COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence1 source 1..2072767 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 971..1408 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS 1422..1904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS 1908..2630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS complement(2676..3695) product galactose/methyl galactoside ABC transporter permease MglC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016955.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 gene mglC CDS complement(3729..5234) product galactose/methyl galactoside ABC transporter ATP-binding protein MglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903113.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 gene mglA CDS complement(5319..6383) product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903112.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 gene mglB CDS complement(6574..7521) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903111.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS 7709..8704 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016366.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 gene trpS CDS complement(8734..9171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903314.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS complement(9184..9822) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015966.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS complement(9928..10899) product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903312.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS complement(10904..12253) product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015965.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 gene glmU CDS complement(12360..12887) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS complement(12911..13471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS complement(13712..14458) product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016359.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS 14816..15598 product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182060.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 gene udp CDS 15626..16828 product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002992274.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS 16887..17300 product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830967.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 gene cdd CDS 17311..18021 product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020631.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 gene deoD CDS 18036..19226 product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046067.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 gene deoB CDS 19240..19905 product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453154.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 gene deoC CDS 19991..20896 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726366.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS 20877..21839 product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454782.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 gene manA CDS complement(21890..22978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS complement(23074..23418) product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016210.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS complement(23420..24685) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016211.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS complement(24687..26132) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895612.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS complement(26277..27779) product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015864.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 gene glpK CDS complement(27802..28551) product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894460.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS complement(28759..29322) product glycerol-3-phosphate responsive antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016313.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS complement(29451..31067) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016573.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 gene groL CDS complement(31087..31356) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583322.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 gene groES CDS 31536..32888 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964165.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS complement(32923..33702) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494826.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS 33823..34179 product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942058.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS 34172..34555 product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392924.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS 34702..35526 product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016252.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 gene thyA CDS 35553..36026 product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016253.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS 36502..37104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS complement(37146..38087) product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416849.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 gene ppaC CDS 38329..38856 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389983.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS 38888..40900 product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015784.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 gene ligA CDS 40994..43672 product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015785.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 gene secA CDS 43683..44423 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627473.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS 44489..45337 product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937958.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS 45334..46332 product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015772.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 gene rfaD CDS 46347..47159 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627503.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS 47439..47909 product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995946.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS 47911..49407 product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016113.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS 49426..51243 product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016920.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS 51259..51810 product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016918.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS 51865..52539 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965838.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(52621..52905) product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903810.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS complement(52907..54067) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903809.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS 54197..54865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS 54877..55746 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00560 note possible pseudo, frameshifted CDS complement(55721..55903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS complement(55900..56118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS complement(56490..57863) product tetracycline efflux MFS transporter Tet(L) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001574277.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 gene tet(L) CDS 58142..58822 product IS6-like element IS1216 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015311.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(58856..59398) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092058.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS 59789..60520 product 23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(A) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001072201.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 gene erm(A) CDS complement(60645..61007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS complement(61539..61673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS complement(61937..63850) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244150.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS complement(64223..64414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS complement(64592..66019) product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641223.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS complement(66273..66416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS 66459..67058 product IS6-like element IS1216 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015311.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS complement(67129..69048) product tetracycline resistance ribosomal protection protein Tet(O) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775603.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 gene tet(O) CDS 69714..71249 product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948686.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS 71309..72736 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903800.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS 72785..73921 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903799.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS 73943..74719 product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015659.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS 74736..75719 product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015658.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS 75847..76794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS 77076..77798 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189288.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS complement(77831..78820) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016045.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 gene galE CDS complement(78831..80351) product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016044.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS complement(80351..81526) product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016043.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 81683..82840 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453947.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS 82955..83731 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016735.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS 83743..84324 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016736.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS 84326..84877 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627936.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS 84938..85690 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904156.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS complement(85723..86445) product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903514.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 gene pflA CDS complement(86459..88687) product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903513.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 gene pflB CDS complement(88915..89454) product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS complement(89722..90297) product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015911.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS complement(90294..91046) product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930880.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(91009..92364) product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495539.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS complement(92372..93697) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016234.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS complement(93690..94856) product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902445.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS complement(94909..96267) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964165.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS 96152..96406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS complement(96358..96927) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015892.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS complement(97001..97213) product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151132.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 gene rpmE CDS 97379..97999 product viroplasmin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016818.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS 98011..98697 product TIGR02206 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016817.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS 98904..99953 product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897407.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS 99972..100247 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902918.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS 100250..100849 product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902916.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS 101350..103080 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965689.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS 103067..104809 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986472.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS 104822..105295 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS complement(105329..105901) product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902123.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 gene ruvC CDS complement(105903..106367) product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016664.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 gene trmL CDS 106627..107253 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016953.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS 107265..108185 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029492176.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS 108255..109565 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942511.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS 109731..110687 product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016583.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS 110690..113314 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494923.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 gene mutS CDS 113317..115995 product LptA/OstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124794599.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS 116017..116742 product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016586.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 gene lptB CDS 116800..119400 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016588.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 gene alaS CDS 119418..119837 product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902478.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 gene ruvX CDS 119854..121086 product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902477.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 gene secD CDS 121077..122021 product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016589.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 gene secF CDS 122108..123205 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016367.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 gene alr CDS 123215..124396 product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016848.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS 124414..124944 product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901848.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS 124963..126039 product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901847.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS 126039..127121 product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016847.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS 127139..128365 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016846.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS 128376..128810 product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016845.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 gene dut CDS 128819..129925 product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016844.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 gene rodA CDS 129933..130796 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016843.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS 130846..132147 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896779.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS complement(132196..133566) product triphosphoribosyl-dephospho-CoA synthase CitG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005668027.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 gene citG CDS complement(133568..134602) product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016310.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 gene citC CDS complement(134693..135235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS 135428..136327 product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902759.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 gene accD CDS 136347..137303 product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016368.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS 137315..138289 product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023041561.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 gene pfkA CDS 138306..138611 product DUF496 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902753.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS 138735..139328 product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016369.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 gene recR CDS 139345..140559 product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925073.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 gene hydF CDS 140581..140985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS complement(141002..141811) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221373.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS 142188..145010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS 145190..146608 product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015707.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS 146605..147132 product ComEA family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495314.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS 147164..148051 product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015705.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS 148077..148847 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494599.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS 148844..149665 product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262328.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 gene rlmA CDS 149674..150054 product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017085.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 gene acpS CDS 150047..150505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS 150697..151623 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197551829.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 gene prfB note possible pseudo, frameshifted CDS 151695..153209 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147373220.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 gene gltX CDS complement(153291..153626) product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901839.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS 153868..155829 product glycogen-debranching protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016656.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS complement(155850..157094) product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906056.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS complement(157105..157908) product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287451.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 gene proB CDS 158063..160039 product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016921.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS 160193..161314 product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963544.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS 161495..163147 product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627741.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS complement(163205..164089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01570 note possible pseudo, frameshifted CDS complement(164020..164586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01580 note possible pseudo, frameshifted CDS complement(164712..165245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS complement(165332..166567) product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170876203.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 gene rpoN CDS complement(166637..167404) product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016812.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 gene pssA CDS 167582..168352 product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016203.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS 168363..170084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS 170273..171502 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS 171553..173724 product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898558.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS 173739..174563 product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058229301.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 gene lpxC CDS 174595..175020 product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016509.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 gene fabZ CDS 175040..175813 product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016510.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 gene lpxA CDS 175813..176613 product LpxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016511.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS 176630..177694 product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901943.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 gene lpxB CDS 177691..179472 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016512.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS 179482..180246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01720 note possible pseudo, frameshifted CDS 180248..180841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01730 note possible pseudo, frameshifted CDS complement(180854..181513) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548397.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS 181714..182790 product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147373114.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 gene recA CDS 182965..184110 product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902854.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 gene nagA tRNA 184165..184249 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS 184313..185302 product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016821.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 gene bioB CDS 185283..185975 product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016822.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 gene bioD CDS 185976..187325 product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896848.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 gene bioA CDS complement(187350..188015) product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016700.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 gene bioC CDS complement(188005..188607) product DUF452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016699.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS complement(188585..189703) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626360.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS complement(189828..194060) product acyl-CoA dehydratase activase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965697.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS complement(194108..194446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS complement(194486..195217) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897094.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS 195419..196243 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903695.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS 196258..196887 product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903694.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS 196899..197132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS 197152..197526 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016728.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS 197612..198868 product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903692.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS 198885..200813 product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903691.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 gene pepF CDS 200857..201624 product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965563.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS 201624..202073 product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903465.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS complement(202099..203721) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902507.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS complement(203939..204325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01950 note possible pseudo, frameshifted CDS complement(204491..205348) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902565.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 repeat_region 205596..205747 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq attgaatagtaacactaggtg CDS 205965..206924 product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016600.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS 206896..208065 product elongation factor P maturation arginine rhamnosyltransferase EarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016605.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 gene earP CDS 208078..208641 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897833.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 gene efp CDS complement(208685..209149) product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965292.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 gene moaC CDS complement(209151..210173) product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435117.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS complement(210170..210844) product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815806.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 gene modB CDS complement(210841..211602) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032249.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 gene modA CDS 212004..213419 product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963597.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS 213579..216035 product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198480299.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS 216050..218146 product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626410.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS 218151..218618 product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016624.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 gene ybeY CDS 218596..219357 product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416641.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS 219367..220893 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS 221246..222433 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357329.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS 222533..223309 product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901833.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS 223372..224211 product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901831.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS complement(224261..225352) product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016530.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 gene dnaN CDS complement(225370..226398) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901986.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS complement(226454..227674) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS 228106..228876 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898090.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS 228889..229413 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903679.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS 229410..229907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS 229916..231010 product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964939.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 gene hydE CDS 231218..231976 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896415.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS 231969..232673 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893083.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS 232682..233614 product NrtA/SsuA/CpmA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429089.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS complement(233763..234077) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS complement(234077..234736) product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017175.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS 234869..235531 product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902702.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS 235556..236347 product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016205.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 gene minD CDS 236356..236625 product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016206.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 gene minE CDS 236640..236972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS 237090..237566 product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765037.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 gene fldA CDS 237568..237909 product DUF2023 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788315.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS complement(238337..239473) product cyclically-permuted mutarotase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626951.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS 239770..240639 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS 240985..242139 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015879.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS complement(242524..243093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS complement(243103..244512) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031832.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS complement(245059..245604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS complement(245714..246085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS complement(246102..246281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS complement(246295..246771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS complement(246768..247190) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS complement(247272..247508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS complement(247514..248449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS complement(248442..249137) product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546810.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS complement(249118..249333) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS complement(249323..249661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS complement(249651..249881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS complement(249887..250903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS complement(250903..251133) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS complement(251409..251648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS 251912..252133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS 252236..253372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS 253640..254188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS 254326..254556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS 254743..254940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS 255052..256131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS 256316..257641 product DNA modification methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940138.