>Feature sequence1 <1 1324 gene locus_tag LOCUS_00010 <1 1324 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012027387.1:restriction endonuclease subunit S 2668 1304 gene locus_tag LOCUS_00020 2668 1304 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680807.1 protein_id gnl|my_center|LOCUS_00020 2713 3519 gene locus_tag LOCUS_00030 2713 3519 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680804.1 protein_id gnl|my_center|LOCUS_00030 4136 3558 gene locus_tag LOCUS_00040 4136 3558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 5362 4163 gene locus_tag LOCUS_00050 5362 4163 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108566.1 protein_id gnl|my_center|LOCUS_00050 5741 5367 gene locus_tag LOCUS_00060 5741 5367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 6853 6035 gene locus_tag LOCUS_00070 6853 6035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 8543 7170 gene locus_tag LOCUS_00080 8543 7170 CDS product DUF3987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203629.1 protein_id gnl|my_center|LOCUS_00080 9022 8543 gene locus_tag LOCUS_00090 9022 8543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 10446 9190 gene locus_tag LOCUS_00100 10446 9190 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202321.1 protein_id gnl|my_center|LOCUS_00100 11003 10443 gene locus_tag LOCUS_00110 11003 10443 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202319.1 protein_id gnl|my_center|LOCUS_00110 13136 11217 gene locus_tag LOCUS_00120 gene dnaK 13136 11217 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785809.1 protein_id gnl|my_center|LOCUS_00120 13341 13583 gene locus_tag LOCUS_00130 13341 13583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 13644 14783 gene locus_tag LOCUS_00140 13644 14783 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768087.1 protein_id gnl|my_center|LOCUS_00140 14783 15778 gene locus_tag LOCUS_00150 14783 15778 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785797.1 protein_id gnl|my_center|LOCUS_00150 16650 15859 gene locus_tag LOCUS_00160 16650 15859 CDS product META domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785793.1 protein_id gnl|my_center|LOCUS_00160 16835 18028 gene locus_tag LOCUS_00170 16835 18028 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764762.1 protein_id gnl|my_center|LOCUS_00170 18034 18486 gene locus_tag LOCUS_00180 gene bcp 18034 18486 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760349.1 protein_id gnl|my_center|LOCUS_00180 18525 19565 gene locus_tag LOCUS_00190 gene recA 18525 19565 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785787.1 protein_id gnl|my_center|LOCUS_00190 19855 20370 gene locus_tag LOCUS_00200 19855 20370 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785783.1 protein_id gnl|my_center|LOCUS_00200 20351 20866 gene locus_tag LOCUS_00210 20351 20866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795692.1 protein_id gnl|my_center|LOCUS_00210 20973 21524 gene locus_tag LOCUS_00220 20973 21524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 22625 21624 gene locus_tag LOCUS_00230 22625 21624 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785778.1 protein_id gnl|my_center|LOCUS_00230 23654 22758 gene locus_tag LOCUS_00240 23654 22758 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785776.1 protein_id gnl|my_center|LOCUS_00240 24279 23701 gene locus_tag LOCUS_00250 24279 23701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785774.1 protein_id gnl|my_center|LOCUS_00250 25291 27879 gene locus_tag LOCUS_00260 gene clpB 25291 27879 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764749.1 protein_id gnl|my_center|LOCUS_00260 28187 27948 gene locus_tag LOCUS_00270 28187 27948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 29115 28684 gene locus_tag LOCUS_00280 29115 28684 CDS product DUF5606 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760341.1 protein_id gnl|my_center|LOCUS_00280 29750 29133 gene locus_tag LOCUS_00290 gene coaE 29750 29133 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764748.1 protein_id gnl|my_center|LOCUS_00290 30753 29740 gene locus_tag LOCUS_00300 30753 29740 CDS product YbbR-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768081.1 protein_id gnl|my_center|LOCUS_00300 31097 30774 gene locus_tag LOCUS_00310 gene yajC 31097 30774 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775925.1 protein_id gnl|my_center|LOCUS_00310 32068 31142 gene locus_tag LOCUS_00320 gene nusB 32068 31142 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760339.1 protein_id gnl|my_center|LOCUS_00320 32237 32596 gene locus_tag LOCUS_00330 32237 32596 CDS product PUR family DNA/RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785761.1 protein_id gnl|my_center|LOCUS_00330 32732 33322 gene locus_tag LOCUS_00340 32732 33322 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785759.1 protein_id gnl|my_center|LOCUS_00340 33425 33988 gene locus_tag LOCUS_00350 gene pth 33425 33988 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764745.1 protein_id gnl|my_center|LOCUS_00350 33993 34415 gene locus_tag LOCUS_00360 33993 34415 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785756.1 protein_id gnl|my_center|LOCUS_00360 36750 34498 gene locus_tag LOCUS_00370 36750 34498 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764744.1 protein_id gnl|my_center|LOCUS_00370 37970 36885 gene locus_tag LOCUS_00380 gene gcvT 37970 36885 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795559.1 protein_id gnl|my_center|LOCUS_00380 39237 38002 gene locus_tag LOCUS_00390 gene pepT 39237 38002 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786005.1 protein_id gnl|my_center|LOCUS_00390 40791 39385 gene locus_tag LOCUS_00400 40791 39385 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764741.1 protein_id gnl|my_center|LOCUS_00400 43324 41165 gene locus_tag LOCUS_00410 43324 41165 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202310.1 protein_id gnl|my_center|LOCUS_00410 45028 43493 gene locus_tag LOCUS_00420 45028 43493 CDS product DUF6377 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761694.1 protein_id gnl|my_center|LOCUS_00420 45139 45522 gene locus_tag LOCUS_00430 gene crcB 45139 45522 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785744.1 protein_id gnl|my_center|LOCUS_00430 45527 46207 gene locus_tag LOCUS_00440 45527 46207 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764720.1 protein_id gnl|my_center|LOCUS_00440 46340 47851 gene locus_tag LOCUS_00450 46340 47851 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109291.1 protein_id gnl|my_center|LOCUS_00450 48024 50810 gene locus_tag LOCUS_00460 48024 50810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202277.1 protein_id gnl|my_center|LOCUS_00460 51211 52497 gene locus_tag LOCUS_00470 51211 52497 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786453.1 protein_id gnl|my_center|LOCUS_00470 52949 53266 gene locus_tag LOCUS_00480 52949 53266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 53734 53961 gene locus_tag LOCUS_00490 53734 53961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 54015 54239 gene locus_tag LOCUS_00500 54015 54239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 54327 55277 gene locus_tag LOCUS_00510 gene rlmF 54327 55277 CDS product 23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109384.1 protein_id gnl|my_center|LOCUS_00510 56203 55280 gene locus_tag LOCUS_00520 56203 55280 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769713.1 protein_id gnl|my_center|LOCUS_00520 56655 57386 gene locus_tag LOCUS_00530 56655 57386 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109289.1 protein_id gnl|my_center|LOCUS_00530 57746 57402 gene locus_tag LOCUS_00540 57746 57402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 58840 58154 gene locus_tag LOCUS_00550 58840 58154 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785882.1 protein_id gnl|my_center|LOCUS_00550 60059 58842 gene locus_tag LOCUS_00560 60059 58842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 61036 62184 gene locus_tag LOCUS_00570 61036 62184 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785877.1 protein_id gnl|my_center|LOCUS_00570 62323 63609 gene locus_tag LOCUS_00580 gene eno 62323 63609 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785741.1 protein_id gnl|my_center|LOCUS_00580 63870 63796 gene locus_tag LOCUS_t00010 63870 63796 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 64188 64745 gene locus_tag LOCUS_00590 64188 64745 CDS product DUF4199 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202309.1 protein_id gnl|my_center|LOCUS_00590 64770 65723 gene locus_tag LOCUS_00600 64770 65723 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785735.1 protein_id gnl|my_center|LOCUS_00600 65856 66257 gene locus_tag LOCUS_00610 65856 66257 CDS product DUF6452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109333.1 protein_id gnl|my_center|LOCUS_00610 66214 66996 gene locus_tag LOCUS_00620 66214 66996 CDS product DUF6048 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764712.1 protein_id gnl|my_center|LOCUS_00620 67002 67583 gene locus_tag LOCUS_00630 67002 67583 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785730.1 protein_id gnl|my_center|LOCUS_00630 67601 68611 gene locus_tag LOCUS_00640 67601 68611 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785727.1 protein_id gnl|my_center|LOCUS_00640 69513 70295 gene locus_tag LOCUS_00650 69513 70295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 70720 70920 gene locus_tag LOCUS_00660 70720 70920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 71304 70933 gene locus_tag LOCUS_00670 71304 70933 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785723.1 protein_id gnl|my_center|LOCUS_00670 72176 71430 gene locus_tag LOCUS_00680 72176 71430 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764709.1 protein_id gnl|my_center|LOCUS_00680 72520 73866 gene locus_tag LOCUS_00690 72520 73866 