 protein_id gnl|my_center|LOCUS_07600 733609 731534 gene locus_tag LOCUS_07610 733609 731534 CDS product CHAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861112.1 protein_id gnl|my_center|LOCUS_07610 736055 733620 gene locus_tag LOCUS_07620 736055 733620 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861114.1 protein_id gnl|my_center|LOCUS_07620 736407 736003 gene locus_tag LOCUS_07630 736407 736003 CDS product PrgI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861115.1 protein_id gnl|my_center|LOCUS_07630 737298 736429 gene locus_tag LOCUS_07640 737298 736429 CDS product CD0415/CD1112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610323.1 protein_id gnl|my_center|LOCUS_07640 739153 737489 gene locus_tag LOCUS_07650 739153 737489 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368663.1 protein_id gnl|my_center|LOCUS_07650 739357 739160 gene locus_tag LOCUS_07660 739357 739160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 740993 739599 gene locus_tag LOCUS_07670 740993 739599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 741549 740902 gene locus_tag LOCUS_07680 741549 740902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 743195 741615 gene locus_tag LOCUS_07690 743195 741615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 743864 743541 gene locus_tag LOCUS_07700 743864 743541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 744098 743910 gene locus_tag LOCUS_07710 744098 743910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 744436 744140 gene locus_tag LOCUS_07720 744436 744140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 744770 744429 gene locus_tag LOCUS_07730 744770 744429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 745440 746246 gene locus_tag LOCUS_07740 745440 746246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 748167 746902 gene locus_tag LOCUS_07750 748167 746902 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298157.1 protein_id gnl|my_center|LOCUS_07750 748437 748246 gene locus_tag LOCUS_07760 748437 748246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 748862 748485 gene locus_tag LOCUS_07770 748862 748485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 749094 748822 gene locus_tag LOCUS_07780 749094 748822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 749408 749250 gene locus_tag LOCUS_07790 749408 749250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 749774 749607 gene locus_tag LOCUS_07800 749774 749607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 751554 749767 gene locus_tag LOCUS_07810 751554 749767 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861117.1 protein_id gnl|my_center|LOCUS_07810 752027 751551 gene locus_tag LOCUS_07820 752027 751551 CDS product PcfB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861118.1 protein_id gnl|my_center|LOCUS_07820 752328 752110 gene locus_tag LOCUS_07830 752328 752110 CDS product DUF5348 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610290.1 protein_id gnl|my_center|LOCUS_07830 753238 752348 gene locus_tag LOCUS_07840 753238 752348 CDS product DUF6017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861119.1 protein_id gnl|my_center|LOCUS_07840 754476 753715 gene locus_tag LOCUS_07850 754476 753715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 756201 754480 gene locus_tag LOCUS_07860 756201 754480 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861101.1 protein_id gnl|my_center|LOCUS_07860 756654 756217 gene locus_tag LOCUS_07870 756654 756217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 757189 756629 gene locus_tag LOCUS_07880 757189 756629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 757980 757468 gene locus_tag LOCUS_07890 757980 757468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 759099 757981 gene locus_tag LOCUS_07900 759099 757981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 759275 759096 gene locus_tag LOCUS_07910 759275 759096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 760456 759287 gene locus_tag LOCUS_07920 760456 759287 CDS product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263960.1 protein_id gnl|my_center|LOCUS_07920 761204 760500 gene locus_tag LOCUS_07930 761204 760500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 761999 761268 gene locus_tag LOCUS_07940 761999 761268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 763045 762080 gene locus_tag LOCUS_07950 763045 762080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 763431 763246 gene locus_tag LOCUS_07960 763431 763246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 763771 763433 gene locus_tag LOCUS_07970 763771 763433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 763892 763752 gene locus_tag LOCUS_07980 763892 763752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 764604 763909 gene locus_tag LOCUS_07990 764604 763909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 765349 764621 gene locus_tag LOCUS_08000 765349 764621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 766106 765354 gene locus_tag LOCUS_08010 766106 765354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 766864 766136 gene locus_tag LOCUS_08020 766864 766136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 768875 766878 gene locus_tag LOCUS_08030 768875 766878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 771418 768881 gene locus_tag LOCUS_08040 771418 768881 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007789938.1 protein_id gnl|my_center|LOCUS_08040 772127 771375 gene locus_tag LOCUS_08050 772127 771375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 773004 772129 gene locus_tag LOCUS_08060 773004 772129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 773403 773062 gene locus_tag LOCUS_08070 773403 773062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 773557 773366 gene locus_tag LOCUS_08080 773557 773366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 775572 773539 gene locus_tag LOCUS_08090 775572 773539 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010247013.1 protein_id gnl|my_center|LOCUS_08090 776843 775575 gene locus_tag LOCUS_08100 776843 775575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 779979 776836 gene locus_tag LOCUS_08110 779979 776836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 780881 780021 gene locus_tag LOCUS_08120 780881 780021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 781129 780953 gene locus_tag LOCUS_08130 781129 780953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 781886 781194 gene locus_tag LOCUS_08140 781886 781194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 783750 781930 gene locus_tag LOCUS_08150 783750 781930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 784299 783760 gene locus_tag LOCUS_08160 784299 783760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 784639 784313 gene locus_tag LOCUS_08170 784639 784313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 785333 784605 gene locus_tag LOCUS_08180 785333 784605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 786019 785390 gene locus_tag LOCUS_08190 786019 785390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 786863 786045 gene locus_tag LOCUS_08200 786863 786045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 788019 787051 gene locus_tag LOCUS_08210 788019 787051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 788713 788204 gene locus_tag LOCUS_08220 788713 788204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 789717 788749 gene locus_tag LOCUS_08230 789717 788749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 789839 789720 gene locus_tag LOCUS_08240 789839 789720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 790651 789842 gene locus_tag LOCUS_08250 790651 789842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 790854 790672 gene locus_tag LOCUS_08260 790854 790672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 791325 790858 gene locus_tag LOCUS_08270 791325 790858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 792438 791362 gene locus_tag LOCUS_08280 792438 791362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 794482 792818 gene locus_tag LOCUS_08290 794482 792818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 796279 794618 gene locus_tag LOCUS_08300 796279 794618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 797049 796375 gene locus_tag LOCUS_08310 797049 796375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 802891 797249 gene locus_tag LOCUS_08320 802891 797249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 804836 803934 gene locus_tag LOCUS_08330 804836 803934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 805905 804859 gene locus_tag LOCUS_08340 805905 804859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 807979 806468 gene locus_tag LOCUS_08350 807979 806468 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047851.1 protein_id gnl|my_center|LOCUS_08350 808265 808074 gene locus_tag LOCUS_08360 808265 808074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 809277 808336 gene locus_tag LOCUS_08370 809277 808336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 809742 809461 gene locus_tag LOCUS_08380 809742 809461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 810381 809968 gene locus_tag LOCUS_08390 810381 809968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 810706 811200 gene locus_tag LOCUS_08400 810706 811200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 811251 812051 gene locus_tag LOCUS_08410 811251 812051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 812098 812463 gene locus_tag LOCUS_08420 812098 812463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962846.1 protein_id gnl|my_center|LOCUS_08420 812804 812595 gene locus_tag LOCUS_08430 812804 812595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 813465 813671 gene locus_tag LOCUS_08440 813465 813671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 814209 813706 gene locus_tag LOCUS_08450 814209 813706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 815948 814647 gene locus_tag LOCUS_08460 815948 814647 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223849864.1 protein_id gnl|my_center|LOCUS_08460 816145 816588 gene locus_tag LOCUS_08470 816145 816588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 818404 817244 gene locus_tag LOCUS_08480 gene iadA 818404 817244 CDS product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128783587.1 protein_id gnl|my_center|LOCUS_08480 819507 818545 gene locus_tag LOCUS_08490 819507 818545 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966767.1 protein_id gnl|my_center|LOCUS_08490 820367 819534 gene locus_tag LOCUS_08500 820367 819534 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298371.1 protein_id gnl|my_center|LOCUS_08500 821169 820378 gene locus_tag LOCUS_08510 821169 820378 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071854933.1 protein_id gnl|my_center|LOCUS_08510 821659 821195 gene locus_tag LOCUS_08520 821659 821195 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298375.1 protein_id gnl|my_center|LOCUS_08520 822136 821717 gene locus_tag LOCUS_08530 822136 821717 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236585661.1 protein_id gnl|my_center|LOCUS_08530 824775 822139 gene locus_tag LOCUS_08540 824775 822139 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002323457.1 protein_id gnl|my_center|LOCUS_08540 826282 824981 gene locus_tag LOCUS_08550 826282 824981 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223849864.1 protein_id gnl|my_center|LOCUS_08550 827760 826486 gene locus_tag LOCUS_08560 827760 826486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 828401 827910 gene locus_tag LOCUS_08570 828401 827910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 828619 828419 gene locus_tag LOCUS_08580 828619 828419 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880829.1 protein_id gnl|my_center|LOCUS_08580 829044 828616 gene locus_tag LOCUS_08590 829044 828616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 829454 829068 gene locus_tag LOCUS_08600 gene ssb 829454 829068 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368292.1 protein_id gnl|my_center|LOCUS_08600 829777 829592 gene locus_tag LOCUS_08610 829777 829592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 830176 829871 gene locus_tag LOCUS_08620 830176 829871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 830629 830237 gene locus_tag LOCUS_08630 830629 830237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 831014 830649 gene locus_tag LOCUS_08640 831014 830649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 831206 831027 gene locus_tag LOCUS_08650 831206 831027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 831950 831390 gene locus_tag LOCUS_08660 831950 831390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 832286 832089 gene locus_tag LOCUS_08670 832286 832089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 832681 832370 gene locus_tag LOCUS_08680 832681 832370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 832856 832683 gene locus_tag LOCUS_08690 832856 832683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 833258 832989 gene locus_tag LOCUS_08700 833258 832989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 833421 833774 gene locus_tag LOCUS_08710 833421 833774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 833838 834923 gene locus_tag LOCUS_08720 833838 834923 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966615.1 protein_id gnl|my_center|LOCUS_08720 835932 835111 gene locus_tag LOCUS_08730 835932 835111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 836561 835986 gene locus_tag LOCUS_08740 836561 835986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 836953 836621 gene locus_tag LOCUS_08750 836953 836621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 837318 836983 gene locus_tag LOCUS_08760 837318 836983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 839937 837997 gene locus_tag LOCUS_08770 839937 837997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 840800 839934 gene locus_tag LOCUS_08780 840800 839934 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861379.1 protein_id gnl|my_center|LOCUS_08780 842280 840805 gene locus_tag LOCUS_08790 842280 840805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 843385 842297 gene locus_tag LOCUS_08800 843385 842297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 843661 843476 gene locus_tag LOCUS_08810 843661 843476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 844059 843754 gene locus_tag LOCUS_08820 844059 843754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 845596 844394 gene locus_tag LOCUS_08830 845596 844394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 846281 845589 gene locus_tag LOCUS_08840 846281 845589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 847390 846320 gene locus_tag LOCUS_08850 847390 846320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 847978 847601 gene locus_tag LOCUS_08860 847978 847601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 848319 847984 gene locus_tag LOCUS_08870 848319 847984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 848705 848331 gene locus_tag LOCUS_08880 848705 848331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 849103 848702 gene locus_tag LOCUS_08890 849103 848702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 849561 849100 gene locus_tag LOCUS_08900 849561 849100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 850099 849548 gene locus_tag LOCUS_08910 850099 849548 CDS product YhfC family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013710.1 protein_id gnl|my_center|LOCUS_08910 851460 850201 gene locus_tag LOCUS_08920 851460 850201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 852149 851466 gene locus_tag LOCUS_08930 852149 851466 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964889.1 protein_id gnl|my_center|LOCUS_08930 852777 852262 gene locus_tag LOCUS_08940 852777 852262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 853129 853458 gene locus_tag LOCUS_08950 853129 853458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 854167 853691 gene locus_tag LOCUS_08960 gene ispF 854167 853691 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488386.1 protein_id gnl|my_center|LOCUS_08960 854374 855117 gene locus_tag LOCUS_08970 854374 855117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 855333 855890 gene locus_tag LOCUS_08980 855333 855890 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814509.1 protein_id gnl|my_center|LOCUS_08980 856225 857646 gene locus_tag LOCUS_08990 856225 857646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 857660 859576 gene locus_tag LOCUS_09000 857660 859576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 859580 860668 gene locus_tag LOCUS_09010 859580 860668 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760828.1 protein_id gnl|my_center|LOCUS_09010 860668 862869 gene locus_tag LOCUS_09020 860668 862869 CDS product DUF5682 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109016.1 protein_id gnl|my_center|LOCUS_09020 862869 864023 gene locus_tag LOCUS_09030 862869 864023 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467385.1 protein_id gnl|my_center|LOCUS_09030 864120 865001 gene locus_tag LOCUS_09040 864120 865001 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386870.1 protein_id gnl|my_center|LOCUS_09040 864998 866125 gene locus_tag LOCUS_09050 864998 866125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 866604 867953 gene locus_tag LOCUS_09060 866604 867953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 868137 869384 gene locus_tag LOCUS_09070 868137 869384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 869894 871255 gene locus_tag LOCUS_09080 869894 871255 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060618671.1 protein_id gnl|my_center|LOCUS_09080 872143 871463 gene locus_tag LOCUS_09090 872143 871463 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893181.1 protein_id gnl|my_center|LOCUS_09090 873288 872143 gene locus_tag LOCUS_09100 873288 872143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 873959 873285 gene locus_tag LOCUS_09110 873959 873285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 875247 874045 gene locus_tag LOCUS_09120 875247 874045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 875930 875244 gene locus_tag LOCUS_09130 875930 875244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 876679 875948 gene locus_tag LOCUS_09140 876679 875948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 877857 876694 gene locus_tag LOCUS_09150 877857 876694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 879665 878547 gene locus_tag LOCUS_09160 879665 878547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 880324 879665 gene locus_tag LOCUS_09170 880324 879665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 881571 880345 gene locus_tag LOCUS_09180 881571 880345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 882278 881568 gene locus_tag LOCUS_09190 882278 881568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 882676 882302 gene locus_tag LOCUS_09200 882676 882302 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436478.1 protein_id gnl|my_center|LOCUS_09200 882891 883649 gene locus_tag LOCUS_09210 gene tam 882891 883649 CDS product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210232.1 protein_id gnl|my_center|LOCUS_09210 885366 883723 gene locus_tag LOCUS_09220 885366 883723 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047904.1 protein_id gnl|my_center|LOCUS_09220 887022 885577 gene locus_tag LOCUS_09230 887022 885577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 887534 887118 gene locus_tag LOCUS_09240 gene mutT 887534 887118 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246544.1 protein_id gnl|my_center|LOCUS_09240 887835 887969 gene locus_tag LOCUS_09250 887835 887969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 889280 888186 gene locus_tag LOCUS_09260 889280 888186 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017115.1 protein_id gnl|my_center|LOCUS_09260 889891 889463 gene locus_tag LOCUS_09270 889891 889463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 890380 889895 gene locus_tag LOCUS_09280 890380 889895 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721638.1 protein_id gnl|my_center|LOCUS_09280 891752 890391 gene locus_tag LOCUS_09290 891752 890391 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037254759.1 protein_id gnl|my_center|LOCUS_09290 893292 891757 gene locus_tag LOCUS_09300 893292 891757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016268198.1 protein_id gnl|my_center|LOCUS_09300 894150 893314 gene locus_tag LOCUS_09310 894150 893314 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476681.1 protein_id gnl|my_center|LOCUS_09310 894946 894140 gene locus_tag LOCUS_09320 894946 894140 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706182.1 protein_id gnl|my_center|LOCUS_09320 895210 895929 gene locus_tag LOCUS_09330 895210 895929 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816925.1 protein_id gnl|my_center|LOCUS_09330 896291 896016 gene locus_tag LOCUS_09340 896291 896016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 896977 896291 gene locus_tag LOCUS_09350 896977 896291 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042046.1 protein_id gnl|my_center|LOCUS_09350 898381 896978 gene locus_tag LOCUS_09360 898381 896978 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002266940.1 protein_id gnl|my_center|LOCUS_09360 899778 898438 gene locus_tag LOCUS_09370 899778 898438 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732174.1 protein_id gnl|my_center|LOCUS_09370 901084 899765 gene locus_tag LOCUS_09380 gene celB 901084 899765 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384702.1 protein_id gnl|my_center|LOCUS_09380 901200 901940 gene locus_tag LOCUS_09390 901200 901940 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285922.1 protein_id gnl|my_center|LOCUS_09390 902318 901941 gene locus_tag LOCUS_09400 902318 901941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 902720 902364 gene locus_tag LOCUS_09410 902720 902364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 903291 903611 gene locus_tag LOCUS_09420 903291 903611 CDS product PTS cellobiose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285948.1 protein_id gnl|my_center|LOCUS_09420 903619 905616 gene locus_tag LOCUS_09430 903619 905616 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285949.1 protein_id gnl|my_center|LOCUS_09430 905633 905953 gene locus_tag LOCUS_09440 905633 905953 CDS product PTS cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070943.1 protein_id gnl|my_center|LOCUS_09440 905968 906480 gene locus_tag LOCUS_09450 905968 906480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285960.1 protein_id gnl|my_center|LOCUS_09450 906499 907860 gene locus_tag LOCUS_09460 gene celB 906499 907860 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285961.1 protein_id gnl|my_center|LOCUS_09460 907920 909338 gene locus_tag LOCUS_09470 907920 909338 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890696.1 protein_id gnl|my_center|LOCUS_09470 909423 909575 gene locus_tag LOCUS_09480 909423 909575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 909572 909724 gene locus_tag LOCUS_09490 909572 909724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 909786 910325 gene locus_tag LOCUS_09500 909786 910325 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002903175.1 protein_id gnl|my_center|LOCUS_09500 910322 911110 gene locus_tag LOCUS_09510 910322 911110 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890817.1 protein_id gnl|my_center|LOCUS_09510 911248 911598 gene locus_tag LOCUS_09520 911248 911598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 912945 911725 gene locus_tag LOCUS_09530 912945 911725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 913131 913790 gene locus_tag LOCUS_09540 913131 913790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 913891 915348 gene locus_tag LOCUS_09550 913891 915348 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109350.1 protein_id gnl|my_center|LOCUS_09550 916951 915419 gene locus_tag LOCUS_09560 gene purH 916951 915419 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244516.1 protein_id gnl|my_center|LOCUS_09560 917546 916953 gene locus_tag LOCUS_09570 gene purN 917546 916953 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288010.1 protein_id gnl|my_center|LOCUS_09570 918571 917540 gene locus_tag LOCUS_09580 gene purM 918571 917540 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010081095.1 protein_id gnl|my_center|LOCUS_09580 920195 918597 gene locus_tag LOCUS_09590 920195 918597 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027392.1 protein_id gnl|my_center|LOCUS_09590 923902 920210 gene locus_tag LOCUS_09600 923902 920210 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964962.1 protein_id gnl|my_center|LOCUS_09600 924437 923934 gene locus_tag LOCUS_09610 gene purE 924437 923934 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769750.1 protein_id gnl|my_center|LOCUS_09610 924681 924505 gene locus_tag LOCUS_09620 924681 924505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 925054 926334 gene locus_tag LOCUS_09630 925054 926334 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054367.1 protein_id gnl|my_center|LOCUS_09630 926597 926824 gene locus_tag LOCUS_09640 926597 926824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 927004 928473 gene locus_tag LOCUS_09650 927004 928473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 928634 929431 gene locus_tag LOCUS_09660 928634 929431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 930915 929488 gene locus_tag LOCUS_09670 930915 929488 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440025.1 protein_id gnl|my_center|LOCUS_09670 932750 930927 gene locus_tag LOCUS_09680 932750 930927 CDS product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861829.1 protein_id gnl|my_center|LOCUS_09680 933598 932756 gene locus_tag LOCUS_09690 933598 932756 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891460.1 protein_id gnl|my_center|LOCUS_09690 939182 933870 gene locus_tag LOCUS_09700 939182 933870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 940250 939414 gene locus_tag LOCUS_09710 940250 939414 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016356.1 protein_id gnl|my_center|LOCUS_09710 940821 940375 gene locus_tag LOCUS_09720 940821 940375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 941317 940838 gene locus_tag LOCUS_09730 941317 940838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 941826 941371 gene locus_tag LOCUS_09740 941826 941371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 942911 941982 gene locus_tag LOCUS_09750 942911 941982 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965842.1 protein_id gnl|my_center|LOCUS_09750 943538 943077 gene locus_tag LOCUS_09760 943538 943077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 944913 943681 gene locus_tag LOCUS_09770 944913 943681 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016314.1 protein_id gnl|my_center|LOCUS_09770 945995 944910 gene locus_tag LOCUS_09780 gene pheA 945995 944910 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861347.1 protein_id gnl|my_center|LOCUS_09780 947172 946204 gene locus_tag LOCUS_09790 947172 946204 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989862.1 protein_id gnl|my_center|LOCUS_09790 948590 947232 gene locus_tag LOCUS_09800 948590 947232 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120376.1 protein_id gnl|my_center|LOCUS_09800 948871 948587 gene locus_tag LOCUS_09810 948871 948587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 950309 948876 gene locus_tag LOCUS_09820 950309 948876 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576736.1 protein_id gnl|my_center|LOCUS_09820 951112 950576 gene locus_tag LOCUS_09830 951112 950576 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966606.1 protein_id gnl|my_center|LOCUS_09830 951231 951959 gene locus_tag LOCUS_09840 951231 951959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680349.1 protein_id gnl|my_center|LOCUS_09840 952663 952049 gene locus_tag LOCUS_09850 952663 952049 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183791.1 protein_id gnl|my_center|LOCUS_09850 953962 952733 gene locus_tag LOCUS_09860 953962 952733 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_09860 955352 954177 gene locus_tag LOCUS_09870 955352 954177 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903257.1 protein_id gnl|my_center|LOCUS_09870 956229 955366 gene locus_tag LOCUS_09880 956229 955366 CDS product ketose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961378.1 protein_id gnl|my_center|LOCUS_09880 957366 956269 gene locus_tag LOCUS_09890 957366 956269 CDS product PTS fructose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662199.1 protein_id gnl|my_center|LOCUS_09890 957699 957385 gene locus_tag LOCUS_09900 957699 957385 CDS product fructose PTS transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028073.1 protein_id gnl|my_center|LOCUS_09900 958159 957716 gene locus_tag LOCUS_09910 958159 957716 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930923.1 protein_id gnl|my_center|LOCUS_09910 960129 958174 gene locus_tag LOCUS_09920 gene manR 960129 958174 CDS product mannose transport/utilization transcriptional regulator ManR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245617.1 protein_id gnl|my_center|LOCUS_09920 961930 960209 gene locus_tag LOCUS_09930 961930 960209 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948081.1 protein_id gnl|my_center|LOCUS_09930 962124 963278 gene locus_tag LOCUS_09940 gene fucO 962124 963278 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783906.1 protein_id gnl|my_center|LOCUS_09940 963336 964460 gene locus_tag LOCUS_09950 963336 964460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 965560 964541 gene locus_tag LOCUS_09960 965560 964541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 966338 965565 gene locus_tag LOCUS_09970 966338 965565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 966561 967604 gene locus_tag LOCUS_09980 gene uxuA 966561 967604 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964641.1 protein_id gnl|my_center|LOCUS_09980 969120 967681 gene locus_tag LOCUS_09990 969120 967681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 969386 970003 gene locus_tag LOCUS_10000 969386 970003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 970284 970048 gene locus_tag LOCUS_10010 970284 970048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 971647 970304 gene locus_tag LOCUS_10020 971647 970304 CDS product 6-phospho-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966696.1 protein_id gnl|my_center|LOCUS_10020 973183 971660 gene locus_tag LOCUS_10030 973183 971660 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966695.1 protein_id gnl|my_center|LOCUS_10030 974112 973396 gene locus_tag LOCUS_10040 974112 973396 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966694.1 protein_id gnl|my_center|LOCUS_10040 974818 974105 gene locus_tag LOCUS_10050 974818 974105 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966694.1 protein_id gnl|my_center|LOCUS_10050 975122 975694 gene locus_tag LOCUS_10060 975122 975694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 976098 975784 gene locus_tag LOCUS_10070 976098 975784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 976920 976183 gene locus_tag LOCUS_10080 976920 976183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10080 977097 976930 gene locus_tag LOCUS_10090 977097 976930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 978794 977328 gene locus_tag LOCUS_10100 978794 977328 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202887107.1 protein_id gnl|my_center|LOCUS_10100 980220 978796 gene locus_tag LOCUS_10110 980220 978796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 980356 981132 gene locus_tag LOCUS_10120 980356 981132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 981873 981532 gene locus_tag LOCUS_10130 981873 981532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 982103 982462 gene locus_tag LOCUS_10140 982103 982462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 983372 982713 gene locus_tag LOCUS_10150 gene deoC 983372 982713 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254138.1 protein_id gnl|my_center|LOCUS_10150 983670 983365 gene locus_tag LOCUS_10160 983670 983365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 983999 983766 gene locus_tag LOCUS_10170 983999 983766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 985039 984020 gene locus_tag LOCUS_10180 985039 984020 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236585662.1 protein_id gnl|my_center|LOCUS_10180 985867 985055 gene locus_tag LOCUS_10190 985867 985055 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627941.1 protein_id gnl|my_center|LOCUS_10190 986630 985857 gene locus_tag LOCUS_10200 986630 985857 CDS product PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357107.1 protein_id gnl|my_center|LOCUS_10200 987124 986654 gene locus_tag LOCUS_10210 987124 986654 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287114.1 protein_id gnl|my_center|LOCUS_10210 987552 987145 gene locus_tag LOCUS_10220 987552 987145 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236585661.1 protein_id gnl|my_center|LOCUS_10220 988384 987554 gene locus_tag LOCUS_10230 988384 987554 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970333.1 protein_id gnl|my_center|LOCUS_10230 991118 988374 gene locus_tag LOCUS_10240 991118 988374 CDS product sigma-54-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287111.1 protein_id gnl|my_center|LOCUS_10240 993647 991956 gene locus_tag LOCUS_10250 993647 991956 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948373.1 protein_id gnl|my_center|LOCUS_10250 994462 993938 gene locus_tag LOCUS_10260 994462 993938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 995364 994549 gene locus_tag LOCUS_10270 995364 994549 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002469110.1 protein_id gnl|my_center|LOCUS_10270 996284 995352 gene locus_tag LOCUS_10280 996284 995352 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903779.1 protein_id gnl|my_center|LOCUS_10280 997098 996277 gene locus_tag LOCUS_10290 997098 996277 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430704.1 protein_id gnl|my_center|LOCUS_10290 997985 997095 gene locus_tag LOCUS_10300 997985 997095 CDS product L-ribulose-5-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095306.1 protein_id gnl|my_center|LOCUS_10300 998652 997951 gene locus_tag LOCUS_10310 gene araD 998652 997951 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005669745.1 protein_id gnl|my_center|LOCUS_10310 999699 998665 gene locus_tag LOCUS_10320 999699 998665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700534.1 protein_id gnl|my_center|LOCUS_10320 1000072 999770 gene locus_tag LOCUS_10330 1000072 999770 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358018.1 protein_id gnl|my_center|LOCUS_10330 1001619 1000141 gene locus_tag LOCUS_10340 1001619 1000141 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288827.1 protein_id gnl|my_center|LOCUS_10340 1002113 1001658 gene locus_tag LOCUS_10350 1002113 1001658 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358021.1 protein_id gnl|my_center|LOCUS_10350 1003186 1002128 gene locus_tag LOCUS_10360 gene ulaG 1003186 1002128 CDS product L-ascorbate 6-phosphate lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005053827.1 protein_id gnl|my_center|LOCUS_10360 1003432 1004226 gene locus_tag LOCUS_10370 1003432 1004226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 1004269 1005057 gene locus_tag LOCUS_10380 1004269 1005057 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321321.1 protein_id gnl|my_center|LOCUS_10380 1005271 1005759 gene locus_tag LOCUS_10390 1005271 1005759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 1005907 1006371 gene locus_tag LOCUS_10400 1005907 1006371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 1006368 1007666 gene locus_tag LOCUS_10410 1006368 1007666 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399308.1 protein_id gnl|my_center|LOCUS_10410 1007686 1008000 gene locus_tag LOCUS_10420 1007686 1008000 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655513.1 protein_id gnl|my_center|LOCUS_10420 1008005 1009498 gene locus_tag LOCUS_10430 1008005 1009498 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644028.1 protein_id gnl|my_center|LOCUS_10430 1009533 1010513 gene locus_tag LOCUS_10440 1009533 1010513 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894480.1 protein_id gnl|my_center|LOCUS_10440 1011261 1010755 gene locus_tag LOCUS_10450 1011261 1010755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 1012875 1011424 gene locus_tag LOCUS_10460 1012875 1011424 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021368039.1 protein_id gnl|my_center|LOCUS_10460 1013212 1012880 gene locus_tag LOCUS_10470 1013212 1012880 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573646.1 protein_id gnl|my_center|LOCUS_10470 1014515 1013244 gene locus_tag LOCUS_10480 1014515 1013244 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013245438.1 protein_id gnl|my_center|LOCUS_10480 1014857 1014534 gene locus_tag LOCUS_10490 1014857 1014534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 1015052 1016965 gene locus_tag LOCUS_10500 1015052 1016965 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674124.1 protein_id gnl|my_center|LOCUS_10500 1017032 1017316 gene locus_tag LOCUS_10510 1017032 1017316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 1017879 1017412 gene locus_tag LOCUS_10520 1017879 1017412 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288826.1 protein_id gnl|my_center|LOCUS_10520 1018239 1017937 gene locus_tag LOCUS_10530 gene ulaB 1018239 1017937 CDS product PTS ascorbate transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218365.1 protein_id gnl|my_center|LOCUS_10530 1019694 1018255 gene locus_tag LOCUS_10540 1019694 1018255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 1021086 1019731 gene locus_tag LOCUS_10550 gene ulaA 1021086 1019731 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000404886.1 protein_id gnl|my_center|LOCUS_10550 1021452 1022201 gene locus_tag LOCUS_10560 1021452 1022201 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321321.1 protein_id gnl|my_center|LOCUS_10560 1022337 1022843 gene locus_tag LOCUS_10570 1022337 1022843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 1022840 1023637 gene locus_tag LOCUS_10580 1022840 1023637 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321321.1 protein_id gnl|my_center|LOCUS_10580 1024431 1025819 gene locus_tag LOCUS_10590 1024431 1025819 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068591.1 protein_id gnl|my_center|LOCUS_10590 1027299 1025884 gene locus_tag LOCUS_10600 1027299 1025884 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964061.1 protein_id gnl|my_center|LOCUS_10600 1029172 1027313 gene locus_tag LOCUS_10610 1029172 1027313 CDS product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146623251.1 protein_id gnl|my_center|LOCUS_10610 1030158 1029307 gene locus_tag LOCUS_10620 1030158 1029307 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723338.1 protein_id gnl|my_center|LOCUS_10620 1030516 1032396 gene locus_tag LOCUS_10630 1030516 1032396 CDS product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931606.1 protein_id gnl|my_center|LOCUS_10630 1033267 1032476 gene locus_tag LOCUS_10640 1033267 1032476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 1034599 1033295 gene locus_tag LOCUS_10650 1034599 1033295 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724230.1 protein_id gnl|my_center|LOCUS_10650 1034909 1034619 gene locus_tag LOCUS_10660 1034909 1034619 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722919.1 protein_id gnl|my_center|LOCUS_10660 1036319 1034925 gene locus_tag LOCUS_10670 1036319 1034925 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989407.1 protein_id gnl|my_center|LOCUS_10670 1036632 1036321 gene locus_tag LOCUS_10680 1036632 1036321 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724232.1 protein_id gnl|my_center|LOCUS_10680 1037168 1036797 gene locus_tag LOCUS_10690 1037168 1036797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 1037962 1037213 gene locus_tag LOCUS_10700 1037962 1037213 CDS product ChbG/HpnK family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644021.1 protein_id gnl|my_center|LOCUS_10700 1039393 1037984 gene locus_tag LOCUS_10710 1039393 1037984 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644020.1 protein_id gnl|my_center|LOCUS_10710 1040307 1039471 gene locus_tag LOCUS_10720 1040307 1039471 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644019.1 protein_id gnl|my_center|LOCUS_10720 1041182 1040553 gene locus_tag LOCUS_10730 1041182 1040553 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032740920.1 protein_id gnl|my_center|LOCUS_10730 1041738 1041160 gene locus_tag LOCUS_10740 1041738 1041160 CDS product DUF3990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054641.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10740 1041839 1041693 gene locus_tag LOCUS_10750 1041839 1041693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 1042804 1041944 gene locus_tag LOCUS_10760 1042804 1041944 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020424.1 protein_id gnl|my_center|LOCUS_10760 1043488 1042856 gene locus_tag LOCUS_10770 1043488 1042856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 1043697 1043882 gene locus_tag LOCUS_10780 1043697 1043882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 1044078 1045193 gene locus_tag LOCUS_10790 1044078 1045193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 1046689 1045253 gene locus_tag LOCUS_10800 1046689 1045253 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861817.1 protein_id gnl|my_center|LOCUS_10800 1048256 1046808 gene locus_tag LOCUS_10810 1048256 1046808 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102204.1 protein_id gnl|my_center|LOCUS_10810 1049722 1048346 gene locus_tag LOCUS_10820 1049722 1048346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 1051306 1049798 gene locus_tag LOCUS_10830 1051306 1049798 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921866.1 protein_id gnl|my_center|LOCUS_10830 1052228 1051392 gene locus_tag LOCUS_10840 1052228 1051392 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644019.1 protein_id gnl|my_center|LOCUS_10840 1052730 1052251 gene locus_tag LOCUS_10850 1052730 1052251 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989640.1 protein_id gnl|my_center|LOCUS_10850 1053446 1052991 gene locus_tag LOCUS_10860 1053446 1052991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 1057032 1053439 gene locus_tag LOCUS_10870 1057032 1053439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 1058535 1057180 gene locus_tag LOCUS_10880 1058535 1057180 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066177.1 protein_id gnl|my_center|LOCUS_10880 1059753 1058716 gene locus_tag LOCUS_10890 1059753 1058716 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814884.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10890 1059992 1059702 gene locus_tag LOCUS_10900 1059992 1059702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 1060689 1060225 gene locus_tag LOCUS_10910 1060689 1060225 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966225.1 protein_id gnl|my_center|LOCUS_10910 1061243 1060692 gene locus_tag LOCUS_10920 1061243 1060692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 1062491 1061247 gene locus_tag LOCUS_10930 1062491 1061247 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015770.1 protein_id gnl|my_center|LOCUS_10930 1062901 1062599 gene locus_tag LOCUS_10940 1062901 1062599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 1063555 1063004 gene locus_tag LOCUS_10950 1063555 1063004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 1064939 1063713 gene locus_tag LOCUS_10960 1064939 1063713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 1065136 1066692 gene locus_tag LOCUS_10970 1065136 1066692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 1067542 1066994 gene locus_tag LOCUS_10980 1067542 1066994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10980 1067736 1067524 gene locus_tag LOCUS_10990 1067736 1067524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 1069305 1068211 gene locus_tag LOCUS_11000 1069305 1068211 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659298.1 protein_id gnl|my_center|LOCUS_11000 1070323 1069385 gene locus_tag LOCUS_11010 1070323 1069385 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130718.1 protein_id gnl|my_center|LOCUS_11010 1070995 1071135 gene locus_tag LOCUS_11020 1070995 1071135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 1071117 1072361 gene locus_tag LOCUS_11030 1071117 1072361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 1072659 1073000 gene locus_tag LOCUS_11040 1072659 1073000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 1073144 1073551 gene locus_tag LOCUS_11050 1073144 1073551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 1073538 1075373 gene locus_tag LOCUS_11060 1073538 1075373 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861117.1 protein_id gnl|my_center|LOCUS_11060 1075473 1075631 gene locus_tag LOCUS_11070 1075473 1075631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 1075786 1076058 gene locus_tag LOCUS_11080 1075786 1076058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 1076018 1076395 gene locus_tag LOCUS_11090 1076018 1076395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 1076445 1076762 gene locus_tag LOCUS_11100 1076445 1076762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 1077663 1076857 gene locus_tag LOCUS_11110 1077663 1076857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 1078332 1078673 gene locus_tag LOCUS_11120 1078332 1078673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 1078666 1078962 gene locus_tag LOCUS_11130 1078666 1078962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 1079264 1079788 gene locus_tag LOCUS_11140 1079264 1079788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943137.1 protein_id gnl|my_center|LOCUS_11140 1079974 1081554 gene locus_tag LOCUS_11150 1079974 1081554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 1081619 1082263 gene locus_tag LOCUS_11160 1081619 1082263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 1082175 1083569 gene locus_tag LOCUS_11170 1082175 1083569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 1083810 1084007 gene locus_tag LOCUS_11180 1083810 1084007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 1084014 1085678 gene locus_tag LOCUS_11190 1084014 1085678 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368663.1 protein_id gnl|my_center|LOCUS_11190 1085861 1086727 gene locus_tag LOCUS_11200 1085861 1086727 CDS product CD0415/CD1112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368724.1 protein_id gnl|my_center|LOCUS_11200 1086810 1087535 gene locus_tag LOCUS_11210 1086810 1087535 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989482.1 protein_id gnl|my_center|LOCUS_11210 1087628 1088128 gene locus_tag LOCUS_11220 1087628 1088128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 1088116 1088517 gene locus_tag LOCUS_11230 1088116 1088517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 1088465 1090831 gene locus_tag LOCUS_11240 1088465 1090831 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773627.1 protein_id gnl|my_center|LOCUS_11240 1090815 1092506 gene locus_tag LOCUS_11250 1090815 1092506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 1092520 1092786 gene locus_tag LOCUS_11260 1092520 1092786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 1092789 1093505 gene locus_tag LOCUS_11270 1092789 1093505 CDS product DUF4366 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035394374.1 protein_id gnl|my_center|LOCUS_11270 1093723 1094076 gene locus_tag LOCUS_11280 1093723 1094076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 1094259 1094408 gene locus_tag LOCUS_11290 1094259 1094408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 1094411 1094758 gene locus_tag LOCUS_11300 gene mobC 1094411 1094758 CDS product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368707.1 protein_id gnl|my_center|LOCUS_11300 1094918 1096264 gene locus_tag LOCUS_11310 1094918 1096264 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861101.1 protein_id gnl|my_center|LOCUS_11310 1096555 1097175 gene locus_tag LOCUS_11320 1096555 1097175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 1097325 1098242 gene locus_tag LOCUS_11330 1097325 1098242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 1098380 1098865 gene locus_tag LOCUS_11340 1098380 1098865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 1098874 1099044 gene locus_tag LOCUS_11350 1098874 1099044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 1099047 1100207 gene locus_tag LOCUS_11360 1099047 1100207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 1100665 1101087 gene locus_tag LOCUS_11370 1100665 1101087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 1101538 1101714 gene locus_tag LOCUS_11380 1101538 1101714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 1101799 1103280 gene locus_tag LOCUS_11390 1101799 1103280 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965254.1 protein_id gnl|my_center|LOCUS_11390 1103344 1104246 gene locus_tag LOCUS_11400 1103344 1104246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 1104861 1104322 gene locus_tag LOCUS_11410 1104861 1104322 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016402.1 protein_id gnl|my_center|LOCUS_11410 1105312 1104929 gene locus_tag LOCUS_11420 1105312 1104929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 1107750 1105495 gene locus_tag LOCUS_11430 1107750 1105495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 1108624 1107761 gene locus_tag LOCUS_11440 1108624 1107761 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050496022.1 protein_id gnl|my_center|LOCUS_11440 1110181 1109114 gene locus_tag LOCUS_11450 gene papA 1110181 1109114 CDS product aminopeptidase PapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230224.1 protein_id gnl|my_center|LOCUS_11450 1112526 1110256 gene locus_tag LOCUS_11460 1112526 1110256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 1113602 1112544 gene locus_tag LOCUS_11470 1113602 1112544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 1115197 1113614 gene locus_tag LOCUS_11480 1115197 1113614 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700706.1 protein_id gnl|my_center|LOCUS_11480 1115944 1115594 gene locus_tag LOCUS_11490 1115944 1115594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 1118478 1116160 gene locus_tag LOCUS_11500 1118478 1116160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 1119133 1118465 gene locus_tag LOCUS_11510 1119133 1118465 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870305.1 protein_id gnl|my_center|LOCUS_11510 1120365 1119112 gene locus_tag LOCUS_11520 1120365 1119112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 1121746 1120370 gene locus_tag LOCUS_11530 1121746 1120370 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201919.1 protein_id gnl|my_center|LOCUS_11530 1123034 1122009 gene locus_tag LOCUS_11540 1123034 1122009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 1124020 1123289 gene locus_tag LOCUS_11550 gene rgbR 1124020 1123289 CDS product two-component system response regulator RgbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438019.1 protein_id gnl|my_center|LOCUS_11550 1124745 1124221 gene locus_tag LOCUS_11560 gene nrdG 1124745 1124221 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432598.1 protein_id gnl|my_center|LOCUS_11560 1127083 1124738 gene locus_tag LOCUS_11570 1127083 1124738 CDS product anaerobic ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436320.1 protein_id gnl|my_center|LOCUS_11570 1127261 1128163 gene locus_tag LOCUS_11580 gene yidA 1127261 1128163 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048269.1 protein_id gnl|my_center|LOCUS_11580 1129108 1128179 gene locus_tag LOCUS_11590 1129108 1128179 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459514.1 protein_id gnl|my_center|LOCUS_11590 1129683 1129234 gene locus_tag LOCUS_11600 1129683 1129234 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837587.1 protein_id gnl|my_center|LOCUS_11600 1130916 1129804 gene locus_tag LOCUS_11610 1130916 1129804 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510927.1 protein_id gnl|my_center|LOCUS_11610 1131605 1130919 gene locus_tag LOCUS_11620 gene vanR 1131605 1130919 CDS product vancomycin resistance response regulator transcription factor VanR-I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461303.1 protein_id gnl|my_center|LOCUS_11620 1132828 1132007 gene locus_tag LOCUS_11630 1132828 1132007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 1134488 1132956 gene locus_tag LOCUS_11640 1134488 1132956 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965729.1 protein_id gnl|my_center|LOCUS_11640 1135149 1134472 gene locus_tag LOCUS_11650 1135149 1134472 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460434.1 protein_id gnl|my_center|LOCUS_11650 1135903 1135214 gene locus_tag LOCUS_11660 1135903 1135214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 1137133 1136276 gene locus_tag LOCUS_11670 gene rsmI 1137133 1136276 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000267819.1 protein_id gnl|my_center|LOCUS_11670 1138114 1137143 gene locus_tag LOCUS_11680 1138114 1137143 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221433.1 protein_id gnl|my_center|LOCUS_11680 1139090 1138116 gene locus_tag LOCUS_11690 gene holB 1139090 1138116 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244417.1 protein_id gnl|my_center|LOCUS_11690 1139715 1139083 gene locus_tag LOCUS_11700 gene tmk 1139715 1139083 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294039.1 protein_id gnl|my_center|LOCUS_11700 1141104 1139839 gene locus_tag LOCUS_11710 1141104 1139839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 1142295 1141396 gene locus_tag LOCUS_11720 1142295 1141396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 1143574 1142297 gene locus_tag LOCUS_11730 gene celB 1143574 1142297 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244271.1 protein_id gnl|my_center|LOCUS_11730 1143745 1144749 gene locus_tag LOCUS_11740 1143745 1144749 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476555.1 protein_id gnl|my_center|LOCUS_11740 1145878 1144883 gene locus_tag LOCUS_11750 1145878 1144883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 1146185 1147345 gene locus_tag LOCUS_11760 1146185 1147345 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010680900.1 protein_id gnl|my_center|LOCUS_11760 1148109 1147672 gene locus_tag LOCUS_11770 1148109 1147672 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813311.1 protein_id gnl|my_center|LOCUS_11770 1148556 1148131 gene locus_tag LOCUS_11780 1148556 1148131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 1149124 1148645 gene locus_tag LOCUS_11790 1149124 1148645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 1150603 1149275 gene locus_tag LOCUS_11800 1150603 1149275 CDS product 6-phospho-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948070.1 protein_id gnl|my_center|LOCUS_11800 1150861 1151637 gene locus_tag LOCUS_11810 1150861 1151637 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963852.1 protein_id gnl|my_center|LOCUS_11810 1152503 1151685 gene locus_tag LOCUS_11820 1152503 1151685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 1153170 1152619 gene locus_tag LOCUS_11830 1153170 1152619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 1153744 1153193 gene locus_tag LOCUS_11840 1153744 1153193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 