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS 257634..258347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS 258487..259080 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS 259080..260900 product phage terminase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001390573.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS 260907..261299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS 261315..262835 product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460141.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS 262807..263850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS 263850..264170 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS 264185..265219 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS 265229..265528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS 265565..265864 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS 265866..266423 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS 266411..266869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS 266879..267082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS 267095..268519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460135.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS 268536..269048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS 269060..269425 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS 269591..272596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS 272577..272795 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS 272786..273796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS 273810..274325 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS 274325..274915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS 274909..275196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS 275186..276283 product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219102.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS 276283..276921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS 276887..278230 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS 278234..278554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS complement(278551..278856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS complement(278856..279128) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS 279188..280162 product phage integrase N-terminal SAM-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964425.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS 280361..281044 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS 281054..281626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS 281636..282166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS 282180..282593 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS complement(282625..282834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS complement(282884..283183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS complement(283293..283484) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS complement(283571..284209) product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016305.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS complement(284213..285514) product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016304.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 gene rsmB CDS complement(285644..287464) product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016311.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 gene htpG CDS complement(287557..288327) product acidic protein MsyB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103477.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 gene msyB CDS complement(288445..289248) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861671.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS complement(289296..290189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02980 note possible pseudo, internal stop codon CDS complement(290370..290615) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02990 note possible pseudo, internal stop codon CDS 290725..291534 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429371.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS 291583..292131 product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802804.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS 292144..292710 product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763311.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS 292721..293311 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495251.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 gene coaE CDS 293315..295471 product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015927.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS 295471..295974 product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015926.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS 295991..297196 product CinA family nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015925.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS 297197..297751 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903986.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS 297782..300286 product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015924.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 300531..301457 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903984.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS 301505..302791 product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903983.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS 302895..303941 product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627079.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 gene mnmA CDS 304117..305295 product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS complement(305316..305816) product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903465.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS complement(305832..306584) product threonine/serine exporter ThrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367097.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS complement(306614..307354) product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903463.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS complement(307458..308774) product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022819390.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS complement(308936..309814) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227377.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS 310164..311720 product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626662.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS 311788..312192 product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016670.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS 312239..313387 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903462.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS 313448..314233 product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903461.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS 314282..315292 product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903460.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS complement(315416..315910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS complement(315934..316971) product IS1595 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116631520.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS complement(317106..317435) product DUF1904 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016617.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS complement(317454..320204) product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202237.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS 320370..321173 product TIGR02452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965841.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS 321297..321938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902933.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS 321947..323182 product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429165.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS complement(323259..324290) product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861175.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 gene mnmH CDS 324520..326781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS 326892..328814 product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898541.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 gene recQ CDS 328826..333709 product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032842746.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS 333709..335961 product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495148.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 gene pbpC CDS 335915..337126 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016502.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS 337119..337796 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495145.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS 337884..338438 product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016408.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 gene raiA CDS complement(338474..340777) product autotransporter phospholipase A1 FplA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015773.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 gene fplA CDS 340985..341680 product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005900142.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS 341693..342937 product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016834.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS 342921..343214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS 343192..345153 product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901728.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 gene hprK CDS 345150..346094 product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016831.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS 346104..347006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS 347029..347334 product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901725.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS 347404..348237 product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015775.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS 348256..349296 product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016813.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS 349293..349952 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902228.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS 349962..351464 product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016014.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS complement(351502..353229) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494171.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 gene ptsP CDS complement(353320..353583) product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005888910.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS 353783..354799 product alpha-hydroxy-acid oxidizing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546010.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS 354832..356241 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS complement(356288..357175) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779466.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS 357414..359513 product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627490.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 gene pnp CDS 359585..360922 product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 gene rimO CDS 360949..361482 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904217.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 gene pgsA CDS 361499..361756 product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358762.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS 361810..362751 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015778.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 gene rsmH CDS 362753..363010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS 363027..364382 product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495280.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 gene rlmD CDS 364394..364996 product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016461.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 gene plsY CDS 365007..366008 product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931786.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS 366035..366853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS 366882..368012 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904330.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 gene dnaN CDS complement(368057..368929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS complement(368939..369592) product DUF45 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858500.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS 369839..371641 product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897958.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 gene lepA CDS 371739..374594 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626200.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 gene uvrA CDS 374587..375177 product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902889.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene ruvA CDS 375190..375678 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016902.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS 375692..376234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS complement(376362..377777) product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426252.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 gene nhaC CDS complement(377920..378480) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902446.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS complement(378506..379732) product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627649.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS complement(379752..381092) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903028.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 gene dnaB CDS complement(381107..381556) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903027.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 gene rplI CDS complement(381575..382366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS complement(382385..383833) product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903025.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 gene dnaX CDS complement(383840..385231) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015857.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS complement(385255..386142) product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894432.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS complement(386155..386586) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779456.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS complement(386601..387212) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894436.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS complement(387232..387573) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS complement(387589..390414) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015862.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS complement(390444..390971) product DUF116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903018.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS complement(391142..391708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS 391910..392512 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358068.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS 392527..395127 product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016653.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 gene ppdK CDS 395118..397076 product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016655.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS 397164..398549 product OmpP1/FadL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779465.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS 398582..399154 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016825.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS complement(399181..400521) product amino acid carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016013.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS complement(400655..401656) product MnmA/TRMU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016484.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS complement(401659..402168) product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901900.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS complement(402188..402877) product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016483.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS complement(402892..403968) product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016482.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 gene hemW CDS complement(403983..405713) product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124795646.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS 406005..407192 product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003392508.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 gene gltS CDS 407357..409081 product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627854.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 gene sppA CDS 409165..409521 product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008797059.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS 409595..410689 product choloylglycine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263137.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS 410843..411781 product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813418.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS 412274..412882 product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774866.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS 412913..413452 product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392868.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS 413498..415027 product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839168.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 gene dacB CDS 415037..415954 product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963616.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS 416185..417756 product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015793.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS 417897..418331 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436793.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS 418348..419727 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015792.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS 419795..421024 product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437954.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 gene pepT CDS complement(421145..421486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS 421509..422582 product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015791.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS 422599..423255 product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904246.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS 423289..425175 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015790.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 gene mnmG CDS 425175..425876 product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015789.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 gene rsmG CDS 425893..430323 product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627076.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS 430335..432422 product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367282.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS 432459..432935 product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903954.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS 432962..433972 product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903952.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 gene lpxD CDS 434044..434631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS 434667..435938 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016148.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 gene serS CDS 435925..436395 product CbiQ family ECF transporter T component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016147.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS 436481..437461 product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932731.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS complement(437608..437883) product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898015.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS 438033..438860 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895540.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS 439038..439238 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356423.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS 439308..439472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04280 tRNA 439484..439569 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS complement(439641..439982) product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902960.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS complement(439994..440425) product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015889.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 gene rpiB CDS complement(440498..441004) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015890.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS complement(441103..441690) product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015891.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS 441827..444175 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903647.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS 444281..445012 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS 445039..445899 product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482477.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 gene mscS CDS 445916..446767 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903458.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS 446871..447386 product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903422.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS 447405..448187 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017148.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS complement(448234..448524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS complement(448635..449417) product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016757.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS complement(449436..450494) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903732.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS complement(450506..451312) product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779463.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS 451456..452898 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016755.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 gene cls CDS 452923..453675 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04440 tRNA 453725..453801 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS 453829..454122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS 454284..454847 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS 454944..455531 product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423380.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS 455525..456328 product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903636.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS 456337..456762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS complement(456785..457246) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949083.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS complement(457233..457793) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627789.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS complement(457830..459002) product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902638.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS 459169..459642 product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084065.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS 459715..460056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS complement(460088..461044) product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889546.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS complement(461067..461351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005899613.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS complement(461366..461506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS 462075..462434 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS 462462..463139 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS 463159..464232 product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016634.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 gene mnmA CDS 464248..465018 product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942064.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS complement(465067..466452) product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015939.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS 466777..467583 product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897350.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS 467650..468054 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS 468109..469425 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454045.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS complement(469484..469981) product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016748.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS 470181..472754 product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627102.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 gene clpB CDS complement(472791..474497) product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627326.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS 474890..475387 product YfbM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681732.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS 475408..476751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS complement(476794..478470) product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147373133.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 gene hcp CDS complement(478978..479346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04720 note possible pseudo, frameshifted CDS 479808..481130 product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869179.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS 481166..481960 product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434058.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS 481960..482430 product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434060.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS 482414..484660 product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897245.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS 484727..485293 product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454633.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS 485595..486359 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948208.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS 486385..487011 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948207.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS 487011..487649 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433939.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS 487729..488040 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS complement(488079..489191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS 489356..490840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS 491035..492078 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016427.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS complement(492134..492844) product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015968.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS complement(492841..493545) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015967.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS 493654..494649 product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398871.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 494673..495410 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922646.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 tRNA 495451..495526 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS complement(495603..496967) product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005899369.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS complement(497356..498267) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694611.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS 498539..499876 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117726.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS 499968..501266 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016943.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS 501276..503888 product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016942.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS 503888..506950 product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016941.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS 507128..507970 product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519031.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS 508000..508557 product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881093.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS 508769..509458 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680085.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS 509469..510416 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861062.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS 510388..511134 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888755.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS 511136..511816 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437066.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS 511877..512725 product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016856.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS complement(512779..514338) product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963421.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS complement(514537..515772) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965785.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS complement(515909..516511) product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966844.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS 516614..517438 product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989393.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 gene yidA CDS 517603..519141 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017155.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 gene guaA CDS 519427..519699 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS 520200..521042 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114969.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS 521056..521958 product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892350.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 gene murQ CDS 521969..523348 product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159750.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS complement(523393..524013) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS 524173..524412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS 524457..524663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS 525010..525540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS 525711..527213 product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398513.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 gene ypwA CDS 527229..528491 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868824.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS 528519..530717 product Xaa-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476404.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS complement(530725..531243) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS 531495..531641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS 531843..532823 product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016492.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS 532936..533505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS complement(533650..534291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS 534442..535851 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894984.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS complement(535885..536112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS complement(536184..536978) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903844.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS complement(537053..537826) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627435.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS complement(537819..538676) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015835.