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202308.1 protein_id gnl|my_center|LOCUS_00690 73874 74344 gene locus_tag LOCUS_00700 73874 74344 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785717.1 protein_id gnl|my_center|LOCUS_00700 74369 75367 gene locus_tag LOCUS_00710 gene floA 74369 75367 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785715.1 protein_id gnl|my_center|LOCUS_00710 75484 76362 gene locus_tag LOCUS_00720 75484 76362 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785714.1 protein_id gnl|my_center|LOCUS_00720 76362 76628 gene locus_tag LOCUS_00730 76362 76628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00730 76663 76890 gene locus_tag LOCUS_00740 76663 76890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00740 77524 76874 gene locus_tag LOCUS_00750 77524 76874 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801072.1 protein_id gnl|my_center|LOCUS_00750 79566 77668 gene locus_tag LOCUS_00760 79566 77668 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032528853.1 protein_id gnl|my_center|LOCUS_00760 79694 81091 gene locus_tag LOCUS_00770 gene mnmE 79694 81091 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109330.1 protein_id gnl|my_center|LOCUS_00770 81278 82291 gene locus_tag LOCUS_00780 81278 82291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 83845 82571 gene locus_tag LOCUS_00790 83845 82571 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789653.1 protein_id gnl|my_center|LOCUS_00790 84153 84875 gene locus_tag LOCUS_00800 84153 84875 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107443.1 protein_id gnl|my_center|LOCUS_00800 84979 85410 gene locus_tag LOCUS_00810 84979 85410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 85764 85943 gene locus_tag LOCUS_00820 85764 85943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 85954 86472 gene locus_tag LOCUS_00830 85954 86472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 86450 86896 gene locus_tag LOCUS_00840 86450 86896 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765003.1 protein_id gnl|my_center|LOCUS_00840 87471 87007 gene locus_tag LOCUS_00850 87471 87007 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004301986.1 protein_id gnl|my_center|LOCUS_00850 88116 87532 gene locus_tag LOCUS_00860 88116 87532 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109292.1 protein_id gnl|my_center|LOCUS_00860 88678 88397 gene locus_tag LOCUS_00870 88678 88397 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764645.1 protein_id gnl|my_center|LOCUS_00870 89921 88710 gene locus_tag LOCUS_00880 89921 88710 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109287.1 protein_id gnl|my_center|LOCUS_00880 90080 90229 gene locus_tag LOCUS_00890 90080 90229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 90902 91879 gene locus_tag LOCUS_00900 90902 91879 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790351.1 protein_id gnl|my_center|LOCUS_00900 91914 92771 gene locus_tag LOCUS_00910 91914 92771 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790353.1 protein_id gnl|my_center|LOCUS_00910 93337 94005 gene locus_tag LOCUS_00920 93337 94005 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802487.1 protein_id gnl|my_center|LOCUS_00920 94782 94009 gene locus_tag LOCUS_00930 94782 94009 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804815.1 protein_id gnl|my_center|LOCUS_00930 96070 94805 gene locus_tag LOCUS_00940 96070 94805 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802486.1 protein_id gnl|my_center|LOCUS_00940 96966 96067 gene locus_tag LOCUS_00950 96966 96067 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797826.1 protein_id gnl|my_center|LOCUS_00950 97118 98203 gene locus_tag LOCUS_00960 gene msrB 97118 98203 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203359.1 protein_id gnl|my_center|LOCUS_00960 98587 103128 gene locus_tag LOCUS_00970 98587 103128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 103493 103281 gene locus_tag LOCUS_00980 103493 103281 CDS product histone H1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780999.1 protein_id gnl|my_center|LOCUS_00980 103572 104246 gene locus_tag LOCUS_00990 103572 104246 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203360.1 protein_id gnl|my_center|LOCUS_00990 104254 105654 gene locus_tag LOCUS_01000 104254 105654 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790372.1 protein_id gnl|my_center|LOCUS_01000 105761 106396 gene locus_tag LOCUS_01010 105761 106396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790373.1 protein_id gnl|my_center|LOCUS_01010 106524 108620 gene locus_tag LOCUS_01020 106524 108620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203361.1 protein_id gnl|my_center|LOCUS_01020 109650 108700 gene locus_tag LOCUS_01030 109650 108700 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202921.1 protein_id gnl|my_center|LOCUS_01030 110640 109681 gene locus_tag LOCUS_01040 110640 109681 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786859.1 protein_id gnl|my_center|LOCUS_01040 111688 110684 gene locus_tag LOCUS_01050 111688 110684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261029.1 protein_id gnl|my_center|LOCUS_01050 112549 111698 gene locus_tag LOCUS_01060 112549 111698 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992747.1 protein_id gnl|my_center|LOCUS_01060 113643 112549 gene locus_tag LOCUS_01070 113643 112549 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202260.1 protein_id gnl|my_center|LOCUS_01070 114764 113658 gene locus_tag LOCUS_01080 114764 113658 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228094.1 protein_id gnl|my_center|LOCUS_01080 115915 114764 gene locus_tag LOCUS_01090 gene wecB 115915 114764 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799504.1 protein_id gnl|my_center|LOCUS_01090 117127 115928 gene locus_tag LOCUS_01100 117127 115928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 117594 117139 gene locus_tag LOCUS_01110 117594 117139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 117593 118015 gene locus_tag LOCUS_01120 117593 118015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 119617 118367 gene locus_tag LOCUS_01130 119617 118367 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107236.1 protein_id gnl|my_center|LOCUS_01130 120708 119617 gene locus_tag LOCUS_01140 120708 119617 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141777.1 protein_id gnl|my_center|LOCUS_01140 121982 120777 gene locus_tag LOCUS_01150 121982 120777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 123136 121991 gene locus_tag LOCUS_01160 123136 121991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 124150 123146 gene locus_tag LOCUS_01170 124150 123146 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646256.1 protein_id gnl|my_center|LOCUS_01170 125247 124147 gene locus_tag LOCUS_01180 125247 124147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 126455 125244 gene locus_tag LOCUS_01190 126455 125244 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108800.1 protein_id gnl|my_center|LOCUS_01190 127564 126455 gene locus_tag LOCUS_01200 127564 126455 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202936.1 protein_id gnl|my_center|LOCUS_01200 129030 127549 gene locus_tag LOCUS_01210 129030 127549 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202937.1 protein_id gnl|my_center|LOCUS_01210 129574 129095 gene locus_tag LOCUS_01220 129574 129095 CDS product UpxZ family transcription anti-terminator antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203521.1 protein_id gnl|my_center|LOCUS_01220 130251 129625 gene locus_tag LOCUS_01230 gene updY 130251 129625 CDS product capsular polysaccharide transcription antiterminator UpdY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770021.1 protein_id gnl|my_center|LOCUS_01230 132667 131063 gene locus_tag LOCUS_01240 132667 131063 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109269.1 protein_id gnl|my_center|LOCUS_01240 135775 132674 gene locus_tag LOCUS_01250 135775 132674 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109268.1 protein_id gnl|my_center|LOCUS_01250 136070 136549 gene locus_tag LOCUS_01260 136070 136549 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657288.1 protein_id gnl|my_center|LOCUS_01260 136567 136920 gene locus_tag LOCUS_01270 136567 136920 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760124.1 protein_id gnl|my_center|LOCUS_01270 136985 137058 gene locus_tag LOCUS_t00020 136985 137058 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 137719 138165 gene locus_tag LOCUS_01280 137719 138165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 139185 138313 gene locus_tag LOCUS_01290 139185 138313 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797836.1 protein_id gnl|my_center|LOCUS_01290 139854 139276 gene locus_tag LOCUS_01300 139854 139276 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790401.1 protein_id gnl|my_center|LOCUS_01300 141236 139851 gene locus_tag LOCUS_01310 141236 139851 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790403.1 protein_id gnl|my_center|LOCUS_01310 141973 141233 gene locus_tag LOCUS_01320 141973 141233 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790405.1 protein_id gnl|my_center|LOCUS_01320 142606 142061 gene locus_tag LOCUS_01330 142606 142061 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817247.1 protein_id gnl|my_center|LOCUS_01330 142955 142593 gene locus_tag LOCUS_01340 gene queD 142955 142593 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790409.1 protein_id gnl|my_center|LOCUS_01340 143120 143482 gene locus_tag LOCUS_01350 143120 143482 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790413.1 protein_id gnl|my_center|LOCUS_01350 144015 143449 gene locus_tag LOCUS_01360 144015 143449 CDS product MTA/SAH nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203366.1 protein_id gnl|my_center|LOCUS_01360 144171 145343 gene locus_tag LOCUS_01370 144171 145343 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790418.1 