1154010 1154660 gene locus_tag LOCUS_11850 1154010 1154660 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965420.1 protein_id gnl|my_center|LOCUS_11850 1154840 1155205 gene locus_tag LOCUS_11860 1154840 1155205 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966669.1 protein_id gnl|my_center|LOCUS_11860 1155283 1155798 gene locus_tag LOCUS_11870 1155283 1155798 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966668.1 protein_id gnl|my_center|LOCUS_11870 1157627 1156062 gene locus_tag LOCUS_11880 1157627 1156062 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_11880 1159246 1157669 gene locus_tag LOCUS_11890 1159246 1157669 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_11890 1159492 1159998 gene locus_tag LOCUS_11900 1159492 1159998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 1160985 1160086 gene locus_tag LOCUS_11910 1160985 1160086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 1162991 1161000 gene locus_tag LOCUS_11920 1162991 1161000 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986666.1 protein_id gnl|my_center|LOCUS_11920 1163220 1163813 gene locus_tag LOCUS_11930 1163220 1163813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 1164548 1166128 gene locus_tag LOCUS_11940 gene malP 1164548 1166128 CDS product PTS maltose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233606.1 protein_id gnl|my_center|LOCUS_11940 1166147 1166650 gene locus_tag LOCUS_11950 1166147 1166650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 1166669 1168000 gene locus_tag LOCUS_11960 1166669 1168000 CDS product 6-phospho-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963854.1 protein_id gnl|my_center|LOCUS_11960 1168002 1168478 gene locus_tag LOCUS_11970 1168002 1168478 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948064.1 protein_id gnl|my_center|LOCUS_11970 1168580 1169239 gene locus_tag LOCUS_11980 1168580 1169239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 1169996 1169277 gene locus_tag LOCUS_11990 1169996 1169277 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964889.1 protein_id gnl|my_center|LOCUS_11990 1170258 1170440 gene locus_tag LOCUS_12000 1170258 1170440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 1170602 1171378 gene locus_tag LOCUS_12010 1170602 1171378 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860824.1 protein_id gnl|my_center|LOCUS_12010 1171356 1172120 gene locus_tag LOCUS_12020 1171356 1172120 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963852.1 protein_id gnl|my_center|LOCUS_12020 1173426 1172248 gene locus_tag LOCUS_12030 1173426 1172248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 1175487 1173913 gene locus_tag LOCUS_12040 1175487 1173913 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861711.1 protein_id gnl|my_center|LOCUS_12040 1177101 1175515 gene locus_tag LOCUS_12050 1177101 1175515 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030046.1 protein_id gnl|my_center|LOCUS_12050 1177256 1179049 gene locus_tag LOCUS_12060 gene manR 1177256 1179049 CDS product mannose transport/utilization transcriptional regulator ManR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245617.1 protein_id gnl|my_center|LOCUS_12060 1179318 1180511 gene locus_tag LOCUS_12070 1179318 1180511 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693372.1 protein_id gnl|my_center|LOCUS_12070 1180702 1182039 gene locus_tag LOCUS_12080 1180702 1182039 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288793.1 protein_id gnl|my_center|LOCUS_12080 1182039 1182650 gene locus_tag LOCUS_12090 1182039 1182650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002309706.1 protein_id gnl|my_center|LOCUS_12090 1182976 1183986 gene locus_tag LOCUS_12100 1182976 1183986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 1184114 1185127 gene locus_tag LOCUS_12110 1184114 1185127 CDS product C45 family autoproteolytic acyltransferase/hydolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986736.1 protein_id gnl|my_center|LOCUS_12110 1185380 1185213 gene locus_tag LOCUS_12120 1185380 1185213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 1186007 1185546 gene locus_tag LOCUS_12130 1186007 1185546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 1186419 1186054 gene locus_tag LOCUS_12140 1186419 1186054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 1186570 1186929 gene locus_tag LOCUS_12150 1186570 1186929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 1188211 1186991 gene locus_tag LOCUS_12160 1188211 1186991 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001224962.1 protein_id gnl|my_center|LOCUS_12160 1189125 1188208 gene locus_tag LOCUS_12170 1189125 1188208 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058115.1 protein_id gnl|my_center|LOCUS_12170 1189888 1189235 gene locus_tag LOCUS_12180 1189888 1189235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 1191480 1190023 gene locus_tag LOCUS_12190 1191480 1190023 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387645.1 protein_id gnl|my_center|LOCUS_12190 1191558 1192754 gene locus_tag LOCUS_12200 1191558 1192754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 1193630 1192749 gene locus_tag LOCUS_12210 1193630 1192749 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721732.1 protein_id gnl|my_center|LOCUS_12210 1195039 1193627 gene locus_tag LOCUS_12220 1195039 1193627 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732174.1 protein_id gnl|my_center|LOCUS_12220 1196330 1195032 gene locus_tag LOCUS_12230 gene celB 1196330 1195032 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009901597.1 protein_id gnl|my_center|LOCUS_12230 1196936 1196514 gene locus_tag LOCUS_12240 1196936 1196514 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272575.1 protein_id gnl|my_center|LOCUS_12240 1197308 1196955 gene locus_tag LOCUS_12250 1197308 1196955 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272757.1 protein_id gnl|my_center|LOCUS_12250 1198340 1197327 gene locus_tag LOCUS_12260 1198340 1197327 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462034.1 protein_id gnl|my_center|LOCUS_12260 1198694 1198422 gene locus_tag LOCUS_12270 1198694 1198422 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461958.1 protein_id gnl|my_center|LOCUS_12270 1199220 1198921 gene locus_tag LOCUS_12280 1199220 1198921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 1200119 1199391 gene locus_tag LOCUS_12290 1200119 1199391 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903177.1 protein_id gnl|my_center|LOCUS_12290 1201048 1200134 gene locus_tag LOCUS_12300 gene miaA 1201048 1200134 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504940.1 protein_id gnl|my_center|LOCUS_12300 1203077 1201053 gene locus_tag LOCUS_12310 gene mutL 1203077 1201053 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516465.1 protein_id gnl|my_center|LOCUS_12310 1205626 1203095 gene locus_tag LOCUS_12320 gene mutS 1205626 1203095 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196026.1 protein_id gnl|my_center|LOCUS_12320 1205857 1207074 gene locus_tag LOCUS_12330 1205857 1207074 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654702.1 protein_id gnl|my_center|LOCUS_12330 1207873 1207100 gene locus_tag LOCUS_12340 1207873 1207100 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232918.1 protein_id gnl|my_center|LOCUS_12340 1207934 1208479 gene locus_tag LOCUS_12350 1207934 1208479 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905301.1 protein_id gnl|my_center|LOCUS_12350 1208476 1208736 gene locus_tag LOCUS_12360 1208476 1208736 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129524.1 protein_id gnl|my_center|LOCUS_12360 1209655 1208726 gene locus_tag LOCUS_12370 1209655 1208726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 1210321 1209728 gene locus_tag LOCUS_12380 gene recR 1210321 1209728 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559169.1 protein_id gnl|my_center|LOCUS_12380 1210626 1210321 gene locus_tag LOCUS_12390 1210626 1210321 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359499.1 protein_id gnl|my_center|LOCUS_12390 1212430 1210631 gene locus_tag LOCUS_12400 1212430 1210631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 1213132 1212659 gene locus_tag LOCUS_12410 gene tadA 1213132 1212659 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247140.1 protein_id gnl|my_center|LOCUS_12410 1215703 1214417 gene locus_tag LOCUS_12420 gene serS 1215703 1214417 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948259.1 protein_id gnl|my_center|LOCUS_12420 1218488 1215960 gene locus_tag LOCUS_12430 gene gyrA 1218488 1215960 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282864.1 protein_id gnl|my_center|LOCUS_12430 1220450 1218504 gene locus_tag LOCUS_12440 gene gyrB 1220450 1218504 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435993.1 protein_id gnl|my_center|LOCUS_12440 1221564 1220443 gene locus_tag LOCUS_12450 gene recF 1221564 1220443 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837724.1 protein_id gnl|my_center|LOCUS_12450 1221764 1221561 gene locus_tag LOCUS_12460 gene yaaA 1221764 1221561 CDS product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958651.1 protein_id gnl|my_center|LOCUS_12460 1223309 1222008 gene locus_tag LOCUS_12470 1223309 1222008 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460406.1 protein_id gnl|my_center|LOCUS_12470 1223585 1224667 gene locus_tag LOCUS_12480 1223585 1224667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 1224713 1225072 gene locus_tag LOCUS_12490 1224713 1225072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 1225351 1225145 gene locus_tag LOCUS_12500 1225351 1225145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 1226812 1225622 gene locus_tag LOCUS_12510 1226812 1225622 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860746.1 protein_id gnl|my_center|LOCUS_12510 1227094 1226891 gene locus_tag LOCUS_12520 1227094 1226891 CDS product excisionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004613735.1 protein_id gnl|my_center|LOCUS_12520 1227730 1227491 gene locus_tag LOCUS_12530 1227730 1227491 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860747.1 protein_id gnl|my_center|LOCUS_12530 1228163 1227735 gene locus_tag LOCUS_12540 1228163 1227735 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003061815.1 protein_id gnl|my_center|LOCUS_12540 1228899 1228534 gene locus_tag LOCUS_12550 1228899 1228534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 1229140 1228916 gene locus_tag LOCUS_12560 1229140 1228916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860757.1 protein_id gnl|my_center|LOCUS_12560 1229299 1229667 gene locus_tag LOCUS_12570 1229299 1229667 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435155.1 protein_id gnl|my_center|LOCUS_12570 1229941 1229705 gene locus_tag LOCUS_12580 1229941 1229705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 1230763 1230131 gene locus_tag LOCUS_12590 1230763 1230131 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426165.1 protein_id gnl|my_center|LOCUS_12590 1232087 1230777 gene locus_tag LOCUS_12600 1232087 1230777 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722689.1 protein_id gnl|my_center|LOCUS_12600 1233431 1232100 gene locus_tag LOCUS_12610 gene vex3 1233431 1232100 CDS product ABC transporter permease subunit Vex3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902984.1 protein_id gnl|my_center|LOCUS_12610 1234752 1233496 gene locus_tag LOCUS_12620 1234752 1233496 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986504.1 protein_id gnl|my_center|LOCUS_12620 1235530 1234859 gene locus_tag LOCUS_12630 1235530 1234859 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986505.1 protein_id gnl|my_center|LOCUS_12630 1235886 1235650 gene locus_tag LOCUS_12640 1235886 1235650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 1236324 1236133 gene locus_tag LOCUS_12650 1236324 1236133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 1236865 1236317 gene locus_tag LOCUS_12660 1236865 1236317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 1237581 1237057 gene locus_tag LOCUS_12670 1237581 1237057 CDS product DUF4865 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571907.1 protein_id gnl|my_center|LOCUS_12670 1237704 1238555 gene locus_tag LOCUS_12680 1237704 1238555 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228551.1 protein_id gnl|my_center|LOCUS_12680 1239498 1238596 gene locus_tag LOCUS_12690 1239498 1238596 CDS product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860758.1 protein_id gnl|my_center|LOCUS_12690 1240522 1239515 gene locus_tag LOCUS_12700 1240522 1239515 CDS product bifunctional lysozyme/C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860759.1 protein_id gnl|my_center|LOCUS_12700 1242702 1240519 gene locus_tag LOCUS_12710 1242702 1240519 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860760.1 protein_id gnl|my_center|LOCUS_12710 1245152 1242702 gene locus_tag LOCUS_12720 1245152 1242702 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860761.1 protein_id gnl|my_center|LOCUS_12720 1245528 1245130 gene locus_tag LOCUS_12730 1245528 1245130 CDS product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004843362.1 protein_id gnl|my_center|LOCUS_12730 1246139 1245636 gene locus_tag LOCUS_12740 1246139 1245636 CDS product antirestriction protein ArdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861949.1 protein_id gnl|my_center|LOCUS_12740 1246660 1246157 gene locus_tag LOCUS_12750 1246660 1246157 CDS product antirestriction protein ArdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860763.1 protein_id gnl|my_center|LOCUS_12750 1246875 1246579 gene locus_tag LOCUS_12760 1246875 1246579 CDS product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860764.1 protein_id gnl|my_center|LOCUS_12760 1247404 1246988 gene locus_tag LOCUS_12770 1247404 1246988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 1247838 1247617 gene locus_tag LOCUS_12780 1247838 1247617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317729.1 protein_id gnl|my_center|LOCUS_12780 1247973 1247839 gene locus_tag LOCUS_12790 1247973 1247839 CDS product DUF3789 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860765.1 protein_id gnl|my_center|LOCUS_12790 1249181 1247985 gene locus_tag LOCUS_12800 gene mobT 1249181 1247985 CDS product MobT family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861953.1 protein_id gnl|my_center|LOCUS_12800 1250759 1249365 gene locus_tag LOCUS_12810 1250759 1249365 CDS product cell division protein FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861954.1 protein_id gnl|my_center|LOCUS_12810 1251582 1250824 gene locus_tag LOCUS_12820 1251582 1250824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 1252064 1251681 gene locus_tag LOCUS_12830 1252064 1251681 CDS product YdcP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861955.1 protein_id gnl|my_center|LOCUS_12830 1252406 1252080 gene locus_tag LOCUS_12840 1252406 1252080 CDS product YdcP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861956.1 protein_id gnl|my_center|LOCUS_12840 1255691 1252641 gene locus_tag LOCUS_12850 1255691 1252641 CDS product SrtB-anchored collagen-binding adhesin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417594.1 protein_id gnl|my_center|LOCUS_12850 1256798 1255956 gene locus_tag LOCUS_12860 1256798 1255956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 1257997 1256879 gene locus_tag LOCUS_12870 gene dnaN 1257997 1256879 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212527.1 protein_id gnl|my_center|LOCUS_12870 1259502 1258144 gene locus_tag LOCUS_12880 gene dnaA 1259502 1258144 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_12880 1260028 1260735 gene locus_tag LOCUS_12890 1260028 1260735 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731957.1 protein_id gnl|my_center|LOCUS_12890 1260877 1261011 gene locus_tag LOCUS_12900 gene rpmH 1260877 1261011 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240855.1 protein_id gnl|my_center|LOCUS_12900 1261069 1261395 gene locus_tag LOCUS_12910 gene rnpA 1261069 1261395 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183578.1 protein_id gnl|my_center|LOCUS_12910 1261426 1262418 gene locus_tag LOCUS_12920 1261426 1262418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 1262430 1263044 gene locus_tag LOCUS_12930 1262430 1263044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 1263137 1264696 gene locus_tag LOCUS_12940 1263137 1264696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 1264724 1265392 gene locus_tag LOCUS_12950 1264724 1265392 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964178.1 protein_id gnl|my_center|LOCUS_12950 1265492 1266424 gene locus_tag LOCUS_12960 1265492 1266424 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948486.1 protein_id gnl|my_center|LOCUS_12960 1266396 1267181 gene locus_tag LOCUS_12970 1266396 1267181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 1267199 1268074 gene locus_tag LOCUS_12980 1267199 1268074 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948489.1 protein_id gnl|my_center|LOCUS_12980 1268088 1268852 gene locus_tag LOCUS_12990 1268088 1268852 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861832.1 protein_id gnl|my_center|LOCUS_12990 1270796 1268868 gene locus_tag LOCUS_13000 1270796 1268868 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861809.1 protein_id gnl|my_center|LOCUS_13000 1272355 1271195 gene locus_tag LOCUS_13010 1272355 1271195 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010680900.1 protein_id gnl|my_center|LOCUS_13010 1272664 1272972 gene locus_tag LOCUS_13020 1272664 1272972 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898152.1 protein_id gnl|my_center|LOCUS_13020 1272994 1274283 gene locus_tag LOCUS_13030 1272994 1274283 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861808.1 protein_id gnl|my_center|LOCUS_13030 1274296 1274625 gene locus_tag LOCUS_13040 1274296 1274625 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721484.1 protein_id gnl|my_center|LOCUS_13040 1274645 1276153 gene locus_tag LOCUS_13050 1274645 1276153 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931832.1 protein_id gnl|my_center|LOCUS_13050 1277042 1276236 gene locus_tag LOCUS_13060 1277042 1276236 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390072.1 protein_id gnl|my_center|LOCUS_13060 1277100 1277339 gene locus_tag LOCUS_13070 1277100 1277339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 1277382 1277981 gene locus_tag LOCUS_13080 1277382 1277981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 1278079 1278294 gene locus_tag LOCUS_13090 1278079 1278294 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809912.1 protein_id gnl|my_center|LOCUS_13090 1278281 1278724 gene locus_tag LOCUS_13100 1278281 1278724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809910.1 protein_id gnl|my_center|LOCUS_13100 1279580 1278771 gene locus_tag LOCUS_13110 1279580 1278771 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876725.1 protein_id gnl|my_center|LOCUS_13110 1280076 1279606 gene locus_tag LOCUS_13120 1280076 1279606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 1280527 1280087 gene locus_tag LOCUS_13130 1280527 1280087 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868208.1 protein_id gnl|my_center|LOCUS_13130 1280774 1281334 gene locus_tag LOCUS_13140 gene pth 1280774 1281334 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226727.1 protein_id gnl|my_center|LOCUS_13140 1281343 1284792 gene locus_tag LOCUS_13150 gene mfd 1281343 1284792 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243453.1 protein_id gnl|my_center|LOCUS_13150 1285112 1285402 gene locus_tag LOCUS_13160 1285112 1285402 CDS product DUF2087 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360471.1 protein_id gnl|my_center|LOCUS_13160 1286335 1285490 gene locus_tag LOCUS_13170 1286335 1285490 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963489.1 protein_id gnl|my_center|LOCUS_13170 1287624 1286338 gene locus_tag LOCUS_13180 1287624 1286338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 1287821 1288756 gene locus_tag LOCUS_13190 1287821 1288756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 1288897 1290450 gene locus_tag LOCUS_13200 1288897 1290450 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681436.1 protein_id gnl|my_center|LOCUS_13200 1292267 1290738 gene locus_tag LOCUS_13210 1292267 1290738 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016681.1 protein_id gnl|my_center|LOCUS_13210 1292504 1292704 gene locus_tag LOCUS_13220 1292504 1292704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 1292783 1293364 gene locus_tag LOCUS_13230 1292783 1293364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 1293871 1293482 gene locus_tag LOCUS_13240 1293871 1293482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 1294057 1294482 gene locus_tag LOCUS_13250 1294057 1294482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 1294634 1294957 gene locus_tag LOCUS_13260 1294634 1294957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 1295037 1295543 gene locus_tag LOCUS_13270 gene cobO 1295037 1295543 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867207.1 protein_id gnl|my_center|LOCUS_13270 1295599 1296225 gene locus_tag LOCUS_13280 1295599 1296225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 1297589 1296399 gene locus_tag LOCUS_13290 1297589 1296399 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860746.1 protein_id gnl|my_center|LOCUS_13290 1297870 1297667 gene locus_tag LOCUS_13300 1297870 1297667 CDS product excisionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004613735.1 protein_id gnl|my_center|LOCUS_13300 1298487 1298245 gene locus_tag LOCUS_13310 1298487 1298245 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860747.1 protein_id gnl|my_center|LOCUS_13310 1298905 1298477 gene locus_tag LOCUS_13320 1298905 1298477 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003061815.1 protein_id gnl|my_center|LOCUS_13320 1299409 1299185 gene locus_tag LOCUS_13330 1299409 1299185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860757.1 protein_id gnl|my_center|LOCUS_13330 1299866 1299441 gene locus_tag LOCUS_13340 1299866 1299441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 1299841 1300125 gene locus_tag LOCUS_13350 1299841 1300125 CDS product topoisomerase DNA-binding C4 zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008787627.1 protein_id gnl|my_center|LOCUS_13350 1300265 1300528 gene locus_tag LOCUS_13360 1300265 1300528 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368882.1 protein_id gnl|my_center|LOCUS_13360 1300757 1301494 gene locus_tag LOCUS_13370 gene erm(B) 1300757 1301494 CDS product 23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038792.1 protein_id gnl|my_center|LOCUS_13370 1302497 1302081 gene locus_tag LOCUS_13380 1302497 1302081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 1302697 1302494 gene locus_tag LOCUS_13390 1302697 1302494 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438035.1 protein_id gnl|my_center|LOCUS_13390 1303709 1302798 gene locus_tag LOCUS_13400 1303709 1302798 CDS product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860758.1 protein_id gnl|my_center|LOCUS_13400 1304732 1303725 gene locus_tag LOCUS_13410 1304732 1303725 CDS product bifunctional lysozyme/C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860759.1 protein_id gnl|my_center|LOCUS_13410 1306930 1304729 gene locus_tag LOCUS_13420 1306930 1304729 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860760.1 protein_id gnl|my_center|LOCUS_13420 1309380 1306930 gene locus_tag LOCUS_13430 1309380 1306930 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861947.1 protein_id gnl|my_center|LOCUS_13430 1309756 1309358 gene locus_tag LOCUS_13440 1309756 1309358 CDS product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004843362.1 protein_id gnl|my_center|LOCUS_13440 1309910 1309743 gene locus_tag LOCUS_13450 1309910 1309743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 1310376 1309873 gene locus_tag LOCUS_13460 1310376 1309873 CDS product antirestriction protein ArdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861949.1 protein_id gnl|my_center|LOCUS_13460 1310897 1310394 gene locus_tag LOCUS_13470 1310897 1310394 CDS product antirestriction protein ArdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861950.1 protein_id gnl|my_center|LOCUS_13470 1311112 1310816 gene locus_tag LOCUS_13480 1311112 1310816 CDS product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861951.1 protein_id gnl|my_center|LOCUS_13480 1311842 1311222 gene locus_tag LOCUS_13490 1311842 1311222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 1312153 1311932 gene locus_tag LOCUS_13500 1312153 1311932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317729.1 protein_id gnl|my_center|LOCUS_13500 1312288 1312154 gene locus_tag LOCUS_13510 1312288 1312154 CDS product DUF3789 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860765.1 protein_id gnl|my_center|LOCUS_13510 1313497 1312301 gene locus_tag LOCUS_13520 gene mobT 1313497 1312301 CDS product MobT family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861953.1 protein_id gnl|my_center|LOCUS_13520 1315075 1313681 gene locus_tag LOCUS_13530 1315075 1313681 CDS product cell division protein FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861954.1 protein_id gnl|my_center|LOCUS_13530 1315347 1315144 gene locus_tag LOCUS_13540 1315347 1315144 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423163.1 protein_id gnl|my_center|LOCUS_13540 1315992 1315351 gene locus_tag LOCUS_13550 1315992 1315351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 1316492 1316109 gene locus_tag LOCUS_13560 1316492 1316109 CDS product YdcP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861955.1 protein_id gnl|my_center|LOCUS_13560 1316834 1316508 gene locus_tag LOCUS_13570 1316834 1316508 CDS product YdcP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861956.1 protein_id gnl|my_center|LOCUS_13570 1320122 1317069 gene locus_tag LOCUS_13580 1320122 1317069 CDS product SrtB-anchored collagen-binding adhesin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860772.1 protein_id gnl|my_center|LOCUS_13580 1320400 1320756 gene locus_tag LOCUS_13590 1320400 1320756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 1320803 1321171 gene locus_tag LOCUS_13600 1320803 1321171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 1321184 1321756 gene locus_tag LOCUS_13610 1321184 1321756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 1321762 1322640 gene locus_tag LOCUS_13620 1321762 1322640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 1322646 1323593 gene locus_tag LOCUS_13630 1322646 1323593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 1323603 1323905 gene locus_tag LOCUS_13640 1323603 1323905 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837349.1 protein_id gnl|my_center|LOCUS_13640 1324193 1323945 gene locus_tag LOCUS_13650 1324193 1323945 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809979.1 protein_id gnl|my_center|LOCUS_13650 1324391 1324885 gene locus_tag LOCUS_13660 gene spoVT 1324391 1324885 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359411.1 protein_id gnl|my_center|LOCUS_13660 1324916 1325203 gene locus_tag LOCUS_13670 1324916 1325203 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194330.1 protein_id gnl|my_center|LOCUS_13670 1325272 1325895 gene locus_tag LOCUS_13680 1325272 1325895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 1325892 1326368 gene locus_tag LOCUS_13690 1325892 1326368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 1326422 1326724 gene locus_tag LOCUS_13700 gene yabP 1326422 1326724 CDS product sporulation protein YabP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059104.1 protein_id gnl|my_center|LOCUS_13700 1327118 1327456 gene locus_tag LOCUS_13710 1327118 1327456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 1327618 1328280 gene locus_tag LOCUS_13720 1327618 1328280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 1328273 1328725 gene locus_tag LOCUS_13730 1328273 1328725 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261902.1 protein_id gnl|my_center|LOCUS_13730 1328767 1329096 gene locus_tag LOCUS_13740 1328767 1329096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 1329090 1329356 gene locus_tag LOCUS_13750 1329090 1329356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 1329363 1329485 gene locus_tag LOCUS_13760 1329363 1329485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 1329495 1329725 gene locus_tag LOCUS_13770 1329495 1329725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 1329737 1330288 gene locus_tag LOCUS_13780 1329737 1330288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 1331360 1330323 gene locus_tag LOCUS_13790 1331360 1330323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 1331488 1332174 gene locus_tag LOCUS_13800 1331488 1332174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 1332287 1333087 gene locus_tag LOCUS_13810 1332287 1333087 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091542811.1 protein_id gnl|my_center|LOCUS_13810 1333149 1334789 gene locus_tag LOCUS_13820 1333149 1334789 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_13820 1334881 1335642 gene locus_tag LOCUS_13830 1334881 1335642 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467026.1 protein_id gnl|my_center|LOCUS_13830 1335836 1336213 gene locus_tag LOCUS_13840 1335836 1336213 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035213450.1 protein_id gnl|my_center|LOCUS_13840 1336246 1336515 gene locus_tag LOCUS_13850 1336246 1336515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 1336678 1336833 gene locus_tag LOCUS_13860 1336678 1336833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 1337045 1337869 gene locus_tag LOCUS_13870 1337045 1337869 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811658.1 protein_id gnl|my_center|LOCUS_13870 1337871 1338779 gene locus_tag LOCUS_13880 1337871 1338779 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459799.1 protein_id gnl|my_center|LOCUS_13880 1338748 1339158 gene locus_tag LOCUS_13890 1338748 1339158 CDS product DUF2000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889078.1 protein_id gnl|my_center|LOCUS_13890 1339243 1339698 gene locus_tag LOCUS_13900 1339243 1339698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680353.1 protein_id gnl|my_center|LOCUS_13900 1340268 1339744 gene locus_tag LOCUS_13910 1340268 1339744 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897047.1 protein_id gnl|my_center|LOCUS_13910 1341481 1340498 gene locus_tag LOCUS_13920 1341481 1340498 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459857.1 protein_id gnl|my_center|LOCUS_13920 1342470 1341841 gene locus_tag LOCUS_13930 1342470 1341841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 1342993 1342523 gene locus_tag LOCUS_13940 1342993 1342523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 1343870 1343295 gene locus_tag LOCUS_13950 1343870 1343295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 1344019 1344720 gene locus_tag LOCUS_13960 1344019 1344720 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068640.1 protein_id gnl|my_center|LOCUS_13960 1344727 1348389 gene locus_tag LOCUS_13970 1344727 1348389 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032740909.1 protein_id gnl|my_center|LOCUS_13970 1349209 1348520 gene locus_tag LOCUS_13980 1349209 1348520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 1349362 1349598 gene locus_tag LOCUS_13990 1349362 1349598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 1349688 1350491 gene locus_tag LOCUS_14000 1349688 1350491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 1350650 1352026 gene locus_tag LOCUS_14010 1350650 1352026 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890696.1 protein_id gnl|my_center|LOCUS_14010 1352040 1353350 gene locus_tag LOCUS_14020 gene celB 1352040 1353350 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009901597.1 protein_id gnl|my_center|LOCUS_14020 1353347 1354636 gene locus_tag LOCUS_14030 1353347 1354636 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582847.1 protein_id gnl|my_center|LOCUS_14030 1354837 1355454 gene locus_tag LOCUS_14040 gene ytaF 1354837 1355454 CDS product sporulation membrane protein YtaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949142.1 protein_id gnl|my_center|LOCUS_14040 1355631 1356974 gene locus_tag LOCUS_14050 1355631 1356974 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094729231.1 protein_id gnl|my_center|LOCUS_14050 1357209 1356991 gene locus_tag LOCUS_14060 1357209 1356991 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423163.1 protein_id gnl|my_center|LOCUS_14060 1357851 1357213 gene locus_tag LOCUS_14070 1357851 1357213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 1358350 1359924 gene locus_tag LOCUS_14080 gene gpmI 1358350 1359924 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973414.1 protein_id gnl|my_center|LOCUS_14080 1359890 1360114 gene locus_tag LOCUS_14090 1359890 1360114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 1360101 1362086 gene locus_tag LOCUS_14100 1360101 1362086 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138304587.1 protein_id gnl|my_center|LOCUS_14100 1362177 1362611 gene locus_tag LOCUS_14110 1362177 1362611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 1363444 1362761 gene locus_tag LOCUS_14120 1363444 1362761 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787603.1 protein_id gnl|my_center|LOCUS_14120 1364307 1363444 gene locus_tag LOCUS_14130 1364307 1363444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 1364531 1367071 gene locus_tag LOCUS_14140 1364531 1367071 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472055.1 protein_id gnl|my_center|LOCUS_14140 1367090 1367221 gene locus_tag LOCUS_14150 1367090 1367221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 1367404 1368072 gene locus_tag LOCUS_14160 1367404 1368072 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888282.1 protein_id gnl|my_center|LOCUS_14160 1368149 1370287 gene locus_tag LOCUS_14170 1368149 1370287 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861226.1 protein_id gnl|my_center|LOCUS_14170 1371537 1370284 gene locus_tag LOCUS_14180 1371537 1370284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 1371829 1371987 gene locus_tag LOCUS_14190 1371829 1371987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 1373254 1372028 gene locus_tag LOCUS_14200 gene rpoN 1373254 1372028 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732487.1 protein_id gnl|my_center|LOCUS_14200 1373424 1376162 gene locus_tag LOCUS_14210 1373424 1376162 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002323457.1 protein_id gnl|my_center|LOCUS_14210 1376360 1376779 gene locus_tag LOCUS_14220 1376360 1376779 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861087.1 protein_id gnl|my_center|LOCUS_14220 1376794 1377276 gene locus_tag LOCUS_14230 1376794 1377276 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287114.1 protein_id gnl|my_center|LOCUS_14230 1377278 1378042 gene locus_tag LOCUS_14240 1377278 1378042 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287115.1 protein_id gnl|my_center|LOCUS_14240 1378032 1378850 gene locus_tag LOCUS_14250 1378032 1378850 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723163.1 protein_id gnl|my_center|LOCUS_14250 1378888 1379742 gene locus_tag LOCUS_14260 1378888 1379742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 1379735 1380166 gene locus_tag LOCUS_14270 1379735 1380166 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211334279.1 protein_id gnl|my_center|LOCUS_14270 1380204 1381214 gene locus_tag LOCUS_14280 1380204 1381214 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236585662.1 protein_id gnl|my_center|LOCUS_14280 1381367 1381510 gene locus_tag LOCUS_14290 1381367 1381510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 1383125 1381863 gene locus_tag LOCUS_14300 1383125 1381863 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812946.1 protein_id gnl|my_center|LOCUS_14300 1383217 1383681 gene locus_tag LOCUS_14310 1383217 1383681 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429434.1 protein_id gnl|my_center|LOCUS_14310 1383846 1384397 gene locus_tag LOCUS_14320 1383846 1384397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 1384412 1386037 gene locus_tag LOCUS_14330 1384412 1386037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 1386028 1388529 gene locus_tag LOCUS_14340 1386028 1388529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 1388684 1389379 gene locus_tag LOCUS_14350 1388684 1389379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 1390128 1390661 gene locus_tag LOCUS_14360 1390128 1390661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 1391313 1391456 gene locus_tag LOCUS_14370 1391313 1391456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 1391453 1391824 gene locus_tag LOCUS_14380 1391453 1391824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 1391893 1393992 gene locus_tag LOCUS_14390 1391893 1393992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 1393989 1395848 gene locus_tag LOCUS_14400 1393989 1395848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 1396033 1395878 gene locus_tag LOCUS_14410 1396033 1395878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 1397578 1396208 gene locus_tag LOCUS_14420 1397578 1396208 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048439.1 protein_id gnl|my_center|LOCUS_14420 1398523 1397738 gene locus_tag LOCUS_14430 1398523 1397738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 1398665 1399048 gene locus_tag LOCUS_14440 1398665 1399048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 1399944 1399369 gene locus_tag LOCUS_14450 1399944 1399369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 1400481 1400302 gene locus_tag LOCUS_14460 1400481 1400302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 1400715 1401590 gene locus_tag LOCUS_14470 1400715 1401590 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391779.1 protein_id gnl|my_center|LOCUS_14470 1401602 1402387 gene locus_tag LOCUS_14480 1401602 1402387 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785236.1 protein_id gnl|my_center|LOCUS_14480 1402936 1403721 gene locus_tag LOCUS_14490 1402936 1403721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 1403840 1405111 gene locus_tag LOCUS_14500 gene femA 1403840 1405111 CDS product glycine glycyltransferase FemA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673315.1 protein_id gnl|my_center|LOCUS_14500 1405275 1405823 gene locus_tag LOCUS_14510 gene rnmV 1405275 1405823 CDS product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692835.1 protein_id gnl|my_center|LOCUS_14510 1405816 1406673 gene locus_tag LOCUS_14520 gene rsmA 1405816 1406673 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226751.1 protein_id gnl|my_center|LOCUS_14520 1406663 1407502 gene locus_tag LOCUS_14530 gene ispE 1406663 1407502 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103329367.1 protein_id gnl|my_center|LOCUS_14530 1407607 1408296 gene locus_tag LOCUS_14540 1407607 1408296 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426384.1 protein_id gnl|my_center|LOCUS_14540 1408289 1409596 gene locus_tag LOCUS_14550 1408289 1409596 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458888.1 protein_id gnl|my_center|LOCUS_14550 1409749 1411104 gene locus_tag LOCUS_14560 gene glmU 1409749 1411104 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071030.1 protein_id gnl|my_center|LOCUS_14560 1411130 1412083 gene locus_tag LOCUS_14570 1411130 1412083 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218353.1 protein_id gnl|my_center|LOCUS_14570 1412103 1412456 gene locus_tag LOCUS_14580 1412103 1412456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 1413449 1412652 gene locus_tag LOCUS_14590 1413449 1412652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 1415162 1414398 gene locus_tag LOCUS_14600 1415162 1414398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 1415944 1415180 gene locus_tag LOCUS_14610 1415944 1415180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 1416025 1416780 gene locus_tag LOCUS_14620 1416025 1416780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 1416863 1418194 gene locus_tag LOCUS_14630 gene mnmE 1416863 1418194 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700790.1 protein_id gnl|my_center|LOCUS_14630 1418454 1419227 gene locus_tag LOCUS_14640 1418454 1419227 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226756.1 protein_id gnl|my_center|LOCUS_14640 1421440 1419521 gene locus_tag LOCUS_14650 1421440 1419521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 1422835 1421612 gene locus_tag LOCUS_14660 1422835 1421612 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459687.1 protein_id gnl|my_center|LOCUS_14660 1423938 1422832 gene locus_tag LOCUS_14670 1423938 1422832 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966652.1 protein_id gnl|my_center|LOCUS_14670 1425632 1424724 gene locus_tag LOCUS_14680 1425632 1424724 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966656.1 protein_id gnl|my_center|LOCUS_14680 1426867 1425632 gene locus_tag LOCUS_14690 1426867 1425632 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966655.1 protein_id gnl|my_center|LOCUS_14690 1427304 1426945 gene locus_tag LOCUS_14700 1427304 1426945 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949091.1 protein_id gnl|my_center|LOCUS_14700 1427712 1427347 gene locus_tag LOCUS_14710 1427712 1427347 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222779.1 protein_id gnl|my_center|LOCUS_14710 1429034 1427760 gene locus_tag LOCUS_14720 1429034 1427760 CDS product alkyl/aryl-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272198.1 protein_id gnl|my_center|LOCUS_14720 1429672 1429190 gene locus_tag LOCUS_14730 1429672 1429190 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902308.1 protein_id gnl|my_center|LOCUS_14730 1430668 1429727 gene locus_tag LOCUS_14740 1430668 1429727 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166348.1 protein_id gnl|my_center|LOCUS_14740 1431749 1430658 gene locus_tag LOCUS_14750 1431749 1430658 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722316.1 protein_id gnl|my_center|LOCUS_14750 1432784 1431759 gene locus_tag LOCUS_14760 1432784 1431759 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829632.1 protein_id gnl|my_center|LOCUS_14760 1433734 1432787 gene locus_tag LOCUS_14770 gene opp1B 1433734 1432787 CDS product oligopeptide ABC transporter permease Opp1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381304.1 protein_id gnl|my_center|LOCUS_14770 1435483 1433825 gene locus_tag LOCUS_14780 1435483 1433825 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824544.1 protein_id gnl|my_center|LOCUS_14780 1436847 1435864 gene locus_tag LOCUS_14790 1436847 1435864 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762189.1 protein_id gnl|my_center|LOCUS_14790 1437048 1437437 gene locus_tag LOCUS_14800 gene mutT 1437048 1437437 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932370.1 protein_id gnl|my_center|LOCUS_14800 1437434 1438621 gene locus_tag LOCUS_14810 1437434 1438621 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061090571.1 protein_id gnl|my_center|LOCUS_14810 1438636 1439862 gene locus_tag LOCUS_14820 1438636 1439862 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438750.1 protein_id gnl|my_center|LOCUS_14820 1440021 1440575 gene locus_tag LOCUS_14830 1440021 1440575 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461583.1 protein_id gnl|my_center|LOCUS_14830 1441346 1440651 gene locus_tag LOCUS_14840 1441346 1440651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 1442008 1443282 gene locus_tag LOCUS_14850 1442008 1443282 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016983.1 protein_id gnl|my_center|LOCUS_14850 1443283 1443864 gene locus_tag LOCUS_14860 1443283 1443864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 1444102 1444593 gene locus_tag LOCUS_14870 1444102 1444593 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903083.1 protein_id gnl|my_center|LOCUS_14870 1444625 1444966 gene locus_tag LOCUS_14880 1444625 1444966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 1444968 1445504 gene locus_tag LOCUS_14890 1444968 1445504 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897366.1 protein_id gnl|my_center|LOCUS_14890 1445940 1445518 gene locus_tag LOCUS_14900 1445940 1445518 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090577.1 protein_id gnl|my_center|LOCUS_14900 1447236 1445998 gene locus_tag LOCUS_14910 1447236 1445998 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903396.1 protein_id gnl|my_center|LOCUS_14910 1447553 1447236 gene locus_tag LOCUS_14920 gene trxA 1447553 1447236 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693835.1 protein_id gnl|my_center|LOCUS_14920 1448909 1447572 gene locus_tag LOCUS_14930 1448909 1447572 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659213.1 protein_id gnl|my_center|LOCUS_14930 1449062 1449949 gene locus_tag LOCUS_14940 1449062 1449949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 1451098 1450229 gene locus_tag LOCUS_14950 1451098 1450229 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964728.1 protein_id gnl|my_center|LOCUS_14950 1451557 1451144 gene locus_tag LOCUS_14960 1451557 1451144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 1451799 1451554 gene locus_tag LOCUS_14970 1451799 1451554 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423177.1 protein_id gnl|my_center|LOCUS_14970 1451997 1452410 gene locus_tag LOCUS_14980 1451997 1452410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 1452681 1453022 gene locus_tag LOCUS_14990 1452681 1453022 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422696.1 protein_id gnl|my_center|LOCUS_14990 1453092 1453895 gene locus_tag LOCUS_15000 1453092 1453895 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965542.1 protein_id gnl|my_center|LOCUS_15000 1453892 1455703 gene locus_tag LOCUS_15010 gene recQ 1453892 1455703 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965975.1 protein_id gnl|my_center|LOCUS_15010 1456161 1455733 gene locus_tag LOCUS_15020 1456161 1455733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 1456611 1456171 gene locus_tag LOCUS_15030 1456611 1456171 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002266702.1 protein_id gnl|my_center|LOCUS_15030 1457523 1456621 gene locus_tag LOCUS_15040 1457523 1456621 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812722.1 protein_id gnl|my_center|LOCUS_15040 1458445 1457510 gene locus_tag LOCUS_15050 1458445 1457510 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812720.1 protein_id gnl|my_center|LOCUS_15050 1459362 1458598 gene locus_tag LOCUS_15060 gene glvR 1459362 1458598 CDS product MurR/RpiR family transcriptional regulator GlvR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233607.1 protein_id gnl|my_center|LOCUS_15060 1459857 1459450 gene locus_tag LOCUS_15070 1459857 1459450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 1461264 1460074 gene locus_tag LOCUS_15080 1461264 1460074 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860746.1 protein_id gnl|my_center|LOCUS_15080 1461545 1461342 gene locus_tag LOCUS_15090 1461545 1461342 CDS product excisionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004613735.1 protein_id gnl|my_center|LOCUS_15090 1462093 1461860 gene locus_tag LOCUS_15100 1462093 1461860 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860747.1 protein_id gnl|my_center|LOCUS_15100 1462518 1462078 gene locus_tag LOCUS_15110 1462518 1462078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 1463428 1462793 gene locus_tag LOCUS_15120 1463428 1462793 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000353149.1 protein_id gnl|my_center|LOCUS_15120 1464887 1463442 gene locus_tag LOCUS_15130 1464887 1463442 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369224.1 protein_id gnl|my_center|LOCUS_15130 1466114 1464891 gene locus_tag LOCUS_15140 1466114 1464891 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990145.1 protein_id gnl|my_center|LOCUS_15140 1466620 1466126 gene locus_tag LOCUS_15150 1466620 1466126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 1466783 1467469 gene locus_tag LOCUS_15160 1466783 1467469 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582912.1 protein_id gnl|my_center|LOCUS_15160 1467463 1468755 gene locus_tag LOCUS_15170 1467463 1468755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 1469025 1468885 gene locus_tag LOCUS_15180 1469025 1468885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15180 1469766 1469071 gene locus_tag LOCUS_15190 1469766 1469071 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861910.1 protein_id gnl|my_center|LOCUS_15190 1470727 1469816 gene locus_tag LOCUS_15200 1470727 1469816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 1471386 1471108 gene locus_tag LOCUS_15210 1471386 1471108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 1472705 1471968 gene locus_tag LOCUS_15220 gene erm(B) 1472705 1471968 CDS product 23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038792.1 protein_id gnl|my_center|LOCUS_15220 1473093 1473650 gene locus_tag LOCUS_15230 1473093 1473650 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861911.1 protein_id gnl|my_center|LOCUS_15230 1474599 1473697 gene locus_tag LOCUS_15240 1474599 1473697 CDS product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860758.1 protein_id gnl|my_center|LOCUS_15240 1475624 1474617 gene locus_tag LOCUS_15250 1475624 1474617 CDS product bifunctional lysozyme/C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860759.1 protein_id gnl|my_center|LOCUS_15250 1477810 1475621 gene locus_tag LOCUS_15260 1477810 1475621 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860760.1 protein_id gnl|my_center|LOCUS_15260 1480260 1477810 gene locus_tag LOCUS_15270 1480260 1477810 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861947.1 protein_id gnl|my_center|LOCUS_15270 1480636 1480238 gene locus_tag LOCUS_15280 1480636 1480238 CDS product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004843362.1 protein_id gnl|my_center|LOCUS_15280 1481248 1480745 gene locus_tag LOCUS_15290 1481248 1480745 CDS product antirestriction protein ArdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861949.1 protein_id gnl|my_center|LOCUS_15290 1481769 1481266 gene locus_tag LOCUS_15300 1481769 1481266 CDS product antirestriction protein ArdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861950.1 protein_id gnl|my_center|LOCUS_15300 1481984 1481688 gene locus_tag LOCUS_15310 1481984 1481688 CDS product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860764.1 protein_id gnl|my_center|LOCUS_15310 1482699 1482073 gene locus_tag LOCUS_15320 1482699 1482073 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287965.1 protein_id gnl|my_center|LOCUS_15320 1482991 1482770 gene locus_tag LOCUS_15330 1482991 1482770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317729.1 protein_id gnl|my_center|LOCUS_15330 1483126 1482992 gene locus_tag LOCUS_15340 1483126 1482992 CDS product DUF3789 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860765.1 protein_id gnl|my_center|LOCUS_15340 1484335 1483139 gene locus_tag LOCUS_15350 gene mobT 1484335 1483139 CDS product MobT family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861953.1 protein_id gnl|my_center|LOCUS_15350 1484976 1484485 gene locus_tag LOCUS_15360 1484976 1484485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 1486360 1484969 gene locus_tag LOCUS_15370 1486360 1484969 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860768.1 protein_id gnl|my_center|LOCUS_15370 1486937 1486452 gene locus_tag LOCUS_15380 1486937 1486452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 1487407 1487024 gene locus_tag LOCUS_15390 1487407 1487024 CDS product YdcP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861955.1 protein_id gnl|my_center|LOCUS_15390 1487749 1487423 gene locus_tag LOCUS_15400 1487749 1487423 CDS product YdcP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861956.1 protein_id gnl|my_center|LOCUS_15400 1491028 1487984 gene locus_tag LOCUS_15410 1491028 1487984 CDS product SrtB-anchored collagen-binding adhesin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417594.1 protein_id gnl|my_center|LOCUS_15410 1492673 1491330 gene locus_tag LOCUS_15420 1492673 1491330 CDS product 6-phospho-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963854.1 protein_id gnl|my_center|LOCUS_15420 1494237 1492687 gene locus_tag LOCUS_15430 gene malP 1494237 1492687 CDS product PTS maltose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233606.1 protein_id gnl|my_center|LOCUS_15430 1494510 1495208 gene locus_tag LOCUS_15440 gene treR 1494510 1495208 CDS product trehalose operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405408.1 protein_id gnl|my_center|LOCUS_15440 1495211 1495543 gene locus_tag LOCUS_15450 1495211 1495543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 1495743 1497179 gene locus_tag LOCUS_15460 gene treP 1495743 1497179 CDS product PTS system trehalose-specific EIIBC component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986523.1 protein_id gnl|my_center|LOCUS_15460 1497166 1498791 gene locus_tag LOCUS_15470 1497166 1498791 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002329642.1 protein_id gnl|my_center|LOCUS_15470 1499180 1500262 gene locus_tag LOCUS_15480 1499180 1500262 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004329798.1 protein_id gnl|my_center|LOCUS_15480 1501222 1500569 gene locus_tag LOCUS_15490 1501222 1500569 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022619212.1 protein_id gnl|my_center|LOCUS_15490 1501329 1502000 gene locus_tag LOCUS_15500 1501329 1502000 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433947.1 protein_id gnl|my_center|LOCUS_15500 1502747 1502151 gene locus_tag LOCUS_15510 1502747 1502151 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964647.1 protein_id gnl|my_center|LOCUS_15510 1502996 1502751 gene locus_tag LOCUS_15520 1502996 1502751 CDS product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454698.1 protein_id gnl|my_center|LOCUS_15520 1503193 1503002 gene locus_tag LOCUS_15530 1503193 1503002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 1503976 1503485 gene locus_tag LOCUS_15540 1503976 1503485 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461280.1 protein_id gnl|my_center|LOCUS_15540 1504140 1504991 gene locus_tag LOCUS_15550 1504140 1504991 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965083.1 protein_id gnl|my_center|LOCUS_15550 1506291 1505131 gene locus_tag LOCUS_15560 1506291 1505131 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010680900.1 protein_id gnl|my_center|LOCUS_15560 1506675 1507169 gene locus_tag LOCUS_15570 1506675 1507169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 1507203 1508663 gene locus_tag LOCUS_15580 1507203 1508663 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965086.1 protein_id gnl|my_center|LOCUS_15580 1508663 1509454 gene locus_tag LOCUS_15590 gene nadE 1508663 1509454 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808614.1 protein_id gnl|my_center|LOCUS_15590 1510578 1509487 gene locus_tag LOCUS_15600 1510578 1509487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 1511108 1510653 gene locus_tag LOCUS_15610 1511108 1510653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 1511343 1511789 gene locus_tag LOCUS_15620 1511343 1511789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 1511802 1512467 gene locus_tag LOCUS_15630 1511802 1512467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 1512464 1513213 gene locus_tag LOCUS_15640 1512464 1513213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 1513979 1515211 gene locus_tag LOCUS_15650 gene purD 1513979 1515211 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101962.1 protein_id gnl|my_center|LOCUS_15650 1515224 1516894 gene locus_tag LOCUS_15660 1515224 