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS complement(538663..539793) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015834.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS complement(539884..540318) product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393623.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS complement(540321..541295) product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461492.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 gene moaA CDS 541442..542260 product selenium-dependent molybdenum cofactor biosynthesis protein YqeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047954.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 gene yqeB CDS 542263..543051 product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386049.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS 543054..543431 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901327.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS 543517..544272 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438367.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS complement(544312..544587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS 544867..545595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS 545732..546304 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966586.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS complement(546369..549944) product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005971513.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 gene nifJ CDS complement(550123..551496) product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017139.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS complement(551515..552705) product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017138.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 gene megL CDS 553001..554428 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903253.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS 554546..554848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS 554895..555101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS complement(555148..555696) product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016097.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 gene rnmV CDS complement(555764..556786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS complement(556799..558190) product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016098.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 gene asnS CDS complement(558216..558416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS complement(558509..559312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS complement(559337..560206) product DUF2156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016276.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS complement(560306..560584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS complement(560626..561672) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016984.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 gene dinB CDS complement(561750..562313) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005951587.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS 562676..563785 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016475.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS complement(563840..564910) product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901598.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 gene corA CDS complement(564935..566461) product TaqI-like C-terminal specificity domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099504.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS complement(566462..567922) product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016596.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 gene murJ CDS complement(567939..568616) product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902469.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS complement(568591..569550) product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016595.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS complement(569553..570455) product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902471.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 gene whiA CDS complement(570480..573161) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016594.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 gene polA CDS 573354..573788 product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902513.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS complement(573826..575997) product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898410.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS complement(576011..577075) product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016454.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 gene rlmN CDS complement(577151..578266) product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016455.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS 578414..579286 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765521.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 tRNA 579351..579438 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS complement(579660..580700) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS complement(580792..581523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS complement(581520..582392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS complement(582376..584250) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS complement(584298..585461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS complement(585464..586084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS complement(586100..587527) product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287699.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS complement(587554..587706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS complement(587693..589039) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068695.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS complement(589570..589980) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS complement(590100..590294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS complement(590361..590954) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS complement(590964..591539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS complement(591642..591884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS complement(591863..592174) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS complement(592361..593350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS complement(593587..594819) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358446.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS complement(595280..595423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS complement(595995..598997) product type III restriction-modification system endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016374.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS complement(599010..600371) product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211204934.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS complement(600419..600889) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05860 note possible pseudo, frameshifted CDS complement(600960..602468) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS complement(602665..603342) product DUF4391 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198480528.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS complement(603354..606572) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016371.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS 606978..608141 product phosphoenolpyruvate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949084.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS 608367..609575 product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949085.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS 609598..610428 product phosphoenolpyruvate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949086.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS complement(610742..611881) product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287525.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 gene tnpB CDS complement(611901..612305) product IS200/IS605-like element ISEfa4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287522.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 gene tnpA CDS complement(612360..612560) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS complement(612553..614172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS complement(614186..615136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS complement(615126..616094) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003043308.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS complement(616107..617057) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962311.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS complement(617047..617766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS complement(617763..618575) product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS complement(618587..619549) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS complement(619629..620762) product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434244.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS 620941..621705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS complement(621755..623377) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015958.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS complement(623406..623966) product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903303.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 gene ahpC CDS 624205..625158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS 625337..627268 product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654954.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS complement(627307..628029) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902265.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS complement(628032..628820) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017145.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS complement(628813..629781) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124797307.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS complement(629793..630677) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626888.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS complement(630731..631852) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902269.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS complement(632241..632726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS 632880..633119 product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965683.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS 633263..634324 product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032842698.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS 634486..634707 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS 634731..635471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 635530..636954 product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626657.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 636941..638038 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016444.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS 638048..641101 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016443.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 641476..642399 product phosphotransferase enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016754.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS complement(642444..643604) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860647.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 643820..644092 product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901839.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS 644184..645764 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016739.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS 645780..646469 product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626351.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS 646486..647370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS 647430..648296 product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479588.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 gene nfo CDS 648300..648821 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895862.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS 649116..650384 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210884.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS 650431..651474 product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210882.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS 651556..652905 product amino acid carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005970668.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS 652902..653666 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418385.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS complement(653894..654232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS complement(654315..655244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS complement(655241..656368) product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202566.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS complement(656365..657486) product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202567.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS complement(657590..657730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS complement(657824..658786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS complement(658779..659762) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06400 note possible pseudo, internal stop codon CDS complement(659877..659996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS complement(660396..660587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS complement(660834..661004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS complement(661435..661971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06440 note possible pseudo, frameshifted CDS complement(662043..662525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06450 note possible pseudo, internal stop codon, frameshifted CDS complement(662759..663040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS complement(663162..663491) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS complement(663635..664186) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016228.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS 664313..664993 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016603.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS 665024..666013 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016688.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS complement(666215..667354) product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271133.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 gene nagA CDS complement(667366..668193) product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016935.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 gene nagB CDS complement(668223..669077) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704383.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(669061..670002) product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016934.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS complement(670093..670806) product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966508.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS complement(670873..671598) product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005915025.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS complement(671611..672339) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016658.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS complement(672332..673042) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903444.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS complement(673364..674554) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964319.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS complement(674675..675424) product precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005915112.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 gene cobK CDS complement(675421..676152) product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016778.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 gene cobJ CDS complement(676145..677137) product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016779.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 gene cbiG CDS complement(677138..677896) product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016784.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 gene cobM CDS complement(677875..678603) product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626293.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 gene cobI CDS complement(678593..679177) product precorrin-6Y C5,15-methyltransferase (decarboxylating) subunit CbiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901667.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 gene cbiT CDS complement(679189..679824) product precorrin-6y C5,15-methyltransferase (decarboxylating) subunit CbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016791.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 gene cbiE CDS complement(679802..680926) product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016792.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 gene cbiD CDS complement(680926..681573) product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626283.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS complement(681573..682898) product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901682.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS complement(682895..683953) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016795.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS complement(683965..684924) product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029491348.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 gene cbiB CDS complement(684926..686407) product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016799.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS complement(686820..688352) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487169.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS 688472..689464 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626320.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS complement(689569..690201) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584007.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 gene thiE CDS complement(690204..690734) product sulfur carrier protein ThiS adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897548.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 gene thiF CDS complement(690731..691837) product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966204.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 gene thiH CDS complement(691834..692613) product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889636.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS complement(692660..692875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS complement(692889..694163) product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047970.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 gene thiC CDS complement(694388..696655) product bifunctional dihydroorotate dehydrogenase B NAD binding subunit/NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202231.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS complement(696708..697412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS complement(697421..698518) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS complement(698678..700015) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986767.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS complement(700139..702733) product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016840.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS complement(702970..703593) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475979.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 gene pyrE CDS complement(703586..704800) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056513.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS complement(704794..705522) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435818.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 gene pyrF CDS complement(705538..706455) product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245610.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS complement(706468..707277) product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765719.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS complement(707299..708363) product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868442.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 gene pyrB CDS complement(708423..708554) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS complement(708620..709591) product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146675.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS 709925..710617 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964819.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS 711034..711972 product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202902.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS complement(712100..713344) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047697.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS complement(713357..714094) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015684.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS complement(714094..715287) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373411.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS complement(715307..716149) product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897787.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 gene dapF CDS complement(716302..717600) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963928.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 gene lysA CDS complement(717656..718573) product arginine deiminase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963436.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS complement(718686..720722) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015947.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS complement(721089..723152) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015947.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS complement(723563..724816) product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963927.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS complement(725027..725497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS complement(725513..726448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS complement(726588..727820) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016314.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS complement(727949..728689) product DUF4261 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015821.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS complement(728700..729161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS 729337..730176 product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016676.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS complement(730193..731368) product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016598.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 gene coaBC CDS complement(731378..732073) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS complement(732139..732735) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183791.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS complement(732756..733172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS complement(733277..734005) product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016971.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS 734179..735354 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966253.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS complement(735400..737457) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627021.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 gene fusA CDS complement(737651..738760) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002353714.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS complement(738771..739997) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016645.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS 740176..742287 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796568.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS complement(742337..744133) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016675.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 gene hflX CDS 744428..744823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367343.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS 744977..746152 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860903.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS complement(746204..746929) product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898376.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 gene fabG CDS 747160..747819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS complement(747891..749450) product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017113.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 gene citF CDS complement(749466..750347) product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898727.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 gene citE CDS complement(750347..750610) product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816323.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 gene citD CDS complement(750658..751767) product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922322.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS complement(751786..752136) product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149793471.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS complement(752146..752460) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS complement(752478..753854) product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355994.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS 754149..755492 product 2-hydroxycarboxylate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902179.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS complement(755561..756220) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869088.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS 756636..758048 product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889640.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS 758069..759244 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066054433.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS 759329..760024 product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015921.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS 760619..761653 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902589.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS 761665..762780 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902588.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS 762770..764416 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896074.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS complement(764450..765703) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016802.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 gene purD CDS complement(765721..767223) product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385254.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 gene purH CDS complement(767220..767810) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047940.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 gene purN CDS complement(767798..768799) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016807.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 gene purM CDS complement(768818..770218) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047942.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 gene purF CDS complement(770222..770938) product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016809.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS complement(770984..771463) product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357851.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 gene purE CDS complement(771476..775204) product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494805.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS complement(775235..776899) product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903107.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS complement(777252..777680) product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964217.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 gene aroQ CDS complement(777680..778483) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439416.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 gene aroE CDS complement(778476..779549) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861346.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 gene aroC CDS complement(779558..780883) product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903562.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 rRNA complement(780948..781041) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 78 percent of the 5S ribosomal RNA locus_tag LOCUS_r00010 rRNA complement(781100..784003) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 rRNA complement(784152..785654) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 CDS complement(785818..786702) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433836.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS complement(786786..787115) product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140100.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS complement(787109..787363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS complement(787470..788153) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07570 tRNA 788477..788553 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA 788559..788633 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS 788765..790579 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016358.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS 790593..791363 product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903485.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS complement(791410..792480) product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387189.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS 792999..794597 product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437129.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS 794597..795724 product betaine/proline/choline family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966134.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS complement(795770..797395) product NFACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016576.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS complement(797412..798095) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902078.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS complement(798097..798738) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902077.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 gene rpe CDS complement(798731..799537) product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627939.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 gene rsgA CDS complement(799631..800341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS 800669..803815 product autotransporter serine protease fusolisin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627120.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS 803998..804519 product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016283.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 gene hpt CDS 804533..805327 product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016282.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 gene rsmA CDS 805377..805640 product DUF4911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016281.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS 805656..805895 product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005899450.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS 805904..806455 product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904385.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 gene rimM CDS 806455..807183 product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016280.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 gene trmD CDS 807207..807728 product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977514.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS 807743..808306 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904383.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS 808335..812699 product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627746.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS 812804..813082 product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901839.