protein_id gnl|my_center|LOCUS_01370 145791 146084 gene locus_tag LOCUS_01380 145791 146084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993398.1 protein_id gnl|my_center|LOCUS_01380 146097 146387 gene locus_tag LOCUS_01390 146097 146387 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790425.1 protein_id gnl|my_center|LOCUS_01390 146499 148037 gene locus_tag LOCUS_01400 gene rny 146499 148037 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790424.1 protein_id gnl|my_center|LOCUS_01400 148109 148855 gene locus_tag LOCUS_01410 148109 148855 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109255.1 protein_id gnl|my_center|LOCUS_01410 148877 149692 gene locus_tag LOCUS_01420 148877 149692 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107576.1 protein_id gnl|my_center|LOCUS_01420 150235 149687 gene locus_tag LOCUS_01430 150235 149687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01430 150902 150213 gene locus_tag LOCUS_01440 150902 150213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01440 151352 150918 gene locus_tag LOCUS_01450 151352 150918 CDS product LapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768060.1 protein_id gnl|my_center|LOCUS_01450 151949 151482 gene locus_tag LOCUS_01460 151949 151482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109252.1 protein_id gnl|my_center|LOCUS_01460 154717 152012 gene locus_tag LOCUS_01470 154717 152012 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202271.1 protein_id gnl|my_center|LOCUS_01470 156236 154752 gene locus_tag LOCUS_01480 156236 154752 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202272.1 protein_id gnl|my_center|LOCUS_01480 156494 156700 gene locus_tag LOCUS_01490 156494 156700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 157037 158137 gene locus_tag LOCUS_01500 157037 158137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 158214 158540 gene locus_tag LOCUS_01510 158214 158540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 158543 159370 gene locus_tag LOCUS_01520 158543 159370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 160449 159391 gene locus_tag LOCUS_01530 gene dinB 160449 159391 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768057.1 protein_id gnl|my_center|LOCUS_01530 161139 160745 gene locus_tag LOCUS_tm00010 161139 160745 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 161608 162735 gene locus_tag LOCUS_01540 161608 162735 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785546.1 protein_id gnl|my_center|LOCUS_01540 163302 162871 gene locus_tag LOCUS_01550 163302 162871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 165172 163682 gene locus_tag LOCUS_01560 165172 163682 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203728.1 protein_id gnl|my_center|LOCUS_01560 165111 165296 gene locus_tag LOCUS_01570 165111 165296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 167688 165454 gene locus_tag LOCUS_01580 167688 165454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 168849 168235 gene locus_tag LOCUS_01590 168849 168235 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760060.1 protein_id gnl|my_center|LOCUS_01590 169557 168892 gene locus_tag LOCUS_01600 169557 168892 CDS product phenylalanine--tRNA ligase beta subunit-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291724.1 protein_id gnl|my_center|LOCUS_01600 170372 169563 gene locus_tag LOCUS_01610 gene pgeF 170372 169563 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291723.1 protein_id gnl|my_center|LOCUS_01610 171535 170369 gene locus_tag LOCUS_01620 gene obgE 171535 170369 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785536.1 protein_id gnl|my_center|LOCUS_01620 172125 171556 gene locus_tag LOCUS_01630 172125 171556 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785533.1 protein_id gnl|my_center|LOCUS_01630 172738 172202 gene locus_tag LOCUS_01640 gene hpt 172738 172202 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785529.1 protein_id gnl|my_center|LOCUS_01640 174343 172901 gene locus_tag LOCUS_01650 174343 172901 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109089.1 protein_id gnl|my_center|LOCUS_01650 175865 174381 gene locus_tag LOCUS_01660 175865 174381 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764298.1 protein_id gnl|my_center|LOCUS_01660 177783 175894 gene locus_tag LOCUS_01670 gene nuoL 177783 175894 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764299.1 protein_id gnl|my_center|LOCUS_01670 178128 177817 gene locus_tag LOCUS_01680 gene nuoK 178128 177817 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007764713.1 protein_id gnl|my_center|LOCUS_01680 178653 178141 gene locus_tag LOCUS_01690 178653 178141 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785044.1 protein_id gnl|my_center|LOCUS_01690 179187 178675 gene locus_tag LOCUS_01700 179187 178675 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785046.1 protein_id gnl|my_center|LOCUS_01700 180257 179235 gene locus_tag LOCUS_01710 gene nuoH 180257 179235 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785048.1 protein_id gnl|my_center|LOCUS_01710 181938 180346 gene locus_tag LOCUS_01720 181938 180346 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760950.1 protein_id gnl|my_center|LOCUS_01720 182568 181972 gene locus_tag LOCUS_01730 182568 181972 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769486.1 protein_id gnl|my_center|LOCUS_01730 182990 182559 gene locus_tag LOCUS_01740 182990 182559 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775585.1 protein_id gnl|my_center|LOCUS_01740 183390 183016 gene locus_tag LOCUS_01750 183390 183016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785055.1 protein_id gnl|my_center|LOCUS_01750 184944 183523 gene locus_tag LOCUS_01760 184944 183523 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109098.1 protein_id gnl|my_center|LOCUS_01760 186345 185005 gene locus_tag LOCUS_01770 gene trkA 186345 185005 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764324.1 protein_id gnl|my_center|LOCUS_01770 188286 186364 gene locus_tag LOCUS_01780 gene dxs 188286 186364 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992199.1 protein_id gnl|my_center|LOCUS_01780 188553 190064 gene locus_tag LOCUS_01790 188553 190064 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109230.1 protein_id gnl|my_center|LOCUS_01790 190141 191202 gene locus_tag LOCUS_01800 190141 191202 CDS product DUF4831 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202253.1 protein_id gnl|my_center|LOCUS_01800 191231 191512 gene locus_tag LOCUS_01810 191231 191512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109229.1 protein_id gnl|my_center|LOCUS_01810 191852 191502 gene locus_tag LOCUS_01820 191852 191502 CDS product PqqD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785477.1 protein_id gnl|my_center|LOCUS_01820 193283 191856 gene locus_tag LOCUS_01830 193283 191856 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785475.1 protein_id gnl|my_center|LOCUS_01830 193850 193452 gene locus_tag LOCUS_01840 193850 193452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 194648 193857 gene locus_tag LOCUS_01850 194648 193857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785470.1 protein_id gnl|my_center|LOCUS_01850 195181 194654 gene locus_tag LOCUS_01860 195181 194654 CDS product LptE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764536.1 protein_id gnl|my_center|LOCUS_01860 196367 195168 gene locus_tag LOCUS_01870 196367 195168 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785466.1 protein_id gnl|my_center|LOCUS_01870 197496 196399 gene locus_tag LOCUS_01880 gene pdxA 197496 196399 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785465.1 protein_id gnl|my_center|LOCUS_01880 198551 197505 gene locus_tag LOCUS_01890 198551 197505 CDS product DUF4837 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785463.1 protein_id gnl|my_center|LOCUS_01890 199661 198627 gene locus_tag LOCUS_01900 gene rlmN 199661 198627 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202252.1 protein_id gnl|my_center|LOCUS_01900 201973 199835 gene locus_tag LOCUS_01910 201973 199835 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658876.1 protein_id gnl|my_center|LOCUS_01910 203350 202094 gene locus_tag LOCUS_01920 203350 202094 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795896.1 protein_id gnl|my_center|LOCUS_01920 203967 203353 gene locus_tag LOCUS_01930 gene lptC 203967 203353 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764532.1 protein_id gnl|my_center|LOCUS_01930 205296 203971 gene locus_tag LOCUS_01940 205296 203971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760038.1 protein_id gnl|my_center|LOCUS_01940 206607 205342 gene locus_tag LOCUS_01950 206607 205342 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785451.1 protein_id gnl|my_center|LOCUS_01950 207325 206594 gene locus_tag LOCUS_01960 207325 206594 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202250.1 protein_id gnl|my_center|LOCUS_01960 207919 210327 gene locus_tag LOCUS_01970 207919 210327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 210846 211121 gene locus_tag LOCUS_01980 210846 211121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 211303 211554 gene locus_tag LOCUS_01990 211303 211554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 212534 212719 gene locus_tag LOCUS_02000 212534 212719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 215758 212996 gene locus_tag LOCUS_02010 215758 212996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 217377 216481 gene locus_tag LOCUS_02020 217377 216481 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764795.1 protein_id gnl|my_center|LOCUS_02020 217919 220435 gene locus_tag LOCUS_02030 217919 220435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 224843 222291 gene locus_tag LOCUS_02040 224843 222291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 226943 225606 gene locus_tag LOCUS_02050 226943 