1516894 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001985392.1 protein_id gnl|my_center|LOCUS_15660 1517099 1517908 gene locus_tag LOCUS_15670 1517099 1517908 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_15670 1518953 1517958 gene locus_tag LOCUS_15680 1518953 1517958 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933588.1 protein_id gnl|my_center|LOCUS_15680 1519339 1519569 gene locus_tag LOCUS_15690 1519339 1519569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 1519566 1520777 gene locus_tag LOCUS_15700 1519566 1520777 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187945.1 protein_id gnl|my_center|LOCUS_15700 1520882 1522105 gene locus_tag LOCUS_15710 1520882 1522105 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963780.1 protein_id gnl|my_center|LOCUS_15710 1522361 1522846 gene locus_tag LOCUS_15720 1522361 1522846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 1524097 1523222 gene locus_tag LOCUS_15730 1524097 1523222 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965767.1 protein_id gnl|my_center|LOCUS_15730 1524277 1526337 gene locus_tag LOCUS_15740 1524277 1526337 CDS product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986653.1 protein_id gnl|my_center|LOCUS_15740 1527160 1526396 gene locus_tag LOCUS_15750 1527160 1526396 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582797.1 protein_id gnl|my_center|LOCUS_15750 1527350 1528378 gene locus_tag LOCUS_15760 1527350 1528378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 1528391 1529218 gene locus_tag LOCUS_15770 gene rhaD 1528391 1529218 CDS product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179745.1 protein_id gnl|my_center|LOCUS_15770 1529452 1529934 gene locus_tag LOCUS_15780 1529452 1529934 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892531.1 protein_id gnl|my_center|LOCUS_15780 1529931 1530233 gene locus_tag LOCUS_15790 1529931 1530233 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861509.1 protein_id gnl|my_center|LOCUS_15790 1530281 1531696 gene locus_tag LOCUS_15800 1530281 1531696 CDS product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897455.1 protein_id gnl|my_center|LOCUS_15800 1531700 1532989 gene locus_tag LOCUS_15810 1531700 1532989 CDS product sn-glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082995.1 protein_id gnl|my_center|LOCUS_15810 1532996 1533694 gene locus_tag LOCUS_15820 gene araD 1532996 1533694 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005669745.1 protein_id gnl|my_center|LOCUS_15820 1533712 1534518 gene locus_tag LOCUS_15830 1533712 1534518 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627865.1 protein_id gnl|my_center|LOCUS_15830 1534540 1535976 gene locus_tag LOCUS_15840 1534540 1535976 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964632.1 protein_id gnl|my_center|LOCUS_15840 1535978 1537246 gene locus_tag LOCUS_15850 1535978 1537246 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964633.1 protein_id gnl|my_center|LOCUS_15850 1537249 1537602 gene locus_tag LOCUS_15860 1537249 1537602 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964634.1 protein_id gnl|my_center|LOCUS_15860 1537791 1538612 gene locus_tag LOCUS_15870 1537791 1538612 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430704.1 protein_id gnl|my_center|LOCUS_15870 1538605 1539528 gene locus_tag LOCUS_15880 1538605 1539528 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903779.1 protein_id gnl|my_center|LOCUS_15880 1540228 1539644 gene locus_tag LOCUS_15890 1540228 1539644 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203642.1 protein_id gnl|my_center|LOCUS_15890 1541139 1540312 gene locus_tag LOCUS_15900 1541139 1540312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 1541534 1541310 gene locus_tag LOCUS_15910 1541534 1541310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 1541982 1541515 gene locus_tag LOCUS_15920 1541982 1541515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 1543319 1541997 gene locus_tag LOCUS_15930 1543319 1541997 CDS product 6-phospho-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098287.1 protein_id gnl|my_center|LOCUS_15930 1544919 1543321 gene locus_tag LOCUS_15940 1544919 1543321 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986061.1 protein_id gnl|my_center|LOCUS_15940 1545867 1545037 gene locus_tag LOCUS_15950 1545867 1545037 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432034.1 protein_id gnl|my_center|LOCUS_15950 1547028 1546051 gene locus_tag LOCUS_15960 1547028 1546051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 1547273 1548610 gene locus_tag LOCUS_15970 1547273 1548610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 1548832 1549941 gene locus_tag LOCUS_15980 1548832 1549941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 1550382 1551224 gene locus_tag LOCUS_15990 1550382 1551224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056248.1 protein_id gnl|my_center|LOCUS_15990 1551358 1551810 gene locus_tag LOCUS_16000 1551358 1551810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 1553339 1551855 gene locus_tag LOCUS_16010 1553339 1551855 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015055963.1 protein_id gnl|my_center|LOCUS_16010 1554235 1555503 gene locus_tag LOCUS_16020 gene murA 1554235 1555503 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413260.1 protein_id gnl|my_center|LOCUS_16020 1555606 1556457 gene locus_tag LOCUS_16030 1555606 1556457 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948948.1 protein_id gnl|my_center|LOCUS_16030 1556636 1557529 gene locus_tag LOCUS_16040 gene murQ 1556636 1557529 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022359.1 protein_id gnl|my_center|LOCUS_16040 1557541 1559463 gene locus_tag LOCUS_16050 1557541 1559463 CDS product glucose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549932.1 protein_id gnl|my_center|LOCUS_16050 1559640 1559942 gene locus_tag LOCUS_16060 1559640 1559942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 1559939 1560265 gene locus_tag LOCUS_16070 1559939 1560265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16070 1560344 1560988 gene locus_tag LOCUS_16080 1560344 1560988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16080 1561809 1561015 gene locus_tag LOCUS_16090 1561809 1561015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 1561956 1563359 gene locus_tag LOCUS_16100 1561956 1563359 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989392.1 protein_id gnl|my_center|LOCUS_16100 1563361 1564635 gene locus_tag LOCUS_16110 gene celB 1563361 1564635 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009901597.1 protein_id gnl|my_center|LOCUS_16110 1564698 1565594 gene locus_tag LOCUS_16120 1564698 1565594 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721732.1 protein_id gnl|my_center|LOCUS_16120 1566006 1565632 gene locus_tag LOCUS_16130 1566006 1565632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 1567395 1566154 gene locus_tag LOCUS_16140 1567395 1566154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 1567501 1568388 gene locus_tag LOCUS_16150 1567501 1568388 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_16150 1569081 1568464 gene locus_tag LOCUS_16160 1569081 1568464 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966613.1 protein_id gnl|my_center|LOCUS_16160 1569187 1569531 gene locus_tag LOCUS_16170 1569187 1569531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 1569464 1570024 gene locus_tag LOCUS_16180 1569464 1570024 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279620.1 protein_id gnl|my_center|LOCUS_16180 1570156 1570887 gene locus_tag LOCUS_16190 1570156 1570887 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662263.1 protein_id gnl|my_center|LOCUS_16190 1572834 1571479 gene locus_tag LOCUS_16200 1572834 1571479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 1574297 1572843 gene locus_tag LOCUS_16210 1574297 1572843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 1575169 1574294 gene locus_tag LOCUS_16220 1575169 1574294 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861379.1 protein_id gnl|my_center|LOCUS_16220 1575866 1575144 gene locus_tag LOCUS_16230 1575866 1575144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 1576398 1575856 gene locus_tag LOCUS_16240 1576398 1575856 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810593.1 protein_id gnl|my_center|LOCUS_16240 1576693 1578462 gene locus_tag LOCUS_16250 1576693 1578462 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262036.1 protein_id gnl|my_center|LOCUS_16250 1578759 1579577 gene locus_tag LOCUS_16260 gene yidA 1578759 1579577 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172824472.1 protein_id gnl|my_center|LOCUS_16260 1579728 1580258 gene locus_tag LOCUS_16270 1579728 1580258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358943.1 protein_id gnl|my_center|LOCUS_16270 1580395 1581522 gene locus_tag LOCUS_16280 1580395 1581522 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082494.1 protein_id gnl|my_center|LOCUS_16280 1581617 1582597 gene locus_tag LOCUS_16290 1581617 1582597 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582922.1 protein_id gnl|my_center|LOCUS_16290 1582782 1584155 gene locus_tag LOCUS_16300 1582782 1584155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 1584168 1585595 gene locus_tag LOCUS_16310 1584168 1585595 CDS product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896953.1 protein_id gnl|my_center|LOCUS_16310 1585904 1586038 gene locus_tag LOCUS_16320 1585904 1586038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 1586611 1587444 gene locus_tag LOCUS_16330 1586611 1587444 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219862.1 protein_id gnl|my_center|LOCUS_16330 1587456 1589339 gene locus_tag LOCUS_16340 1587456 1589339 CDS product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990065.1 protein_id gnl|my_center|LOCUS_16340 1589351 1590067 gene locus_tag LOCUS_16350 1589351 1590067 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990049.1 protein_id gnl|my_center|LOCUS_16350 1592417 1591275 gene locus_tag LOCUS_16360 1592417 1591275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 1593821 1592433 gene locus_tag LOCUS_16370 1593821 1592433 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861592.1 protein_id gnl|my_center|LOCUS_16370 1594296 1593832 gene locus_tag LOCUS_16380 1594296 1593832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 1595056 1594298 gene locus_tag LOCUS_16390 1595056 1594298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 1595244 1596521 gene locus_tag LOCUS_16400 1595244 1596521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 1597072 1598169 gene locus_tag LOCUS_16410 gene metK 1597072 1598169 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942525.1 protein_id gnl|my_center|LOCUS_16410 1598340 1599074 gene locus_tag LOCUS_16420 1598340 1599074 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152423797.1 protein_id gnl|my_center|LOCUS_16420 1599274 1600005 gene locus_tag LOCUS_16430 1599274 1600005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 1600019 1600486 gene locus_tag LOCUS_16440 1600019 1600486 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426364.1 protein_id gnl|my_center|LOCUS_16440 1600509 1601264 gene locus_tag LOCUS_16450 1600509 1601264 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706182.1 protein_id gnl|my_center|LOCUS_16450 1601270 1602088 gene locus_tag LOCUS_16460 1601270 1602088 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723163.1 protein_id gnl|my_center|LOCUS_16460 1602107 1602826 gene locus_tag LOCUS_16470 1602107 1602826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 1602831 1603814 gene locus_tag LOCUS_16480 1602831 1603814 CDS product ribose 1,5-bisphosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146505.1 protein_id gnl|my_center|LOCUS_16480 1603807 1604601 gene locus_tag LOCUS_16490 1603807 1604601 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496728.1 protein_id gnl|my_center|LOCUS_16490 1604603 1604998 gene locus_tag LOCUS_16500 1604603 1604998 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027178.1 protein_id gnl|my_center|LOCUS_16500 1605183 1606493 gene locus_tag LOCUS_16510 1605183 1606493 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094729231.1 protein_id gnl|my_center|LOCUS_16510 1606509 1607465 gene locus_tag LOCUS_16520 1606509 1607465 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906252.1 protein_id gnl|my_center|LOCUS_16520 1607583 1608206 gene locus_tag LOCUS_16530 1607583 1608206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 1608286 1609080 gene locus_tag LOCUS_16540 1608286 1609080 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764352.1 protein_id gnl|my_center|LOCUS_16540 1609159 1609578 gene locus_tag LOCUS_16550 1609159 1609578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 1609596 1610498 gene locus_tag LOCUS_16560 1609596 1610498 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764881.1 protein_id gnl|my_center|LOCUS_16560 1611269 1610604 gene locus_tag LOCUS_16570 1611269 1610604 CDS product suppressor of fused domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263126.1 protein_id gnl|my_center|LOCUS_16570 1611480 1612352 gene locus_tag LOCUS_16580 1611480 1612352 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458873.1 protein_id gnl|my_center|LOCUS_16580 1612498 1612902 gene locus_tag LOCUS_16590 1612498 1612902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 1613116 1614435 gene locus_tag LOCUS_16600 1613116 1614435 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032280.1 protein_id gnl|my_center|LOCUS_16600 1614507 1615517 gene locus_tag LOCUS_16610 1614507 1615517 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080120.1 protein_id gnl|my_center|LOCUS_16610 1615533 1616993 gene locus_tag LOCUS_16620 1615533 1616993 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202887107.1 protein_id gnl|my_center|LOCUS_16620 1617216 1618598 gene locus_tag LOCUS_16630 1617216 1618598 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068695.1 protein_id gnl|my_center|LOCUS_16630 1618591 1619334 gene locus_tag LOCUS_16640 1618591 1619334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 1619453 1620061 gene locus_tag LOCUS_16650 1619453 1620061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 1620246 1621433 gene locus_tag LOCUS_16660 1620246 1621433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 1621516 1621956 gene locus_tag LOCUS_16670 gene rpiB 1621516 1621956 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161952859.1 protein_id gnl|my_center|LOCUS_16670 1621956 1622711 gene locus_tag LOCUS_16680 1621956 1622711 CDS product DUF5131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695943.1 protein_id gnl|my_center|LOCUS_16680 1622704 1623087 gene locus_tag LOCUS_16690 1622704 1623087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 1623084 1624313 gene locus_tag LOCUS_16700 gene glyA 1623084 1624313 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227669.1 protein_id gnl|my_center|LOCUS_16700 1624458 1625789 gene locus_tag LOCUS_16710 1624458 1625789 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_16710 1626331 1625843 gene locus_tag LOCUS_16720 1626331 1625843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 1627301 1627798 gene locus_tag LOCUS_16730 1627301 1627798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 1627801 1628625 gene locus_tag LOCUS_16740 1627801 1628625 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219862.1 protein_id gnl|my_center|LOCUS_16740 1628764 1630113 gene locus_tag LOCUS_16750 1628764 1630113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 1630125 1632035 gene locus_tag LOCUS_16760 1630125 1632035 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966678.1 protein_id gnl|my_center|LOCUS_16760 1632176 1633033 gene locus_tag LOCUS_16770 1632176 1633033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 1633953 1633135 gene locus_tag LOCUS_16780 1633953 1633135 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296740.1 protein_id gnl|my_center|LOCUS_16780 1634135 1635511 gene locus_tag LOCUS_16790 1634135 1635511 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868529.1 protein_id gnl|my_center|LOCUS_16790 1635934 1636503 gene locus_tag LOCUS_16800 gene thiW 1635934 1636503 CDS product energy coupling factor transporter S component ThiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047762.1 protein_id gnl|my_center|LOCUS_16800 1636448 1637266 gene locus_tag LOCUS_16810 gene thiM 1636448 1637266 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986722.1 protein_id gnl|my_center|LOCUS_16810 1637263 1637895 gene locus_tag LOCUS_16820 gene thiE 1637263 1637895 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078223.1 protein_id gnl|my_center|LOCUS_16820 1638040 1639257 gene locus_tag LOCUS_16830 1638040 1639257 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_16830 1640637 1639555 gene locus_tag LOCUS_16840 1640637 1639555 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966740.1 protein_id gnl|my_center|LOCUS_16840 1641074 1641469 gene locus_tag LOCUS_16850 1641074 1641469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 1641625 1643058 gene locus_tag LOCUS_16860 gene dbpA 1641625 1643058 CDS product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243023.1 protein_id gnl|my_center|LOCUS_16860 1643482 1644141 gene locus_tag LOCUS_16870 1643482 1644141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 1644150 1645124 gene locus_tag LOCUS_16880 1644150 1645124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 1645319 1645948 gene locus_tag LOCUS_16890 1645319 1645948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 1646213 1646004 gene locus_tag LOCUS_16900 1646213 1646004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 1647497 1646334 gene locus_tag LOCUS_16910 1647497 1646334 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808537.1 protein_id gnl|my_center|LOCUS_16910 1647985 1647497 gene locus_tag LOCUS_16920 1647985 1647497 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_16920 1648129 1648632 gene locus_tag LOCUS_16930 1648129 1648632 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816021.1 protein_id gnl|my_center|LOCUS_16930 1648619 1649746 gene locus_tag LOCUS_16940 1648619 1649746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 1649906 1651228 gene locus_tag LOCUS_16950 1649906 1651228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 1651421 1652257 gene locus_tag LOCUS_16960 1651421 1652257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 1653318 1652302 gene locus_tag LOCUS_16970 1653318 1652302 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564081.1 protein_id gnl|my_center|LOCUS_16970 1653459 1654013 gene locus_tag LOCUS_16980 1653459 1654013 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262000.1 protein_id gnl|my_center|LOCUS_16980 1654607 1654008 gene locus_tag LOCUS_16990 1654607 1654008 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303217.1 protein_id gnl|my_center|LOCUS_16990 1654877 1655329 gene locus_tag LOCUS_17000 1654877 1655329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 1657365 1655407 gene locus_tag LOCUS_17010 1657365 1655407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 1657544 1657392 gene locus_tag LOCUS_17020 1657544 1657392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 1657490 1658644 gene locus_tag LOCUS_17030 1657490 1658644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 1659394 1658678 gene locus_tag LOCUS_17040 gene dapB 1659394 1658678 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286877.1 protein_id gnl|my_center|LOCUS_17040 1660263 1659391 gene locus_tag LOCUS_17050 gene dapA 1660263 1659391 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438799.1 protein_id gnl|my_center|LOCUS_17050 1661533 1660334 gene locus_tag LOCUS_17060 1661533 1660334 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085971.1 protein_id gnl|my_center|LOCUS_17060 1662816 1661530 gene locus_tag LOCUS_17070 gene lysA 1662816 1661530 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286883.1 protein_id gnl|my_center|LOCUS_17070 1663431 1664117 gene locus_tag LOCUS_17080 1663431 1664117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 1664590 1665393 gene locus_tag LOCUS_17090 1664590 1665393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 1665493 1665612 gene locus_tag LOCUS_17100 1665493 1665612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 1665602 1666138 gene locus_tag LOCUS_17110 1665602 1666138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 1666269 1666472 gene locus_tag LOCUS_17120 1666269 1666472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 1666637 1666497 gene locus_tag LOCUS_17130 1666637 1666497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 1666958 1666821 gene locus_tag LOCUS_17140 1666958 1666821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 1667240 1668661 gene locus_tag LOCUS_17150 1667240 1668661 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546599.1 protein_id gnl|my_center|LOCUS_17150 1668760 1670079 gene locus_tag LOCUS_17160 1668760 1670079 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048276.1 protein_id gnl|my_center|LOCUS_17160 1670082 1670723 gene locus_tag LOCUS_17170 1670082 1670723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 1670972 1672036 gene locus_tag LOCUS_17180 1670972 1672036 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002932053.1 protein_id gnl|my_center|LOCUS_17180 1672169 1674115 gene locus_tag LOCUS_17190 1672169 1674115 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006774564.1 protein_id gnl|my_center|LOCUS_17190 1674640 1674191 gene locus_tag LOCUS_17200 1674640 1674191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 1675543 1674776 gene locus_tag LOCUS_17210 1675543 1674776 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922402.1 protein_id gnl|my_center|LOCUS_17210 1675987 1675559 gene locus_tag LOCUS_17220 1675987 1675559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 1676100 1676759 gene locus_tag LOCUS_17230 1676100 1676759 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723102.1 protein_id gnl|my_center|LOCUS_17230 1676756 1677991 gene locus_tag LOCUS_17240 gene folC 1676756 1677991 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582053.1 protein_id gnl|my_center|LOCUS_17240 1678010 1678900 gene locus_tag LOCUS_17250 1678010 1678900 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001520529.1 protein_id gnl|my_center|LOCUS_17250 1679058 1678906 gene locus_tag LOCUS_17260 1679058 1678906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 1679679 1679131 gene locus_tag LOCUS_17270 1679679 1679131 CDS product folate family ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385065.1 protein_id gnl|my_center|LOCUS_17270 1680268 1679906 gene locus_tag LOCUS_17280 1680268 1679906 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357112.1 protein_id gnl|my_center|LOCUS_17280 1681202 1680315 gene locus_tag LOCUS_17290 1681202 1680315 CDS product fructose bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890749.1 protein_id gnl|my_center|LOCUS_17290 1681618 1681292 gene locus_tag LOCUS_17300 1681618 1681292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 1681893 1684517 gene locus_tag LOCUS_17310 1681893 1684517 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377094.1 protein_id gnl|my_center|LOCUS_17310 1684690 1685694 gene locus_tag LOCUS_17320 gene galE 1684690 1685694 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_17320 1685818 1686525 gene locus_tag LOCUS_17330 1685818 1686525 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693563.1 protein_id gnl|my_center|LOCUS_17330 1686791 1686522 gene locus_tag LOCUS_17340 1686791 1686522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 1687050 1687469 gene locus_tag LOCUS_17350 gene rplK 1687050 1687469 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183506.1 protein_id gnl|my_center|LOCUS_17350 1687494 1688183 gene locus_tag LOCUS_17360 gene rplA 1687494 1688183 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235040.1 protein_id gnl|my_center|LOCUS_17360 1688386 1688928 gene locus_tag LOCUS_17370 gene rplJ 1688386 1688928 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048716.1 protein_id gnl|my_center|LOCUS_17370 1688970 1689341 gene locus_tag LOCUS_17380 gene rplL 1688970 1689341 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262825.1 protein_id gnl|my_center|LOCUS_17380 1689412 1690011 gene locus_tag LOCUS_17390 1689412 1690011 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930903.1 protein_id gnl|my_center|LOCUS_17390 1690120 1694325 gene locus_tag LOCUS_17400 1690120 1694325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 1694330 1698205 gene locus_tag LOCUS_17410 gene rpoC 1694330 1698205 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567936.1 protein_id gnl|my_center|LOCUS_17410 1699105 1698413 gene locus_tag LOCUS_17420 1699105 1698413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 1699350 1699105 gene locus_tag LOCUS_17430 1699350 1699105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 1700098 1701634 gene locus_tag LOCUS_r00040 1700098 1701634 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1701865 1704763 gene locus_tag LOCUS_r00050 1701865 1704763 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1704815 1704922 gene locus_tag LOCUS_r00060 1704815 1704922 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1704978 1706327 gene locus_tag LOCUS_17440 gene brnQ 1704978 1706327 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260900.1 protein_id gnl|my_center|LOCUS_17440 1706570 1706995 gene locus_tag LOCUS_17450 gene rpsL 1706570 1706995 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225781.1 protein_id gnl|my_center|LOCUS_17450 1707021 1707491 gene locus_tag LOCUS_17460 gene rpsG 1707021 1707491 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137491.1 protein_id gnl|my_center|LOCUS_17460 1707507 1709585 gene locus_tag LOCUS_17470 gene fusA 1707507 1709585 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090370.1 protein_id gnl|my_center|LOCUS_17470 1709653 1710837 gene locus_tag LOCUS_17480 gene tuf 1709653 1710837 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040568.1 protein_id gnl|my_center|LOCUS_17480 1711053 1711568 gene locus_tag LOCUS_17490 1711053 1711568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 1711708 1712883 gene locus_tag LOCUS_17500 gene metK 1711708 1712883 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947992.1 protein_id gnl|my_center|LOCUS_17500 1712926 1713711 gene locus_tag LOCUS_17510 1712926 1713711 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896027.1 protein_id gnl|my_center|LOCUS_17510 1714032 1714346 gene locus_tag LOCUS_17520 gene rpsJ 1714032 1714346 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720954.1 protein_id gnl|my_center|LOCUS_17520 1714360 1715046 gene locus_tag LOCUS_17530 gene rplC 1714360 1715046 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399671.1 protein_id gnl|my_center|LOCUS_17530 1715050 1715679 gene locus_tag LOCUS_17540 gene rplD 1715050 1715679 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774252.1 protein_id gnl|my_center|LOCUS_17540 1715679 1715981 gene locus_tag LOCUS_17550 1715679 1715981 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356203.1 protein_id gnl|my_center|LOCUS_17550 1716040 1716873 gene locus_tag LOCUS_17560 gene rplB 1716040 1716873 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225795.1 protein_id gnl|my_center|LOCUS_17560 1716893 1717171 gene locus_tag LOCUS_17570 gene rpsS 1716893 1717171 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829710.1 protein_id gnl|my_center|LOCUS_17570 1717187 1717522 gene locus_tag LOCUS_17580 gene rplV 1717187 1717522 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701308.1 protein_id gnl|my_center|LOCUS_17580 1717534 1718322 gene locus_tag LOCUS_17590 gene rpsC 1717534 1718322 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356207.1 protein_id gnl|my_center|LOCUS_17590 1718326 1718742 gene locus_tag LOCUS_17600 gene rplP 1718326 1718742 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926310.1 protein_id gnl|my_center|LOCUS_17600 1718745 1718945 gene locus_tag LOCUS_17610 gene rpmC 1718745 1718945 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638068.1 protein_id gnl|my_center|LOCUS_17610 1718962 1719222 gene locus_tag LOCUS_17620 gene rpsQ 1718962 1719222 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359348.1 protein_id gnl|my_center|LOCUS_17620 1719243 1719611 gene locus_tag LOCUS_17630 gene rplN 1719243 1719611 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549034.1 protein_id gnl|my_center|LOCUS_17630 1719624 1719947 gene locus_tag LOCUS_17640 gene rplX 1719624 1719947 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558200.1 protein_id gnl|my_center|LOCUS_17640 1719961 1720500 gene locus_tag LOCUS_17650 gene rplE 1719961 1720500 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080831.1 protein_id gnl|my_center|LOCUS_17650 1720515 1720700 gene locus_tag LOCUS_17660 gene rpsN 1720515 1720700 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085700.1 protein_id gnl|my_center|LOCUS_17660 1720722 1721120 gene locus_tag LOCUS_17670 gene rpsH 1720722 1721120 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567538.1 protein_id gnl|my_center|LOCUS_17670 1721147 1721692 gene locus_tag LOCUS_17680 gene rplF 1721147 1721692 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086558.1 protein_id gnl|my_center|LOCUS_17680 1721714 1722070 gene locus_tag LOCUS_17690 gene rplR 1721714 1722070 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225816.1 protein_id gnl|my_center|LOCUS_17690 1722083 1722595 gene locus_tag LOCUS_17700 gene rpsE 1722083 1722595 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000554646.1 protein_id gnl|my_center|LOCUS_17700 1722611 1723051 gene locus_tag LOCUS_17710 gene rplO 1722611 1723051 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766080.1 protein_id gnl|my_center|LOCUS_17710 1723053 1724354 gene locus_tag LOCUS_17720 gene secY 1723053 1724354 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359350.1 protein_id gnl|my_center|LOCUS_17720 1724368 1725015 gene locus_tag LOCUS_17730 1724368 1725015 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860634.1 protein_id gnl|my_center|LOCUS_17730 1725016 1725789 gene locus_tag LOCUS_17740 gene map 1725016 1725789 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582539.1 protein_id gnl|my_center|LOCUS_17740 1725782 1726000 gene locus_tag LOCUS_17750 gene infA 1725782 1726000 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118443.1 protein_id gnl|my_center|LOCUS_17750 1726159 1726524 gene locus_tag LOCUS_17760 gene rpsM 1726159 1726524 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356225.1 protein_id gnl|my_center|LOCUS_17760 1726546 1726941 gene locus_tag LOCUS_17770 gene rpsK 1726546 1726941 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101625.1 protein_id gnl|my_center|LOCUS_17770 1726974 1727933 gene locus_tag LOCUS_17780 1726974 1727933 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427733.1 protein_id gnl|my_center|LOCUS_17780 1727959 1728324 gene locus_tag LOCUS_17790 gene rplQ 1727959 1728324 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331490.1 protein_id gnl|my_center|LOCUS_17790 1728419 1728679 gene locus_tag LOCUS_17800 1728419 1728679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 1728815 1729576 gene locus_tag LOCUS_17810 1728815 1729576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 1729644 1730621 gene locus_tag LOCUS_17820 1729644 1730621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 1730623 1731783 gene locus_tag LOCUS_17830 1730623 1731783 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831857.1 protein_id gnl|my_center|LOCUS_17830 1731793 1732371 gene locus_tag LOCUS_17840 1731793 1732371 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389102.1 protein_id gnl|my_center|LOCUS_17840 1732451 1733206 gene locus_tag LOCUS_17850 1732451 1733206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 1733427 1734749 gene locus_tag LOCUS_17860 1733427 1734749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 1734829 1735548 gene locus_tag LOCUS_17870 1734829 1735548 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948430.1 protein_id gnl|my_center|LOCUS_17870 1735545 1736285 gene locus_tag LOCUS_17880 1735545 1736285 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061295975.1 protein_id gnl|my_center|LOCUS_17880 1736296 1737138 gene locus_tag LOCUS_17890 1736296 1737138 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435784.1 protein_id gnl|my_center|LOCUS_17890 1737316 1738143 gene locus_tag LOCUS_17900 1737316 1738143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 1738119 1738979 gene locus_tag LOCUS_17910 1738119 1738979 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381364.1 protein_id gnl|my_center|LOCUS_17910 1738972 1739772 gene locus_tag LOCUS_17920 1738972 1739772 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399656.1 protein_id gnl|my_center|LOCUS_17920 1739718 1740524 gene locus_tag LOCUS_17930 gene truA 1739718 1740524 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733032.1 protein_id gnl|my_center|LOCUS_17930 1740592 1741380 gene locus_tag LOCUS_17940 1740592 1741380 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764454.1 protein_id gnl|my_center|LOCUS_17940 1742196 1742633 gene locus_tag LOCUS_17950 gene rplM 1742196 1742633 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260793.1 protein_id gnl|my_center|LOCUS_17950 1742646 1743050 gene locus_tag LOCUS_17960 gene rpsI 1742646 1743050 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079986.1 protein_id gnl|my_center|LOCUS_17960 1743519 1743722 gene locus_tag LOCUS_17970 1743519 1743722 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009905249.1 protein_id gnl|my_center|LOCUS_17970 1743712 1744416 gene locus_tag LOCUS_17980 1743712 1744416 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261248.1 protein_id gnl|my_center|LOCUS_17980 1744400 1745980 gene locus_tag LOCUS_17990 1744400 1745980 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719242.1 protein_id gnl|my_center|LOCUS_17990 1746104 1747429 gene locus_tag LOCUS_18000 1746104 1747429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 1747936 1747622 gene locus_tag LOCUS_18010 1747936 1747622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 1748683 1748345 gene locus_tag LOCUS_18020 1748683 1748345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001999997.1 protein_id gnl|my_center|LOCUS_18020 1749405 1749800 gene locus_tag LOCUS_18030 1749405 1749800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893285.1 protein_id gnl|my_center|LOCUS_18030 1749878 1750312 gene locus_tag LOCUS_18040 1749878 1750312 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964324.1 protein_id gnl|my_center|LOCUS_18040 1750418 1751311 gene locus_tag LOCUS_18050 1750418 1751311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 1751584 1752000 gene locus_tag LOCUS_18060 1751584 1752000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 1752133 1752675 gene locus_tag LOCUS_18070 1752133 1752675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 1752778 1753137 gene locus_tag LOCUS_18080 1752778 1753137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 1753281 1753847 gene locus_tag LOCUS_18090 gene yqcF 1753281 1753847 CDS product type VII secretion system immunity protein YqcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967790.1 protein_id gnl|my_center|LOCUS_18090 1753930 1755285 gene locus_tag LOCUS_18100 1753930 1755285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 1755540 1755680 gene locus_tag LOCUS_18110 1755540 1755680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 1756908 1755694 gene locus_tag LOCUS_18120 1756908 1755694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 1758241 1757021 gene locus_tag LOCUS_18130 gene tgt 1758241 1757021 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020309519.1 protein_id gnl|my_center|LOCUS_18130 1758857 1758228 gene locus_tag LOCUS_18140 1758857 1758228 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174123.1 protein_id gnl|my_center|LOCUS_18140 1761057 1759015 gene locus_tag LOCUS_18150 1761057 1759015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 1761346 1763604 gene locus_tag LOCUS_18160 1761346 1763604 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898049.1 protein_id gnl|my_center|LOCUS_18160 1763775 1764635 gene locus_tag LOCUS_18170 1763775 1764635 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048169.1 protein_id gnl|my_center|LOCUS_18170 1765437 1764718 gene locus_tag LOCUS_18180 1765437 1764718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 1765570 1766403 gene locus_tag LOCUS_18190 1765570 1766403 CDS product DUF3100 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016874.1 protein_id gnl|my_center|LOCUS_18190 1766407 1766853 gene locus_tag LOCUS_18200 1766407 1766853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029492212.1 protein_id gnl|my_center|LOCUS_18200 1766855 1768153 gene locus_tag LOCUS_18210 1766855 1768153 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004455014.1 protein_id gnl|my_center|LOCUS_18210 1768246 1769085 gene locus_tag LOCUS_18220 1768246 1769085 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294342.1 protein_id gnl|my_center|LOCUS_18220 1769664 1769113 gene locus_tag LOCUS_18230 1769664 1769113 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860666.1 protein_id gnl|my_center|LOCUS_18230 1770224 1769661 gene locus_tag LOCUS_18240 1770224 1769661 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948278.1 protein_id gnl|my_center|LOCUS_18240 1770324 1771196 gene locus_tag LOCUS_18250 1770324 1771196 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545844.1 protein_id gnl|my_center|LOCUS_18250 1771286 1772239 gene locus_tag LOCUS_18260 1771286 1772239 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028380.1 protein_id gnl|my_center|LOCUS_18260 1772236 1773645 gene locus_tag LOCUS_18270 gene gndA 1772236 1773645 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700011.1 protein_id gnl|my_center|LOCUS_18270 1773638 1775035 gene locus_tag LOCUS_18280 gene zwf 1773638 1775035 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393785.1 protein_id gnl|my_center|LOCUS_18280 1775045 1775374 gene locus_tag LOCUS_18290 1775045 1775374 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016138.1 protein_id gnl|my_center|LOCUS_18290 1776678 1775473 gene locus_tag LOCUS_18300 1776678 1775473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 1777665 1776757 gene locus_tag LOCUS_18310 1777665 1776757 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723973.1 protein_id gnl|my_center|LOCUS_18310 1777876 1777667 gene locus_tag LOCUS_18320 1777876 1777667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 1778368 1778000 gene locus_tag LOCUS_18330 1778368 1778000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18330 1778462 1779037 gene locus_tag LOCUS_18340 1778462 1779037 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550097.1 protein_id gnl|my_center|LOCUS_18340 1779021 1780094 gene locus_tag LOCUS_18350 1779021 1780094 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387189.1 protein_id gnl|my_center|LOCUS_18350 1780177 1780863 gene locus_tag LOCUS_18360 gene cwlD 1780177 1780863 CDS product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399672.1 protein_id gnl|my_center|LOCUS_18360 1781106 1782584 gene locus_tag LOCUS_18370 1781106 1782584 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002995654.1 protein_id gnl|my_center|LOCUS_18370 1782568 1783443 gene locus_tag LOCUS_18380 1782568 1783443 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861296.1 protein_id gnl|my_center|LOCUS_18380 1783430 1785634 gene locus_tag LOCUS_18390 1783430 1785634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 1785627 1786655 gene locus_tag LOCUS_18400 1785627 1786655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 1786750 1786826 gene locus_tag LOCUS_t00010 1786750 1786826 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 1786845 1786920 gene locus_tag LOCUS_t00020 1786845 1786920 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1787111 1787187 gene locus_tag LOCUS_t00030 1787111 1787187 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 1787206 1787281 gene locus_tag LOCUS_t00040 1787206 1787281 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1787423 1787794 gene locus_tag LOCUS_18410 1787423 1787794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 1787902 1789227 gene locus_tag LOCUS_18420 1787902 1789227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 1789239 1789979 gene locus_tag LOCUS_18430 1789239 1789979 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721674.1 protein_id gnl|my_center|LOCUS_18430 1790083 1791063 gene locus_tag LOCUS_18440 1790083 1791063 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101360.1 protein_id gnl|my_center|LOCUS_18440 1791042 1791827 gene locus_tag LOCUS_18450 1791042 1791827 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101359.1 protein_id gnl|my_center|LOCUS_18450 1791959 1792435 gene locus_tag LOCUS_18460 1791959 1792435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814545.1 protein_id gnl|my_center|LOCUS_18460 1792586 1793308 gene locus_tag LOCUS_18470 1792586 1793308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 1793323 1794147 gene locus_tag LOCUS_18480 1793323 1794147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072143.1 protein_id gnl|my_center|LOCUS_18480 1794144 1794392 gene locus_tag LOCUS_18490 1794144 1794392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 1794347 1794844 gene locus_tag LOCUS_18500 1794347 1794844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 1794860 1795711 gene locus_tag LOCUS_18510 1794860 1795711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 1795681 1796346 gene locus_tag LOCUS_18520 1795681 1796346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 1796384 1796953 gene locus_tag LOCUS_18530 1796384 1796953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 1798277 1797420 gene locus_tag LOCUS_18540 1798277 1797420 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723662.1 protein_id gnl|my_center|LOCUS_18540 1798458 1800368 gene locus_tag LOCUS_18550 gene licR 1798458 1800368 CDS product transcriptional regulator LicR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243034.1 protein_id gnl|my_center|LOCUS_18550 1800381 1801088 gene locus_tag LOCUS_18560 1800381 1801088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 1801336 1802700 gene locus_tag LOCUS_18570 gene celB 1801336 1802700 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009901597.1 protein_id gnl|my_center|LOCUS_18570 1802973 1803311 gene locus_tag LOCUS_18580 1802973 1803311 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425440.1 protein_id gnl|my_center|LOCUS_18580 1803308 1803832 gene locus_tag LOCUS_18590 1803308 1803832 CDS product GrdB-related putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860643.1 protein_id gnl|my_center|LOCUS_18590 1803980 1805044 gene locus_tag LOCUS_18600 1803980 1805044 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031514.1 protein_id gnl|my_center|LOCUS_18600 1805057 1806148 gene locus_tag LOCUS_18610 1805057 1806148 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163555.1 protein_id gnl|my_center|LOCUS_18610 1806325 1806206 gene locus_tag LOCUS_18620 1806325 1806206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 1806547 1807818 gene locus_tag LOCUS_18630 1806547 1807818 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013611293.1 protein_id gnl|my_center|LOCUS_18630 1807938 1808594 gene locus_tag LOCUS_18640 1807938 1808594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 1808591 1809181 gene locus_tag LOCUS_18650 1808591 1809181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 1809178 1809747 gene locus_tag LOCUS_18660 1809178 1809747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 1811031 1809781 gene locus_tag LOCUS_18670 1811031 1809781 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964890.1 protein_id gnl|my_center|LOCUS_18670 1811735 1811034 gene locus_tag LOCUS_18680 gene rgbR 1811735 1811034 CDS product two-component system response regulator RgbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438019.1 protein_id gnl|my_center|LOCUS_18680 1812178 1811756 gene locus_tag LOCUS_18690 1812178 1811756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 1812428 1813081 gene locus_tag LOCUS_18700 1812428 1813081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 1813078 1813653 gene locus_tag LOCUS_18710 1813078 1813653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 1813656 1814204 gene locus_tag LOCUS_18720 1813656 1814204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 1815575 1814661 gene locus_tag LOCUS_18730 1815575 1814661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 1817342 1815576 gene locus_tag LOCUS_18740 1817342 1815576 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679753.1 protein_id gnl|my_center|LOCUS_18740 1817558 1817887 gene locus_tag LOCUS_18750 1817558 1817887 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722125.1 protein_id gnl|my_center|LOCUS_18750 1817917 1818237 gene locus_tag LOCUS_18760 1817917 1818237 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425440.1 protein_id gnl|my_center|LOCUS_18760 1818418 1819983 gene locus_tag LOCUS_18770 1818418 1819983 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_18770 1820131 1821801 gene locus_tag LOCUS_18780 1820131 1821801 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948373.1 protein_id gnl|my_center|LOCUS_18780 1822047 1827020 gene locus_tag LOCUS_18790 1822047 1827020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 1827025 1828224 gene locus_tag LOCUS_18800 1827025 1828224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 1828455 1830374 gene locus_tag LOCUS_18810 1828455 1830374 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861809.1 protein_id gnl|my_center|LOCUS_18810 1830385 1831008 gene locus_tag LOCUS_18820 1830385 1831008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 1831093 1831422 gene locus_tag LOCUS_18830 1831093 1831422 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722125.1 protein_id gnl|my_center|LOCUS_18830 1831504 1831842 gene locus_tag LOCUS_18840 1831504 1831842 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425440.1 protein_id gnl|my_center|LOCUS_18840 1831881 1833293 gene locus_tag LOCUS_18850 gene celB 1831881 1833293 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009901597.1 protein_id gnl|my_center|LOCUS_18850 1833338 1833859 gene locus_tag LOCUS_18860 1833338 1833859 CDS product GrdB-related putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860643.1 protein_id gnl|my_center|LOCUS_18860 1833989 1835287 gene locus_tag LOCUS_18870 1833989 1835287 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015782.1 protein_id gnl|my_center|LOCUS_18870 1835371 1836108 gene locus_tag LOCUS_18880 1835371 1836108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 1836222 1837316 gene locus_tag LOCUS_18890 1836222 1837316 CDS product DUF871 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253349.1 protein_id gnl|my_center|LOCUS_18890 1837692 1838639 gene locus_tag LOCUS_18900 1837692 1838639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 1838681 1839646 gene locus_tag LOCUS_18910 1838681 1839646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 1839674 1840543 gene locus_tag LOCUS_18920 1839674 1840543 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861379.1 protein_id gnl|my_center|LOCUS_18920 1840540 1841652 gene locus_tag LOCUS_18930 1840540 1841652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 1841649 1843778 gene locus_tag LOCUS_18940 1841649 1843778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 1844160 1843792 gene locus_tag LOCUS_18950 1844160 1843792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 1845024 1844218 gene locus_tag LOCUS_18960 1845024 1844218 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895974.1 protein_id gnl|my_center|LOCUS_18960 1845109 1845741 gene locus_tag LOCUS_18970 1845109 1845741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 1845747 1846997 gene locus_tag LOCUS_18980 1845747 1846997 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389377.1 protein_id gnl|my_center|LOCUS_18980 1847088 1847927 gene locus_tag LOCUS_18990 1847088 1847927 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861906.1 protein_id gnl|my_center|LOCUS_18990 1847911 1848246 gene locus_tag LOCUS_19000 1847911 1848246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 1848249 1848497 gene locus_tag LOCUS_19010 1848249 1848497 CDS product DUF3781 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438776.1 protein_id gnl|my_center|LOCUS_19010 1848831 1850180 gene locus_tag LOCUS_19020 1848831 1850180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 1851317 1850364 gene locus_tag LOCUS_19030 1851317 1850364 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715339.1 protein_id gnl|my_center|LOCUS_19030 1851498 1853381 gene locus_tag LOCUS_19040 1851498 1853381 CDS product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861973.1 protein_id gnl|my_center|LOCUS_19040 1853381 1854433 gene locus_tag LOCUS_19050 gene ypdE 1853381 1854433 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891992.1 protein_id gnl|my_center|LOCUS_19050 1854435 1854758 gene locus_tag LOCUS_19060 1854435 1854758 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421329.1 protein_id gnl|my_center|LOCUS_19060 1854760 1855101 gene locus_tag LOCUS_19070 1854760 1855101 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421322.1 protein_id gnl|my_center|LOCUS_19070 1855131 1855562 gene locus_tag LOCUS_19080 1855131 1855562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19080 1855572 1856492 gene locus_tag LOCUS_19090 1855572 1856492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19090 1856549 1857619 gene locus_tag LOCUS_19100 1856549 1857619 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861971.1 protein_id gnl|my_center|LOCUS_19100 1857621 1858802 gene locus_tag LOCUS_19110 1857621 1858802 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437779.1 protein_id gnl|my_center|LOCUS_19110 1859128 1858916 gene locus_tag LOCUS_19120 1859128 1858916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 1859939 1859190 gene locus_tag LOCUS_19130 1859939 1859190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 1860112 1861071 gene locus_tag LOCUS_19140 1860112 1861071 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895213.1 protein_id gnl|my_center|LOCUS_19140 1861071 1862177 gene locus_tag LOCUS_19150 1861071 1862177 CDS product Sapep family Mn(2+)-dependent dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860644.1 protein_id gnl|my_center|LOCUS_19150 1862189 1862929 gene locus_tag LOCUS_19160 1862189 1862929 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674428.1 protein_id gnl|my_center|LOCUS_19160 1863127 1863288 gene locus_tag LOCUS_19170 1863127 1863288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 1863306 1863470 gene locus_tag LOCUS_19180 1863306 1863470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 1863442 1864509 gene locus_tag LOCUS_19190 1863442 1864509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 1864657 1864890 gene locus_tag LOCUS_19200 1864657 1864890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 1865186 1871827 gene locus_tag LOCUS_19210 1865186 1871827 CDS product endo-alpha-N-acetylgalactosaminidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207553109.1 protein_id gnl|my_center|LOCUS_19210 1871911 1872573 gene locus_tag LOCUS_19220 1871911 1872573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 1872714 1873817 gene locus_tag LOCUS_19230 1872714 1873817 CDS product DUF871 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295800.1 protein_id gnl|my_center|LOCUS_19230 1873814 1874716 gene locus_tag LOCUS_19240 1873814 1874716 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101006.1 protein_id gnl|my_center|LOCUS_19240 1874835 1875128 gene locus_tag LOCUS_19250 1874835 1875128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 1876156 1875161 gene locus_tag LOCUS_19260 1876156 1875161 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296415.1 protein_id gnl|my_center|LOCUS_19260 1877389 1876235 gene locus_tag LOCUS_19270 1877389 1876235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 1877538 1878854 gene locus_tag LOCUS_19280 gene celB 1877538 1878854 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009901597.1 protein_id gnl|my_center|LOCUS_19280 1878844 1879989 gene locus_tag LOCUS_19290 1878844 1879989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 1879986 1880954 gene locus_tag LOCUS_19300 1879986 1880954 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296415.1 protein_id gnl|my_center|LOCUS_19300 1880957 1882354 gene locus_tag LOCUS_19310 gene bglH 1880957 1882354 CDS product aryl-phospho-beta-d-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243232.1 protein_id gnl|my_center|LOCUS_19310 1882384 1883895 gene locus_tag LOCUS_19320 1882384 1883895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 1883914 1884795 gene locus_tag LOCUS_19330 1883914 1884795 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721732.1 protein_id gnl|my_center|LOCUS_19330 1884887 1885519 gene locus_tag LOCUS_19340 1884887 1885519 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129648.1 protein_id gnl|my_center|LOCUS_19340 1885641 1887305 gene locus_tag LOCUS_19350 1885641 1887305 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860825.1 protein_id gnl|my_center|LOCUS_19350 1887324 1888241 gene locus_tag LOCUS_19360 1887324 1888241 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868400.1 protein_id gnl|my_center|LOCUS_19360 1888213 1889241 gene locus_tag LOCUS_19370 1888213 1889241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 1889234 1891339 gene locus_tag LOCUS_19380 1889234 1891339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 1891663 1891379 gene locus_tag LOCUS_19390 1891663 1891379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 1891905 1892156 gene locus_tag LOCUS_19400 1891905 1892156 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922422.1 protein_id gnl|my_center|LOCUS_19400 1892618 1892226 gene locus_tag LOCUS_19410 1892618 1892226 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090189.1 protein_id gnl|my_center|LOCUS_19410 1892754 1893407 gene locus_tag LOCUS_19420 1892754 1893407 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461531.1 protein_id gnl|my_center|LOCUS_19420 1893734 1895083 gene locus_tag LOCUS_19430 1893734 1895083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 1895314 1896384 gene locus_tag LOCUS_19440 1895314 1896384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 1896459 1897121 gene locus_tag LOCUS_19450 gene deoC 1896459 1897121 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183018.1 protein_id gnl|my_center|LOCUS_19450 1897159 1897974 gene locus_tag LOCUS_19460 1897159 1897974 CDS product YwqG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815259.1 protein_id gnl|my_center|LOCUS_19460 1898040 1899377 gene locus_tag LOCUS_19470 1898040 1899377 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963782.1 protein_id gnl|my_center|LOCUS_19470 1899466 1899789 gene locus_tag LOCUS_19480 1899466 1899789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 1899907 1900251 gene locus_tag LOCUS_19490 1899907 1900251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 1900380 1900706 gene locus_tag LOCUS_19500 1900380 1900706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 1900904 1900829 gene locus_tag LOCUS_t00050 1900904 1900829 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1901280 1900981 gene locus_tag LOCUS_19510 1901280 1900981 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461958.1 