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS 813228..814505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904381.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS 814495..815217 product MlaA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895829.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS 815241..816623 product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016277.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 gene pepV CDS complement(816661..816954) product cysteine-rich small domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437519.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS complement(817048..817770) product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877131.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 gene sfsA CDS complement(817832..818248) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016892.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS complement(818321..819229) product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198480077.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS complement(819254..820726) product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896598.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS complement(820762..821766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS complement(821779..823566) product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902903.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 gene uvrC CDS complement(823560..824444) product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016889.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 gene rapZ CDS 824623..825549 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964929.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS 825560..826444 product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964930.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS 826456..827343 product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490772.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS complement(827448..831017) product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016958.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 gene nifJ CDS complement(831149..832351) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016959.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS complement(832375..833382) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627902.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 gene pta CDS complement(833545..834669) product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016881.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 gene ftsY CDS complement(834796..836184) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583433.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS complement(836202..836684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS complement(836689..837804) product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016880.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 gene yqeH CDS complement(837823..838353) product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668456.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 gene hslV CDS complement(838370..839248) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016879.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS complement(839272..840579) product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016878.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 gene trmFO CDS complement(840579..842852) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902939.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 gene topA CDS complement(842930..843991) product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124795245.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 gene dprA CDS complement(844005..844703) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367128.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS complement(844684..845904) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902942.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 gene xseA CDS complement(845914..847899) product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016236.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 gene uvrB CDS complement(848140..849618) product IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175613129.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS complement(849766..850191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS complement(850265..850945) product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016742.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS complement(850949..851905) product regulatory iron-sulfur-containing complex subunit RicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903716.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 gene ricT CDS complement(851921..852613) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016743.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 gene radC CDS complement(852635..853693) product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016744.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 gene cobT CDS complement(853704..854282) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903719.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS complement(854300..855079) product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016745.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 gene cobS CDS complement(855095..855661) product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016746.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 gene cobU CDS complement(856170..856703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS complement(856990..857325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS complement(857338..858030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS 858402..858725 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356887.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS complement(858743..859996) product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198480035.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS complement(860017..860469) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS complement(860491..861339) product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360263.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 gene htpX CDS 861554..863554 product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016717.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 gene aroB CDS 863547..863810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS 863927..864859 product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q9L4E1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 gene selD CDS 864863..866236 product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545074.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 gene selA CDS 866233..868101 product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454786.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 gene selB CDS 868116..868691 product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892314.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 gene yedF CDS 868688..868951 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08300 tRNA 868952..869044 product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS 869236..870732 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108360.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS 870778..872169 product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261695.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS complement(872224..875442) product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892173.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 gene carB CDS complement(875483..876538) product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429883.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 gene carA CDS complement(876575..876736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS 876931..877569 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS complement(877605..880073) product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626185.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS complement(880107..880271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS complement(880435..882927) product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016714.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS complement(882946..883092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS complement(883113..883790) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025775002.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS complement(883875..884630) product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903362.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS complement(884634..885431) product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903362.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS 885675..885998 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903484.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS 886017..889535 product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147373219.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 gene smc CDS 889609..890634 product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626176.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 gene lpxK CDS 890621..891427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016924.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS 891438..891890 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS 891887..892453 product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016925.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 gene nadD CDS 892471..893013 product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948679.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 gene yfcE CDS 893249..894898 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015951.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 tRNA complement(895098..895174) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 tRNA complement(895178..895253) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 tRNA complement(895263..895338) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 tRNA complement(895485..895561) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 tRNA complement(895565..895640) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 tRNA complement(895650..895725) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS 895870..897234 product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016888.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS complement(897298..898608) product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860915.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS complement(898629..899315) product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678960.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS 899474..902299 product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016452.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS 902301..903479 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS 903466..906261 product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016450.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS 906272..906610 product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396628.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS 906623..907267 product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016449.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS 907557..909035 product IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175613129.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS complement(909193..910380) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898184.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS complement(910517..911455) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948804.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS complement(911473..912948) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948803.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS complement(913094..914086) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948802.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS complement(914100..914726) product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048417.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS complement(915010..915216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS complement(915237..917000) product urocanate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074216.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 gene urdA CDS complement(917264..917965) product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016414.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS complement(917965..918309) product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016413.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS complement(918379..919860) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016412.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 gene lysS CDS complement(919912..921354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626693.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS complement(921442..921813) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS complement(921810..922151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS complement(922187..922654) product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016410.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS complement(922688..924538) product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495553.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 gene mutL CDS 924683..926530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS 926543..929110 product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016344.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 gene recJ CDS complement(929139..930605) product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963991.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS complement(930661..931647) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005918169.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS complement(931647..932639) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016362.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS complement(932661..933545) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902562.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS complement(933561..934457) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016361.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS complement(934620..936158) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016360.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS complement(936462..936725) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005890045.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 gene rpsO CDS complement(936850..939060) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015954.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 gene ftsH CDS complement(939061..940389) product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015953.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 gene tilS CDS complement(940468..942132) product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860933.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS complement(942144..943097) product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015952.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 gene mltG CDS complement(943238..944440) product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903248.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS complement(944475..946397) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903247.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS complement(946638..947804) product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902330.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 gene tgt CDS complement(947818..950001) product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902331.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS complement(950082..950597) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902332.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS complement(950640..951425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS complement(951415..952083) product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017188.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS complement(952080..953234) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017189.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS complement(953475..953930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS complement(953956..954405) product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902336.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS complement(954424..955281) product bifunctional 5,10-methylenetetrahydrofolate dehydrogenase/5,10-methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017190.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS complement(955294..956226) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147373209.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 gene fmt CDS complement(956226..956708) product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902339.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 gene nrdR CDS complement(956732..957205) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005919085.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS complement(957198..957914) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017193.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 gene recO CDS complement(957907..958473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017194.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS complement(958470..959312) product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124796804.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 gene mreC CDS complement(959314..960420) product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861987.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS 960786..961010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09070 tRNA complement(961151..961234) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 tRNA complement(961253..961328) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 tRNA complement(961338..961415) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 tRNA complement(961438..961513) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA complement(961517..961591) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 tRNA complement(961603..961678) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA complement(961682..961757) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS complement(961861..962349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124795010.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS complement(962397..963449) product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016951.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 gene glpX CDS complement(963446..963742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS complement(963745..964263) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016949.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 gene def CDS complement(964289..966592) product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016948.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 gene priA CDS complement(966602..968710) product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198480034.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS complement(968865..969056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS complement(969091..971283) product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546775.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 gene feoB CDS complement(971310..971540) product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545730.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS complement(971649..971873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS complement(972108..972614) product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901774.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 gene nrdG CDS complement(972632..974824) product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016303.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 gene nrdD CDS complement(974954..975796) product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016022.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS complement(975976..976767) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901801.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS complement(976760..977614) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016023.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS complement(977634..978557) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495574.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS complement(978777..980705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS complement(980917..981120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS complement(981145..981624) product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016620.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS complement(981728..982501) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948811.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS complement(982502..983353) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948810.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS complement(983377..984354) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948809.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 tRNA complement(984666..984742) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS complement(984752..985963) product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904352.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS 986295..987164 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016426.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 gene lgt CDS complement(987188..987967) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS complement(988060..988710) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902631.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS complement(988754..989410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627794.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS complement(989394..990545) product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016322.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS complement(990530..991639) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627795.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS complement(991649..992044) product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016324.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS complement(992053..992952) product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016325.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS 993038..993409 product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657078.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 gene mgsA CDS complement(993472..994983) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016326.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS 995131..995589 product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147373094.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 gene dtd CDS complement(995602..996537) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404958.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS 996644..997192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904332.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS 997288..997758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS complement(997849..998988) product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287525.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 gene tnpB CDS complement(999008..999412) product IS200/IS605-like element ISEfa4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287522.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 gene tnpA CDS 999519..1000241 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS 1000301..1000756 product SoxR reducing system RseC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902636.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS complement(1000818..1001639) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925921.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS complement(1001782..1002162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS complement(1002174..1005248) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017033.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS complement(1005277..1006353) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017032.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS complement(1006380..1007651) product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627853.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS complement(1007666..1008289) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903928.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS complement(1008371..1009753) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986504.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS complement(1009766..1010422) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044683.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS complement(1010719..1012161) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016630.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 gene gatB CDS complement(1012181..1013638) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903492.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 gene gatA CDS complement(1013666..1013956) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903491.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 gene gatC CDS complement(1013980..1014690) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903490.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS complement(1014671..1015204) product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903489.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 gene scpB CDS complement(1015194..1016819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS complement(1016847..1017893) product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367094.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS complement(1017911..1018489) product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903487.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS complement(1018473..1019603) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS complement(1019724..1020677) product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902703.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS complement(1020704..1021441) product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071805.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 rRNA complement(1021553..1021644) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 77 percent of the 5S ribosomal RNA locus_tag LOCUS_r00040 rRNA complement(1021704..1024607) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00050 rRNA complement(1024756..1026258) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00060 CDS complement(1026471..1026866) product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948377.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS complement(1026879..1029686) product DUF3427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015950.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS complement(1029813..1030355) product toxin-antitoxin system YwqK family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902930.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS complement(1030514..1031677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS 1031763..1032170 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015893.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS 1032170..1032598 product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860931.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS complement(1032630..1034315) product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627326.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS complement(1034568..1035854) product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902212.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS complement(1035873..1036355) product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896258.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS complement(1036455..1037489) product C4-dicarboxylate TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029491570.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS complement(1037777..1038487) product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895688.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS 1038882..1039394 product toxin-antitoxin system YwqK family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898570.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS 1039431..1039760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS complement(1039794..1041239) product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015880.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS complement(1041597..1043174) product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779462.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS complement(1043195..1043935) product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016663.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 gene kdsB CDS 1044027..1044797 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS 1044817..1045440 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903437.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS 1045443..1046192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS complement(1046225..1047280) product sulfite reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706397.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 gene asrC CDS complement(1047293..1048102) product anaerobic sulfite reductase subunit AsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706396.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 gene asrB CDS complement(1048107..1049141) product anaerobic sulfite reductase subunit AsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964821.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 gene asrA CDS complement(1049501..1050487) product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321171.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS complement(1050508..1051551) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289801.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS 1051795..1053369 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948042.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS 1053347..1054021 product two-component system response regulator MaeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968074.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 gene maeM CDS complement(1054051..1054920) product DUF4438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927126.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS 1055066..1055335 product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053740.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS 1055354..1056712 product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861617.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS complement(1056745..1057665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS 1057800..1058189 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462837.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS 1058228..1059001 product 7-alpha-hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483362.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 gene hdhA CDS 1059216..1060463 product coproporphyrinogen-III oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016639.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS 1060463..1060969 product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016640.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS 1061107..1062078 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903477.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS 1062078..1062872 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016638.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS 1062869..1063759 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626402.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS 1063850..1064560 product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895688.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS 1064809..1065525 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965007.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS 1065533..1067263 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986853.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS 1067427..1069553 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898381.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS 1069706..1070416 product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895688.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS 1070457..1071431 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494482.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS 1071444..1071872 product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903082.