225606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 226976 228094 gene locus_tag LOCUS_02060 226976 228094 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107079.1 protein_id gnl|my_center|LOCUS_02060 228524 228075 gene locus_tag LOCUS_02070 228524 228075 CDS product S24/S26 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107087.1 protein_id gnl|my_center|LOCUS_02070 229378 228521 gene locus_tag LOCUS_02080 229378 228521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 231011 229395 gene locus_tag LOCUS_02090 gene pglK 231011 229395 CDS product ABC-type lipopolysaccharide transporter PglK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858308.1 protein_id gnl|my_center|LOCUS_02090 231273 231004 gene locus_tag LOCUS_02100 231273 231004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 232684 231734 gene locus_tag LOCUS_02110 232684 231734 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816723.1 protein_id gnl|my_center|LOCUS_02110 233620 232727 gene locus_tag LOCUS_02120 233620 232727 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202922.1 protein_id gnl|my_center|LOCUS_02120 234398 233646 gene locus_tag LOCUS_02130 234398 233646 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203385.1 protein_id gnl|my_center|LOCUS_02130 235583 234453 gene locus_tag LOCUS_02140 235583 234453 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202157.1 protein_id gnl|my_center|LOCUS_02140 236178 235594 gene locus_tag LOCUS_02150 236178 235594 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795841.1 protein_id gnl|my_center|LOCUS_02150 236797 236189 gene locus_tag LOCUS_02160 236797 236189 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202264.1 protein_id gnl|my_center|LOCUS_02160 238013 236787 gene locus_tag LOCUS_02170 238013 236787 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257995.1 protein_id gnl|my_center|LOCUS_02170 239317 238010 gene locus_tag LOCUS_02180 239317 238010 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107472.1 protein_id gnl|my_center|LOCUS_02180 240129 239314 gene locus_tag LOCUS_02190 240129 239314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 241151 240141 gene locus_tag LOCUS_02200 241151 240141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 242530 241334 gene locus_tag LOCUS_02210 242530 241334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 243878 242721 gene locus_tag LOCUS_02220 gene wecB 243878 242721 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799504.1 protein_id gnl|my_center|LOCUS_02220 245082 243892 gene locus_tag LOCUS_02230 gene wecC 245082 243892 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202257.1 protein_id gnl|my_center|LOCUS_02230 246332 245214 gene locus_tag LOCUS_02240 246332 245214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 247579 246443 gene locus_tag LOCUS_02250 247579 246443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 248593 247589 gene locus_tag LOCUS_02260 248593 247589 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646256.1 protein_id gnl|my_center|LOCUS_02260 249690 248590 gene locus_tag LOCUS_02270 249690 248590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 250898 249687 gene locus_tag LOCUS_02280 250898 249687 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108800.1 protein_id gnl|my_center|LOCUS_02280 252007 250898 gene locus_tag LOCUS_02290 252007 250898 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202936.1 protein_id gnl|my_center|LOCUS_02290 252984 251992 gene locus_tag LOCUS_02300 252984 251992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 253082 253240 gene locus_tag LOCUS_02310 253082 253240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 253253 253492 gene locus_tag LOCUS_02320 253253 253492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 254020 253565 gene locus_tag LOCUS_02330 254020 253565 CDS product UpxZ family transcription anti-terminator antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203521.1 protein_id gnl|my_center|LOCUS_02330 254724 254164 gene locus_tag LOCUS_02340 gene updY 254724 254164 CDS product capsular polysaccharide transcription antiterminator UpdY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770021.1 protein_id gnl|my_center|LOCUS_02340 256060 257265 gene locus_tag LOCUS_02350 256060 257265 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813038.1 protein_id gnl|my_center|LOCUS_02350 257262 258839 gene locus_tag LOCUS_02360 257262 258839 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785445.1 protein_id gnl|my_center|LOCUS_02360 258889 262209 gene locus_tag LOCUS_02370 gene secA 258889 262209 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202248.1 protein_id gnl|my_center|LOCUS_02370 262351 263478 gene locus_tag LOCUS_02380 262351 263478 CDS product DUF6340 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785441.1 protein_id gnl|my_center|LOCUS_02380 263542 263988 gene locus_tag LOCUS_02390 263542 263988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785439.1 protein_id gnl|my_center|LOCUS_02390 265888 264047 gene locus_tag LOCUS_02400 265888 264047 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202245.1 protein_id gnl|my_center|LOCUS_02400 268689 266062 gene locus_tag LOCUS_02410 268689 266062 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801208.1 protein_id gnl|my_center|LOCUS_02410 268882 269964 gene locus_tag LOCUS_02420 268882 269964 CDS product DUF3810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109216.1 protein_id gnl|my_center|LOCUS_02420 270022 270807 gene locus_tag LOCUS_02430 gene mazG 270022 270807 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109215.1 protein_id gnl|my_center|LOCUS_02430 271594 271127 gene locus_tag LOCUS_02440 271594 271127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785406.1 protein_id gnl|my_center|LOCUS_02440 271997 271620 gene locus_tag LOCUS_02450 271997 271620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109213.1 protein_id gnl|my_center|LOCUS_02450 272597 272046 gene locus_tag LOCUS_02460 272597 272046 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760019.1 protein_id gnl|my_center|LOCUS_02460 273001 272690 gene locus_tag LOCUS_02470 273001 272690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 273998 273084 gene locus_tag LOCUS_02480 273998 273084 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109212.1 protein_id gnl|my_center|LOCUS_02480 274755 274063 gene locus_tag LOCUS_02490 274755 274063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766128.1 protein_id gnl|my_center|LOCUS_02490 276807 275014 gene locus_tag LOCUS_02500 gene rpsA 276807 275014 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775782.1 protein_id gnl|my_center|LOCUS_02500 277948 276971 gene locus_tag LOCUS_02510 277948 276971 CDS product DUF2807 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789219.1 protein_id gnl|my_center|LOCUS_02510 280268 278121 gene locus_tag LOCUS_02520 280268 278121 CDS product DUF5686 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109207.1 protein_id gnl|my_center|LOCUS_02520 280550 282739 gene locus_tag LOCUS_02530 280550 282739 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785391.1 protein_id gnl|my_center|LOCUS_02530 282816 283517 gene locus_tag LOCUS_02540 282816 283517 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785389.1 protein_id gnl|my_center|LOCUS_02540 283560 285992 gene locus_tag LOCUS_02550 283560 285992 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785386.1 protein_id gnl|my_center|LOCUS_02550 287132 286182 gene locus_tag LOCUS_02560 gene trxB 287132 286182 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785383.1 protein_id gnl|my_center|LOCUS_02560 287845 287204 gene locus_tag LOCUS_02570 287845 287204 CDS product LolA-like putative outer membrane lipoprotein chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795926.1 protein_id gnl|my_center|LOCUS_02570 290348 287865 gene locus_tag LOCUS_02580 290348 287865 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202242.1 protein_id gnl|my_center|LOCUS_02580 290753 291412 gene locus_tag LOCUS_02590 290753 291412 CDS product DUF5063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785376.1 protein_id gnl|my_center|LOCUS_02590 291426 292058 gene locus_tag LOCUS_02600 291426 292058 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760005.1 protein_id gnl|my_center|LOCUS_02600 292085 293263 gene locus_tag LOCUS_02610 292085 293263 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760004.1 protein_id gnl|my_center|LOCUS_02610 293643 294896 gene locus_tag LOCUS_02620 293643 294896 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767999.1 protein_id gnl|my_center|LOCUS_02620 294900 295457 gene locus_tag LOCUS_02630 294900 295457 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202239.1 protein_id gnl|my_center|LOCUS_02630 295466 296164 gene locus_tag LOCUS_02640 295466 296164 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202238.1 protein_id gnl|my_center|LOCUS_02640 296245 297807 gene locus_tag LOCUS_02650 296245 297807 CDS product DUF4836 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801225.1 protein_id gnl|my_center|LOCUS_02650 297826 298470 gene locus_tag LOCUS_02660 297826 298470 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840608.1 protein_id gnl|my_center|LOCUS_02660 298482 299684 gene locus_tag LOCUS_02670 298482 299684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109198.1 protein_id gnl|my_center|LOCUS_02670 299823 301220 gene locus_tag LOCUS_02680 299823 301220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 301233 302306 gene locus_tag LOCUS_02690 301233 302306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 302446 303366 gene locus_tag LOCUS_02700 gene miaA 302446 303366 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795937.1 protein_id gnl|my_center|LOCUS_02700 303444 304370 gene locus_tag LOCUS_02710 303444 304370 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785352.1 protein_id gnl|my_center|LOCUS_02710 304388 305191 