protein_id gnl|my_center|LOCUS_19510 1901746 1902981 gene locus_tag LOCUS_19520 1901746 1902981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 1902998 1903729 gene locus_tag LOCUS_19530 1902998 1903729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 1903729 1904592 gene locus_tag LOCUS_19540 1903729 1904592 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812450.1 protein_id gnl|my_center|LOCUS_19540 1904568 1906118 gene locus_tag LOCUS_19550 1904568 1906118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 1906115 1906783 gene locus_tag LOCUS_19560 1906115 1906783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 1907070 1912988 gene locus_tag LOCUS_19570 1907070 1912988 CDS product beta-N-acetylglucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390210.1 protein_id gnl|my_center|LOCUS_19570 1913169 1914101 gene locus_tag LOCUS_19580 1913169 1914101 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861725.1 protein_id gnl|my_center|LOCUS_19580 1914088 1915077 gene locus_tag LOCUS_19590 1914088 1915077 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861724.1 protein_id gnl|my_center|LOCUS_19590 1915074 1916084 gene locus_tag LOCUS_19600 1915074 1916084 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439679.1 protein_id gnl|my_center|LOCUS_19600 1916081 1916860 gene locus_tag LOCUS_19610 1916081 1916860 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861723.1 protein_id gnl|my_center|LOCUS_19610 1916983 1917654 gene locus_tag LOCUS_19620 1916983 1917654 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903427.1 protein_id gnl|my_center|LOCUS_19620 1917651 1918661 gene locus_tag LOCUS_19630 1917651 1918661 CDS product HAMP domain-containing histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439911.1 protein_id gnl|my_center|LOCUS_19630 1918746 1919495 gene locus_tag LOCUS_19640 1918746 1919495 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431374.1 protein_id gnl|my_center|LOCUS_19640 1919760 1921385 gene locus_tag LOCUS_19650 1919760 1921385 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861796.1 protein_id gnl|my_center|LOCUS_19650 1922141 1921422 gene locus_tag LOCUS_19660 1922141 1921422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 1922777 1922181 gene locus_tag LOCUS_19670 1922777 1922181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 1924281 1922788 gene locus_tag LOCUS_19680 gene ypwA 1924281 1922788 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215104.1 protein_id gnl|my_center|LOCUS_19680 1924498 1925151 gene locus_tag LOCUS_19690 1924498 1925151 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048390.1 protein_id gnl|my_center|LOCUS_19690 1925136 1925927 gene locus_tag LOCUS_19700 gene thiD 1925136 1925927 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966376.1 protein_id gnl|my_center|LOCUS_19700 1927608 1925953 gene locus_tag LOCUS_19710 1927608 1925953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 1928440 1927673 gene locus_tag LOCUS_19720 1928440 1927673 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963489.1 protein_id gnl|my_center|LOCUS_19720 1929799 1928453 gene locus_tag LOCUS_19730 1929799 1928453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 1931307 1929913 gene locus_tag LOCUS_19740 1931307 1929913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 1931958 1931365 gene locus_tag LOCUS_19750 1931958 1931365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 1932099 1933355 gene locus_tag LOCUS_19760 1932099 1933355 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363706.1 protein_id gnl|my_center|LOCUS_19760 1933345 1933689 gene locus_tag LOCUS_19770 1933345 1933689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 1934478 1933693 gene locus_tag LOCUS_19780 1934478 1933693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 1934735 1934580 gene locus_tag LOCUS_19790 1934735 1934580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 1935028 1935852 gene locus_tag LOCUS_19800 1935028 1935852 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047741.1 protein_id gnl|my_center|LOCUS_19800 1936294 1937121 gene locus_tag LOCUS_19810 1936294 1937121 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102075.1 protein_id gnl|my_center|LOCUS_19810 1937075 1938019 gene locus_tag LOCUS_19820 1937075 1938019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 1938240 1938953 gene locus_tag LOCUS_19830 1938240 1938953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 1939030 1943610 gene locus_tag LOCUS_19840 1939030 1943610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 1943705 1944268 gene locus_tag LOCUS_19850 1943705 1944268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 1944312 1953422 gene locus_tag LOCUS_19860 1944312 1953422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 1953493 1953852 gene locus_tag LOCUS_19870 1953493 1953852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 1953909 1954907 gene locus_tag LOCUS_19880 1953909 1954907 CDS product DUF3991 and toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368706.1 protein_id gnl|my_center|LOCUS_19880 1954922 1955116 gene locus_tag LOCUS_19890 1954922 1955116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 1955412 1956764 gene locus_tag LOCUS_19900 1955412 1956764 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993582.1 protein_id gnl|my_center|LOCUS_19900 1956861 1957337 gene locus_tag LOCUS_19910 1956861 1957337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 1957429 1957635 gene locus_tag LOCUS_19920 1957429 1957635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 1957946 1958179 gene locus_tag LOCUS_19930 1957946 1958179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 1958176 1958502 gene locus_tag LOCUS_19940 1958176 1958502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 1958504 1959913 gene locus_tag LOCUS_19950 1958504 1959913 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102364993.1 protein_id gnl|my_center|LOCUS_19950 1959888 1960163 gene locus_tag LOCUS_19960 1959888 1960163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 1960144 1960662 gene locus_tag LOCUS_19970 1960144 1960662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 1960666 1961565 gene locus_tag LOCUS_19980 1960666 1961565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 1961575 1961763 gene locus_tag LOCUS_19990 1961575 1961763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 1961741 1963549 gene locus_tag LOCUS_20000 1961741 1963549 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010247013.1 protein_id gnl|my_center|LOCUS_20000 1963653 1963976 gene locus_tag LOCUS_20010 1963653 1963976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 1963981 1964568 gene locus_tag LOCUS_20020 1963981 1964568 CDS product MT-A70 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103677717.1 protein_id gnl|my_center|LOCUS_20020 1964546 1965394 gene locus_tag LOCUS_20030 1964546 1965394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 1965416 1965685 gene locus_tag LOCUS_20040 1965416 1965685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 1965778 1966140 gene locus_tag LOCUS_20050 1965778 1966140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 1966133 1968475 gene locus_tag LOCUS_20060 1966133 1968475 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773627.1 protein_id gnl|my_center|LOCUS_20060 1968479 1969246 gene locus_tag LOCUS_20070 1968479 1969246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 1969285 1969674 gene locus_tag LOCUS_20080 1969285 1969674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 1969677 1971347 gene locus_tag LOCUS_20090 1969677 1971347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 1971604 1972215 gene locus_tag LOCUS_20100 1971604 1972215 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268842.1 protein_id gnl|my_center|LOCUS_20100 1972437 1972838 gene locus_tag LOCUS_20110 1972437 1972838 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358712.1 protein_id gnl|my_center|LOCUS_20110 1972862 1980613 gene locus_tag LOCUS_20120 1972862 1980613 CDS product LPXTG cell wall anchor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390380.1 protein_id gnl|my_center|LOCUS_20120 1980597 1982057 gene locus_tag LOCUS_20130 1980597 1982057 CDS product SpaH/EbpB family LPXTG-anchored major pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390379.1 protein_id gnl|my_center|LOCUS_20130 1982067 1982915 gene locus_tag LOCUS_20140 1982067 1982915 CDS product class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390378.1 protein_id gnl|my_center|LOCUS_20140 1982896 1983555 gene locus_tag LOCUS_20150 1982896 1983555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 1983867 1984340 gene locus_tag LOCUS_20160 1983867 1984340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 1984386 1984709 gene locus_tag LOCUS_20170 1984386 1984709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 1984783 1985202 gene locus_tag LOCUS_20180 1984783 1985202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 1985599 1985964 gene locus_tag LOCUS_20190 1985599 1985964 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963816.1 protein_id gnl|my_center|LOCUS_20190 1986054 1986236 gene locus_tag LOCUS_20200 1986054 1986236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 1986255 1987577 gene locus_tag LOCUS_20210 1986255 1987577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 1987673 1989001 gene locus_tag LOCUS_20220 1987673 1989001 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675870.1 protein_id gnl|my_center|LOCUS_20220 1989071 1989147 gene locus_tag LOCUS_t00060 1989071 1989147 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1989708 1989905 gene locus_tag LOCUS_20230 1989708 1989905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 1989978 1990499 gene locus_tag LOCUS_20240 1989978 1990499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 1990669 1991565 gene locus_tag LOCUS_20250 1990669 1991565 CDS product DUF6017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861119.1 protein_id gnl|my_center|LOCUS_20250 1991566 1992057 gene locus_tag LOCUS_20260 1991566 1992057 CDS product PcfB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368727.1 protein_id gnl|my_center|LOCUS_20260 1992054 1993811 gene locus_tag LOCUS_20270 1992054 1993811 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861117.1 protein_id gnl|my_center|LOCUS_20270 1993848 1994063 gene locus_tag LOCUS_20280 1993848 1994063 CDS product Maff2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610321.1 protein_id gnl|my_center|LOCUS_20280 1994084 1994953 gene locus_tag LOCUS_20290 1994084 1994953 CDS product CD0415/CD1112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368724.1 protein_id gnl|my_center|LOCUS_20290 1994968 1995402 gene locus_tag LOCUS_20300 1994968 1995402 CDS product PrgI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861115.1 protein_id gnl|my_center|LOCUS_20300 1995320 1997749 gene locus_tag LOCUS_20310 1995320 1997749 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861114.1 protein_id gnl|my_center|LOCUS_20310 1997742 1997915 gene locus_tag LOCUS_20320 1997742 1997915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 1998414 1998130 gene locus_tag LOCUS_20330 1998414 1998130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 1998404 1998775 gene locus_tag LOCUS_20340 1998404 1998775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 1998772 1998930 gene locus_tag LOCUS_20350 1998772 1998930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 1998927 2000906 gene locus_tag LOCUS_20360 1998927 2000906 CDS product CHAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861112.1 protein_id gnl|my_center|LOCUS_20360 2000933 2001205 gene locus_tag LOCUS_20370 2000933 2001205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 2001195 2002271 gene locus_tag LOCUS_20380 2001195 2002271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 2002264 2004363 gene locus_tag LOCUS_20390 2002264 2004363 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861108.1 protein_id gnl|my_center|LOCUS_20390 2004350 2004829 gene locus_tag LOCUS_20400 2004350 2004829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 2004842 2006668 gene locus_tag LOCUS_20410 2004842 2006668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 2006711 2006899 gene locus_tag LOCUS_20420 2006711 2006899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 2007650 2007318 gene locus_tag LOCUS_20430 2007650 2007318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 2009065 2007722 gene locus_tag LOCUS_20440 2009065 2007722 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861101.1 protein_id gnl|my_center|LOCUS_20440 2009355 2009026 gene locus_tag LOCUS_20450 gene mobC 2009355 2009026 CDS product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861100.1 protein_id gnl|my_center|LOCUS_20450 2009761 2010339 gene locus_tag LOCUS_20460 2009761 2010339 CDS product MptD family putative ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680633.1 protein_id gnl|my_center|LOCUS_20460 2010339 2011076 gene locus_tag LOCUS_20470 2010339 2011076 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676089.1 protein_id gnl|my_center|LOCUS_20470 2011081 2012616 gene locus_tag LOCUS_20480 2011081 2012616 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462215.1 protein_id gnl|my_center|LOCUS_20480 2012711 2013568 gene locus_tag LOCUS_20490 2012711 2013568 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945452.1 protein_id gnl|my_center|LOCUS_20490 2013690 2015471 gene locus_tag LOCUS_20500 2013690 2015471 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462213.1 protein_id gnl|my_center|LOCUS_20500 2015464 2017215 gene locus_tag LOCUS_20510 2015464 2017215 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986745.1 protein_id gnl|my_center|LOCUS_20510 2017234 2017602 gene locus_tag LOCUS_20520 2017234 2017602 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_20520 2018192 2018617 gene locus_tag LOCUS_20530 2018192 2018617 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003061815.1 protein_id gnl|my_center|LOCUS_20530 2018610 2018852 gene locus_tag LOCUS_20540 2018610 2018852 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009905237.1 protein_id gnl|my_center|LOCUS_20540 2019359 2019565 gene locus_tag LOCUS_20550 2019359 2019565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 2019586 2020980 gene locus_tag LOCUS_20560 2019586 2020980 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678909.1 protein_id gnl|my_center|LOCUS_20560 2021244 2021168 gene locus_tag LOCUS_t00070 2021244 2021168 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2021625 2022050 gene locus_tag LOCUS_20570 2021625 2022050 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261947.1 protein_id gnl|my_center|LOCUS_20570 2022121 2024112 gene locus_tag LOCUS_20580 2022121 2024112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 2024346 2026601 gene locus_tag LOCUS_20590 gene pflB 2024346 2026601 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289265.1 protein_id gnl|my_center|LOCUS_20590 2026654 2027400 gene locus_tag LOCUS_20600 gene pflA 2026654 2027400 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357530.1 protein_id gnl|my_center|LOCUS_20600 2027572 2028231 gene locus_tag LOCUS_20610 2027572 2028231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 2030327 2028342 gene locus_tag LOCUS_20620 2030327 2028342 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016921.1 protein_id gnl|my_center|LOCUS_20620 2030837 2030403 gene locus_tag LOCUS_20630 2030837 2030403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 2031539 2030916 gene locus_tag LOCUS_20640 2031539 2030916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 2031719 2032828 gene locus_tag LOCUS_20650 2031719 2032828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 2032927 2033463 gene locus_tag LOCUS_20660 2032927 2033463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 2033601 2033906 gene locus_tag LOCUS_20670 2033601 2033906 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643121.1 protein_id gnl|my_center|LOCUS_20670 2033906 2034889 gene locus_tag LOCUS_20680 2033906 2034889 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476555.1 protein_id gnl|my_center|LOCUS_20680 2035055 2036422 gene locus_tag LOCUS_20690 2035055 2036422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 2036483 2038987 gene locus_tag LOCUS_20700 2036483 2038987 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582581.1 protein_id gnl|my_center|LOCUS_20700 2040018 2039035 gene locus_tag LOCUS_20710 2040018 2039035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 2040344 2041666 gene locus_tag LOCUS_20720 gene rhaB 2040344 2041666 CDS product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642942.1 protein_id gnl|my_center|LOCUS_20720 2041668 2042912 gene locus_tag LOCUS_20730 gene rhaA 2041668 2042912 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244294.1 protein_id gnl|my_center|LOCUS_20730 2042914 2043741 gene locus_tag LOCUS_20740 gene rhaD 2042914 2043741 CDS product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924506.1 protein_id gnl|my_center|LOCUS_20740 2043827 2045251 gene locus_tag LOCUS_20750 2043827 2045251 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002375743.1 protein_id gnl|my_center|LOCUS_20750 2045460 2046062 gene locus_tag LOCUS_20760 2045460 2046062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 2046804 2046109 gene locus_tag LOCUS_20770 2046804 2046109 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956859.1 protein_id gnl|my_center|LOCUS_20770 2046974 2047555 gene locus_tag LOCUS_20780 2046974 2047555 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732846.1 protein_id gnl|my_center|LOCUS_20780 2047561 2049939 gene locus_tag LOCUS_20790 2047561 2049939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 2049929 2052295 gene locus_tag LOCUS_20800 2049929 2052295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 2052314 2052610 gene locus_tag LOCUS_20810 2052314 2052610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 2053148 2052651 gene locus_tag LOCUS_20820 2053148 2052651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 2053980 2053261 gene locus_tag LOCUS_20830 2053980 2053261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 2055321 2054038 gene locus_tag LOCUS_20840 2055321 2054038 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_20840 2055911 2055450 gene locus_tag LOCUS_20850 2055911 2055450 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172543.1 protein_id gnl|my_center|LOCUS_20850 2057857 2055947 gene locus_tag LOCUS_20860 2057857 2055947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 2058050 2058274 gene locus_tag LOCUS_20870 2058050 2058274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 2059682 2058312 gene locus_tag LOCUS_20880 2059682 2058312 CDS product collagen-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151035592.1 protein_id gnl|my_center|LOCUS_20880 2059980 2064941 gene locus_tag LOCUS_20890 2059980 2064941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 2065179 2066489 gene locus_tag LOCUS_20900 gene thiC 2065179 2066489 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966296.1 protein_id gnl|my_center|LOCUS_20900 2066838 2068340 gene locus_tag LOCUS_20910 2066838 2068340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 2068523 2068954 gene locus_tag LOCUS_20920 2068523 2068954 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052499.1 protein_id gnl|my_center|LOCUS_20920 2068951 2069877 gene locus_tag LOCUS_20930 gene rbsK 2068951 2069877 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419503.1 protein_id gnl|my_center|LOCUS_20930 2069870 2070790 gene locus_tag LOCUS_20940 gene rihC 2069870 2070790 CDS product ribonucleoside hydrolase RihC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052500.1 protein_id gnl|my_center|LOCUS_20940 2070812 2072170 gene locus_tag LOCUS_20950 gene dcuC 2070812 2072170 CDS product C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360057.1 protein_id gnl|my_center|LOCUS_20950 2072236 2073651 gene locus_tag LOCUS_20960 gene dcuC 2072236 2073651 CDS product C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052501.1 protein_id gnl|my_center|LOCUS_20960 2073668 2074489 gene locus_tag LOCUS_20970 2073668 2074489 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430704.1 protein_id gnl|my_center|LOCUS_20970 2074486 2075403 gene locus_tag LOCUS_20980 2074486 2075403 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903779.1 protein_id gnl|my_center|LOCUS_20980 2075520 2076533 gene locus_tag LOCUS_20990 2075520 2076533 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860719.1 protein_id gnl|my_center|LOCUS_20990 2076952 2076575 gene locus_tag LOCUS_21000 2076952 2076575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 2077052 2077690 gene locus_tag LOCUS_21010 2077052 2077690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 2077715 2078422 gene locus_tag LOCUS_21020 2077715 2078422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 2078409 2079284 gene locus_tag LOCUS_21030 2078409 2079284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 2079455 2083045 gene locus_tag LOCUS_21040 2079455 2083045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 2083151 2083789 gene locus_tag LOCUS_21050 2083151 2083789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 2083905 2084402 gene locus_tag LOCUS_21060 2083905 2084402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 2084593 2085285 gene locus_tag LOCUS_21070 2084593 2085285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 2085313 2086101 gene locus_tag LOCUS_21080 2085313 2086101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 2086126 2086848 gene locus_tag LOCUS_21090 2086126 2086848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 2086866 2087486 gene locus_tag LOCUS_21100 2086866 2087486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 2087684 2087872 gene locus_tag LOCUS_21110 2087684 2087872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 2087859 2088362 gene locus_tag LOCUS_21120 2087859 2088362 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767813.1 protein_id gnl|my_center|LOCUS_21120 2088750 2089958 gene locus_tag LOCUS_21130 2088750 2089958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 2089963 2090400 gene locus_tag LOCUS_21140 2089963 2090400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 2090652 2092211 gene locus_tag LOCUS_21150 2090652 2092211 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_21150 2092262 2092537 gene locus_tag LOCUS_21160 2092262 2092537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 2093493 2092618 gene locus_tag LOCUS_21170 2093493 2092618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 2093674 2095347 gene locus_tag LOCUS_21180 2093674 2095347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821217.1 protein_id gnl|my_center|LOCUS_21180 2096633 2095377 gene locus_tag LOCUS_21190 2096633 2095377 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254464.1 protein_id gnl|my_center|LOCUS_21190 2099542 2096630 gene locus_tag LOCUS_21200 2099542 2096630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 2100617 2099529 gene locus_tag LOCUS_21210 2100617 2099529 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870115.1 protein_id gnl|my_center|LOCUS_21210 2100972 2100622 gene locus_tag LOCUS_21220 2100972 2100622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 2101456 2102886 gene locus_tag LOCUS_21230 2101456 2102886 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963597.1 protein_id gnl|my_center|LOCUS_21230 2102994 2103632 gene locus_tag LOCUS_21240 2102994 2103632 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968046.1 protein_id gnl|my_center|LOCUS_21240 2103788 2104447 gene locus_tag LOCUS_21250 2103788 2104447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 2104444 2105601 gene locus_tag LOCUS_21260 2104444 2105601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 2105678 2106319 gene locus_tag LOCUS_21270 2105678 2106319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 2106484 2106906 gene locus_tag LOCUS_21280 2106484 2106906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 2106909 2107328 gene locus_tag LOCUS_21290 2106909 2107328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 2107415 2107876 gene locus_tag LOCUS_21300 2107415 2107876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 2108906 2107914 gene locus_tag LOCUS_21310 2108906 2107914 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379303.1 protein_id gnl|my_center|LOCUS_21310 2109929 2108922 gene locus_tag LOCUS_21320 2109929 2108922 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897407.1 protein_id gnl|my_center|LOCUS_21320 2111422 2109929 gene locus_tag LOCUS_21330 gene galT 2111422 2109929 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966244.1 protein_id gnl|my_center|LOCUS_21330 2112612 2111449 gene locus_tag LOCUS_21340 2112612 2111449 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704250.1 protein_id gnl|my_center|LOCUS_21340 2112880 2113938 gene locus_tag LOCUS_21350 2112880 2113938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 2114189 2114563 gene locus_tag LOCUS_21360 2114189 2114563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 2114839 2114997 gene locus_tag LOCUS_21370 2114839 2114997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 2115164 2115934 gene locus_tag LOCUS_21380 2115164 2115934 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809790.1 protein_id gnl|my_center|LOCUS_21380 2115934 2116482 gene locus_tag LOCUS_21390 2115934 2116482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 2116739 2117431 gene locus_tag LOCUS_21400 2116739 2117431 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_21400 2117443 2118444 gene locus_tag LOCUS_21410 2117443 2118444 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_21410 2118643 2118861 gene locus_tag LOCUS_21420 2118643 2118861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 2118842 2119153 gene locus_tag LOCUS_21430 2118842 2119153 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396712.1 protein_id gnl|my_center|LOCUS_21430 2119256 2120227 gene locus_tag LOCUS_21440 gene mbl 2119256 2120227 CDS product cell shape-determining protein Mbl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227776.1 protein_id gnl|my_center|LOCUS_21440 2120466 2121770 gene locus_tag LOCUS_21450 gene amrA 2120466 2121770 CDS product AmmeMemoRadiSam system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964729.1 protein_id gnl|my_center|LOCUS_21450 2121760 2122575 gene locus_tag LOCUS_21460 gene amrS 2121760 2122575 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081949.1 protein_id gnl|my_center|LOCUS_21460 2122696 2124936 gene locus_tag LOCUS_21470 2122696 2124936 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454973.1 protein_id gnl|my_center|LOCUS_21470 2125067 2124994 gene locus_tag LOCUS_t00080 2125067 2124994 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2125709 2125134 gene locus_tag LOCUS_21480 2125709 2125134 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398496.1 protein_id gnl|my_center|LOCUS_21480 2126427 2125675 gene locus_tag LOCUS_21490 2126427 2125675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 2126944 2126510 gene locus_tag LOCUS_21500 2126944 2126510 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674368.1 protein_id gnl|my_center|LOCUS_21500 2127825 2126944 gene locus_tag LOCUS_21510 gene thrB 2127825 2126944 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674786.1 protein_id gnl|my_center|LOCUS_21510 2129311 2127818 gene locus_tag LOCUS_21520 gene thrC 2129311 2127818 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674787.1 protein_id gnl|my_center|LOCUS_21520 2129432 2130607 gene locus_tag LOCUS_21530 2129432 2130607 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674788.1 protein_id gnl|my_center|LOCUS_21530 2130604 2131917 gene locus_tag LOCUS_21540 2130604 2131917 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986280.1 protein_id gnl|my_center|LOCUS_21540 2131943 2132953 gene locus_tag LOCUS_21550 2131943 2132953 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460383.1 protein_id gnl|my_center|LOCUS_21550 2133380 2132997 gene locus_tag LOCUS_21560 2133380 2132997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 2133536 2133621 gene locus_tag LOCUS_t00090 2133536 2133621 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2133828 2134460 gene locus_tag LOCUS_21570 2133828 2134460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 2134540 2135082 gene locus_tag LOCUS_21580 2134540 2135082 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389983.1 protein_id gnl|my_center|LOCUS_21580 2135188 2135273 gene locus_tag LOCUS_t00100 2135188 2135273 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2136045 2135386 gene locus_tag LOCUS_21590 2136045 2135386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21590 2136550 2136032 gene locus_tag LOCUS_21600 2136550 2136032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 2137571 2136618 gene locus_tag LOCUS_21610 2137571 2136618 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139264482.1 protein_id gnl|my_center|LOCUS_21610 2138047 2137673 gene locus_tag LOCUS_21620 2138047 2137673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 2138207 2139115 gene locus_tag LOCUS_21630 gene ftsX 2138207 2139115 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968247.1 protein_id gnl|my_center|LOCUS_21630 2139128 2140744 gene locus_tag LOCUS_21640 2139128 2140744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 2140827 2141870 gene locus_tag LOCUS_21650 gene mutY 2140827 2141870 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989787.1 protein_id gnl|my_center|LOCUS_21650 2141852 2142442 gene locus_tag LOCUS_21660 2141852 2142442 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701817.1 protein_id gnl|my_center|LOCUS_21660 2142531 2143253 gene locus_tag LOCUS_21670 2142531 2143253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 2143320 2143511 gene locus_tag LOCUS_21680 2143320 2143511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 2143522 2143932 gene locus_tag LOCUS_21690 2143522 2143932 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261614.1 protein_id gnl|my_center|LOCUS_21690 2144162 2143971 gene locus_tag LOCUS_21700 2144162 2143971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 2144256 2145242 gene locus_tag LOCUS_21710 2144256 2145242 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002004297.1 protein_id gnl|my_center|LOCUS_21710 2145242 2145574 gene locus_tag LOCUS_21720 2145242 2145574 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421356.1 protein_id gnl|my_center|LOCUS_21720 2146266 2145637 gene locus_tag LOCUS_21730 2146266 2145637 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943184.1 protein_id gnl|my_center|LOCUS_21730 2146796 2146329 gene locus_tag LOCUS_21740 2146796 2146329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 2148122 2146941 gene locus_tag LOCUS_21750 2148122 2146941 CDS product ISNCY family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589001.1 protein_id gnl|my_center|LOCUS_21750 2148347 2148437 gene locus_tag LOCUS_t00110 2148347 2148437 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2149790 2148762 gene locus_tag LOCUS_21760 2149790 2148762 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084133.1 protein_id gnl|my_center|LOCUS_21760 2150191 2150266 gene locus_tag LOCUS_t00120 2150191 2150266 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2150268 2150341 gene locus_tag LOCUS_t00130 2150268 2150341 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2150810 2151811 gene locus_tag LOCUS_21770 2150810 2151811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 2151864 2152220 gene locus_tag LOCUS_21780 2151864 2152220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 2152448 2152239 gene locus_tag LOCUS_21790 2152448 2152239 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358328.1 protein_id gnl|my_center|LOCUS_21790 2154722 2152557 gene locus_tag LOCUS_21800 2154722 2152557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 2156813 2154738 gene locus_tag LOCUS_21810 2156813 2154738 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930970.1 protein_id gnl|my_center|LOCUS_21810 2157420 2156827 gene locus_tag LOCUS_21820 2157420 2156827 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048232.1 protein_id gnl|my_center|LOCUS_21820 2157663 2158196 gene locus_tag LOCUS_21830 2157663 2158196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 2158259 2158969 gene locus_tag LOCUS_21840 2158259 2158969 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584037.1 protein_id gnl|my_center|LOCUS_21840 2159372 2159001 gene locus_tag LOCUS_21850 2159372 2159001 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434285.1 protein_id gnl|my_center|LOCUS_21850 2160181 2159378 gene locus_tag LOCUS_21860 2160181 2159378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 2160472 2161008 gene locus_tag LOCUS_21870 2160472 2161008 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948224.1 protein_id gnl|my_center|LOCUS_21870 2161010 2162029 gene locus_tag LOCUS_21880 2161010 2162029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 2162044 2162631 gene locus_tag LOCUS_21890 2162044 2162631 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924169.1 protein_id gnl|my_center|LOCUS_21890 2162742 2163362 gene locus_tag LOCUS_21900 2162742 2163362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 2163378 2165963 gene locus_tag LOCUS_21910 2163378 2165963 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263553.1 protein_id gnl|my_center|LOCUS_21910 2166881 2166249 gene locus_tag LOCUS_21920 2166881 2166249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 2167527 2166961 gene locus_tag LOCUS_21930 2167527 2166961 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454478.1 protein_id gnl|my_center|LOCUS_21930 2168517 2167546 gene locus_tag LOCUS_21940 2168517 2167546 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476400.1 protein_id gnl|my_center|LOCUS_21940 2168823 2169224 gene locus_tag LOCUS_21950 2168823 2169224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 2169230 2169616 gene locus_tag LOCUS_21960 2169230 2169616 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668728.1 protein_id gnl|my_center|LOCUS_21960 2169708 2170127 gene locus_tag LOCUS_21970 2169708 2170127 CDS product DUF3788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438911.1 protein_id gnl|my_center|LOCUS_21970 2170252 2170177 gene locus_tag LOCUS_t00140 2170252 2170177 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2170688 2170308 gene locus_tag LOCUS_21980 gene crcB 2170688 2170308 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072309.1 protein_id gnl|my_center|LOCUS_21980 2171934 2170690 gene locus_tag LOCUS_21990 2171934 2170690 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033932046.1 protein_id gnl|my_center|LOCUS_21990 2172134 2173513 gene locus_tag LOCUS_22000 2172134 2173513 CDS product ISNCY family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589001.1 protein_id gnl|my_center|LOCUS_22000 2174787 2173552 gene locus_tag LOCUS_22010 2174787 2173552 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461202.1 protein_id gnl|my_center|LOCUS_22010 2175461 2174784 gene locus_tag LOCUS_22020 2175461 2174784 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238594.1 protein_id gnl|my_center|LOCUS_22020 2175597 2176316 gene locus_tag LOCUS_22030 2175597 2176316 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814520.1 protein_id gnl|my_center|LOCUS_22030 2176309 2176971 gene locus_tag LOCUS_22040 2176309 2176971 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814522.1 protein_id gnl|my_center|LOCUS_22040 2176983 2178878 gene locus_tag LOCUS_22050 2176983 2178878 CDS product carbohydrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814523.1 protein_id gnl|my_center|LOCUS_22050 2178994 2179770 gene locus_tag LOCUS_22060 2178994 2179770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 2179892 2181373 gene locus_tag LOCUS_22070 2179892 2181373 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387645.1 protein_id gnl|my_center|LOCUS_22070 2181366 2183147 gene locus_tag LOCUS_22080 gene bglP 2181366 2183147 CDS product PTS beta-glucoside transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242943.1 protein_id gnl|my_center|LOCUS_22080 2183320 2184027 gene locus_tag LOCUS_22090 2183320 2184027 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244307.1 protein_id gnl|my_center|LOCUS_22090 2184017 2184160 gene locus_tag LOCUS_22100 2184017 2184160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 2185143 2184259 gene locus_tag LOCUS_22110 2185143 2184259 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001231451.1 protein_id gnl|my_center|LOCUS_22110 2185346 2186113 gene locus_tag LOCUS_22120 2185346 2186113 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965563.1 protein_id gnl|my_center|LOCUS_22120 2186115 2186555 gene locus_tag LOCUS_22130 2186115 2186555 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986910.1 protein_id gnl|my_center|LOCUS_22130 2186552 2188825 gene locus_tag LOCUS_22140 2186552 2188825 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048131.1 protein_id gnl|my_center|LOCUS_22140 2188816 2190144 gene locus_tag LOCUS_22150 2188816 2190144 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986630.1 protein_id gnl|my_center|LOCUS_22150 2190141 2190917 gene locus_tag LOCUS_22160 2190141 2190917 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065531.1 protein_id gnl|my_center|LOCUS_22160 2192645 2191266 gene locus_tag LOCUS_22170 2192645 2191266 CDS product ISNCY family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589001.1 protein_id gnl|my_center|LOCUS_22170 2193173 2193015 gene locus_tag LOCUS_22180 2193173 2193015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 2193773 2193489 gene locus_tag LOCUS_22190 2193773 2193489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 2193940 2195409 gene locus_tag LOCUS_22200 2193940 2195409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 2195902 2195444 gene locus_tag LOCUS_22210 2195902 2195444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 2197509 2195995 gene locus_tag LOCUS_22220 2197509 2195995 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897439.1 protein_id gnl|my_center|LOCUS_22220 2197626 2198288 gene locus_tag LOCUS_22230 2197626 2198288 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202796158.1 protein_id gnl|my_center|LOCUS_22230 2198377 2199291 gene locus_tag LOCUS_22240 2198377 2199291 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004846624.1 protein_id gnl|my_center|LOCUS_22240 2199284 2200111 gene locus_tag LOCUS_22250 2199284 2200111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 2200202 2201008 gene locus_tag LOCUS_22260 2200202 2201008 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460597.1 protein_id gnl|my_center|LOCUS_22260 2201216 2202757 gene locus_tag LOCUS_22270 2201216 2202757 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261956.1 protein_id gnl|my_center|LOCUS_22270 2202822 2204411 gene locus_tag LOCUS_22280 2202822 2204411 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861711.1 protein_id gnl|my_center|LOCUS_22280 2205038 2204442 gene locus_tag LOCUS_22290 2205038 2204442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 2205269 2205736 gene locus_tag LOCUS_22300 2205269 2205736 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948763.1 protein_id gnl|my_center|LOCUS_22300 2205711 2207144 gene locus_tag LOCUS_22310 2205711 2207144 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891654.1 protein_id gnl|my_center|LOCUS_22310 2207222 2207644 gene locus_tag LOCUS_22320 2207222 2207644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 2207873 2209237 gene locus_tag LOCUS_22330 2207873 2209237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 2209251 2211299 gene locus_tag LOCUS_22340 gene mtlR 2209251 2211299 CDS product mannitol operon transcriptional activator MtlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246695.1 protein_id gnl|my_center|LOCUS_22340 2211310 2212038 gene locus_tag LOCUS_22350 2211310 2212038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 2212038 2212976 gene locus_tag LOCUS_22360 gene pfkB 2212038 2212976 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963555.1 protein_id gnl|my_center|LOCUS_22360 2212977 2214230 gene locus_tag LOCUS_22370 2212977 2214230 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853233.1 protein_id gnl|my_center|LOCUS_22370 2214452 2214817 gene locus_tag LOCUS_22380 2214452 2214817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 2214970 2215887 gene locus_tag LOCUS_22390 2214970 2215887 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388962.1 protein_id gnl|my_center|LOCUS_22390 2216022 2218004 gene locus_tag LOCUS_22400 2216022 2218004 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986650.1 protein_id gnl|my_center|LOCUS_22400 2218288 2218028 gene locus_tag LOCUS_22410 2218288 2218028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 2220320 2218461 gene locus_tag LOCUS_22420 2220320 2218461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 2220496 2221278 gene locus_tag LOCUS_22430 gene murI 2220496 2221278 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053283.1 protein_id gnl|my_center|LOCUS_22430 2221384 2222760 gene locus_tag LOCUS_22440 2221384 2222760 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964406.1 protein_id gnl|my_center|LOCUS_22440 2222858 2223598 gene locus_tag LOCUS_22450 2222858 2223598 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065023.1 protein_id gnl|my_center|LOCUS_22450 2223601 2224326 gene locus_tag LOCUS_22460 2223601 2224326 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567993.1 protein_id gnl|my_center|LOCUS_22460 2224395 2225402 gene locus_tag LOCUS_22470 gene purR 2224395 2225402 CDS product HTH-type transcriptional repressor PurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005660510.1 protein_id gnl|my_center|LOCUS_22470 2225641 2226939 gene locus_tag LOCUS_22480 gene celB 2225641 2226939 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009901597.1 protein_id gnl|my_center|LOCUS_22480 2226971 2227786 gene locus_tag LOCUS_22490 2226971 2227786 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080608.1 protein_id gnl|my_center|LOCUS_22490 2227786 2228715 gene locus_tag LOCUS_22500 2227786 2228715 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732677.1 protein_id gnl|my_center|LOCUS_22500 2228712 2230157 gene locus_tag LOCUS_22510 gene glpK 2228712 2230157 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080610.1 protein_id gnl|my_center|LOCUS_22510 2230154 2231035 gene locus_tag LOCUS_22520 2230154 2231035 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476368.1 protein_id gnl|my_center|LOCUS_22520 2231020 2232435 gene locus_tag LOCUS_22530 2231020 2232435 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989642.1 protein_id gnl|my_center|LOCUS_22530 2232439 2233713 gene locus_tag LOCUS_22540 2232439 2233713 CDS product DUF4038 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989646.1 protein_id gnl|my_center|LOCUS_22540 2233715 2234026 gene locus_tag LOCUS_22550 2233715 2234026 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002924730.1 protein_id gnl|my_center|LOCUS_22550 2234127 2234429 gene locus_tag LOCUS_22560 2234127 2234429 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922394.1 protein_id gnl|my_center|LOCUS_22560 2234432 2234743 gene locus_tag LOCUS_22570 2234432 2234743 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390312.1 protein_id gnl|my_center|LOCUS_22570 2234953 2236296 gene locus_tag LOCUS_22580 2234953 2236296 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393287.1 protein_id gnl|my_center|LOCUS_22580 2239529 2236329 gene locus_tag LOCUS_22590 2239529 2236329 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016952.1 protein_id gnl|my_center|LOCUS_22590 2239689 2239764 gene locus_tag LOCUS_t00150 2239689 2239764 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2240032 2240682 gene locus_tag LOCUS_22600 2240032 2240682 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459534.1 protein_id gnl|my_center|LOCUS_22600 2240688 2241176 gene locus_tag LOCUS_22610 2240688 2241176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 2241331 2243223 gene locus_tag LOCUS_22620 2241331 2243223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 2243350 2244945 gene locus_tag LOCUS_22630 2243350 2244945 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966231.1 protein_id gnl|my_center|LOCUS_22630 2245091 2246551 gene locus_tag LOCUS_22640 gene gltX 2245091 2246551 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356788.1 protein_id gnl|my_center|LOCUS_22640 2247053 2253382 gene locus_tag LOCUS_22650 2247053 2253382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 2253565 2254002 gene locus_tag LOCUS_22660 2253565 2254002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 2254019 2254294 gene locus_tag LOCUS_22670 2254019 2254294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 2254539 2254979 gene locus_tag LOCUS_22680 2254539 2254979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 2255060 2255977 gene locus_tag LOCUS_22690 2255060 2255977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 2256124 2256606 gene locus_tag LOCUS_22700 2256124 2256606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 2256692 2257510 gene locus_tag LOCUS_22710 2256692 2257510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 2257617 2259407 gene locus_tag LOCUS_22720 2257617 2259407 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897431.1 protein_id gnl|my_center|LOCUS_22720 2259459 2260028 gene locus_tag LOCUS_22730 2259459 2260028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 2260047 2260874 gene locus_tag LOCUS_22740 2260047 2260874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 2260950 2261999 gene locus_tag LOCUS_22750 2260950 2261999 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969226.1 protein_id gnl|my_center|LOCUS_22750 2262171 2262096 gene locus_tag LOCUS_t00160 2262171 2262096 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2262294 2262989 gene locus_tag LOCUS_22760 2262294 2262989 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460301.1 protein_id gnl|my_center|LOCUS_22760 2262986 2263318 gene locus_tag LOCUS_22770 2262986 2263318 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460300.1 protein_id gnl|my_center|LOCUS_22770 2264209 2263328 gene locus_tag LOCUS_22780 2264209 2263328 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262369.1 protein_id gnl|my_center|LOCUS_22780 2264474 2265517 gene locus_tag LOCUS_22790 gene serC 2264474 2265517 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_22790 2265538 2266698 gene locus_tag LOCUS_22800 2265538 2266698 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815835.1 protein_id gnl|my_center|LOCUS_22800 2266792 2268942 gene locus_tag LOCUS_22810 2266792 2268942 CDS product type IA DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235749.1 protein_id gnl|my_center|LOCUS_22810 2269235 2270665 gene locus_tag LOCUS_22820 2269235 2270665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 2270658 2271539 gene locus_tag LOCUS_22830 2270658 2271539 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861296.1 protein_id gnl|my_center|LOCUS_22830 2271598 2273754 gene locus_tag LOCUS_22840 2271598 2273754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 2273751 2274791 gene locus_tag LOCUS_22850 2273751 2274791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 2275036 2274875 gene locus_tag LOCUS_22860 2275036 2274875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 2275143 2275904 gene locus_tag LOCUS_22870 2275143 2275904 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594240.1 protein_id gnl|my_center|LOCUS_22870 2275997 2277340 gene locus_tag LOCUS_22880 2275997 2277340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 2277343 2278713 gene locus_tag LOCUS_22890 2277343 2278713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 2278733 2280073 gene locus_tag LOCUS_22900 gene glmM 2278733 2280073 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234946.1 protein_id gnl|my_center|LOCUS_22900 2280219 2280878 gene locus_tag LOCUS_22910 gene cssR 2280219 2280878 CDS product secretion stress-responsive two-component system response regulator CssR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228529.1 protein_id gnl|my_center|LOCUS_22910 2280880 2282241 gene locus_tag LOCUS_22920 2280880 2282241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 2282313 2283629 gene locus_tag LOCUS_22930 2282313 2283629 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476434.1 protein_id gnl|my_center|LOCUS_22930 2283724 2284428 gene locus_tag LOCUS_22940 2283724 2284428 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852645.1 protein_id gnl|my_center|LOCUS_22940 2284421 2285986 gene locus_tag LOCUS_22950 2284421 2285986 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405061.1 protein_id gnl|my_center|LOCUS_22950 2286038 2287189 gene locus_tag LOCUS_22960 2286038 2287189 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404923.1 protein_id gnl|my_center|LOCUS_22960 2288043 2287207 gene locus_tag LOCUS_22970 2288043 2287207 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948300.1 protein_id gnl|my_center|LOCUS_22970 2288290 2290446 gene locus_tag LOCUS_22980 gene gnpA 2288290 2290446 CDS product 1,3-beta-galactosyl-N-acetylhexosamine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389962.1 protein_id gnl|my_center|LOCUS_22980 2291926 2290472 gene locus_tag LOCUS_22990 2291926 2290472 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010818874.1 protein_id gnl|my_center|LOCUS_22990 2292225 2293562 gene locus_tag LOCUS_23000 gene msmE 2292225 2293562 CDS product sugar-binding protein MsmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262872.1 protein_id gnl|my_center|LOCUS_23000 2293643 2294524 gene locus_tag LOCUS_23010 2293643 2294524 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056604.1 protein_id gnl|my_center|LOCUS_23010 2294537 2295409 gene locus_tag LOCUS_23020 2294537 2295409 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030593.1 protein_id gnl|my_center|LOCUS_23020 2295421 2297595 gene locus_tag LOCUS_23030 gene gnpA 2295421 2297595 CDS product 1,3-beta-galactosyl-N-acetylhexosamine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389962.1 protein_id gnl|my_center|LOCUS_23030 2297582 2297755 gene locus_tag LOCUS_23040 2297582 2297755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 2297767 2298858 gene locus_tag LOCUS_23050 gene ugpC 2297767 2298858 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818946.1 protein_id gnl|my_center|LOCUS_23050 2299843 2299055 gene locus_tag LOCUS_23060 2299843 2299055 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429371.1 protein_id gnl|my_center|LOCUS_23060 2300964 2299861 gene locus_tag LOCUS_23070 2300964 2299861 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881057.1 protein_id gnl|my_center|LOCUS_23070 2301121 2302443 gene locus_tag LOCUS_23080 2301121 2302443 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438549.1 protein_id gnl|my_center|LOCUS_23080 2302931 2302440 gene locus_tag LOCUS_23090 2302931 2302440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 2303258 2303055 gene locus_tag LOCUS_23100 gene cspD 2303258 2303055 CDS product cold-shock protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728273.1 protein_id gnl|my_center|LOCUS_23100 2303551 2304996 gene locus_tag LOCUS_23110 2303551 2304996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 2306801 2305041 gene locus_tag LOCUS_23120 gene pepF 2306801 2305041 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003393.1 protein_id gnl|my_center|LOCUS_23120 2309595 2306788 gene locus_tag LOCUS_23130 2309595 2306788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 2309773 2310219 gene locus_tag LOCUS_23140 2309773 2310219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 2310543 2311757 gene locus_tag LOCUS_23150 gene pepT 2310543 2311757 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460034.1 protein_id gnl|my_center|LOCUS_23150 2312438 2311776 gene locus_tag LOCUS_23160 2312438 2311776 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861651.1 protein_id gnl|my_center|LOCUS_23160 2313445 2312519 gene locus_tag LOCUS_23170 2313445 2312519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 2313797 2314351 gene locus_tag LOCUS_23180 2313797 2314351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 2314580 2316724 gene locus_tag LOCUS_23190 2314580 2316724 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000370122.1 protein_id gnl|my_center|LOCUS_23190 2316857 2318713 gene locus_tag LOCUS_23200 2316857 2318713 CDS product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989614.1 protein_id gnl|my_center|LOCUS_23200 2318833 2320134 gene locus_tag LOCUS_23210 gene celB 2318833 2320134 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244271.1 protein_id gnl|my_center|LOCUS_23210 2320127 2321161 gene locus_tag LOCUS_23220 2320127 2321161 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557877.1 protein_id gnl|my_center|LOCUS_23220 2321324 2322151 gene locus_tag LOCUS_23230 2321324 2322151 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430704.1 protein_id gnl|my_center|LOCUS_23230 2322151 2323077 gene locus_tag LOCUS_23240 2322151 2323077 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903779.1 protein_id gnl|my_center|LOCUS_23240 2323326 2323610 gene locus_tag LOCUS_23250 2323326 2323610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 2323724 2323861 gene locus_tag LOCUS_23260 2323724 2323861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 2323929 2324339 gene locus_tag LOCUS_23270 2323929 2324339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 2324375 2324530 gene locus_tag LOCUS_23280 2324375 2324530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 2324703 2325827 gene locus_tag LOCUS_23290 gene hisZ 2324703 2325827 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170323.1 protein_id gnl|my_center|LOCUS_23290 2325824 2326453 gene locus_tag LOCUS_23300 gene hisG 2325824 2326453 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964254.1 protein_id gnl|my_center|LOCUS_23300 2326457 2327737 gene locus_tag LOCUS_23310 gene hisD 2326457 2327737 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949111.1 protein_id gnl|my_center|LOCUS_23310 2327738 2328778 gene locus_tag LOCUS_23320 gene hisC 2327738 2328778 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889400.1 protein_id gnl|my_center|LOCUS_23320 2328766 2329347 gene locus_tag LOCUS_23330 gene hisB 2328766 2329347 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949112.1 protein_id gnl|my_center|LOCUS_23330 2329344 2329958 gene locus_tag LOCUS_23340 gene hisH 2329344 2329958 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949113.1 protein_id gnl|my_center|LOCUS_23340 2329955 2330674 gene locus_tag LOCUS_23350 gene hisA 2329955 2330674 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964258.1 protein_id gnl|my_center|LOCUS_23350 2330678 2331439 gene locus_tag LOCUS_23360 gene hisF 2330678 2331439 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949116.1 protein_id gnl|my_center|LOCUS_23360 2331436 2331762 gene locus_tag LOCUS_23370 gene hisI 2331436 2331762 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263181.1 protein_id gnl|my_center|LOCUS_23370 2331759 2332082 gene locus_tag LOCUS_23380 gene hisE 2331759 2332082 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964261.1 protein_id gnl|my_center|LOCUS_23380 2332607 2332107 gene locus_tag LOCUS_23390 2332607 2332107 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064860.1 protein_id gnl|my_center|LOCUS_23390 2332754 2333383 gene locus_tag LOCUS_23400 2332754 2333383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 2334365 