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS 1071885..1073366 product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903081.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS complement(1073406..1075118) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016438.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 gene argS CDS complement(1075458..1077257) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016293.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 gene aspS CDS complement(1077291..1078538) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016292.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 gene hisS CDS complement(1078557..1079789) product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016291.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS complement(1079850..1080074) product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904328.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 gene secG CDS complement(1080237..1081436) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870329.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS complement(1081475..1082680) product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890721.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 gene ilvA CDS complement(1083129..1085042) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626551.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 gene thrS CDS complement(1085071..1088805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495458.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS complement(1089093..1089410) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021055.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 gene trxA CDS complement(1089474..1090799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS complement(1090838..1091530) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016759.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 gene tsaB CDS complement(1091511..1091975) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903737.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 gene tsaE CDS complement(1091968..1092480) product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896999.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 gene rfaE2 CDS complement(1092485..1093105) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016761.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS complement(1093196..1093819) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032884835.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 gene upp CDS 1094176..1094841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS 1094855..1095331 product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894981.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS 1095403..1097028 product putative glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124797038.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS 1097112..1097972 product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016546.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 gene truB CDS 1097992..1099809 product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016545.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 gene typA CDS 1099836..1100669 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS 1100698..1101054 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS 1101101..1101262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS 1101436..1101792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10370 note possible pseudo, frameshifted CDS 1101767..1102084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS 1102641..1103258 product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002860212.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS complement(1103315..1104817) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016360.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS 1105042..1105452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS 1105471..1106094 product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002860212.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS 1106215..1107546 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016193.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS 1107618..1108322 product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016610.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS 1108332..1108835 product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016609.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS complement(1108909..1110252) product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944264.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS 1110587..1111228 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367246.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS 1111248..1113173 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017027.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 gene metG CDS 1113203..1114087 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005899251.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 gene galU CDS 1114110..1114718 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS 1114833..1115144 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896540.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 gene rplU CDS 1115149..1115484 product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016913.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS 1115485..1115769 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902873.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 gene rpmA CDS 1115925..1116236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903280.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS 1116248..1117597 product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903281.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 gene ffh CDS 1117651..1117917 product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903282.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 gene rpsP CDS 1118060..1120225 product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895431.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS 1120230..1122638 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367423.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS 1122638..1125439 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903528.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 gene ileS CDS 1125449..1125916 product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895436.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 gene lspA CDS 1125916..1126788 product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903526.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 gene glyQ CDS 1126830..1128899 product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016119.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 gene glyS CDS 1128955..1129506 product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895440.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 gene folE CDS 1129517..1130347 product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016121.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 gene folK CDS 1130356..1131615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS 1131680..1131994 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067446.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 gene trxA CDS complement(1132102..1133376) product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627060.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS complement(1133512..1134474) product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015945.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS complement(1134486..1135262) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901765.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS complement(1135259..1136284) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901766.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS complement(1136281..1137147) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367304.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS complement(1137168..1137857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS complement(1137867..1138277) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779456.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS complement(1138277..1138906) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894436.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS complement(1139280..1140626) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627682.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS 1140725..1141378 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS complement(1141471..1142178) product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895688.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS complement(1142269..1143645) product amino acid carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005970668.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS complement(1143666..1144394) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682266.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS complement(1144818..1145840) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897665.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(1145833..1146543) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016161.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS complement(1146546..1147757) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897667.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS complement(1147845..1149122) product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015701.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS complement(1149143..1149844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10840 note possible pseudo, frameshifted CDS complement(1149856..1151082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10850 note possible pseudo, frameshifted CDS complement(1151084..1151746) product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015703.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 gene cmk CDS complement(1151760..1152689) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029493681.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 gene prmA CDS complement(1152705..1153499) product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904102.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS complement(1153638..1154300) product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902990.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS complement(1154316..1154960) product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902988.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS complement(1155027..1156403) product short-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015878.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS complement(1156705..1158051) product amino acid carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016013.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS complement(1158224..1159417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS complement(1159404..1160477) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017013.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS complement(1160474..1161667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS complement(1161664..1162311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS complement(1162304..1163170) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017011.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS complement(1163172..1164299) product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017015.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS complement(1164287..1165015) product lipopolysaccharide core heptose(II) kinase RfaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017009.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS complement(1165026..1165934) product SP_1767 family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794519.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS 1166206..1167084 product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963998.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS 1167099..1169150 product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015732.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 gene recG CDS 1169209..1170918 product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015730.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS 1171361..1172554 product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903453.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 gene gltS CDS 1172587..1173378 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902800.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 gene murI CDS complement(1173424..1174932) product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902867.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS complement(1175107..1175871) product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578803.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS complement(1175906..1176793) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017072.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS complement(1176795..1177013) product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005899316.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 gene xseB CDS complement(1177035..1177583) product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017073.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 gene rsmD CDS complement(1177596..1178627) product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627822.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 gene queA CDS complement(1178627..1179763) product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495074.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 gene prmC CDS complement(1179765..1180841) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124796873.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 gene prfA CDS complement(1180967..1181368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902390.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS complement(1181381..1181701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902392.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS complement(1181703..1182152) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902394.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS complement(1182278..1183333) product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902396.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 gene ispG CDS complement(1183362..1184360) product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898353.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS complement(1184350..1185597) product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016419.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 gene rho CDS complement(1185628..1186938) product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016418.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 gene miaB CDS complement(1187111..1187794) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS complement(1187894..1189090) product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015639.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS complement(1189106..1189765) product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015638.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 gene ribE CDS complement(1189774..1190850) product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902112.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 gene ribD CDS complement(1190852..1191313) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902111.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 gene ribE CDS complement(1191629..1192975) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438549.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS complement(1193062..1193604) product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948549.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS complement(1193674..1194498) product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430209.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS complement(1194607..1195026) product HutP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356304.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS 1195260..1196618 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948764.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS complement(1196668..1198233) product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627077.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 gene rny CDS complement(1198260..1198607) product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903963.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS complement(1198610..1199005) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894582.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS complement(1199009..1199398) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS complement(1199477..1200376) product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903969.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 gene miaA CDS complement(1200440..1201726) product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015918.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 gene obgE CDS 1202125..1203672 product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957212.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS 1203944..1204255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(1204337..1205947) product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868784.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS complement(1206592..1207833) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814826.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS complement(1208041..1209096) product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016189.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 gene disA CDS complement(1209089..1210471) product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016188.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 gene radA CDS complement(1210489..1210980) product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016187.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 gene coaD CDS complement(1210990..1212459) product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 gene rng CDS complement(1212461..1213486) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016184.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS complement(1213473..1214195) product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124797266.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 gene rnc CDS complement(1214214..1215452) product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016182.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 gene fabF CDS complement(1215524..1215745) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902726.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 gene acpP CDS complement(1215795..1216709) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016181.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 gene fabD CDS complement(1216773..1217765) product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016180.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS complement(1217780..1218790) product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016179.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 gene plsX CDS complement(1219094..1219276) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005890386.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 gene rpmF CDS complement(1219313..1219804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS complement(1219895..1220992) product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017102.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 gene ychF CDS complement(1221118..1221573) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS complement(1221580..1222401) product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941313.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS complement(1222419..1223282) product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016986.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 gene ylqF CDS complement(1223302..1223964) product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903175.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 gene rsmI CDS complement(1223978..1225300) product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494947.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS complement(1225297..1226106) product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016988.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS complement(1226108..1226953) product 3'-5' exoribonuclease YhaM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903178.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS complement(1226937..1228763) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903179.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 gene dxs CDS complement(1228770..1229255) product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810945.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS complement(1229275..1229580) product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016989.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 gene yhbY CDS complement(1229598..1231553) product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896361.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS complement(1231618..1233345) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903183.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 gene mrdA CDS complement(1233457..1233870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS complement(1233889..1234854) product LytR C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903185.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS complement(1234847..1236148) product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016990.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 gene mtaB CDS complement(1236135..1236848) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016991.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS complement(1236858..1237280) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903188.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS complement(1237277..1238284) product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903189.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 gene ruvB CDS complement(1238296..1238910) product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903191.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS complement(1239145..1240770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11740 note possible pseudo, frameshifted CDS complement(1240763..1241638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11750 note possible pseudo, frameshifted CDS complement(1241641..1241910) product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904300.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(1241921..1243660) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152804487.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 gene ptsP CDS 1243890..1246004 product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS complement(1246035..1247429) product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047702.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS complement(1247444..1248346) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262369.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS 1248487..1249608 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418888.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS 1249748..1250641 product VirK/YbjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171082.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS complement(1250668..1252443) product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897431.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS complement(1252455..1254278) product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016400.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 gene glmS CDS complement(1254545..1255555) product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903460.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS complement(1255604..1256389) product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903461.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS complement(1256450..1257598) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903462.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS 1258390..1261800 product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017116.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 gene dnaE CDS 1261867..1262292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS 1262325..1263671 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944627.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 gene accC CDS 1263757..1264137 product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015712.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS 1264189..1264755 product alkaline shock response membrane anchor protein AmaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058229291.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 gene amaP CDS 1264770..1264997 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS 1265010..1265528 product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358828.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 gene nusB CDS complement(1265566..1265955) product dihydroxyacetone kinase phosphoryl donor subunit DhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627629.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 gene dhaM tRNA complement(1266253..1266329) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS complement(1266457..1266885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS complement(1267047..1268180) product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599321.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS complement(1268345..1269709) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659213.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS complement(1269963..1270196) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11990 tRNA complement(1270411..1270501) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 tRNA complement(1270505..1270588) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS complement(1270700..1271509) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434098.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 gene proC CDS complement(1271533..1272384) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424273.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS complement(1272549..1272776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS 1272942..1273631 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284674.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS complement(1273656..1275353) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949122.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS complement(1275499..1276962) product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356603.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS complement(1276994..1277908) product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903278.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 gene glsA CDS complement(1278353..1279687) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627442.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS complement(1279697..1280407) product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015675.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 gene pgeF CDS complement(1280407..1281420) product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015676.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 gene aroF CDS complement(1281480..1281764) product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015677.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(1281827..1281997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS complement(1282141..1282512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903355.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS complement(1282512..1283621) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627593.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS complement(1283611..1284651) product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903357.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS complement(1284644..1286233) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015905.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS complement(1286288..1287469) product DUF3798 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868876.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS complement(1287676..1288146) product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986413.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 gene nuoE rRNA complement(1288239..1288329) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 76 percent of the 5S ribosomal RNA locus_tag LOCUS_r00070 rRNA complement(1288387..1288478) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 77 percent of the 5S ribosomal RNA locus_tag LOCUS_r00080 rRNA complement(1288538..1291441) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00090 tRNA complement(1291540..1291615) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 tRNA complement(1291623..1291699) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 rRNA complement(1291759..1293261) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00100 CDS complement(1293484..1294146) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903942.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS 1294230..1294592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS complement(1294627..1295118) product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS 1295279..1295794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS complement(1295848..1296135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071742188.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS complement(1296214..1297032) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626402.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS complement(1297094..1299355) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898381.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS complement(1299891..1301447) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297195.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS complement(1301573..1302253) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965730.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS complement(1302351..1303202) product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538556.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS 1303398..1304273 product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020932.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 gene pstC CDS 1304283..1305128 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788578.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 gene pstA CDS 1305155..1305919 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986851.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 gene pstB CDS 1305944..1306639 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS complement(1306668..1308113) product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902082.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 gene panF CDS complement(1308110..1308373) product YhdT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367085.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS complement(1308535..1309515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS complement(1309542..1310687) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453947.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS 1310863..1312254 product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964662.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 gene nagE CDS 1312277..1313818 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016268198.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS 1313958..1314206 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS complement(1314234..1315388) product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568430.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 gene iadA CDS complement(1315809..1316582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS complement(1316743..1316937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS complement(1317423..1317773) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901611.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 gene rplT CDS complement(1317822..1318028) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005893833.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 gene rpmI CDS complement(1318071..1318496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS 1319265..1321205 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015947.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS complement(1321388..1322527) product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287525.