gene locus_tag LOCUS_02720 gene kdsA 304388 305191 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759991.1 protein_id gnl|my_center|LOCUS_02720 305248 308070 gene locus_tag LOCUS_02730 305248 308070 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202237.1 protein_id gnl|my_center|LOCUS_02730 308067 309554 gene locus_tag LOCUS_02740 308067 309554 CDS product DUF5687 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759989.1 protein_id gnl|my_center|LOCUS_02740 309651 310427 gene locus_tag LOCUS_02750 309651 310427 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785344.1 protein_id gnl|my_center|LOCUS_02750 310434 310946 gene locus_tag LOCUS_02760 310434 310946 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202236.1 protein_id gnl|my_center|LOCUS_02760 310965 311840 gene locus_tag LOCUS_02770 310965 311840 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759986.1 protein_id gnl|my_center|LOCUS_02770 312104 313279 gene locus_tag LOCUS_02780 312104 313279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108708.1 protein_id gnl|my_center|LOCUS_02780 313314 313955 gene locus_tag LOCUS_02790 313314 313955 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202235.1 protein_id gnl|my_center|LOCUS_02790 314118 314435 gene locus_tag LOCUS_02800 gene rplU 314118 314435 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775748.1 protein_id gnl|my_center|LOCUS_02800 314457 314726 gene locus_tag LOCUS_02810 gene rpmA 314457 314726 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785336.1 protein_id gnl|my_center|LOCUS_02810 314985 316628 gene locus_tag LOCUS_02820 314985 316628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 316922 318943 gene locus_tag LOCUS_02830 316922 318943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 319331 320605 gene locus_tag LOCUS_02840 gene serS 319331 320605 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785334.1 protein_id gnl|my_center|LOCUS_02840 320739 323048 gene locus_tag LOCUS_02850 320739 323048 CDS product bifunctional dihydroorotate dehydrogenase B NAD binding subunit/NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764496.1 protein_id gnl|my_center|LOCUS_02850 327789 323152 gene locus_tag LOCUS_02860 327789 323152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 329439 327817 gene locus_tag LOCUS_02870 329439 327817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 330959 329469 gene locus_tag LOCUS_02880 330959 329469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 331435 333267 gene locus_tag LOCUS_02890 331435 333267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 333773 333420 gene locus_tag LOCUS_02900 333773 333420 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759980.1 protein_id gnl|my_center|LOCUS_02900 334642 333794 gene locus_tag LOCUS_02910 gene panC 334642 333794 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202230.1 protein_id gnl|my_center|LOCUS_02910 334889 335716 gene locus_tag LOCUS_02920 334889 335716 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767986.1 protein_id gnl|my_center|LOCUS_02920 335735 337309 gene locus_tag LOCUS_02930 335735 337309 CDS product DUF4270 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202229.1 protein_id gnl|my_center|LOCUS_02930 338826 337423 gene locus_tag LOCUS_02940 338826 337423 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785317.1 protein_id gnl|my_center|LOCUS_02940 340110 338842 gene locus_tag LOCUS_02950 340110 338842 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767983.1 protein_id gnl|my_center|LOCUS_02950 342065 340125 gene locus_tag LOCUS_02960 342065 340125 CDS product glycogen debranching enzyme N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202228.1 protein_id gnl|my_center|LOCUS_02960 342755 343003 gene locus_tag LOCUS_02970 342755 343003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 343568 342969 gene locus_tag LOCUS_02980 343568 342969 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775732.1 protein_id gnl|my_center|LOCUS_02980 343759 344448 gene locus_tag LOCUS_02990 343759 344448 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813083.1 protein_id gnl|my_center|LOCUS_02990 345638 344610 gene locus_tag LOCUS_03000 345638 344610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 347289 345652 gene locus_tag LOCUS_03010 347289 345652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 348417 347302 gene locus_tag LOCUS_03020 348417 347302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 348877 350145 gene locus_tag LOCUS_03030 348877 350145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 352347 350824 gene locus_tag LOCUS_03040 gene guaA 352347 350824 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785252.1 protein_id gnl|my_center|LOCUS_03040 352857 352423 gene locus_tag LOCUS_03050 gene mscL 352857 352423 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785250.1 protein_id gnl|my_center|LOCUS_03050 352995 354002 gene locus_tag LOCUS_03060 gene gap 352995 354002 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759940.1 protein_id gnl|my_center|LOCUS_03060 354153 356207 gene locus_tag LOCUS_03070 354153 356207 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202217.1 protein_id gnl|my_center|LOCUS_03070 356223 356723 gene locus_tag LOCUS_03080 356223 356723 CDS product DUF4847 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785244.1 protein_id gnl|my_center|LOCUS_03080 356746 357204 gene locus_tag LOCUS_03090 356746 357204 CDS product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785242.1 protein_id gnl|my_center|LOCUS_03090 357272 359002 gene locus_tag LOCUS_03100 357272 359002 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785240.1 protein_id gnl|my_center|LOCUS_03100 358929 359462 gene locus_tag LOCUS_03110 358929 359462 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658777.1 protein_id gnl|my_center|LOCUS_03110 359459 360241 gene locus_tag LOCUS_03120 359459 360241 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764454.1 protein_id gnl|my_center|LOCUS_03120 360572 360282 gene locus_tag LOCUS_03130 360572 360282 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775689.1 protein_id gnl|my_center|LOCUS_03130 361681 360569 gene locus_tag LOCUS_03140 gene recF 361681 360569 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785234.1 protein_id gnl|my_center|LOCUS_03140 361843 362526 gene locus_tag LOCUS_03150 361843 362526 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759931.1 protein_id gnl|my_center|LOCUS_03150 362696 363190 gene locus_tag LOCUS_03160 gene ribH 362696 363190 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785230.1 protein_id gnl|my_center|LOCUS_03160 363263 363346 gene locus_tag LOCUS_t00030 363263 363346 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 363354 363427 gene locus_tag LOCUS_t00040 363354 363427 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 363761 364081 gene locus_tag LOCUS_03170 363761 364081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03170 364731 366344 gene locus_tag LOCUS_03180 364731 366344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108178.1 protein_id gnl|my_center|LOCUS_03180 366518 368485 gene locus_tag LOCUS_03190 366518 368485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 370668 368695 gene locus_tag LOCUS_03200 370668 368695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 372583 370841 gene locus_tag LOCUS_03210 372583 370841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203714.1 protein_id gnl|my_center|LOCUS_03210 372897 374309 gene locus_tag LOCUS_03220 372897 374309 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759920.1 protein_id gnl|my_center|LOCUS_03220 374666 377935 gene locus_tag LOCUS_03230 374666 377935 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764442.1 protein_id gnl|my_center|LOCUS_03230 377973 379061 gene locus_tag LOCUS_03240 377973 379061 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785173.1 protein_id gnl|my_center|LOCUS_03240 379774 379085 gene locus_tag LOCUS_03250 379774 379085 CDS product DUF3256 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764440.1 protein_id gnl|my_center|LOCUS_03250 380700 379801 gene locus_tag LOCUS_03260 380700 379801 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658736.1 protein_id gnl|my_center|LOCUS_03260 381494 380742 gene locus_tag LOCUS_03270 gene truA 381494 380742 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764438.1 protein_id gnl|my_center|LOCUS_03270 385726 381548 gene locus_tag LOCUS_03280 385726 381548 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764437.1 protein_id gnl|my_center|LOCUS_03280 386613 385990 gene locus_tag LOCUS_03290 386613 385990 CDS product DUF5033 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109170.1 protein_id gnl|my_center|LOCUS_03290 386682 386909 gene locus_tag LOCUS_03300 386682 386909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 387012 387641 gene locus_tag LOCUS_03310 387012 387641 CDS product DUF3575 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759911.1 protein_id gnl|my_center|LOCUS_03310 387660 389114 gene locus_tag LOCUS_03320 387660 389114 CDS product DUF3868 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764436.1 protein_id gnl|my_center|LOCUS_03320 390574 391809 gene locus_tag LOCUS_03330 390574 391809 CDS product Mfa1 family fimbria major subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764431.1 protein_id gnl|my_center|LOCUS_03330 391941 393053 gene locus_tag LOCUS_03340 391941 393053 CDS product FimB/Mfa2 family fimbrial subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764430.1 protein_id gnl|my_center|LOCUS_03340 393201 394133 gene locus_tag LOCUS_03350 393201 394133 CDS product FimB/Mfa2 family fimbrial subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764429.1 protein_id gnl|my_center|LOCUS_03350 394155 396980 gene locus_tag LOCUS_03360 394155 396980 CDS product DUF4906 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764428.1 protein_id gnl|my_center|LOCUS_03360 