2333421 gene locus_tag LOCUS_23410 2334365 2333421 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384427.1 protein_id gnl|my_center|LOCUS_23410 2336012 2334540 gene locus_tag LOCUS_23420 2336012 2334540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 2336627 2336094 gene locus_tag LOCUS_23430 2336627 2336094 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964937.1 protein_id gnl|my_center|LOCUS_23430 2336738 2338081 gene locus_tag LOCUS_23440 2336738 2338081 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113324.1 protein_id gnl|my_center|LOCUS_23440 2338083 2339231 gene locus_tag LOCUS_23450 2338083 2339231 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869588.1 protein_id gnl|my_center|LOCUS_23450 2339328 2339684 gene locus_tag LOCUS_23460 2339328 2339684 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965540.1 protein_id gnl|my_center|LOCUS_23460 2339687 2340301 gene locus_tag LOCUS_23470 2339687 2340301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 2340333 2342855 gene locus_tag LOCUS_23480 2340333 2342855 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796568.1 protein_id gnl|my_center|LOCUS_23480 2342969 2343349 gene locus_tag LOCUS_23490 2342969 2343349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 2343524 2344546 gene locus_tag LOCUS_23500 2343524 2344546 CDS product alpha-hydroxy-acid oxidizing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048128.1 protein_id gnl|my_center|LOCUS_23500 2344559 2344948 gene locus_tag LOCUS_23510 2344559 2344948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811520.1 protein_id gnl|my_center|LOCUS_23510 2345023 2345511 gene locus_tag LOCUS_23520 2345023 2345511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 2345526 2346362 gene locus_tag LOCUS_23530 2345526 2346362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 2346420 2348006 gene locus_tag LOCUS_23540 gene rlmD 2346420 2348006 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000914581.1 protein_id gnl|my_center|LOCUS_23540 2348278 2348733 gene locus_tag LOCUS_23550 2348278 2348733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 2348809 2349165 gene locus_tag LOCUS_23560 2348809 2349165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 2349189 2350046 gene locus_tag LOCUS_23570 2349189 2350046 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948667.1 protein_id gnl|my_center|LOCUS_23570 2350076 2350210 gene locus_tag LOCUS_23580 2350076 2350210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 2350173 2350721 gene locus_tag LOCUS_23590 2350173 2350721 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861137.1 protein_id gnl|my_center|LOCUS_23590 2351585 2350944 gene locus_tag LOCUS_23600 2351585 2350944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 2352393 2351566 gene locus_tag LOCUS_23610 2352393 2351566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 2352602 2352393 gene locus_tag LOCUS_23620 2352602 2352393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 2352833 2353453 gene locus_tag LOCUS_23630 2352833 2353453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 2353428 2354801 gene locus_tag LOCUS_23640 2353428 2354801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 2355138 2356406 gene locus_tag LOCUS_23650 2355138 2356406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 2356396 2356560 gene locus_tag LOCUS_23660 2356396 2356560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368174.1 protein_id gnl|my_center|LOCUS_23660 2356679 2357686 gene locus_tag LOCUS_23670 2356679 2357686 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681377.1 protein_id gnl|my_center|LOCUS_23670 2357742 2359418 gene locus_tag LOCUS_23680 2357742 2359418 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031832.1 protein_id gnl|my_center|LOCUS_23680 2359539 2360669 gene locus_tag LOCUS_23690 2359539 2360669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 2360679 2361296 gene locus_tag LOCUS_23700 2360679 2361296 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965980.1 protein_id gnl|my_center|LOCUS_23700 2361526 2362104 gene locus_tag LOCUS_23710 2361526 2362104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 2362108 2362515 gene locus_tag LOCUS_23720 2362108 2362515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809638.1 protein_id gnl|my_center|LOCUS_23720 2362493 2362939 gene locus_tag LOCUS_23730 2362493 2362939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 2363202 2363017 gene locus_tag LOCUS_23740 2363202 2363017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 2363437 2364855 gene locus_tag LOCUS_23750 2363437 2364855 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795565.1 protein_id gnl|my_center|LOCUS_23750 2364972 2366279 gene locus_tag LOCUS_23760 gene guaA 2364972 2366279 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764094.1 protein_id gnl|my_center|LOCUS_23760 2366825 2366391 gene locus_tag LOCUS_23770 2366825 2366391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 2366993 2367517 gene locus_tag LOCUS_23780 2366993 2367517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 2367716 2368033 gene locus_tag LOCUS_23790 2367716 2368033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 2368033 2369310 gene locus_tag LOCUS_23800 2368033 2369310 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102364993.1 protein_id gnl|my_center|LOCUS_23800 2369297 2369647 gene locus_tag LOCUS_23810 2369297 2369647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 2369689 2369955 gene locus_tag LOCUS_23820 2369689 2369955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23820 2369972 2370289 gene locus_tag LOCUS_23830 2369972 2370289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23830 2370634 2371446 gene locus_tag LOCUS_23840 2370634 2371446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 2371480 2371680 gene locus_tag LOCUS_23850 2371480 2371680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 2372237 2373253 gene locus_tag LOCUS_23860 2372237 2373253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 2373301 2374407 gene locus_tag LOCUS_23870 2373301 2374407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 2374409 2375062 gene locus_tag LOCUS_23880 2374409 2375062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 2375049 2375828 gene locus_tag LOCUS_23890 2375049 2375828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 2376333 2376644 gene locus_tag LOCUS_23900 2376333 2376644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 2376629 2376880 gene locus_tag LOCUS_23910 2376629 2376880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 2376901 2377272 gene locus_tag LOCUS_23920 2376901 2377272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 2377500 2378480 gene locus_tag LOCUS_23930 2377500 2378480 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808153.1 protein_id gnl|my_center|LOCUS_23930 2378583 2381171 gene locus_tag LOCUS_23940 2378583 2381171 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814361.1 protein_id gnl|my_center|LOCUS_23940 2381236 2382687 gene locus_tag LOCUS_23950 2381236 2382687 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722014.1 protein_id gnl|my_center|LOCUS_23950 2382834 2383130 gene locus_tag LOCUS_23960 2382834 2383130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 2383293 2383368 gene locus_tag LOCUS_t00170 2383293 2383368 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2383376 2383451 gene locus_tag LOCUS_t00180 2383376 2383451 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2383470 2383553 gene locus_tag LOCUS_t00190 2383470 2383553 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 2383561 2383636 gene locus_tag LOCUS_t00200 2383561 2383636 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2383654 2383729 gene locus_tag LOCUS_t00210 2383654 2383729 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2383736 2383809 gene locus_tag LOCUS_t00220 2383736 2383809 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2384118 2385131 gene locus_tag LOCUS_23970 2384118 2385131 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084192.1 protein_id gnl|my_center|LOCUS_23970 2385391 2386107 gene locus_tag LOCUS_23980 gene deoD 2385391 2386107 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020631.1 protein_id gnl|my_center|LOCUS_23980 2386251 2386514 gene locus_tag LOCUS_23990 2386251 2386514 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966918.1 protein_id gnl|my_center|LOCUS_23990 2386525 2389146 gene locus_tag LOCUS_24000 2386525 2389146 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948919.1 protein_id gnl|my_center|LOCUS_24000 2389217 2389861 gene locus_tag LOCUS_24010 2389217 2389861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 2389965 2392478 gene locus_tag LOCUS_24020 2389965 2392478 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788368.1 protein_id gnl|my_center|LOCUS_24020 2392494 2393537 gene locus_tag LOCUS_24030 2392494 2393537 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681302.1 protein_id gnl|my_center|LOCUS_24030 2393666 2394616 gene locus_tag LOCUS_24040 2393666 2394616 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715339.1 protein_id gnl|my_center|LOCUS_24040 2396005 2394674 gene locus_tag LOCUS_24050 gene pdaC 2396005 2394674 CDS product peptidoglycan-N-acetylmuramic acid deacetylase PdaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245023.1 protein_id gnl|my_center|LOCUS_24050 2397219 2396146 gene locus_tag LOCUS_24060 gene ytvI 2397219 2396146 CDS product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440267.1 protein_id gnl|my_center|LOCUS_24060 2397777 2397232 gene locus_tag LOCUS_24070 gene pgsA 2397777 2397232 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000712121.1 protein_id gnl|my_center|LOCUS_24070 2398586 2397777 gene locus_tag LOCUS_24080 2398586 2397777 CDS product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454079.1 protein_id gnl|my_center|LOCUS_24080 2399237 2398599 gene locus_tag LOCUS_24090 2399237 2398599 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048390.1 protein_id gnl|my_center|LOCUS_24090 2399688 2399227 gene locus_tag LOCUS_24100 2399688 2399227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 2400091 2400762 gene locus_tag LOCUS_24110 2400091 2400762 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073543581.1 protein_id gnl|my_center|LOCUS_24110 2400776 2402860 gene locus_tag LOCUS_24120 gene fusA 2400776 2402860 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583197.1 protein_id gnl|my_center|LOCUS_24120 2403132 2406599 gene locus_tag LOCUS_24130 2403132 2406599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 2406731 2407696 gene locus_tag LOCUS_24140 2406731 2407696 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892121.1 protein_id gnl|my_center|LOCUS_24140 2407722 2408573 gene locus_tag LOCUS_24150 2407722 2408573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 2408850 2409530 gene locus_tag LOCUS_24160 2408850 2409530 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287046.1 protein_id gnl|my_center|LOCUS_24160 2409623 2410180 gene locus_tag LOCUS_24170 2409623 2410180 CDS product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357951.1 protein_id gnl|my_center|LOCUS_24170 2410226 2411596 gene locus_tag LOCUS_24180 2410226 2411596 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861729.1 protein_id gnl|my_center|LOCUS_24180 2411664 2412431 gene locus_tag LOCUS_24190 2411664 2412431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 2413854 2412379 gene locus_tag LOCUS_24200 gene amyS 2413854 2412379 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476408.1 protein_id gnl|my_center|LOCUS_24200 2414014 2414556 gene locus_tag LOCUS_24210 2414014 2414556 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419930.1 protein_id gnl|my_center|LOCUS_24210 2415872 2414889 gene locus_tag LOCUS_24220 2415872 2414889 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289074.1 protein_id gnl|my_center|LOCUS_24220 2416809 2417099 gene locus_tag LOCUS_24230 2416809 2417099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24230 2417931 2417365 gene locus_tag LOCUS_24240 2417931 2417365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 2418140 2419018 gene locus_tag LOCUS_24250 2418140 2419018 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814137.1 protein_id gnl|my_center|LOCUS_24250 2419344 2419754 gene locus_tag LOCUS_24260 2419344 2419754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 2419774 2420154 gene locus_tag LOCUS_24270 2419774 2420154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 2420164 2420595 gene locus_tag LOCUS_24280 2420164 2420595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 2420675 2423104 gene locus_tag LOCUS_24290 2420675 2423104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 2423126 2424454 gene locus_tag LOCUS_24300 2423126 2424454 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436985.1 protein_id gnl|my_center|LOCUS_24300 2424515 2424799 gene locus_tag LOCUS_24310 2424515 2424799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 2426579 2424828 gene locus_tag LOCUS_24320 2426579 2424828 CDS product molecular chaperone HscC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268782.1 protein_id gnl|my_center|LOCUS_24320 2426771 2428546 gene locus_tag LOCUS_24330 2426771 2428546 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861202.1 protein_id gnl|my_center|LOCUS_24330 2428682 2428834 gene locus_tag LOCUS_24340 2428682 2428834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 2428840 2429004 gene locus_tag LOCUS_24350 2428840 2429004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 2429218 2430000 gene locus_tag LOCUS_24360 2429218 2430000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 2430085 2431137 gene locus_tag LOCUS_24370 gene rlmN 2430085 2431137 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989487.1 protein_id gnl|my_center|LOCUS_24370 2431140 2431883 gene locus_tag LOCUS_24380 2431140 2431883 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354922.1 protein_id gnl|my_center|LOCUS_24380 2431876 2433600 gene locus_tag LOCUS_24390 gene pknB 2431876 2433600 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733096.1 protein_id gnl|my_center|LOCUS_24390 2433597 2434466 gene locus_tag LOCUS_24400 gene rsgA 2433597 2434466 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232060.1 protein_id gnl|my_center|LOCUS_24400 2434484 2435146 gene locus_tag LOCUS_24410 gene rpe 2434484 2435146 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902077.1 protein_id gnl|my_center|LOCUS_24410 2435134 2435742 gene locus_tag LOCUS_24420 2435134 2435742 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830164.1 protein_id gnl|my_center|LOCUS_24420 2435811 2437433 gene locus_tag LOCUS_24430 2435811 2437433 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948012.1 protein_id gnl|my_center|LOCUS_24430 2438355 2437468 gene locus_tag LOCUS_24440 2438355 2437468 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230330.1 protein_id gnl|my_center|LOCUS_24440 2438611 2438420 gene locus_tag LOCUS_24450 gene rpmB 2438611 2438420 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124776.1 protein_id gnl|my_center|LOCUS_24450 2438865 2440742 gene locus_tag LOCUS_24460 2438865 2440742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 2440761 2442182 gene locus_tag LOCUS_24470 2440761 2442182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 2442340 2443599 gene locus_tag LOCUS_24480 2442340 2443599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 2443622 2444701 gene locus_tag LOCUS_24490 gene ftsZ 2443622 2444701 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570127.1 protein_id gnl|my_center|LOCUS_24490 2444703 2445155 gene locus_tag LOCUS_24500 2444703 2445155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 2445256 2447826 gene locus_tag LOCUS_24510 2445256 2447826 CDS product calcium-translocating P-type ATPase, SERCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948276.1 protein_id gnl|my_center|LOCUS_24510 2447962 2448378 gene locus_tag LOCUS_24520 2447962 2448378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 2449736 2448396 gene locus_tag LOCUS_24530 2449736 2448396 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775347.1 protein_id gnl|my_center|LOCUS_24530 2450284 2450697 gene locus_tag LOCUS_24540 2450284 2450697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 2450843 2452111 gene locus_tag LOCUS_24550 2450843 2452111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24550 2452118 2452420 gene locus_tag LOCUS_24560 2452118 2452420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 2452521 2454080 gene locus_tag LOCUS_24570 2452521 2454080 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_24570 2454181 2455737 gene locus_tag LOCUS_24580 2454181 2455737 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_24580 2456191 2455883 gene locus_tag LOCUS_24590 2456191 2455883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 2456366 2458375 gene locus_tag LOCUS_24600 2456366 2458375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 2458375 2458974 gene locus_tag LOCUS_24610 2458375 2458974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 2459296 2460699 gene locus_tag LOCUS_24620 2459296 2460699 CDS product Trk family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888508.1 protein_id gnl|my_center|LOCUS_24620 2460718 2461392 gene locus_tag LOCUS_24630 gene ktrA 2460718 2461392 CDS product potassium uptake transporter gating subunit KtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002991064.1 protein_id gnl|my_center|LOCUS_24630 2461463 2462140 gene locus_tag LOCUS_24640 2461463 2462140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 2462247 2463707 gene locus_tag LOCUS_24650 2462247 2463707 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214229.1 protein_id gnl|my_center|LOCUS_24650 2463711 2464880 gene locus_tag LOCUS_24660 2463711 2464880 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943065.1 protein_id gnl|my_center|LOCUS_24660 2464902 2466713 gene locus_tag LOCUS_24670 2464902 2466713 CDS product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808599.1 protein_id gnl|my_center|LOCUS_24670 2466735 2467373 gene locus_tag LOCUS_24680 2466735 2467373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 2469803 2467428 gene locus_tag LOCUS_24690 2469803 2467428 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678883.1 protein_id gnl|my_center|LOCUS_24690 2470957 2469818 gene locus_tag LOCUS_24700 2470957 2469818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 2471190 2472254 gene locus_tag LOCUS_24710 2471190 2472254 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966309.1 protein_id gnl|my_center|LOCUS_24710 2472592 2473353 gene locus_tag LOCUS_24720 2472592 2473353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 2473515 2474069 gene locus_tag LOCUS_24730 2473515 2474069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 2475326 2474232 gene locus_tag LOCUS_24740 2475326 2474232 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808364.1 protein_id gnl|my_center|LOCUS_24740 2477400 2475406 gene locus_tag LOCUS_24750 2477400 2475406 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986666.1 protein_id gnl|my_center|LOCUS_24750 2477525 2478124 gene locus_tag LOCUS_24760 2477525 2478124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 2478293 2478463 gene locus_tag LOCUS_24770 2478293 2478463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 2479493 2479008 gene locus_tag LOCUS_24780 2479493 2479008 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948046.1 protein_id gnl|my_center|LOCUS_24780 2479615 2480604 gene locus_tag LOCUS_24790 2479615 2480604 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896952.1 protein_id gnl|my_center|LOCUS_24790 2480623 2482182 gene locus_tag LOCUS_24800 2480623 2482182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 2482427 2484370 gene locus_tag LOCUS_24810 2482427 2484370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 2484339 2485820 gene locus_tag LOCUS_24820 2484339 2485820 CDS product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896953.1 protein_id gnl|my_center|LOCUS_24820 2485831 2486808 gene locus_tag LOCUS_24830 2485831 2486808 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439483.1 protein_id gnl|my_center|LOCUS_24830 2487414 2486845 gene locus_tag LOCUS_24840 2487414 2486845 CDS product DUF6434 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247875.1 protein_id gnl|my_center|LOCUS_24840 2487977 2493799 gene locus_tag LOCUS_24850 2487977 2493799 CDS product endo-alpha-N-acetylgalactosaminidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207553109.1 protein_id gnl|my_center|LOCUS_24850 2493899 2494603 gene locus_tag LOCUS_24860 2493899 2494603 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948727.1 protein_id gnl|my_center|LOCUS_24860 2494897 2495067 gene locus_tag LOCUS_24870 2494897 2495067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 2495135 2496070 gene locus_tag LOCUS_24880 2495135 2496070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 2496063 2497169 gene locus_tag LOCUS_24890 2496063 2497169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 2497180 2498043 gene locus_tag LOCUS_24900 2497180 2498043 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861379.1 protein_id gnl|my_center|LOCUS_24900 2498040 2499221 gene locus_tag LOCUS_24910 2498040 2499221 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861380.1 protein_id gnl|my_center|LOCUS_24910 2499178 2501292 gene locus_tag LOCUS_24920 2499178 2501292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 2501487 2501400 gene locus_tag LOCUS_t00230 2501487 2501400 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2501569 2501496 gene locus_tag LOCUS_t00240 2501569 2501496 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 2501831 2502889 gene locus_tag LOCUS_24930 2501831 2502889 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867962.1 protein_id gnl|my_center|LOCUS_24930 2502886 2503599 gene locus_tag LOCUS_24940 2502886 2503599 CDS product phosphocholine cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767813.1 protein_id gnl|my_center|LOCUS_24940 2504130 2503588 gene locus_tag LOCUS_24950 2504130 2503588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 2504320 2505297 gene locus_tag LOCUS_24960 2504320 2505297 CDS product putative 2-aminoethylphosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861761.1 protein_id gnl|my_center|LOCUS_24960 2505285 2506070 gene locus_tag LOCUS_24970 2505285 2506070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 2506060 2507643 gene locus_tag LOCUS_24980 2506060 2507643 CDS product putative 2-aminoethylphosphonate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861730.1 protein_id gnl|my_center|LOCUS_24980 2507738 2508115 gene locus_tag LOCUS_24990 2507738 2508115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 2508167 2508874 gene locus_tag LOCUS_25000 2508167 2508874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 2508893 2509366 gene locus_tag LOCUS_25010 2508893 2509366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009368.1 protein_id gnl|my_center|LOCUS_25010 2509384 2509698 gene locus_tag LOCUS_25020 2509384 2509698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 2509725 2510144 gene locus_tag LOCUS_25030 2509725 2510144 CDS product DUF3788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888119.1 protein_id gnl|my_center|LOCUS_25030 2510812 2510153 gene locus_tag LOCUS_25040 2510812 2510153 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811882.1 protein_id gnl|my_center|LOCUS_25040 2511135 2510809 gene locus_tag LOCUS_25050 2511135 2510809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 2511101 2511436 gene locus_tag LOCUS_25060 2511101 2511436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 2511441 2511752 gene locus_tag LOCUS_25070 2511441 2511752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25070 2511768 2511938 gene locus_tag LOCUS_25080 2511768 2511938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 2511950 2512456 gene locus_tag LOCUS_25090 2511950 2512456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 2512682 2513011 gene locus_tag LOCUS_25100 2512682 2513011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 2513039 2514112 gene locus_tag LOCUS_25110 2513039 2514112 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860887.1 protein_id gnl|my_center|LOCUS_25110 2514189 2515094 gene locus_tag LOCUS_25120 2514189 2515094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 2515103 2515378 gene locus_tag LOCUS_25130 2515103 2515378 CDS product DUF1905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814546.1 protein_id gnl|my_center|LOCUS_25130 2515425 2515628 gene locus_tag LOCUS_25140 2515425 2515628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 2515742 2516965 gene locus_tag LOCUS_25150 2515742 2516965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 2517775 2516993 gene locus_tag LOCUS_25160 2517775 2516993 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949104.1 protein_id gnl|my_center|LOCUS_25160 2517890 2520058 gene locus_tag LOCUS_25170 gene priA 2517890 2520058 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560839.1 protein_id gnl|my_center|LOCUS_25170 2520062 2520838 gene locus_tag LOCUS_25180 2520062 2520838 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183363.1 protein_id gnl|my_center|LOCUS_25180 2520835 2522076 gene locus_tag LOCUS_25190 gene rsmB 2520835 2522076 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249665.1 protein_id gnl|my_center|LOCUS_25190 2522079 2522468 gene locus_tag LOCUS_25200 2522079 2522468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 2522611 2523297 gene locus_tag LOCUS_25210 2522611 2523297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 2523609 2523385 gene locus_tag LOCUS_25220 2523609 2523385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 2523853 2525253 gene locus_tag LOCUS_25230 2523853 2525253 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891177.1 protein_id gnl|my_center|LOCUS_25230 2525246 2526577 gene locus_tag LOCUS_25240 2525246 2526577 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898040.1 protein_id gnl|my_center|LOCUS_25240 2528579 2526639 gene locus_tag LOCUS_25250 2528579 2526639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 2528688 2529359 gene locus_tag LOCUS_25260 2528688 2529359 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732773.1 protein_id gnl|my_center|LOCUS_25260 2529488 2530198 gene locus_tag LOCUS_25270 2529488 2530198 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941430.1 protein_id gnl|my_center|LOCUS_25270 2530195 2530497 gene locus_tag LOCUS_25280 2530195 2530497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 2530826 2530494 gene locus_tag LOCUS_25290 2530826 2530494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 2531921 2531166 gene locus_tag LOCUS_25300 gene kduD 2531921 2531166 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210830.1 protein_id gnl|my_center|LOCUS_25300 2532056 2532430 gene locus_tag LOCUS_25310 2532056 2532430 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424232.1 protein_id gnl|my_center|LOCUS_25310 2532433 2533293 gene locus_tag LOCUS_25320 2532433 2533293 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897173.1 protein_id gnl|my_center|LOCUS_25320 2533290 2533937 gene locus_tag LOCUS_25330 2533290 2533937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 2534075 2534452 gene locus_tag LOCUS_25340 2534075 2534452 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948844.1 protein_id gnl|my_center|LOCUS_25340 2534439 2535302 gene locus_tag LOCUS_25350 2534439 2535302 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948845.1 protein_id gnl|my_center|LOCUS_25350 2535299 2536009 gene locus_tag LOCUS_25360 2535299 2536009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948846.1 protein_id gnl|my_center|LOCUS_25360 2536485 2536036 gene locus_tag LOCUS_25370 2536485 2536036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 2536686 2536489 gene locus_tag LOCUS_25380 2536686 2536489 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438035.1 protein_id gnl|my_center|LOCUS_25380 2536836 2537339 gene locus_tag LOCUS_25390 2536836 2537339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 2537744 2537385 gene locus_tag LOCUS_25400 2537744 2537385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 2538694 2537879 gene locus_tag LOCUS_25410 2538694 2537879 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986494.1 protein_id gnl|my_center|LOCUS_25410 2538784 2540514 gene locus_tag LOCUS_25420 2538784 2540514 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897981.1 protein_id gnl|my_center|LOCUS_25420 2540507 2542297 gene locus_tag LOCUS_25430 2540507 2542297 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426617.1 protein_id gnl|my_center|LOCUS_25430 2542654 2542959 gene locus_tag LOCUS_25440 2542654 2542959 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931180.1 protein_id gnl|my_center|LOCUS_25440 2543017 2544441 gene locus_tag LOCUS_25450 2543017 2544441 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775705.1 protein_id gnl|my_center|LOCUS_25450 2544528 2544839 gene locus_tag LOCUS_25460 2544528 2544839 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134124.1 protein_id gnl|my_center|LOCUS_25460 2544863 2545093 gene locus_tag LOCUS_25470 2544863 2545093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722067.1 protein_id gnl|my_center|LOCUS_25470 2545183 2545374 gene locus_tag LOCUS_25480 2545183 2545374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 2545387 2545887 gene locus_tag LOCUS_25490 2545387 2545887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 2545908 2546993 gene locus_tag LOCUS_25500 2545908 2546993 CDS product DUF871 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253349.1 protein_id gnl|my_center|LOCUS_25500 2547017 2547691 gene locus_tag LOCUS_25510 2547017 2547691 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861086.1 protein_id gnl|my_center|LOCUS_25510 2547784 2548737 gene locus_tag LOCUS_25520 2547784 2548737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 2548771 2550306 gene locus_tag LOCUS_25530 gene cls 2548771 2550306 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966588.1 protein_id gnl|my_center|LOCUS_25530 2550417 2551274 gene locus_tag LOCUS_25540 2550417 2551274 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389614.1 protein_id gnl|my_center|LOCUS_25540 2551342 2551821 gene locus_tag LOCUS_25550 gene ndk 2551342 2551821 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438314.1 protein_id gnl|my_center|LOCUS_25550 2551885 2552292 gene locus_tag LOCUS_25560 2551885 2552292 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814133.1 protein_id gnl|my_center|LOCUS_25560 2552285 2554129 gene locus_tag LOCUS_25570 2552285 2554129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 2554186 2555502 gene locus_tag LOCUS_25580 2554186 2555502 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562821.1 protein_id gnl|my_center|LOCUS_25580 2556448 2555516 gene locus_tag LOCUS_25590 2556448 2555516 CDS product YwqG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815259.1 protein_id gnl|my_center|LOCUS_25590 2556830 2557492 gene locus_tag LOCUS_25600 2556830 2557492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 2557482 2559824 gene locus_tag LOCUS_25610 2557482 2559824 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903830.1 protein_id gnl|my_center|LOCUS_25610 2559818 2559997 gene locus_tag LOCUS_25620 2559818 2559997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 2560215 2561669 gene locus_tag LOCUS_25630 2560215 2561669 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963614.1 protein_id gnl|my_center|LOCUS_25630 2561746 2562297 gene locus_tag LOCUS_25640 2561746 2562297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359842.1 protein_id gnl|my_center|LOCUS_25640 2562475 2563317 gene locus_tag LOCUS_25650 2562475 2563317 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440056.1 protein_id gnl|my_center|LOCUS_25650 2563446 2565350 gene locus_tag LOCUS_25660 2563446 2565350 CDS product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861834.1 protein_id gnl|my_center|LOCUS_25660 2565361 2566788 gene locus_tag LOCUS_25670 2565361 2566788 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021359802.1 protein_id gnl|my_center|LOCUS_25670 2567020 2567469 gene locus_tag LOCUS_25680 2567020 2567469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 2567485 2568027 gene locus_tag LOCUS_25690 2567485 2568027 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987052.1 protein_id gnl|my_center|LOCUS_25690 2569571 2568192 gene locus_tag LOCUS_25700 2569571 2568192 CDS product ISNCY family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589001.1 protein_id gnl|my_center|LOCUS_25700 2569887 2570720 gene locus_tag LOCUS_25710 gene licT 2569887 2570720 CDS product transcriptional antiterminator LicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242598.1 protein_id gnl|my_center|LOCUS_25710 2570823 2572664 gene locus_tag LOCUS_25720 2570823 2572664 CDS product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990065.1 protein_id gnl|my_center|LOCUS_25720 2572677 2574158 gene locus_tag LOCUS_25730 2572677 2574158 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431416.1 protein_id gnl|my_center|LOCUS_25730 2574728 2574195 gene locus_tag LOCUS_25740 2574728 2574195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 2575129 2574740 gene locus_tag LOCUS_25750 2575129 2574740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 2575630 2575220 gene locus_tag LOCUS_25760 2575630 2575220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 2576632 2575757 gene locus_tag LOCUS_25770 2576632 2575757 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_25770 2576807 2577970 gene locus_tag LOCUS_25780 2576807 2577970 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897308.1 protein_id gnl|my_center|LOCUS_25780 2577989 2578672 gene locus_tag LOCUS_25790 2577989 2578672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 2578715 2579938 gene locus_tag LOCUS_25800 2578715 2579938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 2581735 2579963 gene locus_tag LOCUS_25810 2581735 2579963 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459675.1 protein_id gnl|my_center|LOCUS_25810 2583441 2581834 gene locus_tag LOCUS_25820 2583441 2581834 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064987.1 protein_id gnl|my_center|LOCUS_25820 2583747 2586011 gene locus_tag LOCUS_25830 gene pcrA 2583747 2586011 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233919.1 protein_id gnl|my_center|LOCUS_25830 2586021 2588000 gene locus_tag LOCUS_25840 gene ligA 2586021 2588000 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233916.1 protein_id gnl|my_center|LOCUS_25840 2588002 2589102 gene locus_tag LOCUS_25850 2588002 2589102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 2589134 2589427 gene locus_tag LOCUS_25860 2589134 2589427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 2589429 2590850 gene locus_tag LOCUS_25870 2589429 2590850 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166930.1 protein_id gnl|my_center|LOCUS_25870 2590847 2592271 gene locus_tag LOCUS_25880 gene gatB 2590847 2592271 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219444.1 protein_id gnl|my_center|LOCUS_25880 2592319 2592924 gene locus_tag LOCUS_25890 2592319 2592924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 2592956 2594281 gene locus_tag LOCUS_25900 gene rlmD 2592956 2594281 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233892.1 protein_id gnl|my_center|LOCUS_25900 2594421 2594864 gene locus_tag LOCUS_25910 2594421 2594864 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868208.1 protein_id gnl|my_center|LOCUS_25910 2594861 2595328 gene locus_tag LOCUS_25920 2594861 2595328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 2595321 2596163 gene locus_tag LOCUS_25930 2595321 2596163 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170849.1 protein_id gnl|my_center|LOCUS_25930 2596163 2596840 gene locus_tag LOCUS_25940 2596163 2596840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 2596956 2597168 gene locus_tag LOCUS_25950 2596956 2597168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 2597165 2597530 gene locus_tag LOCUS_25960 2597165 2597530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 2597552 2598451 gene locus_tag LOCUS_25970 2597552 2598451 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289172.1 protein_id gnl|my_center|LOCUS_25970 2598463 2598756 gene locus_tag LOCUS_25980 2598463 2598756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 2598699 2599094 gene locus_tag LOCUS_25990 2598699 2599094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 2599129 2599587 gene locus_tag LOCUS_26000 2599129 2599587 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680818.1 protein_id gnl|my_center|LOCUS_26000 2599979 2601835 gene locus_tag LOCUS_26010 2599979 2601835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 2601840 2603240 gene locus_tag LOCUS_26020 2601840 2603240 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890696.1 protein_id gnl|my_center|LOCUS_26020 2604248 2603274 gene locus_tag LOCUS_26030 2604248 2603274 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643055.1 protein_id gnl|my_center|LOCUS_26030 2604439 2605710 gene locus_tag LOCUS_26040 2604439 2605710 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643054.1 protein_id gnl|my_center|LOCUS_26040 2605729 2607315 gene locus_tag LOCUS_26050 2605729 2607315 CDS product alpha-L-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102178.1 protein_id gnl|my_center|LOCUS_26050 2607321 2608688 gene locus_tag LOCUS_26060 2607321 2608688 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966692.1 protein_id gnl|my_center|LOCUS_26060 2608834 2609043 gene locus_tag LOCUS_26070 2608834 2609043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 2609118 2609513 gene locus_tag LOCUS_26080 2609118 2609513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 2609531 2609953 gene locus_tag LOCUS_26090 2609531 2609953 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764905.1 protein_id gnl|my_center|LOCUS_26090 2609950 2610528 gene locus_tag LOCUS_26100 2609950 2610528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 2610870 2612750 gene locus_tag LOCUS_26110 2610870 2612750 CDS product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437576.1 protein_id gnl|my_center|LOCUS_26110 2612770 2614185 gene locus_tag LOCUS_26120 2612770 2614185 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379465.1 protein_id gnl|my_center|LOCUS_26120 2614251 2615120 gene locus_tag LOCUS_26130 2614251 2615120 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454252.1 protein_id gnl|my_center|LOCUS_26130 2615111 2616295 gene locus_tag LOCUS_26140 2615111 2616295 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860963.1 protein_id gnl|my_center|LOCUS_26140 2616539 2618197 gene locus_tag LOCUS_26150 2616539 2618197 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788903.1 protein_id gnl|my_center|LOCUS_26150 2618267 2618680 gene locus_tag LOCUS_26160 2618267 2618680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 2618857 2620017 gene locus_tag LOCUS_26170 2618857 2620017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 2621287 2620052 gene locus_tag LOCUS_26180 gene hflX 2621287 2620052 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393283.1 protein_id gnl|my_center|LOCUS_26180 2621538 2622899 gene locus_tag LOCUS_26190 2621538 2622899 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015670.1 protein_id gnl|my_center|LOCUS_26190 2624060 2623056 gene locus_tag LOCUS_26200 gene asrC 2624060 2623056 CDS product sulfite reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706397.1 protein_id gnl|my_center|LOCUS_26200 2624876 2624073 gene locus_tag LOCUS_26210 gene asrB 2624876 2624073 CDS product anaerobic sulfite reductase subunit AsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948642.1 protein_id gnl|my_center|LOCUS_26210 2625910 2624873 gene locus_tag LOCUS_26220 gene asrA 2625910 2624873 CDS product anaerobic sulfite reductase subunit AsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948641.1 protein_id gnl|my_center|LOCUS_26220 2626255 2627193 gene locus_tag LOCUS_26230 gene nadA 2626255 2627193 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016069.1 protein_id gnl|my_center|LOCUS_26230 2627220 2628401 gene locus_tag LOCUS_26240 2627220 2628401 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016070.1 protein_id gnl|my_center|LOCUS_26240 2628406 2629260 gene locus_tag LOCUS_26250 gene nadC 2628406 2629260 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016071.1 protein_id gnl|my_center|LOCUS_26250 2629301 2629858 gene locus_tag LOCUS_26260 2629301 2629858 CDS product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016072.1 protein_id gnl|my_center|LOCUS_26260 2629960 2630397 gene locus_tag LOCUS_26270 2629960 2630397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 2631022 2630462 gene locus_tag LOCUS_26280 2631022 2630462 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986729.1 protein_id gnl|my_center|LOCUS_26280 2631170 2631784 gene locus_tag LOCUS_26290 2631170 2631784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 2632000 2631839 gene locus_tag LOCUS_26300 2632000 2631839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 2632996 2632061 gene locus_tag LOCUS_26310 2632996 2632061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 2634026 2634250 gene locus_tag LOCUS_26320 gene acpP 2634026 2634250 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362599.1 protein_id gnl|my_center|LOCUS_26320 2634295 2634732 gene locus_tag LOCUS_26330 gene accB 2634295 2634732 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966835.1 protein_id gnl|my_center|LOCUS_26330 2634729 2636093 gene locus_tag LOCUS_26340 2634729 2636093 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966833.1 protein_id gnl|my_center|LOCUS_26340 2636077 2636961 gene locus_tag LOCUS_26350 gene accD 2636077 2636961 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471571.1 protein_id gnl|my_center|LOCUS_26350 2636942 2637877 gene locus_tag LOCUS_26360 gene accA 2636942 2637877 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818803.1 protein_id gnl|my_center|LOCUS_26360 2637864 2638838 gene locus_tag LOCUS_26370 2637864 2638838 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966841.1 protein_id gnl|my_center|LOCUS_26370 2638852 2639805 gene locus_tag LOCUS_26380 2638852 2639805 CDS product DUF561 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722294.1 protein_id gnl|my_center|LOCUS_26380 2639795 2640844 gene locus_tag LOCUS_26390 2639795 2640844 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966843.1 protein_id gnl|my_center|LOCUS_26390 2640860 2641786 gene locus_tag LOCUS_26400 gene fabD 2640860 2641786 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048428.1 protein_id gnl|my_center|LOCUS_26400 2641791 2642522 gene locus_tag LOCUS_26410 gene fabG 2641791 2642522 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830161.1 protein_id gnl|my_center|LOCUS_26410 2642523 2643758 gene locus_tag LOCUS_26420 gene fabF 2642523 2643758 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966836.1 protein_id gnl|my_center|LOCUS_26420 2643762 2644190 gene locus_tag LOCUS_26430 gene fabZ 2643762 2644190 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931959.1 protein_id gnl|my_center|LOCUS_26430 2644192 2644854 gene locus_tag LOCUS_26440 2644192 2644854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 2644857 2645201 gene locus_tag LOCUS_26450 gene acpS 2644857 2645201 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583416.1 protein_id gnl|my_center|LOCUS_26450 2645205 2645897 gene locus_tag LOCUS_26460 2645205 2645897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 2646498 2645956 gene locus_tag LOCUS_26470 2646498 2645956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681722.1 protein_id gnl|my_center|LOCUS_26470 2647458 2646574 gene locus_tag LOCUS_26480 2647458 2646574 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183854.1 protein_id gnl|my_center|LOCUS_26480 2648005 2647622 gene locus_tag LOCUS_26490 2648005 2647622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 2649356 2648007 gene locus_tag LOCUS_26500 2649356 2648007 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814884.1 protein_id gnl|my_center|LOCUS_26500 2649702 2651042 gene locus_tag LOCUS_26510 2649702 2651042 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387350.1 protein_id gnl|my_center|LOCUS_26510 2652277 2651354 gene locus_tag LOCUS_26520 2652277 2651354 CDS product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966649.1 protein_id gnl|my_center|LOCUS_26520 2652402 2652983 gene locus_tag LOCUS_26530 2652402 2652983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 2653061 2655070 gene locus_tag LOCUS_26540 2653061 2655070 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949010.1 protein_id gnl|my_center|LOCUS_26540 2655147 2655467 gene locus_tag LOCUS_26550 2655147 2655467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 2655765 2655511 gene locus_tag LOCUS_26560 2655765 2655511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 2656011 2655936 gene locus_tag LOCUS_t00250 2656011 2655936 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 2656933 2656079 gene locus_tag LOCUS_26570 2656933 2656079 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296415.1 protein_id gnl|my_center|LOCUS_26570 2657085 2657010 gene locus_tag LOCUS_t00260 2657085 2657010 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2657298 2658293 gene locus_tag LOCUS_26580 2657298 2658293 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549977.1 protein_id gnl|my_center|LOCUS_26580 2658914 2659444 gene locus_tag LOCUS_26590 2658914 2659444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 2659410 2659829 gene locus_tag LOCUS_26600 2659410 2659829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 2660566 2659880 gene locus_tag LOCUS_26610 2660566 2659880 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461351.1 protein_id gnl|my_center|LOCUS_26610 2662064 2660559 gene locus_tag LOCUS_26620 2662064 2660559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 2663581 2662103 gene locus_tag LOCUS_26630 2663581 2662103 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080375.1 protein_id gnl|my_center|LOCUS_26630 2664248 2663586 gene locus_tag LOCUS_26640 2664248 2663586 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080380.1 protein_id gnl|my_center|LOCUS_26640 2664688 2664245 gene locus_tag LOCUS_26650 2664688 2664245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 2665662 2664814 gene locus_tag LOCUS_26660 2665662 2664814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 2665832 2667004 gene locus_tag LOCUS_26670 2665832 2667004 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_26670 2668437 2667073 gene locus_tag LOCUS_26680 gene fumC 2668437 2667073 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160526.1 protein_id gnl|my_center|LOCUS_26680 2668840 2668556 gene locus_tag LOCUS_26690 2668840 2668556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 2669693 2669133 gene locus_tag LOCUS_26700 2669693 2669133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 2669819 2670742 gene locus_tag LOCUS_26710 2669819 2670742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 2670803 2671036 gene locus_tag LOCUS_26720 2670803 2671036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 2671085 2671564 gene locus_tag LOCUS_26730 2671085 2671564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 2672117 2671608 gene locus_tag LOCUS_26740 2672117 2671608 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434028.1 protein_id gnl|my_center|LOCUS_26740 2672242 2672931 gene locus_tag LOCUS_26750 2672242 2672931 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815292.1 protein_id gnl|my_center|LOCUS_26750 2672988 2673491 gene locus_tag LOCUS_26760 2672988 2673491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 2673678 2674478 gene locus_tag LOCUS_26770 2673678 2674478 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294342.1 protein_id gnl|my_center|LOCUS_26770 2674607 2676859 gene locus_tag LOCUS_26780 gene glgP 2674607 2676859 CDS product glycogen/starch/alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837657.1 protein_id gnl|my_center|LOCUS_26780 2676872 2678344 gene locus_tag LOCUS_26790 gene malQ 2676872 2678344 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003028948.1 protein_id gnl|my_center|LOCUS_26790 2679751 2678381 gene locus_tag LOCUS_26800 2679751 2678381 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048385.1 protein_id gnl|my_center|LOCUS_26800 2680023 2681339 gene locus_tag LOCUS_26810 2680023 2681339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 2681404 2682591 gene locus_tag LOCUS_26820 2681404 2682591 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887601.1 protein_id gnl|my_center|LOCUS_26820 2682733 2682808 gene locus_tag LOCUS_t00270 2682733 2682808 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2682946 2683275 gene locus_tag LOCUS_26830 2682946 2683275 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669619.1 protein_id gnl|my_center|LOCUS_26830 2683259 2683882 gene locus_tag LOCUS_26840 2683259 2683882 CDS product DUF1700 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922782.1 protein_id gnl|my_center|LOCUS_26840 2683869 2684693 gene locus_tag LOCUS_26850 2683869 2684693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 2684699 2685814 gene locus_tag LOCUS_26860 2684699 2685814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440269.1 protein_id gnl|my_center|LOCUS_26860 2687502 2685832 gene locus_tag LOCUS_26870 2687502 2685832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 2688010 2687600 gene locus_tag LOCUS_26880 2688010 2687600 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363085.1 protein_id gnl|my_center|LOCUS_26880 2688455 2688063 gene locus_tag LOCUS_26890 2688455 2688063 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363085.1 protein_id gnl|my_center|LOCUS_26890 2688876 2688478 gene locus_tag LOCUS_26900 2688876 2688478 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363085.1 protein_id gnl|my_center|LOCUS_26900 2690324 2689104 gene locus_tag LOCUS_26910 2690324 2689104 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610375.1 protein_id gnl|my_center|LOCUS_26910 2690623 2690429 gene locus_tag LOCUS_26920 2690623 2690429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 2691312 2691079 gene locus_tag LOCUS_26930 2691312 2691079 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860747.1 protein_id gnl|my_center|LOCUS_26930 2691728 2691309 gene locus_tag LOCUS_26940 2691728 2691309 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804885.1 protein_id gnl|my_center|LOCUS_26940 2692250 2692609 gene locus_tag LOCUS_26950 2692250 2692609 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861423.1 protein_id gnl|my_center|LOCUS_26950 2694077 2692716 gene locus_tag LOCUS_26960 2694077 2692716 CDS product two-component system sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861185.1 protein_id gnl|my_center|LOCUS_26960 2694727 2694059 gene locus_tag LOCUS_26970 2694727 2694059 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405372.1 protein_id gnl|my_center|LOCUS_26970 2695493 2694741 gene locus_tag LOCUS_26980 2695493 2694741 CDS product lantibiotic immunity ABC transporter MutG family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860831.1 protein_id gnl|my_center|LOCUS_26980 2696253 2695495 gene locus_tag LOCUS_26990 2696253 2695495 CDS product lantibiotic immunity ABC transporter MutE/EpiE family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888312.1 protein_id gnl|my_center|LOCUS_26990 2696950 2696246 gene locus_tag LOCUS_27000 2696950 2696246 CDS product lantibiotic protection ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986262.1 protein_id gnl|my_center|LOCUS_27000 2697319 2697095 gene locus_tag LOCUS_27010 2697319 2697095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860757.1 protein_id gnl|my_center|LOCUS_27010 2697659 2697339 gene locus_tag LOCUS_27020 2697659 2697339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 2698132 2697815 gene locus_tag LOCUS_27030 2698132 2697815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 2698353 2698129 gene locus_tag LOCUS_27040 2698353 2698129 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381292.1 protein_id gnl|my_center|LOCUS_27040 2699391 2698480 gene locus_tag LOCUS_27050 2699391 2698480 CDS product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860758.1 protein_id gnl|my_center|LOCUS_27050 2700414 2699407 gene locus_tag LOCUS_27060 2700414 2699407 CDS product bifunctional lysozyme/C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860759.1 protein_id gnl|my_center|LOCUS_27060 2702612 2700411 gene locus_tag LOCUS_27070 2702612 2700411 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860760.1 protein_id gnl|my_center|LOCUS_27070 2705062 2702612 gene locus_tag LOCUS_27080 2705062 2702612 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861947.1 protein_id gnl|my_center|LOCUS_27080 2705438 2705040 gene locus_tag LOCUS_27090 2705438 2705040 CDS product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004843362.1 protein_id gnl|my_center|LOCUS_27090 2705592 2705425 gene locus_tag LOCUS_27100 2705592 2705425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 2706058 2705555 gene locus_tag LOCUS_27110 2706058 2705555 CDS product antirestriction protein ArdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861949.1 protein_id gnl|my_center|LOCUS_27110 2706579 2706076 gene locus_tag LOCUS_27120 2706579 2706076 CDS product antirestriction protein ArdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861950.1 protein_id gnl|my_center|LOCUS_27120 2706794 2706498 gene locus_tag LOCUS_27130 2706794 2706498 CDS product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860764.1 protein_id gnl|my_center|LOCUS_27130 2707624 2706899 gene locus_tag LOCUS_27140 2707624 2706899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 2707926 2707705 gene locus_tag LOCUS_27150 2707926 2707705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009265886.1 protein_id gnl|my_center|LOCUS_27150 2708061 2707927 gene locus_tag LOCUS_27160 2708061 2707927 CDS product DUF3789 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860765.1 protein_id gnl|my_center|LOCUS_27160 2709270 2708074 gene locus_tag LOCUS_27170 gene mobT 2709270 2708074 CDS product MobT family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861953.1 protein_id gnl|my_center|LOCUS_27170 2710848 2709454 gene locus_tag LOCUS_27180 2710848 2709454 CDS product cell division protein FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861954.1 protein_id gnl|my_center|LOCUS_27180 2711338 2710922 gene locus_tag LOCUS_27190 2711338 2710922 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948540.1 protein_id gnl|my_center|LOCUS_27190 2711797 2711414 gene locus_tag LOCUS_27200 2711797 2711414 CDS product YdcP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861955.1 protein_id gnl|my_center|LOCUS_27200 2712139 2711813 gene locus_tag LOCUS_27210 2712139 2711813 CDS product YdcP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861956.1 protein_id gnl|my_center|LOCUS_27210 2715427 2712383 gene locus_tag LOCUS_27220 2715427 2712383 CDS product SrtB-anchored collagen-binding adhesin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861958.1 protein_id gnl|my_center|LOCUS_27220 2716653 2715775 gene locus_tag LOCUS_27230 2716653 2715775 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086430.1 protein_id gnl|my_center|LOCUS_27230 2716767 2716964 gene locus_tag LOCUS_27240 2716767 2716964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 2717817 2716972 gene locus_tag LOCUS_27250 2717817 2716972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 2718491 2717814 gene locus_tag LOCUS_27260 2718491 2717814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 2719877 2718660 gene locus_tag LOCUS_27270 2719877 2718660 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291561.1 protein_id gnl|my_center|LOCUS_27270 2720162 2719959 gene locus_tag LOCUS_27280 2720162 2719959 CDS product excisionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814511.1 protein_id gnl|my_center|LOCUS_27280 2720853 2720623 gene locus_tag LOCUS_27290 2720853 2720623 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857133.1 protein_id gnl|my_center|LOCUS_27290 2721272 2720850 gene locus_tag LOCUS_27300 2721272 2720850 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804885.1 protein_id gnl|my_center|LOCUS_27300 2721777 2722130 gene locus_tag LOCUS_27310 2721777 2722130 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227347.1 protein_id gnl|my_center|LOCUS_27310 2724395 2722476 gene locus_tag LOCUS_27320 gene tet(M) 2724395 2722476 CDS product tetracycline resistance ribosomal protection protein Tet(M) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691727.1 protein_id gnl|my_center|LOCUS_27320 2725686 2724772 gene locus_tag LOCUS_27330 2725686 2724772 CDS product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001224318.1 protein_id gnl|my_center|LOCUS_27330 2726702 2725701 gene locus_tag LOCUS_27340 2726702 2725701 CDS product bifunctional lysozyme/C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769868.1 protein_id gnl|my_center|LOCUS_27340 2728882 2726699 gene locus_tag LOCUS_27350 2728882 2726699 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804748.1 protein_id gnl|my_center|LOCUS_27350 2731332 2728885 gene locus_tag LOCUS_27360 2731332 2728885 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331160.1 protein_id gnl|my_center|LOCUS_27360 2731708 2731316 gene locus_tag LOCUS_27370 2731708 2731316 CDS product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506270.