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 gene tnpB CDS complement(1322547..1322951) product IS200/IS605-like element ISEfa4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287522.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 gene tnpA CDS complement(1323006..1323440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS 1323669..1324217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS 1324331..1325830 product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015709.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS complement(1325856..1327178) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439092.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS complement(1327214..1328338) product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262909.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS complement(1328331..1329023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426728.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(1329038..1329763) product DUF5058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426729.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS 1329943..1331217 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439084.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS 1331432..1332835 product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868901.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 gene hydG CDS 1333004..1333177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS complement(1333278..1334735) product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902130.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS 1334985..1335509 product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867207.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 gene cobO CDS 1335646..1337313 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627701.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS 1337328..1338056 product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902128.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS complement(1338103..1338819) product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861305.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS complement(1338831..1339439) product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016415.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS complement(1339450..1340832) product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048281.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 gene pepV CDS complement(1340889..1341194) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417897.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS complement(1341221..1342513) product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098234.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 gene celB CDS complement(1342545..1343504) product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895213.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS complement(1343532..1343846) product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895529.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS 1344092..1345207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS 1345230..1346546 product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017139.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS complement(1346647..1347909) product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016618.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 gene hutI CDS complement(1347918..1349942) product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016651.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS complement(1349969..1351504) product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016650.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 gene hutH CDS complement(1351553..1352851) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016320.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS 1353133..1354269 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897979.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS 1354334..1354879 product HutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904290.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS 1354895..1355806 product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902051.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 gene hutG CDS 1355938..1357212 product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016106.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 gene brnQ CDS complement(1357237..1357509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS 1357596..1358870 product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964213.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 gene aroA CDS 1358998..1359687 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673955.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS complement(1359730..1361001) product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288256.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS complement(1361004..1361483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS complement(1361483..1362499) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288260.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS complement(1362514..1364118) product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054937112.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS complement(1364143..1365192) product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964641.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 gene uxuA CDS complement(1365210..1366619) product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964011.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 gene uxaC CDS complement(1366814..1368946) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016521.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 gene rnr CDS complement(1368943..1369521) product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016520.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 gene yqeK CDS complement(1369653..1370195) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS complement(1370212..1371219) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029491986.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS complement(1371338..1371619) product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017079.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 gene yajC CDS complement(1371746..1372900) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016154.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 gene dnaJ CDS complement(1372973..1373845) product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296994.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS complement(1373938..1375761) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016153.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 gene dnaK CDS complement(1375821..1376417) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016151.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 gene grpE CDS complement(1376407..1377438) product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198480919.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 gene hrcA CDS 1377698..1378324 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082842.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS 1378317..1379090 product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082840.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 gene fetB CDS complement(1379114..1380472) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494970.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS complement(1380476..1381153) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029491567.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS 1381309..1382025 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS 1382022..1382291 product lipid-A-disaccharide synthase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972149.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS 1382288..1383880 product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017024.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS 1383882..1384928 product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799038.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS 1384933..1386255 product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545232.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS 1386257..1387723 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS complement(1387739..1389115) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS complement(1389228..1389800) product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689963.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 gene pdxT CDS complement(1389802..1390677) product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138517.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 gene pdxS CDS 1390832..1392229 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896029.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS complement(1392257..1392661) product ATP synthase F1 subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016334.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 gene atpC CDS complement(1392664..1394064) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016335.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 gene atpD CDS complement(1394083..1394934) product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016336.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 gene atpG CDS complement(1394949..1396451) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016337.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 gene atpA CDS complement(1396479..1397000) product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016338.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 gene atpH CDS complement(1396997..1397494) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052212.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 gene atpF CDS complement(1397552..1397824) product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902609.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 gene atpE CDS complement(1397873..1398748) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124796847.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 gene atpB CDS complement(1398776..1399153) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS complement(1399163..1399381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS complement(1399488..1400195) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229973.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS complement(1400212..1401567) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902604.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 gene glmM CDS complement(1401564..1402085) product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902602.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS complement(1402085..1403518) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016341.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 gene purB CDS complement(1403587..1404012) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001022053.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS complement(1404021..1404950) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029491539.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 gene lepB CDS complement(1405119..1406462) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294399.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS complement(1406578..1406928) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898626.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 gene rplS tRNA complement(1407060..1407135) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 rRNA complement(1407161..1407253) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 78 percent of the 5S ribosomal RNA locus_tag LOCUS_r00110 rRNA complement(1407312..1410215) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00120 rRNA complement(1410364..1411866) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00130 CDS complement(1412066..1413154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS complement(1413240..1414700) product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776859.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS complement(1414713..1414877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS complement(1414895..1416358) product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121872.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS complement(1416401..1417528) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453947.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS complement(1417563..1417760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS 1418364..1419770 product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903277.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS complement(1419939..1420316) product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124796962.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 gene nifU CDS complement(1420369..1421541) product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016111.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 gene nifS CDS complement(1421871..1422656) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966376.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 gene thiD CDS complement(1422657..1423301) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963817.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 gene thiE CDS complement(1423288..1424109) product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966377.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 gene thiM CDS complement(1424306..1424971) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895383.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 gene nth CDS complement(1425037..1425504) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016109.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS complement(1425520..1426746) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367412.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 gene tyrS CDS complement(1427150..1428640) product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986561.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS complement(1429044..1429706) product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898027.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS complement(1429727..1430056) product branched-chain amino acid transporter AzlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245988.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 gene azlD CDS complement(1430049..1430756) product azaleucine resistance protein AzlC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969035.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 gene azlC CDS complement(1430925..1432196) product 2-hydroxycarboxylate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680734.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS complement(1432333..1433637) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015819.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 gene eno CDS complement(1433711..1435123) product pyruvate kinase PykF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005900019.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 gene pykF CDS complement(1435653..1436327) product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017182.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS complement(1436351..1436809) product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029492147.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS complement(1436884..1437792) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017180.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS complement(1437877..1439784) product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902322.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS complement(1439818..1440804) product sialic acid TRAP transporter substrate-binding protein SiaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017179.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS complement(1440839..1441843) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017178.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS 1442148..1442477 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047981.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS 1442577..1443587 product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016441.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS complement(1443655..1444443) product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861091.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 gene zupT CDS complement(1444615..1445079) product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002661617.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS complement(1445203..1445439) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS complement(1445667..1446260) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS 1446499..1446699 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288762.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS complement(1446770..1447762) product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894909.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS complement(1447765..1447980) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894911.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS complement(1447993..1448559) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904066.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 gene gmk CDS complement(1448552..1448800) product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583796.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS complement(1448809..1449690) product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015992.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS complement(1449769..1453725) product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904068.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 gene rpoC CDS complement(1453845..1457351) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015993.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 gene rpoB CDS complement(1457558..1457923) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005889295.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 gene rplL CDS complement(1458025..1458546) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904072.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 gene rplJ CDS complement(1458710..1459417) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015994.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 gene rplA CDS complement(1459506..1459931) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894933.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 gene rplK CDS complement(1460001..1460600) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904074.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 gene nusG CDS complement(1460605..1460787) product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904075.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 gene secE tRNA complement(1460832..1460907) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS complement(1460925..1461077) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940181.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 gene rpmG rRNA complement(1461271..1461363) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 78 percent of the 5S ribosomal RNA locus_tag LOCUS_r00140 rRNA complement(1461422..1464325) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00150 rRNA complement(1464474..1465976) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00160 CDS complement(1466302..1467441) product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287525.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 gene tnpB CDS complement(1467461..1467865) product IS200/IS605-like element ISEfa4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287522.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 gene tnpA CDS complement(1468038..1470647) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015646.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 gene leuS CDS complement(1470725..1471321) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015647.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS complement(1471368..1472090) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015648.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 gene rlmB CDS complement(1472097..1473365) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015649.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 gene murA CDS complement(1473365..1473919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS 1474232..1475278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS complement(1475321..1475821) product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682427.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS 1475951..1476334 product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435507.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS 1476508..1477254 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS 1477247..1478065 product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986981.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS 1478066..1478836 product capsular polysaccharide biosynthesis protein Cps4B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922734.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 gene cps4B CDS 1478766..1480007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS 1480023..1481351 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS 1481353..1482438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS complement(1482654..1482845) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS complement(1482893..1484032) product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287525.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 gene tnpB CDS complement(1484052..1484456) product IS200/IS605-like element ISEfa4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287522.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 gene tnpA CDS complement(1484620..1485639) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016472.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 gene tsaD CDS complement(1485741..1486478) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948182.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS complement(1486491..1487039) product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032881713.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS complement(1487026..1488105) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147373114.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 gene recA CDS complement(1488108..1489097) product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016469.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS complement(1489107..1489790) product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016468.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS complement(1489790..1490800) product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016467.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS complement(1490787..1491827) product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495222.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS complement(1491839..1492603) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898431.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS complement(1492613..1493689) product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029491176.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 tRNA complement(1493895..1493971) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS complement(1494094..1494252) product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966063.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS complement(1494337..1494720) product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048271.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS complement(1494772..1495197) product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904077.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS complement(1495287..1495736) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015995.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS complement(1495726..1496478) product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627073.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 gene truA tRNA complement(1496550..1496633) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 tRNA complement(1496640..1496715) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 tRNA complement(1496731..1496806) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 tRNA complement(1496822..1496898) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 tRNA complement(1496904..1496979) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 tRNA complement(1496987..1497063) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 CDS 1497350..1498003 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367249.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS 1498151..1498486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS complement(1498614..1498988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS complement(1499214..1500536) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS complement(1500575..1501906) product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986689.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS complement(1502019..1502300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS complement(1502440..1503591) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015738.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS complement(1503592..1504461) product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877393.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 gene rfbA CDS complement(1504621..1505676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS complement(1505669..1507495) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203684.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS complement(1507523..1508629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS complement(1508726..1509529) product phosphorylcholine transferase LicD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811992.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS complement(1509522..1510988) product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015752.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS complement(1511347..1512753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS complement(1513163..1513315) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS complement(1513746..1514855) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050765261.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS complement(1514852..1515991) product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202262.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 gene wecB CDS complement(1516005..1517051) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS complement(1517053..1518219) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107232.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS complement(1518244..1519305) product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107231.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS complement(1519308..1520531) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963416.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS complement(1520546..1521340) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015764.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS complement(1521340..1522020) product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005947811.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS complement(1522032..1522556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS complement(1522549..1524159) product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627506.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS complement(1525127..1526542) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS complement(1526634..1527278) product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861300.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 gene pcp CDS complement(1527291..1528211) product DUF979 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433654.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS complement(1528211..1528903) product DUF969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681060.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS complement(1529060..1530058) product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428486.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS complement(1530077..1530661) product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904083.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 gene rsxA CDS complement(1530665..1531273) product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904084.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS complement(1531273..1531806) product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015690.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS complement(1531796..1532743) product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015691.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS complement(1532781..1534091) product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198480691.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 gene rsxC CDS complement(1534400..1534960) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015693.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 gene pth CDS complement(1535072..1536280) product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902886.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS complement(1536471..1537610) product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287525.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 gene tnpB CDS complement(1537630..1538034) product IS200/IS605-like element ISEfa4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287522.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 gene tnpA CDS complement(1538216..1540603) product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016058.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 gene pheT CDS complement(1540619..1541635) product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895121.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 gene pheS CDS complement(1541696..1542160) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016060.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS complement(1542165..1542935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS complement(1542977..1545520) product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903616.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 gene gyrA CDS complement(1545588..1547495) product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895130.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 gene gyrB CDS complement(1547498..1547743) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS complement(1547743..1548354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS complement(1548335..1549432) product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016062.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS complement(1549466..1549672) product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903607.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 gene yaaA CDS 1549919..1550215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS 1550327..1551502 product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949005.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS complement(1551570..1552625) product sulfite reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706397.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 gene asrC CDS complement(1552642..1553451) product anaerobic sulfite reductase subunit AsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948642.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 gene asrB CDS complement(1553456..1554490) product anaerobic sulfite reductase subunit AsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948641.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 gene asrA CDS complement(1554661..1555527) product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS complement(1555817..1556215) product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369434.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 gene mscL CDS complement(1556291..1557643) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103658.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS complement(1557687..1558124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14700 tRNA complement(1558350..1558424) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 CDS complement(1558473..1558721) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903836.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS complement(1558898..1559740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS complement(1559986..1561125) product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287525.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 gene tnpB CDS complement(1561145..1561549) product IS200/IS605-like element ISEfa4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287522.