396996 397265 gene locus_tag LOCUS_03370 396996 397265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 397500 397997 gene locus_tag LOCUS_03380 397500 397997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785162.1 protein_id gnl|my_center|LOCUS_03380 398044 399690 gene locus_tag LOCUS_03390 398044 399690 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785160.1 protein_id gnl|my_center|LOCUS_03390 399799 400467 gene locus_tag LOCUS_03400 399799 400467 CDS product DUF5715 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785158.1 protein_id gnl|my_center|LOCUS_03400 401845 400529 gene locus_tag LOCUS_03410 401845 400529 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108623.1 protein_id gnl|my_center|LOCUS_03410 402141 403154 gene locus_tag LOCUS_03420 402141 403154 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785156.1 protein_id gnl|my_center|LOCUS_03420 403163 404110 gene locus_tag LOCUS_03430 403163 404110 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759891.1 protein_id gnl|my_center|LOCUS_03430 404383 405120 gene locus_tag LOCUS_03440 gene ubiE 404383 405120 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785152.1 protein_id gnl|my_center|LOCUS_03440 405142 405885 gene locus_tag LOCUS_03450 405142 405885 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759889.1 protein_id gnl|my_center|LOCUS_03450 405894 406859 gene locus_tag LOCUS_03460 405894 406859 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785146.1 protein_id gnl|my_center|LOCUS_03460 406895 407821 gene locus_tag LOCUS_03470 406895 407821 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202197.1 protein_id gnl|my_center|LOCUS_03470 407891 408472 gene locus_tag LOCUS_03480 407891 408472 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202196.1 protein_id gnl|my_center|LOCUS_03480 408706 409872 gene locus_tag LOCUS_03490 408706 409872 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813169.1 protein_id gnl|my_center|LOCUS_03490 409924 411027 gene locus_tag LOCUS_03500 gene prfA 409924 411027 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785133.1 protein_id gnl|my_center|LOCUS_03500 411098 411928 gene locus_tag LOCUS_03510 gene pyrF 411098 411928 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759883.1 protein_id gnl|my_center|LOCUS_03510 411935 413170 gene locus_tag LOCUS_03520 411935 413170 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759882.1 protein_id gnl|my_center|LOCUS_03520 413292 414341 gene locus_tag LOCUS_03530 gene lpxD 413292 414341 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764416.1 protein_id gnl|my_center|LOCUS_03530 414345 415730 gene locus_tag LOCUS_03540 414345 415730 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785120.1 protein_id gnl|my_center|LOCUS_03540 415738 416505 gene locus_tag LOCUS_03550 gene lpxA 415738 416505 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785118.1 protein_id gnl|my_center|LOCUS_03550 416525 417088 gene locus_tag LOCUS_03560 416525 417088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769509.1 protein_id gnl|my_center|LOCUS_03560 417255 418169 gene locus_tag LOCUS_03570 gene miaA 417255 418169 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759877.1 protein_id gnl|my_center|LOCUS_03570 418166 420358 gene locus_tag LOCUS_03580 418166 420358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 420606 420400 gene locus_tag LOCUS_03590 420606 420400 CDS product Arc family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764408.1 protein_id gnl|my_center|LOCUS_03590 422012 421023 gene locus_tag LOCUS_03600 422012 421023 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764407.1 protein_id gnl|my_center|LOCUS_03600 425339 422277 gene locus_tag LOCUS_03610 425339 422277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 427111 425444 gene locus_tag LOCUS_03620 427111 425444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 427565 429367 gene locus_tag LOCUS_03630 427565 429367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 430609 429362 gene locus_tag LOCUS_03640 430609 429362 CDS product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202226.1 protein_id gnl|my_center|LOCUS_03640 431808 430648 gene locus_tag LOCUS_03650 431808 430648 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109125.1 protein_id gnl|my_center|LOCUS_03650 433060 431945 gene locus_tag LOCUS_03660 433060 431945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 433193 432951 gene locus_tag LOCUS_03670 433193 432951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 433192 433980 gene locus_tag LOCUS_03680 433192 433980 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764352.1 protein_id gnl|my_center|LOCUS_03680 433980 435989 gene locus_tag LOCUS_03690 433980 435989 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761012.1 protein_id gnl|my_center|LOCUS_03690 436645 439191 gene locus_tag LOCUS_03700 436645 439191 CDS product AsmA-like C-terminal region-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202225.1 protein_id gnl|my_center|LOCUS_03700 439194 439856 gene locus_tag LOCUS_03710 439194 439856 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795972.1 protein_id gnl|my_center|LOCUS_03710 440798 439986 gene locus_tag LOCUS_03720 gene nagB 440798 439986 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775719.1 protein_id gnl|my_center|LOCUS_03720 442038 440839 gene locus_tag LOCUS_03730 442038 440839 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795977.1 protein_id gnl|my_center|LOCUS_03730 443048 442113 gene locus_tag LOCUS_03740 443048 442113 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761007.1 protein_id gnl|my_center|LOCUS_03740 445411 443165 gene locus_tag LOCUS_03750 gene ccsA 445411 443165 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764579.1 protein_id gnl|my_center|LOCUS_03750 447059 445476 gene locus_tag LOCUS_03760 447059 445476 CDS product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261811.1 protein_id gnl|my_center|LOCUS_03760 448249 447077 gene locus_tag LOCUS_03770 448249 447077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 449593 448277 gene locus_tag LOCUS_03780 449593 448277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108309.1 protein_id gnl|my_center|LOCUS_03780 451572 450754 gene locus_tag LOCUS_03790 451572 450754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 452458 451640 gene locus_tag LOCUS_03800 452458 451640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 456041 453132 gene locus_tag LOCUS_03810 456041 453132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 457792 456953 gene locus_tag LOCUS_03820 457792 456953 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202222.1 protein_id gnl|my_center|LOCUS_03820 458552 457815 gene locus_tag LOCUS_03830 458552 457815 CDS product DUF5668 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785272.1 protein_id gnl|my_center|LOCUS_03830 460270 458777 gene locus_tag LOCUS_03840 460270 458777 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109097.1 protein_id gnl|my_center|LOCUS_03840 460668 462827 gene locus_tag LOCUS_03850 460668 462827 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795983.1 protein_id gnl|my_center|LOCUS_03850 462827 463678 gene locus_tag LOCUS_03860 gene lipA 462827 463678 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764405.1 protein_id gnl|my_center|LOCUS_03860 463738 464856 gene locus_tag LOCUS_03870 463738 464856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785267.1 protein_id gnl|my_center|LOCUS_03870 465526 464822 gene locus_tag LOCUS_03880 465526 464822 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202221.1 protein_id gnl|my_center|LOCUS_03880 466478 465528 gene locus_tag LOCUS_03890 466478 465528 CDS product GldB family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759865.1 protein_id gnl|my_center|LOCUS_03890 467398 466541 gene locus_tag LOCUS_03900 467398 466541 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759864.1 protein_id gnl|my_center|LOCUS_03900 467587 468234 gene locus_tag LOCUS_03910 467587 468234 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109158.1 protein_id gnl|my_center|LOCUS_03910 470059 468449 gene locus_tag LOCUS_03920 470059 468449 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203343.1 protein_id gnl|my_center|LOCUS_03920 470400 471236 gene locus_tag LOCUS_03930 470400 471236 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107849.1 protein_id gnl|my_center|LOCUS_03930 471350 472720 gene locus_tag LOCUS_03940 471350 472720 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659213.1 protein_id gnl|my_center|LOCUS_03940 472922 475408 gene locus_tag LOCUS_03950 472922 475408 CDS product SEL1-like repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201902.1 protein_id gnl|my_center|LOCUS_03950 475405 477174 gene locus_tag LOCUS_03960 475405 477174 CDS product HSP90 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201903.1 protein_id gnl|my_center|LOCUS_03960 477183 478250 gene locus_tag LOCUS_03970 477183 478250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201904.1 protein_id gnl|my_center|LOCUS_03970 484024 478334 gene locus_tag LOCUS_03980 484024 478334 CDS product alpha-2-macroglobulin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072066367.1 protein_id gnl|my_center|LOCUS_03980 485994 484537 gene locus_tag LOCUS_03990 485994 484537 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764285.1 protein_id gnl|my_center|LOCUS_03990 487002 486016 gene locus_tag LOCUS_04000 487002 486016 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760929.1 protein_id gnl|my_center|LOCUS_04000 487073 487888 gene locus_tag LOCUS_04010 gene rsmA 487073 487888 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760928.1 protein_id gnl|my_center|LOCUS_04010 487897 489243 gene locus_tag LOCUS_04020 gene mgtE 487897 489243 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784864.1 protein_id gnl|my_center|LOCUS_04020 489361 491214 gene locus_tag LOCUS_04030 