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27370 2732292 2731795 gene locus_tag LOCUS_27380 2732292 2731795 CDS product antirestriction protein ArdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342539.1 protein_id gnl|my_center|LOCUS_27380 2732632 2732411 gene locus_tag LOCUS_27390 2732632 2732411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009056.1 protein_id gnl|my_center|LOCUS_27390 2733880 2732675 gene locus_tag LOCUS_27400 gene mobT 2733880 2732675 CDS product MobT family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000398284.1 protein_id gnl|my_center|LOCUS_27400 2735443 2734058 gene locus_tag LOCUS_27410 2735443 2734058 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813488.1 protein_id gnl|my_center|LOCUS_27410 2735858 2735472 gene locus_tag LOCUS_27420 2735858 2735472 CDS product YdcP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985015.1 protein_id gnl|my_center|LOCUS_27420 2736188 2735874 gene locus_tag LOCUS_27430 2736188 2735874 CDS product YdcP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000420682.1 protein_id gnl|my_center|LOCUS_27430 2737091 2736504 gene locus_tag LOCUS_27440 2737091 2736504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 2737244 2737609 gene locus_tag LOCUS_27450 2737244 2737609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 2737680 2738345 gene locus_tag LOCUS_27460 2737680 2738345 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461502.1 protein_id gnl|my_center|LOCUS_27460 2738404 2739357 gene locus_tag LOCUS_27470 2738404 2739357 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221977.1 protein_id gnl|my_center|LOCUS_27470 2739338 2740105 gene locus_tag LOCUS_27480 2739338 2740105 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837817.1 protein_id gnl|my_center|LOCUS_27480 2740118 2740408 gene locus_tag LOCUS_27490 2740118 2740408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 2740474 2740605 gene locus_tag LOCUS_27500 2740474 2740605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 2740711 2742282 gene locus_tag LOCUS_27510 gene abc-f 2740711 2742282 CDS product ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150916.1 protein_id gnl|my_center|LOCUS_27510 2742348 2742656 gene locus_tag LOCUS_27520 2742348 2742656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 2742759 2743151 gene locus_tag LOCUS_27530 2742759 2743151 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068146.1 protein_id gnl|my_center|LOCUS_27530 2743212 2743406 gene locus_tag LOCUS_27540 2743212 2743406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 2743728 2744390 gene locus_tag LOCUS_27550 2743728 2744390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 2744558 2745040 gene locus_tag LOCUS_27560 2744558 2745040 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428667.1 protein_id gnl|my_center|LOCUS_27560 2745385 2745303 gene locus_tag LOCUS_t00280 2745385 2745303 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2745609 2746151 gene locus_tag LOCUS_27570 2745609 2746151 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645488.1 protein_id gnl|my_center|LOCUS_27570 2746148 2747107 gene locus_tag LOCUS_27580 2746148 2747107 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966228.1 protein_id gnl|my_center|LOCUS_27580 2747199 2748512 gene locus_tag LOCUS_27590 2747199 2748512 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732326.1 protein_id gnl|my_center|LOCUS_27590 2749739 2748549 gene locus_tag LOCUS_27600 2749739 2748549 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929846.1 protein_id gnl|my_center|LOCUS_27600 2750310 2749777 gene locus_tag LOCUS_27610 2750310 2749777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292012.1 protein_id gnl|my_center|LOCUS_27610 2752297 2750375 gene locus_tag LOCUS_27620 2752297 2750375 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948184.1 protein_id gnl|my_center|LOCUS_27620 2752439 2753773 gene locus_tag LOCUS_27630 2752439 2753773 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276303.1 protein_id gnl|my_center|LOCUS_27630 2753776 2754777 gene locus_tag LOCUS_27640 2753776 2754777 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774414.1 protein_id gnl|my_center|LOCUS_27640 2756095 2754851 gene locus_tag LOCUS_27650 2756095 2754851 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385467.1 protein_id gnl|my_center|LOCUS_27650 2756885 2756082 gene locus_tag LOCUS_27660 gene proB 2756885 2756082 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723561.1 protein_id gnl|my_center|LOCUS_27660 2757070 2759007 gene locus_tag LOCUS_27670 gene htpG 2757070 2759007 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966587.1 protein_id gnl|my_center|LOCUS_27670 2759291 2759530 gene locus_tag LOCUS_27680 2759291 2759530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 2759589 2760200 gene locus_tag LOCUS_27690 2759589 2760200 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081157.1 protein_id gnl|my_center|LOCUS_27690 2760194 2761552 gene locus_tag LOCUS_27700 gene rlmD 2760194 2761552 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722228.1 protein_id gnl|my_center|LOCUS_27700 2761765 2762505 gene locus_tag LOCUS_27710 2761765 2762505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 2762783 2763061 gene locus_tag LOCUS_27720 2762783 2763061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27720 2763181 2764023 gene locus_tag LOCUS_27730 2763181 2764023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27730 2764260 2764805 gene locus_tag LOCUS_27740 2764260 2764805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 2765194 2765850 gene locus_tag LOCUS_27750 2765194 2765850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 2765942 2766646 gene locus_tag LOCUS_27760 2765942 2766646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 2767652 2766669 gene locus_tag LOCUS_27770 2767652 2766669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 2767790 2768107 gene locus_tag LOCUS_27780 2767790 2768107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 2768088 2770175 gene locus_tag LOCUS_27790 2768088 2770175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 2770341 2770754 gene locus_tag LOCUS_27800 2770341 2770754 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705736.1 protein_id gnl|my_center|LOCUS_27800 2770917 2772188 gene locus_tag LOCUS_27810 2770917 2772188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 2772349 2774577 gene locus_tag LOCUS_27820 2772349 2774577 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454973.1 protein_id gnl|my_center|LOCUS_27820 2776564 2774636 gene locus_tag LOCUS_27830 2776564 2774636 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965088.1 protein_id gnl|my_center|LOCUS_27830 2778191 2776671 gene locus_tag LOCUS_27840 2778191 2776671 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895925.1 protein_id gnl|my_center|LOCUS_27840 2778347 2779717 gene locus_tag LOCUS_27850 2778347 2779717 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814295.1 protein_id gnl|my_center|LOCUS_27850 2779717 2780496 gene locus_tag LOCUS_27860 2779717 2780496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 2780498 2781298 gene locus_tag LOCUS_27870 2780498 2781298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 2781410 2781835 gene locus_tag LOCUS_27880 2781410 2781835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 2781911 2782444 gene locus_tag LOCUS_27890 2781911 2782444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 2782503 2783153 gene locus_tag LOCUS_27900 2782503 2783153 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028708.1 protein_id gnl|my_center|LOCUS_27900 2783903 2783136 gene locus_tag LOCUS_27910 2783903 2783136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 2786233 2783900 gene locus_tag LOCUS_27920 2786233 2783900 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930732.1 protein_id gnl|my_center|LOCUS_27920 2786376 2787305 gene locus_tag LOCUS_27930 2786376 2787305 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949019.1 protein_id gnl|my_center|LOCUS_27930 2787421 2788698 gene locus_tag LOCUS_27940 2787421 2788698 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987123.1 protein_id gnl|my_center|LOCUS_27940 2788920 2789231 gene locus_tag LOCUS_27950 2788920 2789231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 2789263 2790303 gene locus_tag LOCUS_27960 2789263 2790303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 2790319 2792247 gene locus_tag LOCUS_27970 2790319 2792247 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869273.1 protein_id gnl|my_center|LOCUS_27970 2792264 2792707 gene locus_tag LOCUS_27980 2792264 2792707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 2792728 2793036 gene locus_tag LOCUS_27990 2792728 2793036 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925114.1 protein_id gnl|my_center|LOCUS_27990 2793047 2793643 gene locus_tag LOCUS_28000 2793047 2793643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 2793684 2795441 gene locus_tag LOCUS_28010 2793684 2795441 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869269.1 protein_id gnl|my_center|LOCUS_28010 2795459 2796901 gene locus_tag LOCUS_28020 2795459 2796901 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869712.1 protein_id gnl|my_center|LOCUS_28020 2796904 2797539 gene locus_tag LOCUS_28030 2796904 2797539 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183773554.1 protein_id gnl|my_center|LOCUS_28030 2797698 2797774 gene locus_tag LOCUS_t00290 2797698 2797774 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2797783 2797859 gene locus_tag LOCUS_t00300 2797783 2797859 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2797870 2797946 gene locus_tag LOCUS_t00310 2797870 2797946 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2797959 2798035 gene locus_tag LOCUS_t00320 2797959 2798035 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2798052 2798142 gene locus_tag LOCUS_t00330 2798052 2798142 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2798180 2798256 gene locus_tag LOCUS_t00340 2798180 2798256 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2798260 2798335 gene locus_tag LOCUS_t00350 2798260 2798335 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 2799538 2798624 gene locus_tag LOCUS_28040 2799538 2798624 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965690.1 protein_id gnl|my_center|LOCUS_28040 2799586 2801307 gene locus_tag LOCUS_28050 2799586 2801307 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965689.1 protein_id gnl|my_center|LOCUS_28050 2801304 2803025 gene locus_tag LOCUS_28060 2801304 2803025 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965688.1 protein_id gnl|my_center|LOCUS_28060 2803139 2804563 gene locus_tag LOCUS_28070 2803139 2804563 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582448.1 protein_id gnl|my_center|LOCUS_28070 2804563 2805813 gene locus_tag LOCUS_28080 2804563 2805813 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016211.1 protein_id gnl|my_center|LOCUS_28080 2805810 2806172 gene locus_tag LOCUS_28090 2805810 2806172 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016210.1 protein_id gnl|my_center|LOCUS_28090 2806177 2806734 gene locus_tag LOCUS_28100 2806177 2806734 CDS product glycerol-3-phosphate responsive antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439577.1 protein_id gnl|my_center|LOCUS_28100 2806731 2808011 gene locus_tag LOCUS_28110 2806731 2808011 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431793.1 protein_id gnl|my_center|LOCUS_28110 2808078 2809283 gene locus_tag LOCUS_28120 2808078 2809283 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027644.1 protein_id gnl|my_center|LOCUS_28120 2809793 2810482 gene locus_tag LOCUS_28130 2809793 2810482 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476421.1 protein_id gnl|my_center|LOCUS_28130 2810489 2811274 gene locus_tag LOCUS_28140 gene cps4B 2810489 2811274 CDS product capsular polysaccharide biosynthesis protein Cps4B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922734.1 protein_id gnl|my_center|LOCUS_28140 2811276 2812007 gene locus_tag LOCUS_28150 2811276 2812007 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986981.1 protein_id gnl|my_center|LOCUS_28150 2811994 2812530 gene locus_tag LOCUS_28160 2811994 2812530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 2812650 2814494 gene locus_tag LOCUS_28170 2812650 2814494 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476102.1 protein_id gnl|my_center|LOCUS_28170 2814500 2815060 gene locus_tag LOCUS_28180 2814500 2815060 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700389.1 protein_id gnl|my_center|LOCUS_28180 2815074 2815694 gene locus_tag LOCUS_28190 2815074 2815694 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902061.1 protein_id gnl|my_center|LOCUS_28190 2815691 2816899 gene locus_tag LOCUS_28200 2815691 2816899 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776619.1 protein_id gnl|my_center|LOCUS_28200 2816886 2817941 gene locus_tag LOCUS_28210 2816886 2817941 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107231.1 protein_id gnl|my_center|LOCUS_28210 2817941 2818801 gene locus_tag LOCUS_28220 2817941 2818801 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202924.1 protein_id gnl|my_center|LOCUS_28220 2818868 2820001 gene locus_tag LOCUS_28230 gene wecB 2818868 2820001 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202262.1 protein_id gnl|my_center|LOCUS_28230 2819998 2821140 gene locus_tag LOCUS_28240 2819998 2821140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 2821464 2822981 gene locus_tag LOCUS_28250 2821464 2822981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 2822978 2824345 gene locus_tag LOCUS_28260 2822978 2824345 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108298.1 protein_id gnl|my_center|LOCUS_28260 2825688 2824504 gene locus_tag LOCUS_28270 2825688 2824504 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006906966.1 protein_id gnl|my_center|LOCUS_28270 2825967 2825767 gene locus_tag LOCUS_28280 2825967 2825767 CDS product excisionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814511.1 protein_id gnl|my_center|LOCUS_28280 2828146 2826932 gene locus_tag LOCUS_28290 gene mobT 2828146 2826932 CDS product MobT family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000398284.1 protein_id gnl|my_center|LOCUS_28290 2828915 2828466 gene locus_tag LOCUS_28300 2828915 2828466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 2829936 2829385 gene locus_tag LOCUS_28310 2829936 2829385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 2830801 2832057 gene locus_tag LOCUS_28320 2830801 2832057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 2832282 2833073 gene locus_tag LOCUS_28330 2832282 2833073 CDS product phosphorylcholine transferase LicD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811992.1 protein_id gnl|my_center|LOCUS_28330 2833098 2833283 gene locus_tag LOCUS_28340 2833098 2833283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 2833246 2833449 gene locus_tag LOCUS_28350 2833246 2833449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28350 2833638 2833799 gene locus_tag LOCUS_28360 2833638 2833799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 2833786 2834139 gene locus_tag LOCUS_28370 2833786 2834139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28370 2835236 2836354 gene locus_tag LOCUS_28380 2835236 2836354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 2836361 2836966 gene locus_tag LOCUS_28390 2836361 2836966 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389905.1 protein_id gnl|my_center|LOCUS_28390 2836963 2837871 gene locus_tag LOCUS_28400 2836963 2837871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 2837884 2839299 gene locus_tag LOCUS_28410 gene cps4A 2837884 2839299 CDS product capsular polysaccharide biosynthesis protein Cps4A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091050.1 protein_id gnl|my_center|LOCUS_28410 2839430 2840077 gene locus_tag LOCUS_28420 2839430 2840077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 2840082 2840816 gene locus_tag LOCUS_28430 2840082 2840816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 2840888 2842387 gene locus_tag LOCUS_28440 2840888 2842387 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656040.1 protein_id gnl|my_center|LOCUS_28440 2842444 2843247 gene locus_tag LOCUS_28450 2842444 2843247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 2843225 2845162 gene locus_tag LOCUS_28460 2843225 2845162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 2845180 2845980 gene locus_tag LOCUS_28470 2845180 2845980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 2846036 2846614 gene locus_tag LOCUS_28480 2846036 2846614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 2846638 2846805 gene locus_tag LOCUS_28490 2846638 2846805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 2846871 2847614 gene locus_tag LOCUS_28500 2846871 2847614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 2847604 2848515 gene locus_tag LOCUS_28510 2847604 2848515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 2848729 2849928 gene locus_tag LOCUS_28520 2848729 2849928 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462283.1 protein_id gnl|my_center|LOCUS_28520 2851437 2850115 gene locus_tag LOCUS_28530 gene kbaZ 2851437 2850115 CDS product tagatose-bisphosphate aldolase subunit KbaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209876.1 protein_id gnl|my_center|LOCUS_28530 2851704 2853044 gene locus_tag LOCUS_28540 2851704 2853044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 2853931 2853050 gene locus_tag LOCUS_28550 2853931 2853050 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216774.1 protein_id gnl|my_center|LOCUS_28550 2854073 2854453 gene locus_tag LOCUS_28560 2854073 2854453 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453642.1 protein_id gnl|my_center|LOCUS_28560 2854528 2855052 gene locus_tag LOCUS_28570 2854528 2855052 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902348.1 protein_id gnl|my_center|LOCUS_28570 2855181 2855579 gene locus_tag LOCUS_28580 2855181 2855579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 2855572 2856831 gene locus_tag LOCUS_28590 2855572 2856831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 2857695 2856838 gene locus_tag LOCUS_28600 2857695 2856838 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966614.1 protein_id gnl|my_center|LOCUS_28600 2858661 2857723 gene locus_tag LOCUS_28610 2858661 2857723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 2858731 2859915 gene locus_tag LOCUS_28620 2858731 2859915 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048277.1 protein_id gnl|my_center|LOCUS_28620 2861517 2860063 gene locus_tag LOCUS_28630 2861517 2860063 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384219.1 protein_id gnl|my_center|LOCUS_28630 2862388 2861618 gene locus_tag LOCUS_28640 gene pgeF 2862388 2861618 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967191.1 protein_id gnl|my_center|LOCUS_28640 2862697 2863710 gene locus_tag LOCUS_28650 gene hrcA 2862697 2863710 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954941.1 protein_id gnl|my_center|LOCUS_28650 2863720 2864355 gene locus_tag LOCUS_28660 2863720 2864355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 2864371 2866182 gene locus_tag LOCUS_28670 gene dnaK 2864371 2866182 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475828.1 protein_id gnl|my_center|LOCUS_28670 2866208 2867416 gene locus_tag LOCUS_28680 2866208 2867416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 2867431 2868546 gene locus_tag LOCUS_28690 gene dnaJ 2867431 2868546 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119021.1 protein_id gnl|my_center|LOCUS_28690 2868793 2869011 gene locus_tag LOCUS_28700 2868793 2869011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 2870411 2871217 gene locus_tag LOCUS_28710 2870411 2871217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 2871388 2873517 gene locus_tag LOCUS_28720 2871388 2873517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 2873519 2876155 gene locus_tag LOCUS_28730 2873519 2876155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 2876158 2879445 gene locus_tag LOCUS_28740 2876158 2879445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 2879435 2881879 gene locus_tag LOCUS_28750 2879435 2881879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 2881899 2882711 gene locus_tag LOCUS_28760 2881899 2882711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 2882708 2885869 gene locus_tag LOCUS_28770 2882708 2885869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 2885871 2886527 gene locus_tag LOCUS_28780 2885871 2886527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 2887382 2888917 gene locus_tag LOCUS_28790 gene dndC 2887382 2888917 CDS product DNA phosphorothioation system sulfurtransferase DndC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109921.1 protein_id gnl|my_center|LOCUS_28790 2888917 2890869 gene locus_tag LOCUS_28800 gene dndD 2888917 2890869 CDS product DNA sulfur modification protein DndD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109923.1 protein_id gnl|my_center|LOCUS_28800 2890866 2891246 gene locus_tag LOCUS_28810 gene dndE 2890866 2891246 CDS product DNA sulfur modification protein DndE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296384.1 protein_id gnl|my_center|LOCUS_28810 2891253 2892401 gene locus_tag LOCUS_28820 gene dndA 2891253 2892401 CDS product cysteine desulfurase DndA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109917.1 protein_id gnl|my_center|LOCUS_28820 2893472 2893086 gene locus_tag LOCUS_28830 2893472 2893086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 2893577 2894155 gene locus_tag LOCUS_28840 2893577 2894155 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456472.1 protein_id gnl|my_center|LOCUS_28840 2894979 2895122 gene locus_tag LOCUS_28850 2894979 2895122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 2895478 2895660 gene locus_tag LOCUS_28860 2895478 2895660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 2895792 2895956 gene locus_tag LOCUS_28870 2895792 2895956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 2896115 2897677 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtctagctctatatgagctagtggatttaaat 2898409 2898484 gene locus_tag LOCUS_t00360 2898409 2898484 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2898554 2898823 gene locus_tag LOCUS_28880 2898554 2898823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 2898839 2899078 gene locus_tag LOCUS_28890 2898839 2899078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 2899418 2899107 gene locus_tag LOCUS_28900 2899418 2899107 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965771.1 protein_id gnl|my_center|LOCUS_28900 2900251 2899451 gene locus_tag LOCUS_28910 2900251 2899451 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896869.1 protein_id gnl|my_center|LOCUS_28910 2901323 2900352 gene locus_tag LOCUS_28920 gene pta 2901323 2900352 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067221.1 protein_id gnl|my_center|LOCUS_28920 2901455 2901652 gene locus_tag LOCUS_28930 2901455 2901652 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964294.1 protein_id gnl|my_center|LOCUS_28930 2901749 2902216 gene locus_tag LOCUS_28940 2901749 2902216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 2902406 2903128 gene locus_tag LOCUS_28950 gene treR 2902406 2903128 CDS product trehalose operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405408.1 protein_id gnl|my_center|LOCUS_28950 2903244 2905160 gene locus_tag LOCUS_28960 gene treP 2903244 2905160 CDS product PTS system trehalose-specific EIIBC component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921815.1 protein_id gnl|my_center|LOCUS_28960 2905173 2906816 gene locus_tag LOCUS_28970 gene treC 2905173 2906816 CDS product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986524.1 protein_id gnl|my_center|LOCUS_28970 2907344 2907129 gene locus_tag LOCUS_28980 2907344 2907129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 2907474 2907719 gene locus_tag LOCUS_28990 2907474 2907719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 2908085 2909770 gene locus_tag LOCUS_29000 2908085 2909770 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461751.1 protein_id gnl|my_center|LOCUS_29000 2909775 2911031 gene locus_tag LOCUS_29010 gene leuC 2909775 2911031 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966450.1 protein_id gnl|my_center|LOCUS_29010 2911044 2911538 gene locus_tag LOCUS_29020 gene leuD 2911044 2911538 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966449.1 protein_id gnl|my_center|LOCUS_29020 2911535 2912614 gene locus_tag LOCUS_29030 gene leuB 2911535 2912614 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583554.1 protein_id gnl|my_center|LOCUS_29030 2912719 2913933 gene locus_tag LOCUS_29040 2912719 2913933 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108877.1 protein_id gnl|my_center|LOCUS_29040 2914074 2914433 gene locus_tag LOCUS_29050 2914074 2914433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 2914446 2915429 gene locus_tag LOCUS_29060 2914446 2915429 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682171.1 protein_id gnl|my_center|LOCUS_29060 2915571 2916899 gene locus_tag LOCUS_29070 2915571 2916899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 2916899 2917756 gene locus_tag LOCUS_29080 2916899 2917756 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948436.1 protein_id gnl|my_center|LOCUS_29080 2917746 2918669 gene locus_tag LOCUS_29090 2917746 2918669 CDS product CorA family divalent cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682345.1 protein_id gnl|my_center|LOCUS_29090 2918783 2920873 gene locus_tag LOCUS_29100 2918783 2920873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 2921014 2921709 gene locus_tag LOCUS_29110 2921014 2921709 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813911.1 protein_id gnl|my_center|LOCUS_29110 2922350 2922484 gene locus_tag LOCUS_29120 2922350 2922484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 2922481 2922864 gene locus_tag LOCUS_29130 2922481 2922864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 2922916 2925036 gene locus_tag LOCUS_29140 2922916 2925036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 2925056 2927167 gene locus_tag LOCUS_29150 2925056 2927167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 2927197 2928498 gene locus_tag LOCUS_29160 2927197 2928498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 2928491 2930356 gene locus_tag LOCUS_29170 2928491 2930356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 2930603 2932480 gene locus_tag LOCUS_29180 2930603 2932480 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437073.1 protein_id gnl|my_center|LOCUS_29180 2932477 2932827 gene locus_tag LOCUS_29190 2932477 2932827 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963932.1 protein_id gnl|my_center|LOCUS_29190 2932828 2933529 gene locus_tag LOCUS_29200 2932828 2933529 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356156.1 protein_id gnl|my_center|LOCUS_29200 2934951 2933560 gene locus_tag LOCUS_29210 2934951 2933560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 2935310 2935756 gene locus_tag LOCUS_29220 2935310 2935756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 2935740 2937611 gene locus_tag LOCUS_29230 gene ftsH 2935740 2937611 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428619.1 protein_id gnl|my_center|LOCUS_29230 2937706 2938689 gene locus_tag LOCUS_29240 2937706 2938689 CDS product zinc dependent phospholipase C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678767.1 protein_id gnl|my_center|LOCUS_29240 2938718 2939668 gene locus_tag LOCUS_29250 2938718 2939668 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889546.1 protein_id gnl|my_center|LOCUS_29250 2940085 2939672 gene locus_tag LOCUS_29260 2940085 2939672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 2940244 2940783 gene locus_tag LOCUS_29270 gene raiA 2940244 2940783 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003637821.1 protein_id gnl|my_center|LOCUS_29270 2941036 2942619 gene locus_tag LOCUS_29280 2941036 2942619 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966289.1 protein_id gnl|my_center|LOCUS_29280 2942645 2943202 gene locus_tag LOCUS_29290 2942645 2943202 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052021.1 protein_id gnl|my_center|LOCUS_29290 2943514 2943590 gene locus_tag LOCUS_t00370 2943514 2943590 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2943962 2943663 gene locus_tag LOCUS_29300 2943962 2943663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 2944174 2944902 gene locus_tag LOCUS_29310 2944174 2944902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 2944928 2946205 gene locus_tag LOCUS_29320 gene tig 2944928 2946205 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729253.1 protein_id gnl|my_center|LOCUS_29320 2946261 2948585 gene locus_tag LOCUS_29330 gene lon 2946261 2948585 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097289.1 protein_id gnl|my_center|LOCUS_29330 2948586 2949176 gene locus_tag LOCUS_29340 gene yihA 2948586 2949176 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002915299.1 protein_id gnl|my_center|LOCUS_29340 2949272 2949556 gene locus_tag LOCUS_29350 2949272 2949556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 2949558 2949851 gene locus_tag LOCUS_29360 2949558 2949851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 2949919 2950710 gene locus_tag LOCUS_29370 2949919 2950710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 2951360 2950725 gene locus_tag LOCUS_29380 2951360 2950725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021681.1 protein_id gnl|my_center|LOCUS_29380 2951505 2952257 gene locus_tag LOCUS_29390 2951505 2952257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 2952599 2953174 gene locus_tag LOCUS_29400 2952599 2953174 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590589.1 protein_id gnl|my_center|LOCUS_29400 2953158 2955779 gene locus_tag LOCUS_29410 gene valS 2953158 2955779 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072238.1 protein_id gnl|my_center|LOCUS_29410 2956768 2955866 gene locus_tag LOCUS_29420 2956768 2955866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 2957399 2958457 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcattatgctatatgcatgatgtggatttaaac 2960343 2958601 gene locus_tag LOCUS_29430 2960343 2958601 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948291.1 protein_id gnl|my_center|LOCUS_29430 2960903 2961973 gene locus_tag LOCUS_29440 2960903 2961973 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_29440 2962051 2962242 gene locus_tag LOCUS_29450 2962051 2962242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 2963392 2962280 gene locus_tag LOCUS_29460 2963392 2962280 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354751.1 protein_id gnl|my_center|LOCUS_29460 2963647 2964942 gene locus_tag LOCUS_29470 gene rsxC 2963647 2964942 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198480691.1 protein_id gnl|my_center|LOCUS_29470 2964954 2966456 gene locus_tag LOCUS_29480 2964954 2966456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 2966470 2966988 gene locus_tag LOCUS_29490 2966470 2966988 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948147.1 protein_id gnl|my_center|LOCUS_29490 2967001 2967660 gene locus_tag LOCUS_29500 2967001 2967660 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761246.1 protein_id gnl|my_center|LOCUS_29500 2967664 2968245 gene locus_tag LOCUS_29510 gene rsxA 2967664 2968245 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904083.1 protein_id gnl|my_center|LOCUS_29510 2968247 2968420 gene locus_tag LOCUS_29520 2968247 2968420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 2968439 2968756 gene locus_tag LOCUS_29530 2968439 2968756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 2969726 2968803 gene locus_tag LOCUS_29540 2969726 2968803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 2970045 2971277 gene locus_tag LOCUS_29550 2970045 2971277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 2971677 2972324 gene locus_tag LOCUS_29560 2971677 2972324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 2972858 2973475 gene locus_tag LOCUS_29570 2972858 2973475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 2974337 2975689 gene locus_tag LOCUS_29580 2974337 2975689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 2975703 2976602 gene locus_tag LOCUS_29590 2975703 2976602 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245448.1 protein_id gnl|my_center|LOCUS_29590 2976606 2977772 gene locus_tag LOCUS_29600 2976606 2977772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 2978045 2978506 gene locus_tag LOCUS_29610 2978045 2978506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 2978566 2978841 gene locus_tag LOCUS_29620 2978566 2978841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 2978970 2979347 gene locus_tag LOCUS_29630 2978970 2979347 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814465.1 protein_id gnl|my_center|LOCUS_29630 2979393 2980256 gene locus_tag LOCUS_29640 2979393 2980256 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897173.1 protein_id gnl|my_center|LOCUS_29640 2980250 2980894 gene locus_tag LOCUS_29650 2980250 2980894 CDS product ABC-2 transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435186.1 protein_id gnl|my_center|LOCUS_29650 2980992 2982008 gene locus_tag LOCUS_29660 gene asnA 2980992 2982008 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949062.1 protein_id gnl|my_center|LOCUS_29660 2982085 2982801 gene locus_tag LOCUS_29670 2982085 2982801 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969534.1 protein_id gnl|my_center|LOCUS_29670 2982794 2983636 gene locus_tag LOCUS_29680 2982794 2983636 CDS product radical SAM mobile pair protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679438.1 protein_id gnl|my_center|LOCUS_29680 2983974 2985323 gene locus_tag LOCUS_29690 2983974 2985323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 2986185 2985508 gene locus_tag LOCUS_29700 2986185 2985508 CDS product suppressor of fused domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263126.1 protein_id gnl|my_center|LOCUS_29700 2987854 2986196 gene locus_tag LOCUS_29710 2987854 2986196 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863284.1 protein_id gnl|my_center|LOCUS_29710 2987969 2988541 gene locus_tag LOCUS_29720 gene gmk 2987969 2988541 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257738.1 protein_id gnl|my_center|LOCUS_29720 2989959 2988628 gene locus_tag LOCUS_29730 gene gdhA 2989959 2988628 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945505.1 protein_id gnl|my_center|LOCUS_29730 2990144 2990368 gene locus_tag LOCUS_29740 2990144 2990368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 2990365 2992476 gene locus_tag LOCUS_29750 gene feoB 2990365 2992476 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546775.1 protein_id gnl|my_center|LOCUS_29750 2992517 2992987 gene locus_tag LOCUS_29760 2992517 2992987 CDS product LURP-one-related/scramblase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847065.1 protein_id gnl|my_center|LOCUS_29760 2993181 2993810 gene locus_tag LOCUS_29770 2993181 2993810 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861198.1 protein_id gnl|my_center|LOCUS_29770 2993813 2995291 gene locus_tag LOCUS_29780 2993813 2995291 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965086.1 protein_id gnl|my_center|LOCUS_29780 2995284 2995940 gene locus_tag LOCUS_29790 2995284 2995940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816577.1 protein_id gnl|my_center|LOCUS_29790 2996776 2995952 gene locus_tag LOCUS_29800 2996776 2995952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 2996871 2997602 gene locus_tag LOCUS_29810 2996871 2997602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 2997663 2998127 gene locus_tag LOCUS_29820 2997663 2998127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 2998438 2998154 gene locus_tag LOCUS_29830 2998438 2998154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 2998597 2998920 gene locus_tag LOCUS_29840 2998597 2998920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 2998931 2999149 gene locus_tag LOCUS_29850 2998931 2999149 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860795.1 protein_id gnl|my_center|LOCUS_29850 2999247 2999759 gene locus_tag LOCUS_29860 2999247 2999759 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948568.1 protein_id gnl|my_center|LOCUS_29860 2999775 3000248 gene locus_tag LOCUS_29870 2999775 3000248 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797562.1 protein_id gnl|my_center|LOCUS_29870 3000475 3001332 gene locus_tag LOCUS_29880 3000475 3001332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 3001660 3002694 gene locus_tag LOCUS_29890 3001660 3002694 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356948.1 protein_id gnl|my_center|LOCUS_29890 3002688 3003368 gene locus_tag LOCUS_29900 3002688 3003368 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293786.1 protein_id gnl|my_center|LOCUS_29900 3003394 3004209 gene locus_tag LOCUS_29910 3003394 3004209 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390147.1 protein_id gnl|my_center|LOCUS_29910 3004216 3005385 gene locus_tag LOCUS_29920 3004216 3005385 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383734.1 protein_id gnl|my_center|LOCUS_29920 3005561 3006322 gene locus_tag LOCUS_29930 3005561 3006322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 3006368 3007477 gene locus_tag LOCUS_29940 3006368 3007477 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476309.1 protein_id gnl|my_center|LOCUS_29940 3007481 3010069 gene locus_tag LOCUS_29950 3007481 3010069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 3010075 3010797 gene locus_tag LOCUS_29960 3010075 3010797 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963607.1 protein_id gnl|my_center|LOCUS_29960 3012428 3010824 gene locus_tag LOCUS_29970 3012428 3010824 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051558.1 protein_id gnl|my_center|LOCUS_29970 3012741 3012418 gene locus_tag LOCUS_29980 3012741 3012418 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054731.1 protein_id gnl|my_center|LOCUS_29980 3013419 3013494 gene locus_tag LOCUS_t00380 3013419 3013494 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 3013617 3013704 gene locus_tag LOCUS_t00390 3013617 3013704 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3013870 3014709 gene locus_tag LOCUS_29990 3013870 3014709 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003266758.1 protein_id gnl|my_center|LOCUS_29990 3014722 3015477 gene locus_tag LOCUS_30000 3014722 3015477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 3016117 3015512 gene locus_tag LOCUS_30010 3016117 3015512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 3016295 3016699 gene locus_tag LOCUS_30020 3016295 3016699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 3016696 3017373 gene locus_tag LOCUS_30030 gene radC 3016696 3017373 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013377.1 protein_id gnl|my_center|LOCUS_30030 3017423 3018253 gene locus_tag LOCUS_30040 gene mreC 3017423 3018253 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003725674.1 protein_id gnl|my_center|LOCUS_30040 3018253 3018810 gene locus_tag LOCUS_30050 3018253 3018810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 3018783 3019391 gene locus_tag LOCUS_30060 3018783 3019391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 3019328 3020104 gene locus_tag LOCUS_30070 gene minD 3019328 3020104 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503310.1 protein_id gnl|my_center|LOCUS_30070 3020161 3021252 gene locus_tag LOCUS_30080 3020161 3021252 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411472.1 protein_id gnl|my_center|LOCUS_30080 3021318 3021890 gene locus_tag LOCUS_30090 3021318 3021890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 3021973 3022617 gene locus_tag LOCUS_30100 3021973 3022617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 3022671 3023630 gene locus_tag LOCUS_30110 3022671 3023630 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733831.1 protein_id gnl|my_center|LOCUS_30110 3023724 3026309 gene locus_tag LOCUS_30120 gene polA 3023724 3026309 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412819.1 protein_id gnl|my_center|LOCUS_30120 3026309 3027136 gene locus_tag LOCUS_30130 gene mutM 3026309 3027136 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114478.1 protein_id gnl|my_center|LOCUS_30130 3027118 3027714 gene locus_tag LOCUS_30140 gene coaE 3027118 3027714 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583248.1 protein_id gnl|my_center|LOCUS_30140 3027726 3028922 gene locus_tag LOCUS_30150 3027726 3028922 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415049.1 protein_id gnl|my_center|LOCUS_30150 3028915 3029829 gene locus_tag LOCUS_30160 gene dnaI 3028915 3029829 CDS product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229466.1 protein_id gnl|my_center|LOCUS_30160 3029930 3030892 gene locus_tag LOCUS_30170 gene pfkA 3029930 3030892 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000591796.1 protein_id gnl|my_center|LOCUS_30170 3030948 3032369 gene locus_tag LOCUS_30180 gene pyk 3030948 3032369 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232673.1 protein_id gnl|my_center|LOCUS_30180 3032523 3033116 gene locus_tag LOCUS_30190 3032523 3033116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 3033263 3034177 gene locus_tag LOCUS_30200 3033263 3034177 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949138.1 protein_id gnl|my_center|LOCUS_30200 3034174 3035415 gene locus_tag LOCUS_30210 3034174 3035415 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429165.1 protein_id gnl|my_center|LOCUS_30210 3035568 3036125 gene locus_tag LOCUS_30220 3035568 3036125 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963812.1 protein_id gnl|my_center|LOCUS_30220 3036187 3038064 gene locus_tag LOCUS_30230 3036187 3038064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 3038711 3038097 gene locus_tag LOCUS_30240 3038711 3038097 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268842.1 protein_id gnl|my_center|LOCUS_30240 3039228 3040961 gene locus_tag LOCUS_30250 gene thrS 3039228 3040961 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626551.1 protein_id gnl|my_center|LOCUS_30250 3040958 3041875 gene locus_tag LOCUS_30260 3040958 3041875 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681111.1 protein_id gnl|my_center|LOCUS_30260 3041889 3042275 gene locus_tag LOCUS_30270 3041889 3042275 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869146.1 protein_id gnl|my_center|LOCUS_30270 3042334 3042834 gene locus_tag LOCUS_30280 3042334 3042834 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965782.1 protein_id gnl|my_center|LOCUS_30280 3043079 3043339 gene locus_tag LOCUS_30290 3043079 3043339 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420907.1 protein_id gnl|my_center|LOCUS_30290 3043359 3044978 gene locus_tag LOCUS_30300 gene groL 3043359 3044978 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726503.1 protein_id gnl|my_center|LOCUS_30300 3045114 3046991 gene locus_tag LOCUS_30310 3045114 3046991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 3047005 3047475 gene locus_tag LOCUS_30320 3047005 3047475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272655.1 protein_id gnl|my_center|LOCUS_30320 3047603 3047806 gene locus_tag LOCUS_30330 3047603 3047806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 3048292 3047831 gene locus_tag LOCUS_30340 gene bcp 3048292 3047831 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439443.1 protein_id gnl|my_center|LOCUS_30340 3048387 3049238 gene locus_tag LOCUS_30350 3048387 3049238 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721781.1 protein_id gnl|my_center|LOCUS_30350 3049306 3050355 gene locus_tag LOCUS_30360 3049306 3050355 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530862.1 protein_id gnl|my_center|LOCUS_30360 3051220 3050393 gene locus_tag LOCUS_30370 3051220 3050393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 3051294 3052967 gene locus_tag LOCUS_30380 3051294 3052967 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986940.1 protein_id gnl|my_center|LOCUS_30380 3052964 3053551 gene locus_tag LOCUS_30390 3052964 3053551 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659319.1 protein_id gnl|my_center|LOCUS_30390 3053554 3054063 gene locus_tag LOCUS_30400 gene trmL 3053554 3054063 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538147.1 protein_id gnl|my_center|LOCUS_30400 3054060 3054644 gene locus_tag LOCUS_30410 3054060 3054644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 3054917 3054669 gene locus_tag LOCUS_30420 3054917 3054669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 3055245 3055826 gene locus_tag LOCUS_30430 3055245 3055826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 3056253 3056447 gene locus_tag LOCUS_30440 3056253 3056447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 3056606 3056869 gene locus_tag LOCUS_30450 3056606 3056869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 3057109 3058011 gene locus_tag LOCUS_30460 gene pyrB 3057109 3058011 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018849.1 protein_id gnl|my_center|LOCUS_30460 3058008 3059288 gene locus_tag LOCUS_30470 gene pyrC 3058008 3059288 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108375.1 protein_id gnl|my_center|LOCUS_30470 3059285 3060355 gene locus_tag LOCUS_30480 3059285 3060355 CDS product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232115.1 protein_id gnl|my_center|LOCUS_30480 3060359 3063559 gene locus_tag LOCUS_30490 gene carB 3060359 3063559 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126101.1 protein_id gnl|my_center|LOCUS_30490 3063561 3064307 gene locus_tag LOCUS_30500 3063561 3064307 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016380.1 protein_id gnl|my_center|LOCUS_30500 3064307 3065218 gene locus_tag LOCUS_30510 gene pyrD 3064307 3065218 CDS product dihydroorotate oxidase B catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081049.1 protein_id gnl|my_center|LOCUS_30510 3065215 3065916 gene locus_tag LOCUS_30520 gene pyrF 3065215 3065916 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083500.1 protein_id gnl|my_center|LOCUS_30520 3065916 3066554 gene locus_tag LOCUS_30530 gene pyrE 3065916 3066554 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232105.1 protein_id gnl|my_center|LOCUS_30530 3066597 3067673 gene locus_tag LOCUS_30540 3066597 3067673 CDS product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828686.1 protein_id gnl|my_center|LOCUS_30540 3067675 3070878 gene locus_tag LOCUS_30550 gene carB 3067675 3070878 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126101.1 protein_id gnl|my_center|LOCUS_30550 3070955 3071287 gene locus_tag LOCUS_30560 3070955 3071287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 3071310 3071717 gene locus_tag LOCUS_30570 3071310 3071717 CDS product DUF4259 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887029.1 protein_id gnl|my_center|LOCUS_30570 3071906 3073840 gene locus_tag LOCUS_30580 3071906 3073840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 3074057 3075466 gene locus_tag LOCUS_30590 3074057 3075466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 3075488 3077767 gene locus_tag LOCUS_30600 3075488 3077767 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898049.1 protein_id gnl|my_center|LOCUS_30600 3077772 3079055 gene locus_tag LOCUS_30610 3077772 3079055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 3079059 3079880 gene locus_tag LOCUS_30620 3079059 3079880 CDS product TIGR02452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965841.1 protein_id gnl|my_center|LOCUS_30620 3079877 3080401 gene locus_tag LOCUS_30630 3079877 3080401 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483979.1 protein_id gnl|my_center|LOCUS_30630 3080429 3080560 gene locus_tag LOCUS_30640 3080429 3080560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 3080650 3081825 gene locus_tag LOCUS_30650 3080650 3081825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 3081904 3083835 gene locus_tag LOCUS_30660 3081904 3083835 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989931.1 protein_id gnl|my_center|LOCUS_30660 3083848 3085773 gene locus_tag LOCUS_30670 3083848 3085773 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006774564.1 protein_id gnl|my_center|LOCUS_30670 3085901 3088021 gene locus_tag LOCUS_30680 3085901 3088021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 3089371 3088067 gene locus_tag LOCUS_30690 3089371 3088067 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966536.1 protein_id gnl|my_center|LOCUS_30690 3089785 3090987 gene locus_tag LOCUS_30700 gene ilvA 3089785 3090987 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272642.1 protein_id gnl|my_center|LOCUS_30700 3091001 3092671 gene locus_tag LOCUS_30710 gene ilvB 3091001 3092671 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966446.1 protein_id gnl|my_center|LOCUS_30710 3092686 3093177 gene locus_tag LOCUS_30720 gene ilvN 3092686 3093177 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393740.1 protein_id gnl|my_center|LOCUS_30720 3093239 3094234 gene locus_tag LOCUS_30730 gene ilvC 3093239 3094234 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938673.1 protein_id gnl|my_center|LOCUS_30730 3094247 3095911 gene locus_tag LOCUS_30740 gene ilvD 3094247 3095911 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_30740 3096875 3096210 gene locus_tag LOCUS_30750 3096875 3096210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 3097526 3097005 gene locus_tag LOCUS_30760 3097526 3097005 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251052.1 protein_id gnl|my_center|LOCUS_30760 3097643 3099007 gene locus_tag LOCUS_30770 3097643 3099007 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234223.1 protein_id gnl|my_center|LOCUS_30770 3099669 3099061 gene locus_tag LOCUS_30780 3099669 3099061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 3099782 3100447 gene locus_tag LOCUS_30790 3099782 3100447 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429376.1 protein_id gnl|my_center|LOCUS_30790 3100456 3100788 gene locus_tag LOCUS_30800 3100456 3100788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 3100898 3101584 gene locus_tag LOCUS_30810 3100898 3101584 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861224.1 protein_id gnl|my_center|LOCUS_30810 3101574 3102569 gene locus_tag LOCUS_30820 3101574 3102569 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434897.1 protein_id gnl|my_center|LOCUS_30820 3102590 3103045 gene locus_tag LOCUS_30830 3102590 3103045 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459496.1 protein_id gnl|my_center|LOCUS_30830 3103176 3103859 gene locus_tag LOCUS_30840 3103176 3103859 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963847.1 protein_id gnl|my_center|LOCUS_30840 3103856 3106417 gene locus_tag LOCUS_30850 3103856 3106417 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892169.1 protein_id gnl|my_center|LOCUS_30850 3106540 3108021 gene locus_tag LOCUS_30860 gene glpK 3106540 3108021 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233384.1 protein_id gnl|my_center|LOCUS_30860 3108133 3108570 gene locus_tag LOCUS_30870 3108133 3108570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 3108656 3109081 gene locus_tag LOCUS_30880 3108656 3109081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 3109157 3109540 gene locus_tag LOCUS_30890 3109157 3109540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 3109537 3110052 gene locus_tag LOCUS_30900 3109537 3110052 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817206.1 protein_id gnl|my_center|LOCUS_30900 3110056 3110325 gene locus_tag LOCUS_30910 3110056 3110325 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788104.1 protein_id gnl|my_center|LOCUS_30910 3110396 3112195 gene locus_tag LOCUS_30920 3110396 3112195 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680842.1 protein_id gnl|my_center|LOCUS_30920 3112176 3114002 gene locus_tag LOCUS_30930 3112176 3114002 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666962.1 protein_id gnl|my_center|LOCUS_30930 3114013 3114387 gene locus_tag LOCUS_30940 3114013 3114387 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365398.1 protein_id gnl|my_center|LOCUS_30940 3114585 3115436 gene locus_tag LOCUS_30950 3114585 3115436 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439998.1 protein_id gnl|my_center|LOCUS_30950 3115612 3117510 gene locus_tag LOCUS_30960 3115612 3117510 CDS product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861819.1 protein_id gnl|my_center|LOCUS_30960 3117647 3117913 gene locus_tag LOCUS_30970 3117647 3117913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30970 3118016 3119080 gene locus_tag LOCUS_30980 3118016 3119080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30980 3119106 3120521 gene locus_tag LOCUS_30990 3119106 3120521 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546652.1 protein_id gnl|my_center|LOCUS_30990 3120698 3122110 gene locus_tag LOCUS_31000 3120698 3122110 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890696.1 protein_id gnl|my_center|LOCUS_31000 3122396 3122899 gene locus_tag LOCUS_31010 3122396 3122899 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905176.1 protein_id gnl|my_center|LOCUS_31010 3122978 3123352 gene locus_tag LOCUS_31020 3122978 3123352 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047976.1 protein_id gnl|my_center|LOCUS_31020 3123352 3124194 gene locus_tag LOCUS_31030 3123352 3124194 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896018.1 protein_id gnl|my_center|LOCUS_31030 3124540 3124839 gene locus_tag LOCUS_31040 3124540 3124839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 3124832 