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 gene tnpA CDS complement(1561713..1563188) product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015664.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 gene nagE CDS complement(1563512..1564306) product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627865.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS complement(1564463..1564744) product septation protein SpoVG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016082.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS complement(1564764..1565639) product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016081.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 gene ispE CDS complement(1565636..1565929) product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005900912.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS complement(1565986..1566765) product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545835.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 gene mazG CDS complement(1566752..1569742) product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016080.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS 1570187..1571530 product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016888.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS 1571561..1572979 product cation:dicarboxylase symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861591.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS complement(1573017..1573550) product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723402.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS complement(1573803..1574687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14850 note possible pseudo, frameshifted CDS complement(1574618..1575184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14860 note possible pseudo, frameshifted CDS complement(1575274..1576311) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062640.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS complement(1576325..1576957) product bifunctional 2-keto-4-hydroxyglutarate aldolase/2-keto-3-deoxy-6-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367887.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS 1577137..1578036 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027102.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS 1578048..1578800 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393281.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS 1579156..1579470 product YdcP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000420682.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS 1579486..1579872 product YdcP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985015.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS 1579901..1581286 product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813488.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS 1581464..1582669 product MobT family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000398284.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 gene mobT CDS 1582712..1582933 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009056.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS 1583050..1583547 product antirestriction protein ArdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342539.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS 1583798..1584028 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS 1584012..1586459 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331160.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS 1586462..1588639 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804748.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS 1588636..1589637 product bifunctional lysozyme/C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769868.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS 1589634..1590566 product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001224318.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS 1590943..1592862 product tetracycline resistance ribosomal protection protein Tet(M) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371500.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 gene tet(M) CDS complement(1593027..1594166) product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287525.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 gene tnpB CDS complement(1594186..1594590) product IS200/IS605-like element ISEfa4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287522.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 gene tnpA CDS complement(1594787..1596343) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233752.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS complement(1596581..1597081) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS complement(1597670..1599520) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016068.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 gene mnmG CDS complement(1599587..1600957) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016067.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 gene mnmE CDS complement(1600967..1601806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS complement(1601812..1602432) product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903598.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS complement(1602441..1602677) product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016065.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 gene yidD CDS complement(1602687..1603025) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016064.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 gene rnpA CDS complement(1603100..1603234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS 1604033..1605823 product replication initiator protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016063.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS 1605942..1606508 product YiiX/YebB-like N1pC/P60 family cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015783.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS complement(1606561..1607385) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948267.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS complement(1607907..1608443) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356834.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS complement(1608678..1609817) product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287525.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 gene tnpB CDS complement(1609837..1610241) product IS200/IS605-like element ISEfa4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287522.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 gene tnpA CDS 1610737..1611756 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948870.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS 1611756..1612973 product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902886.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS complement(1613548..1613985) product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357848.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS 1614512..1614748 product YdbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986552.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS complement(1614796..1615971) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016940.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS complement(1616067..1617356) product serine dehydratase subunit alpha family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902828.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS complement(1617586..1619349) product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047951.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS complement(1619553..1619693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS 1619923..1620858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS 1621012..1622055 product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016492.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS complement(1622399..1623877) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986715.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS complement(1623968..1624420) product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016462.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS complement(1624410..1625720) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016463.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 gene hemL CDS complement(1625729..1626781) product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016407.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 gene hemB CDS complement(1626959..1627798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15340 note possible pseudo, frameshifted CDS complement(1627876..1629342) product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016554.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 gene cobA CDS complement(1629335..1630234) product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016555.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 gene hemC CDS complement(1630238..1631245) product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016556.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 gene hemA CDS 1631586..1632458 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902040.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS 1632671..1633678 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016560.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 gene gap CDS 1633786..1634985 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989997.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS complement(1635089..1635475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS 1635679..1636125 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS 1636122..1638386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS 1638441..1638845 product IS200/IS605-like element ISEfa4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287522.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 gene tnpA CDS 1638865..1640004 product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287525.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 gene tnpB CDS 1640369..1640779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS 1641329..1642714 product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657823.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS 1642865..1643734 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS 1643965..1644105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS 1644195..1644347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS complement(1644374..1645237) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367304.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS complement(1645318..1647267) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015947.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS 1647747..1648580 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS 1648594..1649766 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS complement(1649821..1650144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS 1650366..1650968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS 1650987..1651703 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS complement(1651772..1652050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS 1652318..1652494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS 1652649..1653176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15600 rRNA 1653478..1654980 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00170 rRNA 1655129..1658032 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00180 rRNA 1658092..1658183 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 77 percent of the 5S ribosomal RNA locus_tag LOCUS_r00190 CDS 1658349..1659431 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440236.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 rRNA 1659730..1661232 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00200 rRNA 1661381..1664284 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00210 rRNA 1664342..1664435 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 78 percent of the 5S ribosomal RNA locus_tag LOCUS_r00220 CDS 1664639..1665259 product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830824.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 gene udk CDS complement(1665294..1666061) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016872.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS complement(1666367..1666861) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS complement(1666854..1667651) product DUF3100 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016874.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS complement(1667641..1668900) product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853394.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 rRNA 1669260..1670762 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00230 rRNA 1670911..1673814 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00240 rRNA 1673872..1673965 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 78 percent of the 5S ribosomal RNA locus_tag LOCUS_r00250 CDS 1674161..1674718 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS 1674795..1676075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS 1676114..1677202 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902299.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 gene mraY CDS 1677283..1678590 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029597345.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 gene murD CDS 1678596..1679663 product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626926.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 gene murG CDS 1679665..1681020 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626924.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 gene murC CDS 1681020..1681871 product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898186.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 gene murB CDS 1681887..1682753 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198480619.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS 1682763..1683458 product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898188.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS 1683448..1684779 product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902286.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 gene ftsA CDS 1684805..1685872 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902285.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 gene ftsZ CDS 1685973..1686257 product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023040534.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 gene rpsF CDS 1686299..1686517 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005891822.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 gene rpsR CDS 1686911..1687540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS 1687732..1688760 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080120.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS 1688803..1689804 product C4-dicarboxylate TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029491570.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS 1689814..1690290 product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235681.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS 1690355..1691569 product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902212.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS 1691595..1692371 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392911.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS complement(1692474..1692731) product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898205.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 gene rpmB CDS 1692901..1695237 product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015682.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS 1695213..1695917 product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015681.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 gene ispD CDS 1695914..1696741 product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941312.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS 1696755..1698020 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS 1698039..1699454 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015680.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 gene cysS CDS 1699442..1699831 product mini-ribonuclease 3-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902248.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS 1699821..1700855 product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902246.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS 1700855..1701766 product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015679.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 tRNA 1701958..1702033 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 tRNA 1702040..1702117 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA 1702126..1702201 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 tRNA 1702221..1702294 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 CDS 1702427..1703383 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS 1703661..1704584 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113483.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 gene rbsK CDS 1704571..1704978 product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330720.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 gene rbsD CDS 1704987..1706483 product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463701.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 gene rbsA CDS 1706477..1707403 product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001891150.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 gene rbsC CDS 1707421..1708293 product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463703.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 gene rbsB CDS 1708531..1709445 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113483.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 gene rbsK CDS 1709472..1710869 product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731941.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS 1710927..1711874 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262036.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS 1712044..1712961 product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281520.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS 1713072..1714043 product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000712177.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS 1714036..1714866 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903868.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 tRNA 1715155..1715230 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 tRNA 1715235..1715309 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 tRNA 1715340..1715424 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 CDS 1715561..1716745 product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903497.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 gene tuf CDS 1717101..1717412 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897308.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 gene rpsJ CDS 1717601..1718227 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015720.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 gene rplC CDS 1718257..1718889 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904141.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 gene rplD CDS 1718889..1719176 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015719.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 gene rplW CDS 1719249..1720076 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904139.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 gene rplB CDS 1720107..1720379 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897301.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 gene rpsS CDS 1720426..1720761 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897300.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 gene rplV CDS 1720779..1721435 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005892367.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 gene rpsC CDS 1721438..1721860 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904138.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 gene rplP CDS 1721860..1722042 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015718.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 gene rpmC CDS 1722087..1722338 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904137.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 gene rpsQ CDS 1722369..1722737 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904136.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 gene rplN CDS 1722762..1723103 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897291.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 gene rplX CDS 1723123..1723674 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005892302.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 gene rplE CDS 1723699..1723986 product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015715.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 gene rpsN CDS 1724022..1724417 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904135.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 gene rpsH CDS 1724442..1724999 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904134.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 gene rplF CDS 1725025..1725393 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904133.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 gene rplR CDS 1725418..1725921 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015714.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 gene rpsE CDS 1725934..1726119 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005892817.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 gene rpmD CDS 1726119..1726598 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005899800.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 gene rplO CDS 1726723..1727916 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904128.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 gene secY CDS 1728083..1729171 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870212.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS 1729180..1729956 product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891882.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS 1729973..1730812 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770467.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS 1730802..1730975 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS 1731089..1731493 product IS200/IS605-like element ISEfa4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287522.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 gene tnpA CDS 1731513..1732652 product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287525.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 gene tnpB CDS 1732840..1733853 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263897.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS 1734049..1734690 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021125.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS 1734710..1735474 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017049.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 gene map CDS 1735579..1735800 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005899265.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 gene infA CDS 1736114..1736470 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903912.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 gene rpsM CDS 1736526..1736915 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903915.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 gene rpsK CDS 1737003..1737590 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903916.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 gene rpsD CDS 1737617..1738594 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023041516.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS 1738622..1738972 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903918.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 gene rplQ CDS complement(1739083..1739706) product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902979.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS complement(1739746..1741023) product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903982.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS 1741211..1741714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS complement(1741746..1742777) product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016459.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS complement(1743054..1743914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026612303.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS 1744397..1745752 product melibiose:sodium transporter MelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028111.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 gene melB CDS 1745771..1747714 product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575935.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS complement(1747752..1748294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS complement(1748313..1749332) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475724.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS complement(1749358..1749984) product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964265.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS complement(1750086..1750703) product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211676.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 gene pncA CDS 1750935..1751678 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904120.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 gene rpsB CDS 1751734..1752627 product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015713.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 gene tsf CDS 1752854..1753573 product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904124.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 gene pyrH CDS 1753606..1754166 product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904126.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 gene frr CDS 1754315..1755001 product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017071.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS 1755003..1755824 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017070.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS 1755875..1757026 product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147373191.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 gene dxr CDS 1757016..1757702 product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017068.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS 1757728..1758759 product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017067.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS 1758924..1760309 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896128.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS 1760379..1762106 product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627831.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS 1762312..1764141 product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017064.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 gene dnaG CDS 1764141..1765532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS 1765614..1766435 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS 1766432..1767211 product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902529.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS 1767222..1767800 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16710 rRNA 1768354..1769856 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00260 tRNA 1769916..1769992 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 tRNA 1770000..1770075 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 rRNA 1770174..1773077 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00270 rRNA 1773136..1773229 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 78 percent of the 5S ribosomal RNA locus_tag LOCUS_r00280 tRNA 1773255..1773330 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 CDS 1773373..1773843 product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017107.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 gene ybaK CDS 1773906..1774910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS 1775056..1776546 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017097.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS 1776548..1777462 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017098.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS 1777462..1778226 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017099.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS 1778223..1778954 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017100.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS 1778956..1779708 product dipeptide/oligopeptide/nickel ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494590.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS complement(1779852..1780994) product N-acetyldiaminopimelate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891676.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS 1781122..1781802 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289316.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS complement(1781833..1782234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS 1782681..1782959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16820 note possible pseudo, internal stop codon CDS complement(1782986..1783504) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016625.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS complement(1783521..1784864) product DUF1576 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367092.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS 1784992..1785306 product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015678.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 tRNA 1785360..1785448 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 tRNA 1785458..1785534 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 tRNA 1785558..1785633 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 tRNA 1785639..1785714 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 tRNA 1785720..1785796 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 tRNA 1785799..1785875 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 tRNA 1785878..1785952 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 tRNA 1785984..1786067 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 tRNA 1786072..1786147 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00560 tRNA 1786164..1786239 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00570 tRNA 1786247..1786324 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00580 tRNA 1786331..1786419 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00590 tRNA 1786430..1786506 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00600 tRNA 1786530..1786605 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00610 tRNA 1786611..1786686 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00620 tRNA 1786691..1786767 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00630 tRNA 1786771..1786848 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00640 tRNA 1786851..1786925 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00650 tRNA 1786955..1787038 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00660 tRNA 1787046..1787121 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00670 tRNA 1787135..1787210 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00680 tRNA 1787219..1787296 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00690 CDS 1787409..1787780 product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459713.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS 1787963..1789294 product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986205.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 gene mgtE CDS 1789463..1789918 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009909619.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS 1789881..1790720 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460667.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS complement(1790795..1791667) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964831.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS 1791877..1792524 product type A chloramphenicol O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986550.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 gene catA CDS 1792533..1793354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16920 note possible pseudo, frameshifted CDS 1793326..1794333 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16930 note possible pseudo, frameshifted CDS 1794343..1795032 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016734.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS 1795152..1795712 product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889371.