489361 491214 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764283.1 protein_id gnl|my_center|LOCUS_04030 491555 491484 gene locus_tag LOCUS_t00050 491555 491484 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 491858 492217 gene locus_tag LOCUS_04040 gene rsfS 491858 492217 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784862.1 protein_id gnl|my_center|LOCUS_04040 492227 494275 gene locus_tag LOCUS_04050 gene ftsH 492227 494275 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784860.1 protein_id gnl|my_center|LOCUS_04050 494288 495127 gene locus_tag LOCUS_04060 494288 495127 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764240.1 protein_id gnl|my_center|LOCUS_04060 496293 495559 gene locus_tag LOCUS_04070 496293 495559 CDS product NigD-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992150.1 protein_id gnl|my_center|LOCUS_04070 497512 496376 gene locus_tag LOCUS_04080 gene lpxB 497512 496376 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784854.1 protein_id gnl|my_center|LOCUS_04080 498296 497532 gene locus_tag LOCUS_04090 gene surE 498296 497532 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784852.1 protein_id gnl|my_center|LOCUS_04090 498615 499382 gene locus_tag LOCUS_04100 498615 499382 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784850.1 protein_id gnl|my_center|LOCUS_04100 499393 500283 gene locus_tag LOCUS_04110 499393 500283 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775476.1 protein_id gnl|my_center|LOCUS_04110 500338 501156 gene locus_tag LOCUS_04120 500338 501156 CDS product DUF5683 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784846.1 protein_id gnl|my_center|LOCUS_04120 501138 502484 gene locus_tag LOCUS_04130 501138 502484 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764235.1 protein_id gnl|my_center|LOCUS_04130 502514 504802 gene locus_tag LOCUS_04140 502514 504802 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796220.1 protein_id gnl|my_center|LOCUS_04140 505170 504817 gene locus_tag LOCUS_04150 505170 504817 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760912.1 protein_id gnl|my_center|LOCUS_04150 506143 505175 gene locus_tag LOCUS_04160 506143 505175 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796222.1 protein_id gnl|my_center|LOCUS_04160 506249 508867 gene locus_tag LOCUS_04170 gene alaS 506249 508867 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796226.1 protein_id gnl|my_center|LOCUS_04170 509255 510403 gene locus_tag LOCUS_04180 509255 510403 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172461650.1 protein_id gnl|my_center|LOCUS_04180 511007 513229 gene locus_tag LOCUS_04190 511007 513229 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658550.1 protein_id gnl|my_center|LOCUS_04190 513248 513802 gene locus_tag LOCUS_04200 513248 513802 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109055.1 protein_id gnl|my_center|LOCUS_04200 513841 514854 gene locus_tag LOCUS_04210 513841 514854 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303128.1 protein_id gnl|my_center|LOCUS_04210 514916 517195 gene locus_tag LOCUS_04220 514916 517195 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796237.1 protein_id gnl|my_center|LOCUS_04220 518537 517329 gene locus_tag LOCUS_04230 518537 517329 CDS product hexokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788030.1 protein_id gnl|my_center|LOCUS_04230 518608 520059 gene locus_tag LOCUS_04240 gene gnd 518608 520059 CDS product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107660.1 protein_id gnl|my_center|LOCUS_04240 520642 520196 gene locus_tag LOCUS_04250 520642 520196 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790451.1 protein_id gnl|my_center|LOCUS_04250 521053 524343 gene locus_tag LOCUS_04260 521053 524343 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032814420.1 protein_id gnl|my_center|LOCUS_04260 524440 525945 gene locus_tag LOCUS_04270 524440 525945 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760899.1 protein_id gnl|my_center|LOCUS_04270 525957 526976 gene locus_tag LOCUS_04280 525957 526976 CDS product glycoside hydrolase family 18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109050.1 protein_id gnl|my_center|LOCUS_04280 526985 528139 gene locus_tag LOCUS_04290 526985 528139 CDS product DUF1735 and LamG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760901.1 protein_id gnl|my_center|LOCUS_04290 528169 530112 gene locus_tag LOCUS_04300 528169 530112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 530340 532220 gene locus_tag LOCUS_04310 530340 532220 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202360.1 protein_id gnl|my_center|LOCUS_04310 533078 532398 gene locus_tag LOCUS_04320 533078 532398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 534643 533225 gene locus_tag LOCUS_04330 534643 533225 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202124.1 protein_id gnl|my_center|LOCUS_04330 534821 535435 gene locus_tag LOCUS_04340 534821 535435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760896.1 protein_id gnl|my_center|LOCUS_04340 535416 536207 gene locus_tag LOCUS_04350 535416 536207 CDS product DUF3822 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769417.1 protein_id gnl|my_center|LOCUS_04350 536198 536731 gene locus_tag LOCUS_04360 536198 536731 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760894.1 protein_id gnl|my_center|LOCUS_04360 538187 536748 gene locus_tag LOCUS_04370 gene cls 538187 536748 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796243.1 protein_id gnl|my_center|LOCUS_04370 541321 538412 gene locus_tag LOCUS_04380 541321 538412 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796251.1 protein_id gnl|my_center|LOCUS_04380 544189 541451 gene locus_tag LOCUS_04390 544189 541451 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760893.1 protein_id gnl|my_center|LOCUS_04390 544628 544224 gene locus_tag LOCUS_04400 544628 544224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784807.1 protein_id gnl|my_center|LOCUS_04400 544710 545771 gene locus_tag LOCUS_04410 gene aroB 544710 545771 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109049.1 protein_id gnl|my_center|LOCUS_04410 548482 545768 gene locus_tag LOCUS_04420 548482 545768 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202980.1 protein_id gnl|my_center|LOCUS_04420 548870 548944 gene locus_tag LOCUS_t00060 548870 548944 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 548970 549248 gene locus_tag LOCUS_04430 548970 549248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 549325 550599 gene locus_tag LOCUS_04440 gene aroA 549325 550599 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303115.1 protein_id gnl|my_center|LOCUS_04440 550673 551095 gene locus_tag LOCUS_04450 550673 551095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784767.1 protein_id gnl|my_center|LOCUS_04450 551273 552070 gene locus_tag LOCUS_04460 551273 552070 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759703.1 protein_id gnl|my_center|LOCUS_04460 552094 555060 gene locus_tag LOCUS_04470 552094 555060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 555116 556693 gene locus_tag LOCUS_04480 555116 556693 CDS product PglZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_04480 556756 557172 gene locus_tag LOCUS_04490 gene tsaE 556756 557172 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759702.1 protein_id gnl|my_center|LOCUS_04490 557183 557395 gene locus_tag LOCUS_04500 557183 557395 CDS product immunity 17 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796270.1 protein_id gnl|my_center|LOCUS_04500 558644 557400 gene locus_tag LOCUS_04510 558644 557400 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784758.1 protein_id gnl|my_center|LOCUS_04510 559873 558794 gene locus_tag LOCUS_04520 559873 558794 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108172.1 protein_id gnl|my_center|LOCUS_04520 561217 559886 gene locus_tag LOCUS_04530 561217 559886 CDS product DUF4350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202114.1 protein_id gnl|my_center|LOCUS_04530 561852 561214 gene locus_tag LOCUS_04540 561852 561214 CDS product DUF4129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801447.1 protein_id gnl|my_center|LOCUS_04540 562805 561870 gene locus_tag LOCUS_04550 562805 561870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005818289.1 protein_id gnl|my_center|LOCUS_04550 563748 562786 gene locus_tag LOCUS_04560 563748 562786 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784748.1 protein_id gnl|my_center|LOCUS_04560 563847 564578 gene locus_tag LOCUS_04570 563847 564578 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784744.1 protein_id gnl|my_center|LOCUS_04570 564898 564593 gene locus_tag LOCUS_04580 564898 564593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 565988 565698 gene locus_tag LOCUS_04590 565988 565698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 566797 567330 gene locus_tag LOCUS_04600 gene upbY 566797 567330 CDS product capsular polysaccharide transcription antiterminator UpbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786813.1 protein_id gnl|my_center|LOCUS_04600 567356 567850 gene locus_tag LOCUS_04610 567356 567850 CDS product UpxZ family transcription anti-terminator antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203398.1 protein_id gnl|my_center|LOCUS_04610 567992 569200 gene locus_tag LOCUS_04620 567992 569200 CDS product UDP-N-acetylglucosamine 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202418.1 protein_id gnl|my_center|LOCUS_04620 569226 570359 gene locus_tag LOCUS_04630 569226 570359 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582967.1 protein_id gnl|my_center|LOCUS_04630 570352 571587 gene locus_tag LOCUS_04640 570352 571587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 571589 572257 gene locus_tag LOCUS_04650 571589 572257 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963399.1 protein_id gnl|my_center|LOCUS_04650 572319 573383 gene