3125455 gene locus_tag LOCUS_31050 3124832 3125455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 3126249 3126578 gene locus_tag LOCUS_31060 3126249 3126578 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889116.1 protein_id gnl|my_center|LOCUS_31060 3126565 3127617 gene locus_tag LOCUS_31070 3126565 3127617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 3127617 3128093 gene locus_tag LOCUS_31080 3127617 3128093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 3129524 3130696 gene locus_tag LOCUS_31090 3129524 3130696 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080839.1 protein_id gnl|my_center|LOCUS_31090 3130984 3131448 gene locus_tag LOCUS_31100 gene lspA 3130984 3131448 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989666.1 protein_id gnl|my_center|LOCUS_31100 3131445 3132362 gene locus_tag LOCUS_31110 3131445 3132362 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005831.1 protein_id gnl|my_center|LOCUS_31110 3132366 3133619 gene locus_tag LOCUS_31120 3132366 3133619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 3133616 3134098 gene locus_tag LOCUS_31130 3133616 3134098 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_31130 3135056 3134169 gene locus_tag LOCUS_31140 gene rnhC 3135056 3134169 CDS product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071591.1 protein_id gnl|my_center|LOCUS_31140 3135161 3135841 gene locus_tag LOCUS_31150 3135161 3135841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 3135838 3138159 gene locus_tag LOCUS_31160 3135838 3138159 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229541.1 protein_id gnl|my_center|LOCUS_31160 3138170 3139948 gene locus_tag LOCUS_31170 gene uvrC 3138170 3139948 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246045.1 protein_id gnl|my_center|LOCUS_31170 3140000 3140191 gene locus_tag LOCUS_31180 gene gerE 3140000 3140191 CDS product spore germination transcription factor GerE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003184172.1 protein_id gnl|my_center|LOCUS_31180 3140282 3140710 gene locus_tag LOCUS_31190 3140282 3140710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 3140808 3141836 gene locus_tag LOCUS_31200 3140808 3141836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 3141912 3142880 gene locus_tag LOCUS_31210 3141912 3142880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 3142938 3143426 gene locus_tag LOCUS_31220 3142938 3143426 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476166.1 protein_id gnl|my_center|LOCUS_31220 3143540 3144730 gene locus_tag LOCUS_31230 3143540 3144730 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424103.1 protein_id gnl|my_center|LOCUS_31230 3144940 3145950 gene locus_tag LOCUS_31240 3144940 3145950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 3146071 3147081 gene locus_tag LOCUS_31250 3146071 3147081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 3147401 3149602 gene locus_tag LOCUS_31260 3147401 3149602 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454973.1 protein_id gnl|my_center|LOCUS_31260 3149919 3150419 gene locus_tag LOCUS_31270 3149919 3150419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 3150425 3151126 gene locus_tag LOCUS_31280 gene sigE 3150425 3151126 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221446.1 protein_id gnl|my_center|LOCUS_31280 3151357 3152955 gene locus_tag LOCUS_31290 3151357 3152955 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890592.1 protein_id gnl|my_center|LOCUS_31290 3152968 3153393 gene locus_tag LOCUS_31300 3152968 3153393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 3153398 3153793 gene locus_tag LOCUS_31310 3153398 3153793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 3153837 3154676 gene locus_tag LOCUS_31320 3153837 3154676 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964664.1 protein_id gnl|my_center|LOCUS_31320 3154922 3155446 gene locus_tag LOCUS_31330 3154922 3155446 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765311.1 protein_id gnl|my_center|LOCUS_31330 3155439 3156518 gene locus_tag LOCUS_31340 gene yqeH 3155439 3156518 CDS product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391202.1 protein_id gnl|my_center|LOCUS_31340 3156518 3156802 gene locus_tag LOCUS_31350 gene yhbY 3156518 3156802 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941918.1 protein_id gnl|my_center|LOCUS_31350 3156807 3157832 gene locus_tag LOCUS_31360 3156807 3157832 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183272.1 protein_id gnl|my_center|LOCUS_31360 3157833 3158171 gene locus_tag LOCUS_31370 gene rsfS 3157833 3158171 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088020.1 protein_id gnl|my_center|LOCUS_31370 3158168 3158875 gene locus_tag LOCUS_31380 3158168 3158875 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905221.1 protein_id gnl|my_center|LOCUS_31380 3158872 3159543 gene locus_tag LOCUS_31390 gene mtnN 3158872 3159543 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217037.1 protein_id gnl|my_center|LOCUS_31390 3159638 3160099 gene locus_tag LOCUS_31400 3159638 3160099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 3160096 3160635 gene locus_tag LOCUS_31410 3160096 3160635 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357986.1 protein_id gnl|my_center|LOCUS_31410 3160635 3161288 gene locus_tag LOCUS_31420 gene nth 3160635 3161288 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357985.1 protein_id gnl|my_center|LOCUS_31420 3164092 3161354 gene locus_tag LOCUS_31430 3164092 3161354 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398589.1 protein_id gnl|my_center|LOCUS_31430 3164672 3164076 gene locus_tag LOCUS_31440 gene recU 3164672 3164076 CDS product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155598.1 protein_id gnl|my_center|LOCUS_31440 3164867 3165187 gene locus_tag LOCUS_31450 gene gpsB 3164867 3165187 CDS product cell division regulator GpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146522.1 protein_id gnl|my_center|LOCUS_31450 3165696 3166658 gene locus_tag LOCUS_31460 3165696 3166658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 3166658 3167254 gene locus_tag LOCUS_31470 gene pgsA 3166658 3167254 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365382.1 protein_id gnl|my_center|LOCUS_31470 3167255 3167710 gene locus_tag LOCUS_31480 3167255 3167710 CDS product nicotinamide-nucleotide amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013447851.1 protein_id gnl|my_center|LOCUS_31480 3167728 3168840 gene locus_tag LOCUS_31490 gene recA 3167728 3168840 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641504.1 protein_id gnl|my_center|LOCUS_31490 3169019 3170572 gene locus_tag LOCUS_31500 gene rny 3169019 3170572 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099773.1 protein_id gnl|my_center|LOCUS_31500 3170574 3171353 gene locus_tag LOCUS_31510 gene ymdB 3170574 3171353 CDS product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245138.1 protein_id gnl|my_center|LOCUS_31510 3171479 3171652 gene locus_tag LOCUS_31520 3171479 3171652 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869128.1 protein_id gnl|my_center|LOCUS_31520 3171728 3173164 gene locus_tag LOCUS_31530 gene miaB 3171728 3173164 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005404.1 protein_id gnl|my_center|LOCUS_31530 3173328 3174986 gene locus_tag LOCUS_31540 3173328 3174986 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052590.1 protein_id gnl|my_center|LOCUS_31540 3175017 3177398 gene locus_tag LOCUS_31550 3175017 3177398 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118781.1 protein_id gnl|my_center|LOCUS_31550 3177504 3178760 gene locus_tag LOCUS_31560 3177504 3178760 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439538.1 protein_id gnl|my_center|LOCUS_31560 3178741 3180021 gene locus_tag LOCUS_31570 3178741 3180021 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411976.1 protein_id gnl|my_center|LOCUS_31570 3180177 3180488 gene locus_tag LOCUS_31580 3180177 3180488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 3181123 3180521 gene locus_tag LOCUS_31590 gene rpsD 3181123 3180521 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229304.1 protein_id gnl|my_center|LOCUS_31590 3181442 3183196 gene locus_tag LOCUS_31600 gene ezrA 3181442 3183196 CDS product septation ring formation regulator EzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830796.1 protein_id gnl|my_center|LOCUS_31600 3183200 3184330 gene locus_tag LOCUS_31610 3183200 3184330 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638992.1 protein_id gnl|my_center|LOCUS_31610 3184311 3185531 gene locus_tag LOCUS_31620 gene thiI 3184311 3185531 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922339.1 protein_id gnl|my_center|LOCUS_31620 3185577 3185807 gene locus_tag LOCUS_31630 3185577 3185807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 3185896 3186684 gene locus_tag LOCUS_31640 gene rlmA 3185896 3186684 CDS product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010122.1 protein_id gnl|my_center|LOCUS_31640 3186684 3187055 gene locus_tag LOCUS_31650 3186684 3187055 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861104.1 protein_id gnl|my_center|LOCUS_31650 3187121 3188527 gene locus_tag LOCUS_31660 gene ffh 3187121 3188527 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232020.1 protein_id gnl|my_center|LOCUS_31660 3188658 3188930 gene locus_tag LOCUS_31670 gene rpsP 3188658 3188930 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699989.1 protein_id gnl|my_center|LOCUS_31670 3188933 3189181 gene locus_tag LOCUS_31680 3188933 3189181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 3189216 3189713 gene locus_tag LOCUS_31690 gene rimM 3189216 3189713 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261987.1 protein_id gnl|my_center|LOCUS_31690 3189710 3190447 gene locus_tag LOCUS_31700 gene trmD 3189710 3190447 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183438.1 protein_id gnl|my_center|LOCUS_31700 3190715 3191062 gene locus_tag LOCUS_31710 gene rplS 3190715 3191062 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728425.1 protein_id gnl|my_center|LOCUS_31710 3191129 3191707 gene locus_tag LOCUS_31720 3191129 3191707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 3191720 3192322 gene locus_tag LOCUS_31730 gene lepB 3191720 3192322 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246166.1 protein_id gnl|my_center|LOCUS_31730 3192312 3193178 gene locus_tag LOCUS_31740 gene ylqF 3192312 3193178 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967235.1 protein_id gnl|my_center|LOCUS_31740 3193168 3193791 gene locus_tag LOCUS_31750 3193168 3193791 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723891.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31750 3193882 3194259 gene locus_tag LOCUS_31760 3193882 3194259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 3194264 3194692 gene locus_tag LOCUS_31770 3194264 3194692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 3194716 3195663 gene locus_tag LOCUS_31780 3194716 3195663 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_31780 3195766 3196494 gene locus_tag LOCUS_31790 3195766 3196494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 3196568 3198817 gene locus_tag LOCUS_31800 gene topA 3196568 3198817 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131148.1 protein_id gnl|my_center|LOCUS_31800 3198821 3200119 gene locus_tag LOCUS_31810 gene trmFO 3198821 3200119 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001991958.1 protein_id gnl|my_center|LOCUS_31810 3200119 3201039 gene locus_tag LOCUS_31820 gene xerC 3200119 3201039 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110333.1 protein_id gnl|my_center|LOCUS_31820 3201223 3202164 gene locus_tag LOCUS_31830 3201223 3202164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 3202190 3203080 gene locus_tag LOCUS_31840 gene tsf 3202190 3203080 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018581.1 protein_id gnl|my_center|LOCUS_31840 3203204 3203917 gene locus_tag LOCUS_31850 gene pyrH 3203204 3203917 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703168.1 protein_id gnl|my_center|LOCUS_31850 3203922 3204467 gene locus_tag LOCUS_31860 gene frr 3203922 3204467 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531501.1 protein_id gnl|my_center|LOCUS_31860 3204637 3205341 gene locus_tag LOCUS_31870 3204637 3205341 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231925.1 protein_id gnl|my_center|LOCUS_31870 3205343 3206116 gene locus_tag LOCUS_31880 3205343 3206116 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384675.1 protein_id gnl|my_center|LOCUS_31880 3206113 3207273 gene locus_tag LOCUS_31890 gene dxr 3206113 3207273 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245155.1 protein_id gnl|my_center|LOCUS_31890 3207270 3208331 gene locus_tag LOCUS_31900 gene rseP 3207270 3208331 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545838.1 protein_id gnl|my_center|LOCUS_31900 3209443 3208358 gene locus_tag LOCUS_31910 3209443 3208358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 3209848 3209582 gene locus_tag LOCUS_31920 gene rpsT 3209848 3209582 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113577.1 protein_id gnl|my_center|LOCUS_31920 3209954 3210829 gene locus_tag LOCUS_31930 gene gpr 3209954 3210829 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430954.1 protein_id gnl|my_center|LOCUS_31930 3210913 3211776 gene locus_tag LOCUS_31940 3210913 3211776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 3211776 3212072 gene locus_tag LOCUS_31950 3211776 3212072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 3212107 3213048 gene locus_tag LOCUS_31960 gene fmt 3212107 3213048 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598785.1 protein_id gnl|my_center|LOCUS_31960 3213262 3215067 gene locus_tag LOCUS_31970 gene lepA 3213262 3215067 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229999.1 protein_id gnl|my_center|LOCUS_31970 3215182 3215919 gene locus_tag LOCUS_31980 3215182 3215919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 3215928 3217028 gene locus_tag LOCUS_31990 gene hemW 3215928 3217028 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027377.1 protein_id gnl|my_center|LOCUS_31990 3217148 3217234 gene locus_tag LOCUS_t00400 3217148 3217234 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3218460 3217309 gene locus_tag LOCUS_32000 3218460 3217309 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047593.1 protein_id gnl|my_center|LOCUS_32000 3219070 3218609 gene locus_tag LOCUS_32010 3219070 3218609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 3219452 3219126 gene locus_tag LOCUS_32020 3219452 3219126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 3219891 3219454 gene locus_tag LOCUS_32030 3219891 3219454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 3220053 3220283 gene locus_tag LOCUS_32040 3220053 3220283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 3220303 3220485 gene locus_tag LOCUS_32050 3220303 3220485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 3220923 3221240 gene locus_tag LOCUS_32060 3220923 3221240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 3221461 3221237 gene locus_tag LOCUS_32070 3221461 3221237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 3221537 3222325 gene locus_tag LOCUS_32080 3221537 3222325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 3222318 3222608 gene locus_tag LOCUS_32090 3222318 3222608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 3222660 3222932 gene locus_tag LOCUS_32100 3222660 3222932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 3222937 3223185 gene locus_tag LOCUS_32110 3222937 3223185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 3223303 3223467 gene locus_tag LOCUS_32120 3223303 3223467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 3223493 3224008 gene locus_tag LOCUS_32130 3223493 3224008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 3224001 3224246 gene locus_tag LOCUS_32140 3224001 3224246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 3224246 3224929 gene locus_tag LOCUS_32150 3224246 3224929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 3224939 3225793 gene locus_tag LOCUS_32160 3224939 3225793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 3225793 3226356 gene locus_tag LOCUS_32170 3225793 3226356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 3226343 3227251 gene locus_tag LOCUS_32180 3226343 3227251 CDS product recombinase RecT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229907.1 protein_id gnl|my_center|LOCUS_32180 3227261 3227752 gene locus_tag LOCUS_32190 3227261 3227752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 3227739 3228143 gene locus_tag LOCUS_32200 3227739 3228143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 3228158 3228910 gene locus_tag LOCUS_32210 3228158 3228910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922062.1 protein_id gnl|my_center|LOCUS_32210 3228907 3229329 gene locus_tag LOCUS_32220 3228907 3229329 CDS product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047623.1 protein_id gnl|my_center|LOCUS_32220 3229322 3229807 gene locus_tag LOCUS_32230 3229322 3229807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 3229809 3230042 gene locus_tag LOCUS_32240 3229809 3230042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 3230046 3230831 gene locus_tag LOCUS_32250 3230046 3230831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 3230828 3231370 gene locus_tag LOCUS_32260 3230828 3231370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 3231487 3231672 gene locus_tag LOCUS_32270 3231487 3231672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 3231669 3232559 gene locus_tag LOCUS_32280 3231669 3232559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 3232585 3232749 gene locus_tag LOCUS_32290 3232585 3232749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 3232752 3233096 gene locus_tag LOCUS_32300 3232752 3233096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 3233108 3233326 gene locus_tag LOCUS_32310 3233108 3233326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 3233316 3233918 gene locus_tag LOCUS_32320 3233316 3233918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 3233922 3234224 gene locus_tag LOCUS_32330 3233922 3234224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 3234221 3234622 gene locus_tag LOCUS_32340 3234221 3234622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 3234640 3234945 gene locus_tag LOCUS_32350 3234640 3234945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 3234951 3235295 gene locus_tag LOCUS_32360 3234951 3235295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 3235288 3235539 gene locus_tag LOCUS_32370 3235288 3235539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 3235532 3235933 gene locus_tag LOCUS_32380 3235532 3235933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 3235935 3236393 gene locus_tag LOCUS_32390 3235935 3236393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 3236390 3236665 gene locus_tag LOCUS_32400 3236390 3236665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 3236634 3237206 gene locus_tag LOCUS_32410 3236634 3237206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 3237288 3237914 gene locus_tag LOCUS_32420 3237288 3237914 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268842.1 protein_id gnl|my_center|LOCUS_32420 3238358 3238116 gene locus_tag LOCUS_32430 3238358 3238116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 3238613 3238951 gene locus_tag LOCUS_32440 3238613 3238951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 3238953 3239330 gene locus_tag LOCUS_32450 3238953 3239330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 3239446 3240009 gene locus_tag LOCUS_32460 3239446 3240009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 3240425 3240625 gene locus_tag LOCUS_32470 3240425 3240625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 3241503 3241576 gene locus_tag LOCUS_t00410 3241503 3241576 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 3241769 3241842 gene locus_tag LOCUS_t00420 3241769 3241842 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 3241901 3242248 gene locus_tag LOCUS_32480 3241901 3242248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 3242257 3244002 gene locus_tag LOCUS_32490 3242257 3244002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 3244014 3245603 gene locus_tag LOCUS_32500 3244014 3245603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 3245723 3246301 gene locus_tag LOCUS_32510 3245723 3246301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 3246319 3247332 gene locus_tag LOCUS_32520 3246319 3247332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390337.1 protein_id gnl|my_center|LOCUS_32520 3247337 3247624 gene locus_tag LOCUS_32530 3247337 3247624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 3247634 3247981 gene locus_tag LOCUS_32540 3247634 3247981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 3247978 3248331 gene locus_tag LOCUS_32550 3247978 3248331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 3248318 3248839 gene locus_tag LOCUS_32560 3248318 3248839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 3248836 3249255 gene locus_tag LOCUS_32570 3248836 3249255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 3249271 3249993 gene locus_tag LOCUS_32580 3249271 3249993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 3250048 3250551 gene locus_tag LOCUS_32590 3250048 3250551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 3250605 3250877 gene locus_tag LOCUS_32600 3250605 3250877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 3250911 3255527 gene locus_tag LOCUS_32610 3250911 3255527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 3255524 3255892 gene locus_tag LOCUS_32620 3255524 3255892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 3255913 3256341 gene locus_tag LOCUS_32630 3255913 3256341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 3256362 3262637 gene locus_tag LOCUS_32640 3256362 3262637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 3262683 3262955 gene locus_tag LOCUS_32650 3262683 3262955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 3263039 3263458 gene locus_tag LOCUS_32660 3263039 3263458 CDS product holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965147.1 protein_id gnl|my_center|LOCUS_32660 3263461 3264126 gene locus_tag LOCUS_32670 3263461 3264126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 3266098 3264563 gene locus_tag LOCUS_32680 3266098 3264563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 3266336 3266091 gene locus_tag LOCUS_32690 3266336 3266091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 3266599 3266895 gene locus_tag LOCUS_32700 3266599 3266895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 3267072 3266905 gene locus_tag LOCUS_32710 3267072 3266905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 3267765 3268745 gene locus_tag LOCUS_32720 3267765 3268745 CDS product D-isomer specific 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964851.1 protein_id gnl|my_center|LOCUS_32720 3268842 3269291 gene locus_tag LOCUS_32730 3268842 3269291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 3269288 3270667 gene locus_tag LOCUS_32740 3269288 3270667 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 protein_id gnl|my_center|LOCUS_32740 3270951 3272487 gene locus_tag LOCUS_r00070 3270951 3272487 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3272718 3275616 gene locus_tag LOCUS_r00080 3272718 3275616 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3275668 3275775 gene locus_tag LOCUS_r00090 3275668 3275775 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3275892 3277046 gene locus_tag LOCUS_32750 gene mnmA 3275892 3277046 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202943733.1 protein_id gnl|my_center|LOCUS_32750 3277097 3279271 gene locus_tag LOCUS_32760 3277097 3279271 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528083.1 protein_id gnl|my_center|LOCUS_32760 3279315 3279491 gene locus_tag LOCUS_32770 3279315 3279491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 3279514 3280629 gene locus_tag LOCUS_32780 3279514 3280629 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244365.1 protein_id gnl|my_center|LOCUS_32780 3280900 3283527 gene locus_tag LOCUS_32790 gene alaS 3280900 3283527 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811825.1 protein_id gnl|my_center|LOCUS_32790 3283587 3283844 gene locus_tag LOCUS_32800 3283587 3283844 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003719797.1 protein_id gnl|my_center|LOCUS_32800 3283844 3284257 gene locus_tag LOCUS_32810 gene ruvX 3283844 3284257 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229795.1 protein_id gnl|my_center|LOCUS_32810 3284299 3284559 gene locus_tag LOCUS_32820 3284299 3284559 CDS product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246199.1 protein_id gnl|my_center|LOCUS_32820 3284537 3285607 gene locus_tag LOCUS_32830 3284537 3285607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 3285617 3286249 gene locus_tag LOCUS_32840 gene udk 3285617 3286249 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355702.1 protein_id gnl|my_center|LOCUS_32840 3286279 3286758 gene locus_tag LOCUS_32850 gene greA 3286279 3286758 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011182999.1 protein_id gnl|my_center|LOCUS_32850 3286838 3287302 gene locus_tag LOCUS_32860 3286838 3287302 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583465.1 protein_id gnl|my_center|LOCUS_32860 3287431 3289275 gene locus_tag LOCUS_32870 3287431 3289275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 3289321 3290280 gene locus_tag LOCUS_32880 gene holA 3289321 3290280 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279916.1 protein_id gnl|my_center|LOCUS_32880 3290283 3291485 gene locus_tag LOCUS_32890 3290283 3291485 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902886.1 protein_id gnl|my_center|LOCUS_32890 3291502 3292005 gene locus_tag LOCUS_32900 3291502 3292005 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436147.1 protein_id gnl|my_center|LOCUS_32900 3292146 3295088 gene locus_tag LOCUS_32910 3292146 3295088 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166660.1 protein_id gnl|my_center|LOCUS_32910 3295088 3296065 gene locus_tag LOCUS_32920 gene ftsY 3295088 3296065 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007650.1 protein_id gnl|my_center|LOCUS_32920 3296058 3296372 gene locus_tag LOCUS_32930 3296058 3296372 CDS product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419333.1 protein_id gnl|my_center|LOCUS_32930 3296387 3297583 gene locus_tag LOCUS_32940 3296387 3297583 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223511.1 protein_id gnl|my_center|LOCUS_32940 3297583 3298530 gene locus_tag LOCUS_32950 3297583 3298530 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132452.1 protein_id gnl|my_center|LOCUS_32950 3298579 3299229 gene locus_tag LOCUS_32960 3298579 3299229 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263190.1 protein_id gnl|my_center|LOCUS_32960 3299280 3302351 gene locus_tag LOCUS_32970 gene dnaE 3299280 3302351 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229412.1 protein_id gnl|my_center|LOCUS_32970 3302358 3302837 gene locus_tag LOCUS_32980 3302358 3302837 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890795.1 protein_id gnl|my_center|LOCUS_32980 3303034 3303345 gene locus_tag LOCUS_32990 gene rplU 3303034 3303345 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000270907.1 protein_id gnl|my_center|LOCUS_32990 3303349 3303663 gene locus_tag LOCUS_33000 3303349 3303663 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732583.1 protein_id gnl|my_center|LOCUS_33000 3303666 3303950 gene locus_tag LOCUS_33010 gene rpmA 3303666 3303950 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944958.1 protein_id gnl|my_center|LOCUS_33010 3304011 3305300 gene locus_tag LOCUS_33020 gene obgE 3304011 3305300 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384537.1 protein_id gnl|my_center|LOCUS_33020 3305399 3307165 gene locus_tag LOCUS_33030 3305399 3307165 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193735789.1 protein_id gnl|my_center|LOCUS_33030 3307623 3307204 gene locus_tag LOCUS_33040 3307623 3307204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722815.1 protein_id gnl|my_center|LOCUS_33040 3307689 3308744 gene locus_tag LOCUS_33050 3307689 3308744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 3308842 3309549 gene locus_tag LOCUS_33060 3308842 3309549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 3309641 3310249 gene locus_tag LOCUS_33070 3309641 3310249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 3310365 3311117 gene locus_tag LOCUS_33080 3310365 3311117 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963545.1 protein_id gnl|my_center|LOCUS_33080 3311306 3312625 gene locus_tag LOCUS_33090 3311306 3312625 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869179.1 protein_id gnl|my_center|LOCUS_33090 3312615 3313133 gene locus_tag LOCUS_33100 3312615 3313133 CDS product nucleoside-triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047955.1 protein_id gnl|my_center|LOCUS_33100 3313130 3314125 gene locus_tag LOCUS_33110 3313130 3314125 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965288.1 protein_id gnl|my_center|LOCUS_33110 3314127 3315095 gene locus_tag LOCUS_33120 3314127 3315095 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460845.1 protein_id gnl|my_center|LOCUS_33120 3315092 3315862 gene locus_tag LOCUS_33130 3315092 3315862 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948946.1 protein_id gnl|my_center|LOCUS_33130 3315868 3316638 gene locus_tag LOCUS_33140 3315868 3316638 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861448.1 protein_id gnl|my_center|LOCUS_33140 3316629 3317093 gene locus_tag LOCUS_33150 3316629 3317093 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434060.1 protein_id gnl|my_center|LOCUS_33150 3317090 3319366 gene locus_tag LOCUS_33160 3317090 3319366 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897245.1 protein_id gnl|my_center|LOCUS_33160 3319356 3319913 gene locus_tag LOCUS_33170 gene mocA 3319356 3319913 CDS product molybdenum cofactor cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890188.1 protein_id gnl|my_center|LOCUS_33170 3319989 3320579 gene locus_tag LOCUS_33180 3319989 3320579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 3320576 3321142 gene locus_tag LOCUS_33190 3320576 3321142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 3321222 3322613 gene locus_tag LOCUS_33200 3321222 3322613 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 protein_id gnl|my_center|LOCUS_33200 3322630 3323211 gene locus_tag LOCUS_33210 gene ruvA 3322630 3323211 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229717.1 protein_id gnl|my_center|LOCUS_33210 3323215 3324228 gene locus_tag LOCUS_33220 gene ruvB 3323215 3324228 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344450.1 protein_id gnl|my_center|LOCUS_33220 3324581 3324225 gene locus_tag LOCUS_33230 3324581 3324225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 3324642 3325304 gene locus_tag LOCUS_33240 3324642 3325304 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398801.1 protein_id gnl|my_center|LOCUS_33240 3326586 3325285 gene locus_tag LOCUS_33250 gene spoVB 3326586 3325285 CDS product stage V sporulation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198301.1 protein_id gnl|my_center|LOCUS_33250 3326783 3327073 gene locus_tag LOCUS_33260 3326783 3327073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 3327070 3329355 gene locus_tag LOCUS_33270 gene secDF 3327070 3329355 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245970.1 protein_id gnl|my_center|LOCUS_33270 3329449 3331059 gene locus_tag LOCUS_33280 3329449 3331059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 3331113 3331628 gene locus_tag LOCUS_33290 3331113 3331628 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902332.1 protein_id gnl|my_center|LOCUS_33290 3331670 3333871 gene locus_tag LOCUS_33300 gene relA 3331670 3333871 CDS product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229747.1 protein_id gnl|my_center|LOCUS_33300 3333871 3334356 gene locus_tag LOCUS_33310 3333871 3334356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 3334467 3334967 gene locus_tag LOCUS_33320 3334467 3334967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 3335561 3334992 gene locus_tag LOCUS_33330 3335561 3334992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 3336637 3335561 gene locus_tag LOCUS_33340 3336637 3335561 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244707.1 protein_id gnl|my_center|LOCUS_33340 3336737 3337666 gene locus_tag LOCUS_33350 3336737 3337666 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387471.1 protein_id gnl|my_center|LOCUS_33350 3337822 3338331 gene locus_tag LOCUS_33360 3337822 3338331 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702323.1 protein_id gnl|my_center|LOCUS_33360 3338347 3338517 gene locus_tag LOCUS_33370 gene rpmF 3338347 3338517 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830121.1 protein_id gnl|my_center|LOCUS_33370 3338670 3339275 gene locus_tag LOCUS_33380 3338670 3339275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 3339471 3339938 gene locus_tag LOCUS_33390 gene rimP 3339471 3339938 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288499.1 protein_id gnl|my_center|LOCUS_33390 3339955 3341640 gene locus_tag LOCUS_33400 3339955 3341640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 3341664 3341924 gene locus_tag LOCUS_33410 gene rulR 3341664 3341924 CDS product glucose-induced regulator RulR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967250.1 protein_id gnl|my_center|LOCUS_33410 3341917 3342204 gene locus_tag LOCUS_33420 3341917 3342204 CDS product YlxQ family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722455.1 protein_id gnl|my_center|LOCUS_33420 3342213 3344066 gene locus_tag LOCUS_33430 gene infB 3342213 3344066 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036341.1 protein_id gnl|my_center|LOCUS_33430 3344081 3344419 gene locus_tag LOCUS_33440 gene rbfA 3344081 3344419 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967251.1 protein_id gnl|my_center|LOCUS_33440 3344772 3346403 gene locus_tag LOCUS_33450 3344772 3346403 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_33450 3347040 3346423 gene locus_tag LOCUS_33460 3347040 3346423 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666641.1 protein_id gnl|my_center|LOCUS_33460 3348095 3347037 gene locus_tag LOCUS_33470 3348095 3347037 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289599.1 protein_id gnl|my_center|LOCUS_33470 3348257 3349189 gene locus_tag LOCUS_33480 3348257 3349189 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057287.1 protein_id gnl|my_center|LOCUS_33480 3349201 3350334 gene locus_tag LOCUS_33490 3349201 3350334 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294551.1 protein_id gnl|my_center|LOCUS_33490 3350335 3351540 gene locus_tag LOCUS_33500 3350335 3351540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 3351656 3353107 gene locus_tag LOCUS_33510 3351656 3353107 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289243.1 protein_id gnl|my_center|LOCUS_33510 3353468 3354151 gene locus_tag LOCUS_33520 3353468 3354151 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986980.1 protein_id gnl|my_center|LOCUS_33520 3354156 3354680 gene locus_tag LOCUS_33530 3354156 3354680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 3354797 3355489 gene locus_tag LOCUS_33540 3354797 3355489 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393128.1 protein_id gnl|my_center|LOCUS_33540 3355493 3356284 gene locus_tag LOCUS_33550 3355493 3356284 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966326.1 protein_id gnl|my_center|LOCUS_33550 3356286 3357011 gene locus_tag LOCUS_33560 3356286 3357011 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986981.1 protein_id gnl|my_center|LOCUS_33560 3357027 3357593 gene locus_tag LOCUS_33570 3357027 3357593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 3357603 3359042 gene locus_tag LOCUS_33580 3357603 3359042 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837625.1 protein_id gnl|my_center|LOCUS_33580 3359057 3359953 gene locus_tag LOCUS_33590 gene rfbA 3359057 3359953 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068370.1 protein_id gnl|my_center|LOCUS_33590 3359971 3360996 gene locus_tag LOCUS_33600 gene rfbB 3359971 3360996 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461013.1 protein_id gnl|my_center|LOCUS_33600 3361012 3361914 gene locus_tag LOCUS_33610 gene rfbD 3361012 3361914 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027245.1 protein_id gnl|my_center|LOCUS_33610 3361941 3362543 gene locus_tag LOCUS_33620 gene rfbC 3361941 3362543 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965628.1 protein_id gnl|my_center|LOCUS_33620 3362719 3363549 gene locus_tag LOCUS_33630 3362719 3363549 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112142.1 protein_id gnl|my_center|LOCUS_33630 3364257 3364048 gene locus_tag LOCUS_33640 3364257 3364048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 3365341 3366180 gene locus_tag LOCUS_33650 3365341 3366180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 3366177 3367253 gene locus_tag LOCUS_33660 3366177 3367253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 3367232 3367915 gene locus_tag LOCUS_33670 3367232 3367915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33670 3367902 3368213 gene locus_tag LOCUS_33680 3367902 3368213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 3368203 3369336 gene locus_tag LOCUS_33690 3368203 3369336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 3369356 3370249 gene locus_tag LOCUS_33700 3369356 3370249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 3370273 3370863 gene locus_tag LOCUS_33710 3370273 3370863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 3370860 3371792 gene locus_tag LOCUS_33720 3370860 3371792 CDS product alpha-1,2-fucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288204.1 protein_id gnl|my_center|LOCUS_33720 3371809 3372675 gene locus_tag LOCUS_33730 3371809 3372675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 3373062 3372910 gene locus_tag LOCUS_33740 3373062 3372910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 3373076 3374188 gene locus_tag LOCUS_33750 3373076 3374188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 3374348 3374692 gene locus_tag LOCUS_33760 3374348 3374692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 3374727 3374915 gene locus_tag LOCUS_33770 3374727 3374915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 3375303 3375452 gene locus_tag LOCUS_33780 3375303 3375452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 3375421 3375633 gene locus_tag LOCUS_33790 3375421 3375633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 3377270 3375921 gene locus_tag LOCUS_33800 3377270 3375921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 3379973 3377619 gene locus_tag LOCUS_33810 3379973 3377619 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861289.1 protein_id gnl|my_center|LOCUS_33810 3380233 3381948 gene locus_tag LOCUS_33820 3380233 3381948 CDS product metalloendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860923.1 protein_id gnl|my_center|LOCUS_33820 3382228 3383865 gene locus_tag LOCUS_33830 3382228 3383865 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_33830 3383976 3385529 gene locus_tag LOCUS_33840 3383976 3385529 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812879.1 protein_id gnl|my_center|LOCUS_33840 3385736 3386275 gene locus_tag LOCUS_33850 3385736 3386275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246043.1 protein_id gnl|my_center|LOCUS_33850 3386340 3387269 gene locus_tag LOCUS_33860 3386340 3387269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 3389225 3387384 gene locus_tag LOCUS_33870 3389225 3387384 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963595.1 protein_id gnl|my_center|LOCUS_33870 3389984 3389373 gene locus_tag LOCUS_33880 gene plsY 3389984 3389373 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382346.1 protein_id gnl|my_center|LOCUS_33880 3390178 3392106 gene locus_tag LOCUS_33890 gene parE 3390178 3392106 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381887.1 protein_id gnl|my_center|LOCUS_33890 3392110 3394611 gene locus_tag LOCUS_33900 gene parC 3392110 3394611 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296998.1 protein_id gnl|my_center|LOCUS_33900 3394835 3395794 gene locus_tag LOCUS_33910 3394835 3395794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 3396309 3396944 gene locus_tag LOCUS_33920 3396309 3396944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 3396956 3398740 gene locus_tag LOCUS_33930 3396956 3398740 CDS product mannonate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861961.1 protein_id gnl|my_center|LOCUS_33930 3398743 3400923 gene locus_tag LOCUS_33940 3398743 3400923 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948909.1 protein_id gnl|my_center|LOCUS_33940 3401517 3400993 gene locus_tag LOCUS_33950 3401517 3400993 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393827.1 protein_id gnl|my_center|LOCUS_33950 3401725 3402165 gene locus_tag LOCUS_33960 gene spoVAC 3401725 3402165 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095399.1 protein_id gnl|my_center|LOCUS_33960 3402170 3403162 gene locus_tag LOCUS_33970 gene spoVAD 3402170 3403162 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230465.1 protein_id gnl|my_center|LOCUS_33970 3403165 3403515 gene locus_tag LOCUS_33980 gene spoVAE 3403165 3403515 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345915.1 protein_id gnl|my_center|LOCUS_33980 3403512 3404861 gene locus_tag LOCUS_33990 gene spoVAF 3403512 3404861 CDS product spore germination protein SpoVAF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230471.1 protein_id gnl|my_center|LOCUS_33990 3404984 3405418 gene locus_tag LOCUS_34000 3404984 3405418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 3405415 3405918 gene locus_tag LOCUS_34010 3405415 3405918 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810590.1 protein_id gnl|my_center|LOCUS_34010 3405923 3406819 gene locus_tag LOCUS_34020 3405923 3406819 CDS product DUF4261 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681717.1 protein_id gnl|my_center|LOCUS_34020 3406966 3407706 gene locus_tag LOCUS_34030 3406966 3407706 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723598.1 protein_id gnl|my_center|LOCUS_34030 3407693 3408250 gene locus_tag LOCUS_34040 gene scpB 3407693 3408250 CDS product segregation/condensation protein ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000376225.1 protein_id gnl|my_center|LOCUS_34040 3408640 3409347 gene locus_tag LOCUS_34050 3408640 3409347 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860731.1 protein_id gnl|my_center|LOCUS_34050 3409350 3410270 gene locus_tag LOCUS_34060 3409350 3410270 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888178.1 protein_id gnl|my_center|LOCUS_34060 3410414 3411337 gene locus_tag LOCUS_34070 3410414 3411337 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860730.1 protein_id gnl|my_center|LOCUS_34070 3411330 3412064 gene locus_tag LOCUS_34080 3411330 3412064 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895383.1 protein_id gnl|my_center|LOCUS_34080 3412074 3412811 gene locus_tag LOCUS_34090 3412074 3412811 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860729.1 protein_id gnl|my_center|LOCUS_34090 3412795 3412980 gene locus_tag LOCUS_34100 3412795 3412980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 3413360 3413518 gene locus_tag LOCUS_34110 3413360 3413518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 3413600 3415240 gene locus_tag LOCUS_34120 3413600 3415240 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294025.1 protein_id gnl|my_center|LOCUS_34120 3415240 3415812 gene locus_tag LOCUS_34130 3415240 3415812 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964176.1 protein_id gnl|my_center|LOCUS_34130 3415870 3416847 gene locus_tag LOCUS_34140 gene dacB 3415870 3416847 CDS product D-alanyl-D-alanine carboxypeptidase DacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252614.1 protein_id gnl|my_center|LOCUS_34140 3416844 3417416 gene locus_tag LOCUS_34150 gene spmA 3416844 3417416 CDS product spore maturation protein SpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247808.1 protein_id gnl|my_center|LOCUS_34150 3417409 3417921 gene locus_tag LOCUS_34160 gene spmB 3417409 3417921 CDS product spore maturation protein SpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029514.1 protein_id gnl|my_center|LOCUS_34160 3417984 3418460 gene locus_tag LOCUS_34170 3417984 3418460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 3418519 3419112 gene locus_tag LOCUS_34180 3418519 3419112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 3419081 3419341 gene locus_tag LOCUS_34190 3419081 3419341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 3419760 3420086 gene locus_tag LOCUS_34200 3419760 3420086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 3420070 3420597 gene locus_tag LOCUS_34210 3420070 3420597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 3420610 3421251 gene locus_tag LOCUS_34220 3420610 3421251 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243153.1 protein_id gnl|my_center|LOCUS_34220 3421235 3422008 gene locus_tag LOCUS_34230 3421235 3422008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 3422108 3422845 gene locus_tag LOCUS_34240 gene rluB 3422108 3422845 CDS product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440556.1 protein_id gnl|my_center|LOCUS_34240 3422895 3423641 gene locus_tag LOCUS_34250 3422895 3423641 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183200.1 protein_id gnl|my_center|LOCUS_34250 3423638 3424417 gene locus_tag LOCUS_34260 3423638 3424417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 3424472 3425758 gene locus_tag LOCUS_34270 gene mtaB 3424472 3425758 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108686.1 protein_id gnl|my_center|LOCUS_34270 3425772 3427238 gene locus_tag LOCUS_34280 3425772 3427238 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016996.1 protein_id gnl|my_center|LOCUS_34280 3427367 3427546 gene locus_tag LOCUS_34290 gene rpsU 3427367 3427546 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565673.1 protein_id gnl|my_center|LOCUS_34290 3427957 3429477 gene locus_tag LOCUS_34300 3427957 3429477 CDS product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476410.1 protein_id gnl|my_center|LOCUS_34300 3429470 3430207 gene locus_tag LOCUS_34310 3429470 3430207 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860947.1 protein_id gnl|my_center|LOCUS_34310 3430320 3430841 gene locus_tag LOCUS_34320 3430320 3430841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 3431043 3431243 gene locus_tag LOCUS_34330 3431043 3431243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 3431233 3432159 gene locus_tag LOCUS_34340 3431233 3432159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 3432176 3433168 gene locus_tag LOCUS_34350 3432176 3433168 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840501.1 protein_id gnl|my_center|LOCUS_34350 3433140 3433820 gene locus_tag LOCUS_34360 gene phoP 3433140 3433820 CDS product two-component system response regulator PhoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229442.1 protein_id gnl|my_center|LOCUS_34360 3433807 3435027 gene locus_tag LOCUS_34370 3433807 3435027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 3435302 3435141 gene locus_tag LOCUS_34380 3435302 3435141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 3435561 3435487 gene locus_tag LOCUS_t00430 3435561 3435487 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3435769 3436692 gene locus_tag LOCUS_34390 3435769 3436692 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716331.1 protein_id gnl|my_center|LOCUS_34390 3436760 3437701 gene locus_tag LOCUS_34400 gene pstC 3436760 3437701 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454007.1 protein_id gnl|my_center|LOCUS_34400 3437701 3438942 gene locus_tag LOCUS_34410 3437701 3438942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 3438955 3439713 gene locus_tag LOCUS_34420 gene pstB 3438955 3439713 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432349.1 protein_id gnl|my_center|LOCUS_34420 3439726 3440364 gene locus_tag LOCUS_34430 gene phoU 3439726 3440364 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251234.1 protein_id gnl|my_center|LOCUS_34430 3442073 3440391 gene locus_tag LOCUS_34440 3442073 3440391 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456248.1 protein_id gnl|my_center|LOCUS_34440 3442272 3442739 gene locus_tag LOCUS_34450 gene ybeY 3442272 3442739 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494134.1 protein_id gnl|my_center|LOCUS_34450 3442708 3443064 gene locus_tag LOCUS_34460 3442708 3443064 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794207.1 protein_id gnl|my_center|LOCUS_34460 3443064 3443468 gene locus_tag LOCUS_34470 gene cdd 3443064 3443468 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016798.1 protein_id gnl|my_center|LOCUS_34470 3443468 3444364 gene locus_tag LOCUS_34480 gene era 3443468 3444364 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080230.1 protein_id gnl|my_center|LOCUS_34480 3444357 3445091 gene locus_tag LOCUS_34490 3444357 3445091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 3445411 3446793 gene locus_tag LOCUS_34500 3445411 3446793 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048370.1 protein_id gnl|my_center|LOCUS_34500 3446812 3448578 gene locus_tag LOCUS_34510 gene dnaG 3446812 3448578 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528211.1 protein_id gnl|my_center|LOCUS_34510 3448584 3449774 gene locus_tag LOCUS_34520 gene rpoD 3448584 3449774 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002440071.1 protein_id gnl|my_center|LOCUS_34520 3449776 3450435 gene locus_tag LOCUS_34530 3449776 3450435 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547613.1 protein_id gnl|my_center|LOCUS_34530 3451355 3450447 gene locus_tag LOCUS_34540 gene ispH 3451355 3450447 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706669.1 protein_id gnl|my_center|LOCUS_34540 3451538 3452899 gene locus_tag LOCUS_34550 gene cshB 3451538 3452899 CDS product DEAD-box ATP-dependent RNA helicase CshB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399101.1 protein_id gnl|my_center|LOCUS_34550 3452896 3453777 gene locus_tag LOCUS_34560 3452896 3453777 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912466.1 protein_id gnl|my_center|LOCUS_34560 3453777 3454310 gene locus_tag LOCUS_34570 3453777 3454310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 3455411 3454341 gene locus_tag LOCUS_34580 gene ispG 3455411 3454341 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002194540.1 protein_id gnl|my_center|LOCUS_34580 3455602 3456981 gene locus_tag LOCUS_34590 3455602 3456981 CDS product ISNCY family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589001.1 protein_id gnl|my_center|LOCUS_34590 3457107 3459203 gene locus_tag LOCUS_34600 3457107 3459203 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721943.1 protein_id gnl|my_center|LOCUS_34600 3459269 3459418 gene locus_tag LOCUS_34610 gene rpmG 3459269 3459418 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831295.1 protein_id gnl|my_center|LOCUS_34610 3459460 3460077 gene locus_tag LOCUS_34620 3459460 3460077 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356716.1 protein_id gnl|my_center|LOCUS_34620 3460165 3461157 gene locus_tag LOCUS_34630 gene comGA 3460165 3461157 CDS product competence type IV pilus ATPase ComGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013170.1 protein_id gnl|my_center|LOCUS_34630 3461048 3462103 gene locus_tag LOCUS_34640 3461048 3462103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 3462126 3462428 gene locus_tag LOCUS_34650 gene comGC 3462126 3462428 CDS product competence type IV pilus major pilin ComGC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732258.1 protein_id gnl|my_center|LOCUS_34650 3462442 3462801 gene locus_tag LOCUS_34660 3462442 3462801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 3462791 3462955 gene locus_tag LOCUS_34670 3462791 3462955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 3462927 3463322 gene locus_tag LOCUS_34680 3462927 3463322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 3463255 3463716 gene locus_tag LOCUS_34690 3463255 3463716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 3463763 3464092 gene locus_tag LOCUS_34700 3463763 3464092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 3464165 3464728 gene locus_tag LOCUS_34710 gene efp 3464165 3464728 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183306.1 protein_id gnl|my_center|LOCUS_34710 3464843 3465805 gene locus_tag LOCUS_34720 3464843 3465805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 3465805 3466467 gene locus_tag LOCUS_34730 gene cmk 3465805 3466467 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357612.1 protein_id gnl|my_center|LOCUS_34730 3466506 3467822 gene locus_tag LOCUS_34740 gene engA 3466506 3467822 CDS product ribosome-associated GTPase EngA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125893.1 protein_id gnl|my_center|LOCUS_34740 3467827 3468825 gene locus_tag LOCUS_34750 3467827 3468825 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357312.1 protein_id gnl|my_center|LOCUS_34750 3468943 3470535 gene locus_tag LOCUS_34760 3468943 3470535 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048268.1 protein_id gnl|my_center|LOCUS_34760 3470578 3470760 gene locus_tag LOCUS_34770 3470578 3470760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 3470856 3472334 gene locus_tag LOCUS_34780 gene spoIVA 3470856 3472334 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230572.1 protein_id gnl|my_center|LOCUS_34780 3472442 3472726 gene locus_tag LOCUS_34790 3472442 3472726 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701976.1 protein_id gnl|my_center|LOCUS_34790 3472843 3473556 gene locus_tag LOCUS_34800 3472843 3473556 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047881.1 protein_id gnl|my_center|LOCUS_34800 3473787 3473650 gene locus_tag LOCUS_34810 3473787 3473650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 3474898 3474158 gene locus_tag LOCUS_34820 3474898 3474158 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948177.1 protein_id gnl|my_center|LOCUS_34820 3476231 3474915 gene locus_tag LOCUS_34830 3476231 3474915 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964280.1 protein_id gnl|my_center|LOCUS_34830 3476505 3477188 gene locus_tag LOCUS_34840 3476505 3477188 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426355.1 protein_id gnl|my_center|LOCUS_34840 3477376 3478083 gene locus_tag LOCUS_34850 3477376 3478083 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047943.1 protein_id gnl|my_center|LOCUS_34850 3478102 3479532 gene locus_tag LOCUS_34860 gene purB 3478102 3479532 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986778.1 protein_id gnl|my_center|LOCUS_34860 3481166 3479571 gene locus_tag LOCUS_34870 3481166 3479571 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966175.1 protein_id gnl|my_center|LOCUS_34870 3481743 3481171 gene locus_tag LOCUS_34880 3481743 3481171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 3483146 3481863 gene locus_tag LOCUS_34890 3483146 3481863 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015701.1 protein_id gnl|my_center|LOCUS_34890 3484182 3483349 gene locus_tag LOCUS_34900 3484182 3483349 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430209.1 protein_id gnl|my_center|LOCUS_34900 3485396 3484206 gene locus_tag LOCUS_34910 gene deoB 3485396 3484206 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046067.1 protein_id gnl|my_center|LOCUS_34910 3486294 3485383 gene locus_tag LOCUS_34920 gene xerD 3486294 3485383 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390088.1 protein_id gnl|my_center|LOCUS_34920 3487020 3486358 gene locus_tag LOCUS_34930 3487020 3486358 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775270.1 protein_id gnl|my_center|LOCUS_34930 3487675 3487076 gene locus_tag LOCUS_34940 3487675 3487076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 3488907 3487741 gene locus_tag LOCUS_34950 3488907 3487741 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398755.1 protein_id gnl|my_center|LOCUS_34950 3489795 3488962 gene locus_tag LOCUS_34960 gene spo0A 3489795 3488962 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226427.1 protein_id gnl|my_center|LOCUS_34960 3490962 3489979 gene locus_tag LOCUS_34970 3490962 3489979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 3492670 3491021 gene locus_tag LOCUS_34980 gene recN 3492670 3491021 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699855.1 protein_id gnl|my_center|LOCUS_34980 3493472 3492690 gene locus_tag LOCUS_34990 3493472 3492690 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111875.1 protein_id gnl|my_center|LOCUS_34990 3495339 3493462 gene locus_tag LOCUS_35000 gene dxs 3495339 3493462 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366452.1 protein_id gnl|my_center|LOCUS_35000 3496195 3495353 gene locus_tag LOCUS_35010 3496195 3495353 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230262.1 protein_id gnl|my_center|LOCUS_35010 3496403 3496188 gene locus_tag LOCUS_35020 3496403 3496188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 3497731 3496400 gene locus_tag LOCUS_35030 gene xseA 3497731 3496400 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415260.1 protein_id gnl|my_center|LOCUS_35030 3498105 3497728 gene locus_tag LOCUS_35040 3498105 3497728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 3499073 3498180 gene locus_tag LOCUS_35050 3499073 3498180 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958093.1 protein_id gnl|my_center|LOCUS_35050 3499450 3499121 gene locus_tag LOCUS_35060 3499450 3499121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 3499821 3499522 gene locus_tag LOCUS_35070 3499821 3499522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 3500425 3499907 gene locus_tag LOCUS_35080 3500425 3499907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 3501882 3500506 gene locus_tag LOCUS_35090 3501882 3500506 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454447.1 protein_id gnl|my_center|LOCUS_35090 3502817 3501873 gene locus_tag LOCUS_35100 gene ribF 3502817 3501873 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766711.1 protein_id gnl|my_center|LOCUS_35100 3503656 3502826 gene locus_tag LOCUS_35110 gene truB 3503656 3502826 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836811.1 protein_id gnl|my_center|LOCUS_35110 3503827 3504606 gene locus_tag LOCUS_35120 3503827 3504606 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947991.1 protein_id gnl|my_center|LOCUS_35120 3505201 3504623 gene locus_tag LOCUS_35130 3505201 3504623 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965241.1 protein_id gnl|my_center|LOCUS_35130 3505714 3506514 gene locus_tag LOCUS_35140 3505714 3506514 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813277.1 protein_id gnl|my_center|LOCUS_35140 3506514 3507446 gene locus_tag LOCUS_35150 gene ligD 3506514 3507446 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879221.1 protein_id gnl|my_center|LOCUS_35150 3509570 3507567 gene locus_tag LOCUS_35160 3509570 3507567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 3510181 3509567 gene locus_tag LOCUS_35170 3510181 3509567 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435768.1 protein_id gnl|my_center|LOCUS_35170 3512196 3510442 gene locus_tag LOCUS_35180 gene aspS 3512196 3510442 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840895.1 protein_id gnl|my_center|LOCUS_35180 3513547 3512207 gene locus_tag LOCUS_35190 gene hisS 3513547 3512207 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229755.1 protein_id gnl|my_center|LOCUS_35190 3514821 3513853 gene locus_tag LOCUS_35200 3514821 3513853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 3515621 3514884 gene locus_tag LOCUS_35210 3515621 3514884 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464874.1 protein_id gnl|my_center|LOCUS_35210 3515992 3515738 gene locus_tag LOCUS_35220 3515992 3515738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 3518444 3516045 gene locus_tag LOCUS_35230 gene leuS 3518444 3516045 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285916.1 protein_id gnl|my_center|LOCUS_35230 3518973 3518731 gene locus_tag LOCUS_35240 3518973 3518731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 3520796 3519411 gene locus_tag LOCUS_35250 gene gltA 3520796 3519411 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048248.1 protein_id gnl|my_center|LOCUS_35250 3521641 3520796 gene locus_tag LOCUS_35260 3521641 3520796 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932161.1 protein_id gnl|my_center|LOCUS_35260 3522541 3521768 gene locus_tag LOCUS_35270 gene aroD 3522541 3521768 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897376.1 protein_id gnl|my_center|LOCUS_35270 3522878 3524131 gene locus_tag LOCUS_35280 3522878 3524131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 3524153 3525169 gene locus_tag LOCUS_35290 gene aroF 3524153 3525169 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964210.1 protein_id gnl|my_center|LOCUS_35290 3525381 3525560 gene locus_tag LOCUS_35300 3525381 3525560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 3526409 3525576 gene locus_tag LOCUS_35310 gene fakB1 3526409 3525576 CDS product fatty acid kinase binding subunit FakB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829661.1 protein_id gnl|my_center|LOCUS_35310 3527106 3526423 gene locus_tag LOCUS_35320 3527106 3526423 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680514.1 protein_id gnl|my_center|LOCUS_35320 3527266 3528219 gene locus_tag LOCUS_35330 3527266 3528219 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868031.1 protein_id gnl|my_center|LOCUS_35330 3528275 3528922 gene locus_tag LOCUS_35340 3528275 3528922 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438111.1 protein_id gnl|my_center|LOCUS_35340 3529461 3528895 gene locus_tag LOCUS_35350 3529461 3528895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 3530265 3529498 gene locus_tag LOCUS_35360 3530265 3529498 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016102.1 protein_id gnl|my_center|LOCUS_35360 3530785 3530267 gene locus_tag LOCUS_35370 3530785 3530267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 3532434 3530908 gene locus_tag LOCUS_35380 3532434 3530908 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392862.