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS 1796196..1796498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS 1796511..1797221 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS 1797247..1797819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS 1797878..1798531 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS 1798544..1801087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS 1801088..1801591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS 1801592..1802029 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS 1802026..1806012 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS complement(1806049..1806393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS 1806607..1807221 product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707003.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS 1807355..1807759 product IS200/IS605-like element ISEfa4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287522.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 gene tnpA CDS 1807779..1808918 product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287525.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 gene tnpB CDS 1809077..1809622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS 1809622..1810203 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109982.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS 1810664..1812163 product putative basic amino acid antiporter YfcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016083.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 gene yfcC CDS complement(1812549..1814843) product autotransporter phospholipase A1 FplA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015773.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 gene fplA CDS 1814977..1816893 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903085.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS 1817043..1817411 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894529.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 gene rpsL CDS 1817433..1817903 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005888149.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 gene rpsG CDS 1817959..1820040 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015672.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 gene fusA CDS 1820123..1821307 product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903497.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 gene tuf CDS 1821382..1821975 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016871.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS 1822066..1822887 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904393.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS 1822887..1823813 product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016289.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS 1823896..1824750 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903510.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS 1824747..1825844 product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029492060.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS 1825857..1826654 product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016268.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS 1826648..1828309 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016269.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 gene recN CDS 1828321..1829112 product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547075.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 gene xerD CDS 1829113..1830006 product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016271.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 gene era CDS 1830019..1831752 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438014.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS 1831770..1832696 product PEP phosphonomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901609.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS 1832780..1833313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS complement(1833368..1834162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS complement(1834155..1834517) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902525.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS complement(1834557..1835168) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017058.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS 1835380..1836054 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS 1836299..1838536 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898381.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS 1838556..1842701 product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898379.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS 1842727..1843086 product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016038.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS 1843117..1844364 product coproporphyrinogen-III oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016639.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS 1844368..1844886 product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016640.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS 1845042..1845896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS 1845883..1846512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS 1846750..1848261 product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895105.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS 1848300..1849724 product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017035.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS complement(1849829..1851337) product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477450.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS complement(1851709..1852065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS 1852696..1854843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS complement(1854880..1856157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS 1856435..1857445 product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016565.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS 1857435..1858082 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016564.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS 1858122..1858904 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016563.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS complement(1858962..1860317) product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006194892.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS complement(1860388..1860864) product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015827.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 gene ispF CDS complement(1860867..1861853) product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627445.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 gene rfaE1 CDS complement(1861879..1863531) product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198480816.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS complement(1863540..1864310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS complement(1864300..1865466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS complement(1865453..1866055) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS complement(1866024..1866605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS complement(1866607..1867041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS complement(1867038..1867481) product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016032.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS complement(1867466..1867936) product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029491830.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS complement(1867954..1869117) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016034.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS complement(1869111..1870376) product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016035.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS complement(1870373..1870549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS complement(1870551..1871108) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236585678.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS 1871250..1871690 product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016522.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 gene smpB tmRNA 1871736..1872084 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(1872237..1873172) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986890.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS complement(1873584..1874336) product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198479972.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS complement(1874348..1875523) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627896.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS 1875929..1876645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016516.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS 1876766..1877200 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901604.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 gene rplM CDS 1877217..1877615 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901602.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 gene rpsI CDS 1877800..1878036 product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966797.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 gene tnpA CDS 1878886..1879563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS 1879806..1879988 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS 1880047..1881246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17740 note possible pseudo, frameshifted CDS 1881295..1881966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS 1882499..1883215 product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880058.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 gene cas6 CDS 1883224..1884864 product type I-B CRISPR-associated protein Cas8b1/Cst1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861771.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 gene cas8a1 CDS 1884866..1885738 product type I-B CRISPR-associated protein Cas7/Cst2/DevR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544921.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 gene cas7i CDS 1885725..1886483 product type I-B CRISPR-associated protein Cas5b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439785.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 gene cas5b CDS 1886502..1888823 product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016965.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS 1888839..1889333 product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016964.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 gene cas4 CDS 1889356..1890330 product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896423.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 gene cas1b CDS 1890333..1890611 product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202914.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 gene cas2 repeat_region 1890798..1891294 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttttatctaaccatagtggaatgtaaat CDS complement(1891341..1891535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS complement(1891693..1892631) product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966234.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS complement(1892634..1893485) product tagatose bisphosphate family class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358381.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS complement(1893512..1894654) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898687.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS complement(1894670..1895623) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903111.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS complement(1895702..1896427) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437811.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS complement(1896539..1897990) product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111696793.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS complement(1897983..1899680) product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077417416.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS complement(1899712..1900434) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014894892.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS 1900706..1901836 product SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390206.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS 1901981..1903954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS 1904202..1904975 product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963683.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 gene kduD CDS 1905010..1905846 product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423611.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 gene kduI CDS 1906008..1907138 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210834.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS 1907152..1908051 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972692.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS 1908062..1908940 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003517572.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS 1908960..1910519 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972693.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS 1910718..1915190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS 1915208..1917625 product polysaccharide lyase 8 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263809.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS 1917813..1919222 product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785076.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS 1919237..1920427 product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000975716.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS 1920473..1921888 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289668.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS 1921904..1922539 product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963678.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS 1922541..1923107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS 1923264..1924646 product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776786.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS 1924663..1926198 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972693.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS 1926336..1928450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS complement(1928508..1931429) product chondroitinase family polysaccharide lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767535.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS complement(1931449..1932243) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002325086.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS complement(1932500..1932739) product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965683.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS complement(1932768..1934318) product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868784.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS 1934608..1935828 product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047950.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 gene dpaL CDS 1935869..1937053 product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421980.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS 1937128..1938717 product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893877.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS 1938863..1940638 product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047951.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS 1940882..1942207 product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861868.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 gene ssnA CDS 1942224..1943564 product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047949.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS 1943604..1944701 product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891591.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS 1944721..1946088 product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047948.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 gene hydA CDS 1946103..1948670 product selenium-dependent xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891588.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 gene xdh CDS 1948688..1949065 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901327.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS complement(1949126..1949365) product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965683.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS complement(1949518..1950000) product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832596.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 gene queF CDS complement(1950002..1950691) product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877949.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 gene queC CDS complement(1950700..1951272) product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966889.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 gene folE CDS complement(1951275..1951943) product putative 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949101.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 gene queE CDS complement(1951943..1952368) product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949100.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 gene queD CDS complement(1952573..1953499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS complement(1953609..1954961) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901931.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS complement(1954945..1955610) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901930.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS complement(1955640..1955840) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS complement(1955863..1956399) product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903104.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS 1956805..1957593 product 5'-methylthioadenosine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819438.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS complement(1957848..1959092) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583175.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS complement(1959108..1959464) product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760124.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS 1959869..1961203 product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016106.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 gene brnQ CDS 1961424..1962743 product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880072.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 gene hslU CDS 1963014..1963910 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439388.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS complement(1964061..1965233) product IS110-like element ISFnu4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015895.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS 1965509..1965841 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287745.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS complement(1965876..1967300) product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015910.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS complement(1967404..1967598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS complement(1967611..1968237) product DUF1847 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435816.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS 1968405..1969220 product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626543.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS 1969359..1970813 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017001.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 gene guaB CDS 1970906..1971703 product toxin-antitoxin system YwqK family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902355.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS 1971772..1972620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS 1972617..1973039 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902354.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS 1973061..1974824 product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099491.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS 1974836..1975510 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416528.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS 1975590..1975952 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS 1975969..1977420 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016996.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS 1977438..1978274 product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023041482.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 gene kdsA CDS 1978277..1979254 product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016738.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS 1979333..1979533 product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902519.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS 1979703..1980425 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722576.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS 1980428..1981342 product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244923.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 gene pfkB CDS 1981357..1983204 product PTS fructose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232350.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS 1983277..1983990 product complement resistance protein TraT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367168.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS complement(1984051..1984887) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015839.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS complement(1984937..1986133) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897631.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS complement(1986199..1987665) product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015837.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS complement(1987705..1988364) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903848.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS complement(1988697..1989353) product N-glycosylase/DNA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016533.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS complement(1989328..1990782) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965729.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS complement(1990785..1991444) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965730.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS complement(1991468..1992025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS complement(1992042..1994513) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861457.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS complement(1994532..1994735) product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124797412.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS complement(1994833..1995867) product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016665.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS complement(1995903..1996271) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016333.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS 1996387..1997097 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017120.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS 1997249..1999990 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898759.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS 2000008..2001777 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626840.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS 2001908..2002855 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494586.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS 2002852..2003469 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626801.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS 2003459..2003821 product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017105.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS 2003811..2004008 product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898710.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS 2003983..2004618 product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898707.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS 2004627..2005235 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017103.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS 2005339..2006094 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902187.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 gene tpiA CDS 2006107..2007624 product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948029.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 gene gpmI CDS complement(2007748..2008542) product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902977.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS complement(2008542..2010098) product D-lysine 5,6-aminomutase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015881.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS complement(2010103..2011566) product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015882.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS complement(2011563..2012591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367345.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS complement(2012614..2013861) product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902971.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 gene ablA CDS complement(2013932..2014969) product L-erythro-3,5-diaminohexanoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015884.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 gene kdd CDS complement(2015029..2015844) product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS complement(2015868..2016263) product 3-aminobutyryl-CoA ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902967.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS 2017028..2018473 product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015880.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS complement(2018553..2019308) product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144051.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS complement(2019371..2020405) product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897713.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS complement(2020398..2022644) product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016141.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS complement(2022646..2022849) product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016140.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS complement(2023016..2023510) product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393622.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS complement(2023528..2024031) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016229.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS complement(2024100..2024360) product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902954.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 gene rpsT CDS complement(2024551..2025105) product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902912.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS complement(2025132..2025392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029492198.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS 2025687..2026463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS 2026483..2027994 product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016706.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 gene malQ CDS 2028022..2030403 product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016705.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS 2030427..2032289 product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367106.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 gene glgB CDS 2032374..2033519 product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626354.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS 2033537..2034712 product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903377.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 gene glgD CDS 2034722..2036104 product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016702.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS complement(2036146..2036865) product nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626191.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS complement(2036862..2037401) product DUF1007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494746.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS complement(2037537..2038112) product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016435.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 gene gmhA CDS complement(2038121..2038993) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903649.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS complement(2039110..2039892) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390072.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS complement(2039944..2040258) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS complement(2040318..2042978) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015981.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS complement(2042979..2043584) product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894870.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 gene yihA CDS complement(2043601..2045910) product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015983.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 gene lon CDS complement(2045929..2047173) product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015984.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 gene clpX CDS complement(2047195..2047770) product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894880.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 gene clpP CDS complement(2047875..2049161) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015985.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 gene tig CDS complement(2049177..2050895) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367291.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 gene recJ CDS complement(2050904..2051260) product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903343.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 gene rbfA CDS complement(2051294..2053480) product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894893.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 gene infB CDS complement(2053501..2054028) product DUF448 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903345.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS complement(2054031..2055119) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903346.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 gene nusA CDS complement(2055146..2055625) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015988.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS 2056118..2056537 product methylaspartate mutase subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902997.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 gene glmS CDS 2056612..2058021 product methylaspartate mutase accessory protein GlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015877.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 gene glmL CDS 2058061..2059518 product methylaspartate mutase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680091.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS 2059673..2060920 product methylaspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680089.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS 2061005..2061265 product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566181.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 gene citD CDS 2061300..2062172 product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679317.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS 2062197..2063738 product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272879.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 gene citF CDS 2063979..2065133 product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016332.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 gene metK CDS 2065501..2066496 product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949062.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 gene asnA CDS complement(2066708..2068030) product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016201.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 gene der CDS complement(2068046..2069767) product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016615.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS 2070406..2071215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19400