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35380 3532995 3532498 gene locus_tag LOCUS_35390 3532995 3532498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35390 3534233 3533082 gene locus_tag LOCUS_35400 3534233 3533082 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021359756.1 protein_id gnl|my_center|LOCUS_35400 3534338 3534922 gene locus_tag LOCUS_35410 3534338 3534922 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354991.1 protein_id gnl|my_center|LOCUS_35410 3534923 3535270 gene locus_tag LOCUS_35420 3534923 3535270 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943036.1 protein_id gnl|my_center|LOCUS_35420 3536927 3535623 gene locus_tag LOCUS_35430 3536927 3535623 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485262.1 protein_id gnl|my_center|LOCUS_35430 3537382 3536915 gene locus_tag LOCUS_35440 gene folA 3537382 3536915 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707142.1 protein_id gnl|my_center|LOCUS_35440 3538095 3537400 gene locus_tag LOCUS_35450 3538095 3537400 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217125.1 protein_id gnl|my_center|LOCUS_35450 3539803 3538097 gene locus_tag LOCUS_35460 3539803 3538097 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732534.1 protein_id gnl|my_center|LOCUS_35460 3540344 3539823 gene locus_tag LOCUS_35470 3540344 3539823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 3540601 3540437 gene locus_tag LOCUS_35480 3540601 3540437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 3540826 3540647 gene locus_tag LOCUS_35490 3540826 3540647 CDS product sporulation protein Cse60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223398.1 protein_id gnl|my_center|LOCUS_35490 3541709 3540855 gene locus_tag LOCUS_35500 gene dapA 3541709 3540855 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245816.1 protein_id gnl|my_center|LOCUS_35500 3542288 3541710 gene locus_tag LOCUS_35510 3542288 3541710 CDS product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460384.1 protein_id gnl|my_center|LOCUS_35510 3543049 3542285 gene locus_tag LOCUS_35520 gene dpaA 3543049 3542285 CDS product dipicolinic acid synthetase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954735.1 protein_id gnl|my_center|LOCUS_35520 3544361 3543126 gene locus_tag LOCUS_35530 gene tyrS 3544361 3543126 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021100.1 protein_id gnl|my_center|LOCUS_35530 3545627 3544632 gene locus_tag LOCUS_35540 gene ccpA 3545627 3544632 CDS product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229285.1 protein_id gnl|my_center|LOCUS_35540 3546178 3545648 gene locus_tag LOCUS_35550 3546178 3545648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 3546564 3546178 gene locus_tag LOCUS_35560 3546564 3546178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 3547927 3546614 gene locus_tag LOCUS_35570 gene murC 3547927 3546614 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989758.1 protein_id gnl|my_center|LOCUS_35570 3548701 3547940 gene locus_tag LOCUS_35580 3548701 3547940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 3549048 3548716 gene locus_tag LOCUS_35590 3549048 3548716 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838193.1 protein_id gnl|my_center|LOCUS_35590 3549799 3549143 gene locus_tag LOCUS_35600 gene trmB 3549799 3549143 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398646.1 protein_id gnl|my_center|LOCUS_35600 3551192 3549810 gene locus_tag LOCUS_35610 gene pepV 3551192 3549810 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732537.1 protein_id gnl|my_center|LOCUS_35610 3552125 3551565 gene locus_tag LOCUS_35620 3552125 3551565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 3554501 3552330 gene locus_tag LOCUS_35630 gene pnp 3554501 3552330 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378800.1 protein_id gnl|my_center|LOCUS_35630 3554871 3554605 gene locus_tag LOCUS_35640 gene rpsO 3554871 3554605 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419491.1 protein_id gnl|my_center|LOCUS_35640 3556378 3555002 gene locus_tag LOCUS_35650 3556378 3555002 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_35650 3557136 3556441 gene locus_tag LOCUS_35660 3557136 3556441 CDS product biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_154460019.1 protein_id gnl|my_center|LOCUS_35660 3557483 3557268 gene locus_tag LOCUS_35670 3557483 3557268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 3557882 3557553 gene locus_tag LOCUS_35680 3557882 3557553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 3559488 3558037 gene locus_tag LOCUS_35690 3559488 3558037 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888725.1 protein_id gnl|my_center|LOCUS_35690 3560456 3559581 gene locus_tag LOCUS_35700 3560456 3559581 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004121002.1 protein_id gnl|my_center|LOCUS_35700 3560659 3561231 gene locus_tag LOCUS_35710 3560659 3561231 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948106.1 protein_id gnl|my_center|LOCUS_35710 3561861 3561259 gene locus_tag LOCUS_35720 3561861 3561259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 3562810 3561902 gene locus_tag LOCUS_35730 gene argF 3562810 3561902 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393769.1 protein_id gnl|my_center|LOCUS_35730 3564012 3562843 gene locus_tag LOCUS_35740 3564012 3562843 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861434.1 protein_id gnl|my_center|LOCUS_35740 3564881 3564015 gene locus_tag LOCUS_35750 gene argB 3564881 3564015 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435171.1 protein_id gnl|my_center|LOCUS_35750 3566118 3564901 gene locus_tag LOCUS_35760 gene argJ 3566118 3564901 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435168.1 protein_id gnl|my_center|LOCUS_35760 3567176 3566136 gene locus_tag LOCUS_35770 gene argC 3567176 3566136 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861435.1 protein_id gnl|my_center|LOCUS_35770 3568554 3567178 gene locus_tag LOCUS_35780 gene argH 3568554 3567178 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393767.1 protein_id gnl|my_center|LOCUS_35780 3569026 3568586 gene locus_tag LOCUS_35790 3569026 3568586 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673332.1 protein_id gnl|my_center|LOCUS_35790 3570259 3569036 gene locus_tag LOCUS_35800 3570259 3569036 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_35800 3570729 3571928 gene locus_tag LOCUS_35810 3570729 3571928 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263541.1 protein_id gnl|my_center|LOCUS_35810 3572264 3572007 gene locus_tag LOCUS_35820 3572264 3572007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 3572408 3573163 gene locus_tag LOCUS_35830 3572408 3573163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 3574046 3573270 gene locus_tag LOCUS_35840 3574046 3573270 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764352.1 protein_id gnl|my_center|LOCUS_35840 3575081 3574050 gene locus_tag LOCUS_35850 3575081 3574050 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461701.1 protein_id gnl|my_center|LOCUS_35850 3575529 3576068 gene locus_tag LOCUS_35860 gene dcd 3575529 3576068 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881042.1 protein_id gnl|my_center|LOCUS_35860 3577663 3576113 gene locus_tag LOCUS_35870 3577663 3576113 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083710.1 protein_id gnl|my_center|LOCUS_35870 3578535 3577756 gene locus_tag LOCUS_35880 3578535 3577756 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965999.1 protein_id gnl|my_center|LOCUS_35880 3579471 3578632 gene locus_tag LOCUS_35890 3579471 3578632 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901831.1 protein_id gnl|my_center|LOCUS_35890 3580573 3579551 gene locus_tag LOCUS_35900 3580573 3579551 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417347.1 protein_id gnl|my_center|LOCUS_35900 3581377 3580586 gene locus_tag LOCUS_35910 gene etfB 3581377 3580586 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427760.1 protein_id gnl|my_center|LOCUS_35910 3582537 3581398 gene locus_tag LOCUS_35920 3582537 3581398 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418888.1 protein_id gnl|my_center|LOCUS_35920 3583086 3584291 gene locus_tag LOCUS_35930 3583086 3584291 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903642.1 protein_id gnl|my_center|LOCUS_35930 3584979 3584335 gene locus_tag LOCUS_35940 gene pcp 3584979 3584335 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287081.1 protein_id gnl|my_center|LOCUS_35940 3585950 3584997 gene locus_tag LOCUS_35950 3585950 3584997 CDS product DUF979 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287082.1 protein_id gnl|my_center|LOCUS_35950 3586633 3585947 gene locus_tag LOCUS_35960 3586633 3585947 CDS product DUF969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287083.1 protein_id gnl|my_center|LOCUS_35960 3588876 3586774 gene locus_tag LOCUS_35970 gene feoB 3588876 3586774 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439379.1 protein_id gnl|my_center|LOCUS_35970 3589102 3588866 gene locus_tag LOCUS_35980 3589102 3588866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 3589613 3589197 gene locus_tag LOCUS_35990 3589613 3589197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 3590228 3589626 gene locus_tag LOCUS_36000 3590228 3589626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 3591411 3590290 gene locus_tag LOCUS_36010 3591411 3590290 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583054.1 protein_id gnl|my_center|LOCUS_36010 3592387 3591476 gene locus_tag LOCUS_36020 gene metA 3592387 3591476 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814315.1 protein_id gnl|my_center|LOCUS_36020 3593671 3592409 gene locus_tag LOCUS_36030 3593671 3592409 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_36030 3594678 3593728 gene locus_tag LOCUS_36040 3594678 3593728 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964789.1 protein_id gnl|my_center|LOCUS_36040 3594813 3595490 gene locus_tag LOCUS_36050 3594813 3595490 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670138.1 protein_id gnl|my_center|LOCUS_36050 3595764 3595691 gene locus_tag LOCUS_t00440 3595764 3595691 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3595917 3596204 gene locus_tag LOCUS_36060 3595917 3596204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 3597024 3596254 gene locus_tag LOCUS_36070 3597024 3596254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36070 3597668 3597150 gene locus_tag LOCUS_36080 3597668 3597150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36080 3597998 3597735 gene locus_tag LOCUS_36090 3597998 3597735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36090 3599446 3597941 gene locus_tag LOCUS_36100 3599446 3597941 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931645.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36100 3600592 3599525 gene locus_tag LOCUS_36110 3600592 3599525 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386380.1 protein_id gnl|my_center|LOCUS_36110 3600992 3600597 gene locus_tag LOCUS_36120 3600992 3600597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 3601357 3600989 gene locus_tag LOCUS_36130 3601357 3600989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 3601806 3601354 gene locus_tag LOCUS_36140 3601806 3601354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 3602113 3601808 gene locus_tag LOCUS_36150 3602113 3601808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 3603138 3602113 gene locus_tag LOCUS_36160 3603138 3602113 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892080.1 protein_id gnl|my_center|LOCUS_36160 3604103 3603156 gene locus_tag LOCUS_36170 3604103 3603156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 3604274 3604744 gene locus_tag LOCUS_36180 gene sigY 3604274 3604744 CDS product RNA polymerase sigma factor SigY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243678.1 protein_id gnl|my_center|LOCUS_36180 3604741 3605262 gene locus_tag LOCUS_36190 3604741 3605262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 3605259 3605957 gene locus_tag LOCUS_36200 3605259 3605957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 3606418 3606032 gene locus_tag LOCUS_36210 3606418 3606032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 3607024 3606515 gene locus_tag LOCUS_36220 3607024 3606515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 3607181 3606996 gene locus_tag LOCUS_36230 3607181 3606996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 3607517 3607275 gene locus_tag LOCUS_36240 3607517 3607275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 3608293 3607613 gene locus_tag LOCUS_36250 3608293 3607613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 3608690 3608818 gene locus_tag LOCUS_36260 3608690 3608818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 3609625 3608861 gene locus_tag LOCUS_36270 3609625 3608861 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435927.1 protein_id gnl|my_center|LOCUS_36270 3610539 3609622 gene locus_tag LOCUS_36280 3610539 3609622 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860718.1 protein_id gnl|my_center|LOCUS_36280 3610736 3610536 gene locus_tag LOCUS_36290 3610736 3610536 CDS product PLD nuclease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562727.1 protein_id gnl|my_center|LOCUS_36290 3611850 3610738 gene locus_tag LOCUS_36300 3611850 3610738 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659021.1 protein_id gnl|my_center|LOCUS_36300 3612023 3612826 gene locus_tag LOCUS_36310 3612023 3612826 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861671.1 protein_id gnl|my_center|LOCUS_36310 3613526 3612885 gene locus_tag LOCUS_36320 3613526 3612885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 3614167 3613523 gene locus_tag LOCUS_36330 3614167 3613523 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460105.1 protein_id gnl|my_center|LOCUS_36330 3614794 3614171 gene locus_tag LOCUS_36340 3614794 3614171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 3615606 3614791 gene locus_tag LOCUS_36350 3615606 3614791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 3616243 3615728 gene locus_tag LOCUS_36360 3616243 3615728 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881124.1 protein_id gnl|my_center|LOCUS_36360 3617636 3616236 gene locus_tag LOCUS_36370 gene sufB 3617636 3616236 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118827.1 protein_id gnl|my_center|LOCUS_36370 3618078 3617626 gene locus_tag LOCUS_36380 3618078 3617626 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966566.1 protein_id gnl|my_center|LOCUS_36380 3619324 3618092 gene locus_tag LOCUS_36390 3619324 3618092 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172824500.1 protein_id gnl|my_center|LOCUS_36390 3620117 3619317 gene locus_tag LOCUS_36400 3620117 3619317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 3620932 3620120 gene locus_tag LOCUS_36410 gene sufC 3620932 3620120 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929158.1 protein_id gnl|my_center|LOCUS_36410 3621169 3622179 gene locus_tag LOCUS_36420 3621169 3622179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 3622193 3623068 gene locus_tag LOCUS_36430 3622193 3623068 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906107.1 protein_id gnl|my_center|LOCUS_36430 3623141 3623536 gene locus_tag LOCUS_36440 3623141 3623536 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278316.1 protein_id gnl|my_center|LOCUS_36440 3624074 3623565 gene locus_tag LOCUS_36450 3624074 3623565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 3624944 3624084 gene locus_tag LOCUS_36460 3624944 3624084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 3625495 3625013 gene locus_tag LOCUS_36470 gene coaD 3625495 3625013 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728846.1 protein_id gnl|my_center|LOCUS_36470 3626052 3625492 gene locus_tag LOCUS_36480 gene rsmD 3626052 3625492 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933092.1 protein_id gnl|my_center|LOCUS_36480 3627399 3626158 gene locus_tag LOCUS_36490 3627399 3626158 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830097.1 protein_id gnl|my_center|LOCUS_36490 3627542 3628102 gene locus_tag LOCUS_36500 gene def 3627542 3628102 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700015.1 protein_id gnl|my_center|LOCUS_36500 3628226 3630079 gene locus_tag LOCUS_36510 gene rnjA 3628226 3630079 CDS product ribonuclease J1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670368.1 protein_id gnl|my_center|LOCUS_36510 3630177 3631046 gene locus_tag LOCUS_36520 3630177 3631046 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002026257.1 protein_id gnl|my_center|LOCUS_36520 3631200 3632315 gene locus_tag LOCUS_36530 3631200 3632315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 3632337 3633452 gene locus_tag LOCUS_36540 3632337 3633452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 3635885 3633483 gene locus_tag LOCUS_36550 gene pheT 3635885 3633483 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398979.1 protein_id gnl|my_center|LOCUS_36550 3636937 3635897 gene locus_tag LOCUS_36560 gene pheS 3636937 3635897 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398818.1 protein_id gnl|my_center|LOCUS_36560 3637326 3638462 gene locus_tag LOCUS_36570 3637326 3638462 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986549.1 protein_id gnl|my_center|LOCUS_36570 3640373 3638484 gene locus_tag LOCUS_36580 3640373 3638484 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_36580 3642283 3640397 gene locus_tag LOCUS_36590 3642283 3640397 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_36590 3642836 3642300 gene locus_tag LOCUS_36600 3642836 3642300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 3644186 3642849 gene locus_tag LOCUS_36610 3644186 3642849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36610 3646236 3644341 gene locus_tag LOCUS_36620 3646236 3644341 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_36620 3647059 3646373 gene locus_tag LOCUS_36630 3647059 3646373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 3648113 3647061 gene locus_tag LOCUS_36640 3648113 3647061 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583239.1 protein_id gnl|my_center|LOCUS_36640 3649795 3648122 gene locus_tag LOCUS_36650 3649795 3648122 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460315.1 protein_id gnl|my_center|LOCUS_36650 3650797 3649811 gene locus_tag LOCUS_36660 3650797 3649811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 3652290 3651100 gene locus_tag LOCUS_36670 3652290 3651100 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860746.1 protein_id gnl|my_center|LOCUS_36670 3652572 3652369 gene locus_tag LOCUS_36680 3652572 3652369 CDS product excisionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004613735.1 protein_id gnl|my_center|LOCUS_36680 3653191 3652946 gene locus_tag LOCUS_36690 3653191 3652946 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860747.1 protein_id gnl|my_center|LOCUS_36690 3653614 3653195 gene locus_tag LOCUS_36700 3653614 3653195 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003061815.1 protein_id gnl|my_center|LOCUS_36700 3654109 3653885 gene locus_tag LOCUS_36710 3654109 3653885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860757.1 protein_id gnl|my_center|LOCUS_36710 3654847 3654131 gene locus_tag LOCUS_36720 3654847 3654131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 3655659 3654844 gene locus_tag LOCUS_36730 3655659 3654844 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221995.1 protein_id gnl|my_center|LOCUS_36730 3656456 3655662 gene locus_tag LOCUS_36740 3656456 3655662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 3657949 3656576 gene locus_tag LOCUS_36750 3657949 3656576 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861931.1 protein_id gnl|my_center|LOCUS_36750 3658799 3657942 gene locus_tag LOCUS_36760 3658799 3657942 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860817.1 protein_id gnl|my_center|LOCUS_36760 3659370 3658978 gene locus_tag LOCUS_36770 3659370 3658978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 3659697 3659867 gene locus_tag LOCUS_36780 3659697 3659867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36780 3660155 3659925 gene locus_tag LOCUS_36790 3660155 3659925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860757.1 protein_id gnl|my_center|LOCUS_36790 3661581 3660142 gene locus_tag LOCUS_36800 3661581 3660142 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964761.1 protein_id gnl|my_center|LOCUS_36800 3661713 3662597 gene locus_tag LOCUS_36810 3661713 3662597 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897167.1 protein_id gnl|my_center|LOCUS_36810 3663521 3662622 gene locus_tag LOCUS_36820 3663521 3662622 CDS product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860758.1 protein_id gnl|my_center|LOCUS_36820 3664546 3663539 gene locus_tag LOCUS_36830 3664546 3663539 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861946.1 protein_id gnl|my_center|LOCUS_36830 3666753 3664543 gene locus_tag LOCUS_36840 3666753 3664543 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860760.1 protein_id gnl|my_center|LOCUS_36840 3669203 3666753 gene locus_tag LOCUS_36850 3669203 3666753 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860761.1 protein_id gnl|my_center|LOCUS_36850 3669579 3669181 gene locus_tag LOCUS_36860 3669579 3669181 CDS product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004843362.1 protein_id gnl|my_center|LOCUS_36860 3670201 3669698 gene locus_tag LOCUS_36870 3670201 3669698 CDS product antirestriction protein ArdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860762.1 protein_id gnl|my_center|LOCUS_36870 3670722 3670219 gene locus_tag LOCUS_36880 3670722 3670219 CDS product antirestriction protein ArdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860763.1 protein_id gnl|my_center|LOCUS_36880 3670937 3670641 gene locus_tag LOCUS_36890 3670937 3670641 CDS product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860764.1 protein_id gnl|my_center|LOCUS_36890 3672340 3671462 gene locus_tag LOCUS_36900 gene blaCDD 3672340 3671462 CDS product CDD family class D beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021358847.1 protein_id gnl|my_center|LOCUS_36900 3672644 3672423 gene locus_tag LOCUS_36910 3672644 3672423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317729.1 protein_id gnl|my_center|LOCUS_36910 3672779 3672645 gene locus_tag LOCUS_36920 3672779 3672645 CDS product DUF3789 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860765.1 protein_id gnl|my_center|LOCUS_36920 3673988 3672792 gene locus_tag LOCUS_36930 gene mobT 3673988 3672792 CDS product MobT family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861953.1 protein_id gnl|my_center|LOCUS_36930 3675566 3674172 gene locus_tag LOCUS_36940 3675566 3674172 CDS product cell division protein FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861954.1 protein_id gnl|my_center|LOCUS_36940 3676429 3675665 gene locus_tag LOCUS_36950 3676429 3675665 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810589.1 protein_id gnl|my_center|LOCUS_36950 3676914 3676531 gene locus_tag LOCUS_36960 3676914 3676531 CDS product YdcP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861955.1 protein_id gnl|my_center|LOCUS_36960 3677256 3676930 gene locus_tag LOCUS_36970 3677256 3676930 CDS product YdcP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861956.1 protein_id gnl|my_center|LOCUS_36970 3680543 3677493 gene locus_tag LOCUS_36980 3680543 3677493 CDS product SrtB-anchored collagen-binding adhesin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860772.1 protein_id gnl|my_center|LOCUS_36980 3681021 3680797 gene locus_tag LOCUS_36990 3681021 3680797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 3681853 3681206 gene locus_tag LOCUS_37000 3681853 3681206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37000 3682675 3682241 gene locus_tag LOCUS_37010 3682675 3682241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37010 3683163 3682705 gene locus_tag LOCUS_37020 3683163 3682705 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902308.1 protein_id gnl|my_center|LOCUS_37020 3684718 3683279 gene locus_tag LOCUS_37030 3684718 3683279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 3685587 3684715 gene locus_tag LOCUS_37040 3685587 3684715 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861379.1 protein_id gnl|my_center|LOCUS_37040 3686276 3685578 gene locus_tag LOCUS_37050 3686276 3685578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 3686811 3686263 gene locus_tag LOCUS_37060 3686811 3686263 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082042.1 protein_id gnl|my_center|LOCUS_37060 3690150 3686902 gene locus_tag LOCUS_37070 3690150 3686902 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964141.1 protein_id gnl|my_center|LOCUS_37070 3690855 3690151 gene locus_tag LOCUS_37080 3690855 3690151 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171779440.1 protein_id gnl|my_center|LOCUS_37080 3691166 3693124 gene locus_tag LOCUS_37090 3691166 3693124 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966944.1 protein_id gnl|my_center|LOCUS_37090 3693742 3693161 gene locus_tag LOCUS_37100 3693742 3693161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 3695023 3693863 gene locus_tag LOCUS_37110 3695023 3693863 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898184.1 protein_id gnl|my_center|LOCUS_37110 3696424 3695036 gene locus_tag LOCUS_37120 3696424 3695036 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889640.1 protein_id gnl|my_center|LOCUS_37120 3699095 3696732 gene locus_tag LOCUS_37130 3699095 3696732 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836618.1 protein_id gnl|my_center|LOCUS_37130 3699859 3699098 gene locus_tag LOCUS_37140 3699859 3699098 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721684.1 protein_id gnl|my_center|LOCUS_37140 3701185 3699938 gene locus_tag LOCUS_37150 3701185 3699938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 3701865 3701182 gene locus_tag LOCUS_37160 3701865 3701182 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195828.1 protein_id gnl|my_center|LOCUS_37160 3702013 3702720 gene locus_tag LOCUS_37170 3702013 3702720 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021134.1 protein_id gnl|my_center|LOCUS_37170 3702710 3704311 gene locus_tag LOCUS_37180 3702710 3704311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990774.1 protein_id gnl|my_center|LOCUS_37180 3704350 3704715 gene locus_tag LOCUS_37190 3704350 3704715 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767940.1 protein_id gnl|my_center|LOCUS_37190 3705196 3704756 gene locus_tag LOCUS_37200 3705196 3704756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37200 3705486 3707219 gene locus_tag LOCUS_37210 3705486 3707219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 3707685 3707242 gene locus_tag LOCUS_37220 3707685 3707242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 3707806 3709473 gene locus_tag LOCUS_37230 3707806 3709473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 3710468 3709623 gene locus_tag LOCUS_37240 3710468 3709623 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047035641.1 protein_id gnl|my_center|LOCUS_37240 3710889 3710587 gene locus_tag LOCUS_37250 3710889 3710587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 3711022 3711915 gene locus_tag LOCUS_37260 3711022 3711915 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900902.1 protein_id gnl|my_center|LOCUS_37260 3711975 3712631 gene locus_tag LOCUS_37270 3711975 3712631 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052019.1 protein_id gnl|my_center|LOCUS_37270 3712633 3713394 gene locus_tag LOCUS_37280 3712633 3713394 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815081.1 protein_id gnl|my_center|LOCUS_37280 3713447 3714739 gene locus_tag LOCUS_37290 3713447 3714739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 3714751 3715212 gene locus_tag LOCUS_37300 3714751 3715212 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016553.1 protein_id gnl|my_center|LOCUS_37300 3715306 3715608 gene locus_tag LOCUS_37310 3715306 3715608 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461299.1 protein_id gnl|my_center|LOCUS_37310 3715611 3716978 gene locus_tag LOCUS_37320 3715611 3716978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 3719311 3717011 gene locus_tag LOCUS_37330 3719311 3717011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 3720141 3719488 gene locus_tag LOCUS_37340 3720141 3719488 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902949.1 protein_id gnl|my_center|LOCUS_37340 3721016 3720156 gene locus_tag LOCUS_37350 3721016 3720156 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357950.1 protein_id gnl|my_center|LOCUS_37350 3721464 3721285 gene locus_tag LOCUS_37360 3721464 3721285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37360 3723423 3721567 gene locus_tag LOCUS_37370 3723423 3721567 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943600.1 protein_id gnl|my_center|LOCUS_37370 3725147 3723423 gene locus_tag LOCUS_37380 3725147 3723423 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814402.1 protein_id gnl|my_center|LOCUS_37380 3725591 3725163 gene locus_tag LOCUS_37390 3725591 3725163 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963521.1 protein_id gnl|my_center|LOCUS_37390 3726943 3725738 gene locus_tag LOCUS_37400 3726943 3725738 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459687.1 protein_id gnl|my_center|LOCUS_37400 3727785 3728474 gene locus_tag LOCUS_37410 3727785 3728474 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417201.1 protein_id gnl|my_center|LOCUS_37410 3728461 3730443 gene locus_tag LOCUS_37420 3728461 3730443 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021374131.1 protein_id gnl|my_center|LOCUS_37420 3732090 3730459 gene locus_tag LOCUS_37430 3732090 3730459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 3732367 3732987 gene locus_tag LOCUS_37440 3732367 3732987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 3732984 3733661 gene locus_tag LOCUS_37450 3732984 3733661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 3735236 3734052 gene locus_tag LOCUS_37460 3735236 3734052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 3739064 3735387 gene locus_tag LOCUS_37470 3739064 3735387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 3740749 3739580 gene locus_tag LOCUS_37480 3740749 3739580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 3742355 3740880 gene locus_tag LOCUS_37490 3742355 3740880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 3743837 3742374 gene locus_tag LOCUS_37500 3743837 3742374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 3744777 3743824 gene locus_tag LOCUS_37510 3744777 3743824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 3745054 3746271 gene locus_tag LOCUS_37520 3745054 3746271 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986283.1 protein_id gnl|my_center|LOCUS_37520 3747101 3746319 gene locus_tag LOCUS_37530 gene phnX 3747101 3746319 CDS product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687375.1 protein_id gnl|my_center|LOCUS_37530 3748206 3747109 gene locus_tag LOCUS_37540 gene phnW 3748206 3747109 CDS product 2-aminoethylphosphonate--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138251.1 protein_id gnl|my_center|LOCUS_37540 3750773 3748218 gene locus_tag LOCUS_37550 3750773 3748218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 3751560 3750805 gene locus_tag LOCUS_37560 3751560 3750805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 3752848 3751904 gene locus_tag LOCUS_37570 3752848 3751904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 3753940 3752858 gene locus_tag LOCUS_37580 3753940 3752858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37580 3755369 3754101 gene locus_tag LOCUS_37590 3755369 3754101 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861380.1 protein_id gnl|my_center|LOCUS_37590 3756578 3755382 gene locus_tag LOCUS_37600 3756578 3755382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 3757441 3756575 gene locus_tag LOCUS_37610 3757441 3756575 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861379.1 protein_id gnl|my_center|LOCUS_37610 3758138 3757398 gene locus_tag LOCUS_37620 3758138 3757398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37620 3758653 3758135 gene locus_tag LOCUS_37630 3758653 3758135 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459747.1 protein_id gnl|my_center|LOCUS_37630 3760157 3758760 gene locus_tag LOCUS_37640 3760157 3758760 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356603.1 protein_id gnl|my_center|LOCUS_37640 3760469 3761641 gene locus_tag LOCUS_37650 3760469 3761641 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379407.1 protein_id gnl|my_center|LOCUS_37650 3761689 3762090 gene locus_tag LOCUS_37660 3761689 3762090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37660 3762078 3763238 gene locus_tag LOCUS_37670 3762078 3763238 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116269310.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_37670 3763338 3764888 gene locus_tag LOCUS_37680 gene lidL 3763338 3764888 CDS product Dot/Icm type IV secretion system effector LidL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946906.1 protein_id gnl|my_center|LOCUS_37680 3765390 3764920 gene locus_tag LOCUS_37690 3765390 3764920 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437963.1 protein_id gnl|my_center|LOCUS_37690 3765567 3766553 gene locus_tag LOCUS_37700 3765567 3766553 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439336.1 protein_id gnl|my_center|LOCUS_37700 3766568 3767488 gene locus_tag LOCUS_37710 3766568 3767488 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948810.1 protein_id gnl|my_center|LOCUS_37710 3767498 3768298 gene locus_tag LOCUS_37720 3767498 3768298 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948811.1 protein_id gnl|my_center|LOCUS_37720 3768524 3770359 gene locus_tag LOCUS_37730 3768524 3770359 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679271.1 protein_id gnl|my_center|LOCUS_37730 3770353 3772089 gene locus_tag LOCUS_37740 3770353 3772089 CDS product [FeFe] hydrogenase, group A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671107.1 protein_id gnl|my_center|LOCUS_37740 3772465 3772127 gene locus_tag LOCUS_37750 3772465 3772127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 3772523 3772774 gene locus_tag LOCUS_37760 3772523 3772774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 3775012 3773885 gene locus_tag LOCUS_37770 3775012 3773885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37770 3775793 3775002 gene locus_tag LOCUS_37780 3775793 3775002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 3776033 3776248 gene locus_tag LOCUS_37790 3776033 3776248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 3776372 3776575 gene locus_tag LOCUS_37800 3776372 3776575 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184197.1 protein_id gnl|my_center|LOCUS_37800 3778508 3776967 gene locus_tag LOCUS_37810 gene guaA 3778508 3776967 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162837124.1 protein_id gnl|my_center|LOCUS_37810 3779945 3778611 gene locus_tag LOCUS_37820 3779945 3778611 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902205.1 protein_id gnl|my_center|LOCUS_37820 3780664 3780068 gene locus_tag LOCUS_37830 3780664 3780068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 3781755 3780661 gene locus_tag LOCUS_37840 3781755 3780661 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272338.1 protein_id gnl|my_center|LOCUS_37840 3782069 3783670 gene locus_tag LOCUS_37850 3782069 3783670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 3785786 3784065 gene locus_tag LOCUS_37860 3785786 3784065 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272556.1 protein_id gnl|my_center|LOCUS_37860 3786338 3785802 gene locus_tag LOCUS_37870 3786338 3785802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 3787872 3786322 gene locus_tag LOCUS_37880 3787872 3786322 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861938.1 protein_id gnl|my_center|LOCUS_37880 3788112 3787957 gene locus_tag LOCUS_37890 3788112 3787957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 3788858 3788124 gene locus_tag LOCUS_37900 3788858 3788124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 3790001 3789504 gene locus_tag LOCUS_37910 3790001 3789504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 3790427 3790101 gene locus_tag LOCUS_37920 3790427 3790101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37920 3790930 3790478 gene locus_tag LOCUS_37930 3790930 3790478 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426191.1 protein_id gnl|my_center|LOCUS_37930 3791719 3791588 gene locus_tag LOCUS_37940 3791719 3791588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 3792310 3791741 gene locus_tag LOCUS_37950 3792310 3791741 CDS product accessory gene regulator B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454130.1 protein_id gnl|my_center|LOCUS_37950 3793179 3792568 gene locus_tag LOCUS_37960 3793179 3792568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37960 3793394 3793266 gene locus_tag LOCUS_37970 3793394 3793266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37970 3794140 3793463 gene locus_tag LOCUS_37980 3794140 3793463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 3802614 3794152 gene locus_tag LOCUS_37990 3802614 3794152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 3803080 3802604 gene locus_tag LOCUS_38000 3803080 3802604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 3804119 3803205 gene locus_tag LOCUS_38010 3804119 3803205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 3805198 3804494 gene locus_tag LOCUS_38020 3805198 3804494 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964889.1 protein_id gnl|my_center|LOCUS_38020 3805658 3805221 gene locus_tag LOCUS_38030 3805658 3805221 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435155.1 protein_id gnl|my_center|LOCUS_38030 3806183 3805944 gene locus_tag LOCUS_38040 3806183 3805944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 3806366 3806587 gene locus_tag LOCUS_38050 3806366 3806587 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965253.1 protein_id gnl|my_center|LOCUS_38050 3806906 3806757 gene locus_tag LOCUS_38060 3806906 3806757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060 3807667 3806996 gene locus_tag LOCUS_38070 3807667 3806996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 3809985 3808240 gene locus_tag LOCUS_38080 3809985 3808240 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459375.1 protein_id gnl|my_center|LOCUS_38080 3811685 3810042 gene locus_tag LOCUS_38090 3811685 3810042 CDS product DUF3991 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461990.1 protein_id gnl|my_center|LOCUS_38090 3814529 3811818 gene locus_tag LOCUS_38100 gene mobP3 3814529 3811818 CDS product MobP3 family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461899.1 protein_id gnl|my_center|LOCUS_38100 3814877 3814596 gene locus_tag LOCUS_38110 3814877 3814596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38110 3815152 3814874 gene locus_tag LOCUS_38120 3815152 3814874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 3815614 3815216 gene locus_tag LOCUS_38130 3815614 3815216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461992.1 protein_id gnl|my_center|LOCUS_38130 3816907 3815681 gene locus_tag LOCUS_38140 3816907 3815681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 3817829 3817416 gene locus_tag LOCUS_38150 3817829 3817416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 3818043 3817858 gene locus_tag LOCUS_38160 3818043 3817858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 3819363 3818080 gene locus_tag LOCUS_38170 3819363 3818080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 3820050 3819385 gene locus_tag LOCUS_38180 3820050 3819385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 3820483 3820028 gene locus_tag LOCUS_38190 3820483 3820028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 3821626 3820502 gene locus_tag LOCUS_38200 3821626 3820502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 3822105 3821626 gene locus_tag LOCUS_38210 3822105 3821626 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458833.1 protein_id gnl|my_center|LOCUS_38210 3823124 3822120 gene locus_tag LOCUS_38220 3823124 3822120 CDS product amidoligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272738.1 protein_id gnl|my_center|LOCUS_38220 3824213 3823140 gene locus_tag LOCUS_38230 3824213 3823140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 3825486 3824218 gene locus_tag LOCUS_38240 3825486 3824218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_38240 3825891 3825514 gene locus_tag LOCUS_38250 3825891 3825514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_38250 3827292 3826426 gene locus_tag LOCUS_38260 3827292 3826426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 3827854 3827279 gene locus_tag LOCUS_38270 3827854 3827279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272740.1 protein_id gnl|my_center|LOCUS_38270 3828159 3827854 gene locus_tag LOCUS_38280 3828159 3827854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272741.1 protein_id gnl|my_center|LOCUS_38280 3829223 3828240 gene locus_tag LOCUS_38290 3829223 3828240 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289074.1 protein_id gnl|my_center|LOCUS_38290 3829661 3829314 gene locus_tag LOCUS_38300 3829661 3829314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 3830528 3829674 gene locus_tag LOCUS_38310 3830528 3829674 CDS product DUF6045 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272743.1 protein_id gnl|my_center|LOCUS_38310 3830882 3830538 gene locus_tag LOCUS_38320 3830882 3830538 CDS product DUF3852 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158208705.1 protein_id gnl|my_center|LOCUS_38320 3831174 3830875 gene locus_tag LOCUS_38330 3831174 3830875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38330 3831559 3831143 gene locus_tag LOCUS_38340 3831559 3831143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 3832493 3831552 gene locus_tag LOCUS_38350 3832493 3831552 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462025.1 protein_id gnl|my_center|LOCUS_38350 3833086 3832517 gene locus_tag LOCUS_38360 3833086 3832517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 3837004 3833174 gene locus_tag LOCUS_38370 3837004 3833174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38370 3837929 3837201 gene locus_tag LOCUS_38380 3837929 3837201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38380 3838689 3838108 gene locus_tag LOCUS_38390 gene maa 3838689 3838108 CDS product maltose O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095888.1 protein_id gnl|my_center|LOCUS_38390 3839546 3839301 gene locus_tag LOCUS_38400 3839546 3839301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 3842234 3839817 gene locus_tag LOCUS_38410 3842234 3839817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38410 3842532 3842311 gene locus_tag LOCUS_38420 3842532 3842311 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_38420 3842765 3842553 gene locus_tag LOCUS_38430 3842765 3842553 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360986.1 protein_id gnl|my_center|LOCUS_38430 3843610 3843308 gene locus_tag LOCUS_38440 3843610 3843308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 3844301 3843919 gene locus_tag LOCUS_tm00010 3844301 3843919 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 3844803 3844354 gene locus_tag LOCUS_38450 gene smpB 3844803 3844354 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123905.1 protein_id gnl|my_center|LOCUS_38450 3846998 3844830 gene locus_tag LOCUS_38460 gene rnr 3846998 3844830 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391086.1 protein_id gnl|my_center|LOCUS_38460 3847287 3847057 gene locus_tag LOCUS_38470 3847287 3847057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 3847825 3847382 gene locus_tag LOCUS_38480 3847825 3847382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 3849833 3847818 gene locus_tag LOCUS_38490 3849833 3847818 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963445.1 protein_id gnl|my_center|LOCUS_38490 3850777 3849851 gene locus_tag LOCUS_38500 3850777 3849851 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895564.1 protein_id gnl|my_center|LOCUS_38500 3851280 3850801 gene locus_tag LOCUS_38510 3851280 3850801 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816201.1 protein_id gnl|my_center|LOCUS_38510 3851896 3851273 gene locus_tag LOCUS_38520 3851896 3851273 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006874833.1 protein_id gnl|my_center|LOCUS_38520 3852273 3851902 gene locus_tag LOCUS_38530 gene cheY 3852273 3851902 CDS product chemotaxis protein CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244957.1 protein_id gnl|my_center|LOCUS_38530 3853964 3852270 gene locus_tag LOCUS_38540 3853964 3852270 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425090.1 protein_id gnl|my_center|LOCUS_38540 3854454 3853981 gene locus_tag LOCUS_38550 3854454 3853981 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816201.1 protein_id gnl|my_center|LOCUS_38550 3855041 3854451 gene locus_tag LOCUS_38560 3855041 3854451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 3855403 3855038 gene locus_tag LOCUS_38570 3855403 3855038 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940568.1 protein_id gnl|my_center|LOCUS_38570 3856400 3855375 gene locus_tag LOCUS_38580 3856400 3855375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 3857205 3856390 gene locus_tag LOCUS_38590 3857205 3856390 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425096.1 protein_id gnl|my_center|LOCUS_38590 3857602 3857198 gene locus_tag LOCUS_38600 3857602 3857198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 3859950 3857599 gene locus_tag LOCUS_38610 3859950 3857599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 3860380 3859940 gene locus_tag LOCUS_38620 3860380 3859940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 3861835 3860537 gene locus_tag LOCUS_38630 gene eno 3861835 3860537 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357098.1 protein_id gnl|my_center|LOCUS_38630 3862112 3861924 gene locus_tag LOCUS_38640 3862112 3861924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 3862746 3862180 gene locus_tag LOCUS_38650 gene nusG 3862746 3862180 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225764.1 protein_id gnl|my_center|LOCUS_38650 3862938 3862762 gene locus_tag LOCUS_38660 3862938 3862762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 3863100 3862951 gene locus_tag LOCUS_38670 gene rpmG 3863100 3862951 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114322.1 protein_id gnl|my_center|LOCUS_38670 3863755 3863153 gene locus_tag LOCUS_38680 3863755 3863153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38680 3864497 3863775 gene locus_tag LOCUS_38690 gene rlmB 3864497 3863775 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724085.1 protein_id gnl|my_center|LOCUS_38690 3864882 3864502 gene locus_tag LOCUS_38700 3864882 3864502 CDS product mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399685.1 protein_id gnl|my_center|LOCUS_38700 3866216 3864882 gene locus_tag LOCUS_38710 gene cysS 3866216 3864882 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631969.1 protein_id gnl|my_center|LOCUS_38710 3866674 3866495 gene locus_tag LOCUS_38720 3866674 3866495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 3866858 3866643 gene locus_tag LOCUS_38730 3866858 3866643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 3867804 3866791 gene locus_tag LOCUS_38740 gene gap 3867804 3866791 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025408.1 protein_id gnl|my_center|LOCUS_38740 3869359 3868055 gene locus_tag LOCUS_38750 3869359 3868055 CDS product triacylglycerol lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964346.1 protein_id gnl|my_center|LOCUS_38750 3869470 3870045 gene locus_tag LOCUS_38760 gene clpP 3869470 3870045 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700621.1 protein_id gnl|my_center|LOCUS_38760 3872593 3870032 gene locus_tag LOCUS_38770 3872593 3870032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 3873433 3872711 gene locus_tag LOCUS_38780 3873433 3872711 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008798583.1 protein_id gnl|my_center|LOCUS_38780 3874976 3873426 gene locus_tag LOCUS_38790 3874976 3873426 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015979.1 protein_id gnl|my_center|LOCUS_38790 3875284 3875048 gene locus_tag LOCUS_38800 3875284 3875048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38800 3876816 3875302 gene locus_tag LOCUS_38810 3876816 3875302 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203343.1 protein_id gnl|my_center|LOCUS_38810 3877688 3877038 gene locus_tag LOCUS_38820 3877688 3877038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 3878872 3877802 gene locus_tag LOCUS_38830 3878872 3877802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38830