locus_tag LOCUS_04660 572319 573383 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795358.1 protein_id gnl|my_center|LOCUS_04660 573387 574565 gene locus_tag LOCUS_04670 573387 574565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 574572 575969 gene locus_tag LOCUS_04680 574572 575969 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208049.1 protein_id gnl|my_center|LOCUS_04680 576728 577135 gene locus_tag LOCUS_04690 576728 577135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 577141 577974 gene locus_tag LOCUS_04700 577141 577974 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897935.1 protein_id gnl|my_center|LOCUS_04700 578018 579235 gene locus_tag LOCUS_04710 578018 579235 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107731.1 protein_id gnl|my_center|LOCUS_04710 579243 580256 gene locus_tag LOCUS_04720 579243 580256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 580326 581051 gene locus_tag LOCUS_04730 580326 581051 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000564500.1 protein_id gnl|my_center|LOCUS_04730 581117 582073 gene locus_tag LOCUS_04740 581117 582073 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786859.1 protein_id gnl|my_center|LOCUS_04740 582104 583048 gene locus_tag LOCUS_04750 582104 583048 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202921.1 protein_id gnl|my_center|LOCUS_04750 585733 583409 gene locus_tag LOCUS_04760 585733 583409 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764202.1 protein_id gnl|my_center|LOCUS_04760 586194 585859 gene locus_tag LOCUS_04770 586194 585859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759609.1 protein_id gnl|my_center|LOCUS_04770 586537 586223 gene locus_tag LOCUS_04780 gene trxA 586537 586223 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759608.1 protein_id gnl|my_center|LOCUS_04780 590439 586642 gene locus_tag LOCUS_04790 gene dnaE 590439 586642 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992125.1 protein_id gnl|my_center|LOCUS_04790 590517 591290 gene locus_tag LOCUS_04800 590517 591290 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784739.1 protein_id gnl|my_center|LOCUS_04800 591379 592008 gene locus_tag LOCUS_04810 gene pssA 591379 592008 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759605.1 protein_id gnl|my_center|LOCUS_04810 592071 592358 gene locus_tag LOCUS_04820 592071 592358 CDS product DUF4834 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764000.1 protein_id gnl|my_center|LOCUS_04820 602613 592837 gene locus_tag LOCUS_04830 602613 592837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 605064 602947 gene locus_tag LOCUS_04840 605064 602947 CDS product LruC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203505.1 protein_id gnl|my_center|LOCUS_04840 605554 605099 gene locus_tag LOCUS_04850 605554 605099 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784733.1 protein_id gnl|my_center|LOCUS_04850 605784 605551 gene locus_tag LOCUS_04860 605784 605551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759602.1 protein_id gnl|my_center|LOCUS_04860 605872 606237 gene locus_tag LOCUS_04870 605872 606237 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764002.1 protein_id gnl|my_center|LOCUS_04870 606263 606619 gene locus_tag LOCUS_04880 606263 606619 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764003.1 protein_id gnl|my_center|LOCUS_04880 606603 607364 gene locus_tag LOCUS_04890 606603 607364 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769390.1 protein_id gnl|my_center|LOCUS_04890 608052 607354 gene locus_tag LOCUS_04900 608052 607354 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784721.1 protein_id gnl|my_center|LOCUS_04900 608175 609497 gene locus_tag LOCUS_04910 608175 609497 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784716.1 protein_id gnl|my_center|LOCUS_04910 609776 610507 gene locus_tag LOCUS_04920 609776 610507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 610636 611346 gene locus_tag LOCUS_04930 gene pyrH 610636 611346 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784714.1 protein_id gnl|my_center|LOCUS_04930 611933 611385 gene locus_tag LOCUS_04940 611933 611385 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203406.1 protein_id gnl|my_center|LOCUS_04940 612102 612662 gene locus_tag LOCUS_04950 gene frr 612102 612662 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775374.1 protein_id gnl|my_center|LOCUS_04950 612757 613689 gene locus_tag LOCUS_04960 gene rsgA 612757 613689 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764015.1 protein_id gnl|my_center|LOCUS_04960 613808 614887 gene locus_tag LOCUS_04970 613808 614887 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764016.1 protein_id gnl|my_center|LOCUS_04970 614900 617944 gene locus_tag LOCUS_04980 614900 617944 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784705.1 protein_id gnl|my_center|LOCUS_04980 617961 619283 gene locus_tag LOCUS_04990 617961 619283 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784703.1 protein_id gnl|my_center|LOCUS_04990 619764 619342 gene locus_tag LOCUS_05000 619764 619342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 620141 619764 gene locus_tag LOCUS_05010 620141 619764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 621278 620295 gene locus_tag LOCUS_05020 621278 620295 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109297.1 protein_id gnl|my_center|LOCUS_05020 622776 621616 gene locus_tag LOCUS_05030 622776 621616 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992113.1 protein_id gnl|my_center|LOCUS_05030 624567 622930 gene locus_tag LOCUS_05040 624567 622930 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813403.1 protein_id gnl|my_center|LOCUS_05040 626745 624754 gene locus_tag LOCUS_05050 626745 624754 CDS product DUF4954 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796342.1 protein_id gnl|my_center|LOCUS_05050 628019 626763 gene locus_tag LOCUS_05060 gene hflX 628019 626763 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759581.1 protein_id gnl|my_center|LOCUS_05060 630183 628303 gene locus_tag LOCUS_05070 630183 628303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 631858 630227 gene locus_tag LOCUS_05080 631858 630227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 635081 631881 gene locus_tag LOCUS_05090 635081 631881 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202496.1 protein_id gnl|my_center|LOCUS_05090 635534 636715 gene locus_tag LOCUS_05100 635534 636715 CDS product Tsr0667 family tyrosine-type DNA invertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784676.1 protein_id gnl|my_center|LOCUS_05100 637959 637309 gene locus_tag LOCUS_05110 637959 637309 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778522.1 protein_id gnl|my_center|LOCUS_05110 638712 638020 gene locus_tag LOCUS_05120 638712 638020 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108200.1 protein_id gnl|my_center|LOCUS_05120 639569 638712 gene locus_tag LOCUS_05130 639569 638712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784668.1 protein_id gnl|my_center|LOCUS_05130 640270 639596 gene locus_tag LOCUS_05140 gene rsmI 640270 639596 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108201.1 protein_id gnl|my_center|LOCUS_05140 640880 640284 gene locus_tag LOCUS_05150 640880 640284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172461645.1 protein_id gnl|my_center|LOCUS_05150 641044 641571 gene locus_tag LOCUS_05160 641044 641571 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784663.1 protein_id gnl|my_center|LOCUS_05160 641593 642720 gene locus_tag LOCUS_05170 641593 642720 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202097.1 protein_id gnl|my_center|LOCUS_05170 642826 642901 gene locus_tag LOCUS_t00070 642826 642901 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 643140 644384 gene locus_tag LOCUS_05180 643140 644384 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008149802.1 protein_id gnl|my_center|LOCUS_05180 645159 644401 gene locus_tag LOCUS_05190 645159 644401 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_05190 645683 645156 gene locus_tag LOCUS_05200 645683 645156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 645772 646050 gene locus_tag LOCUS_05210 645772 646050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 646423 647235 gene locus_tag LOCUS_05220 646423 647235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 647239 647784 gene locus_tag LOCUS_05230 647239 647784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 647978 648265 gene locus_tag LOCUS_05240 647978 648265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025814668.1 protein_id gnl|my_center|LOCUS_05240 648243 648638 gene locus_tag LOCUS_05250 648243 648638 CDS product RteC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162173703.1 protein_id gnl|my_center|LOCUS_05250 648767 649090 gene locus_tag LOCUS_05260 648767 649090 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007485505.1 protein_id gnl|my_center|LOCUS_05260 649285 649515 gene locus_tag LOCUS_05270 649285 649515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 649517 650725 gene locus_tag LOCUS_05280 649517 650725 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109064.1 protein_id gnl|my_center|LOCUS_05280 650790 651014 gene locus_tag LOCUS_05290 650790 651014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 651114 651821 gene locus_tag LOCUS_05300 651114 651821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 651913 655284 gene locus_tag LOCUS_05310 651913 655284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 655574 655389 gene locus_tag LOCUS_05320 655574 655389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 656004 657212 gene locus_tag LOCUS_05330 656004 657212 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202365.1 protein_id gnl|my_center|LOCUS_05330 658691 657264 gene locus_tag LOCUS_05340 658691 657264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095757.1 protein_id gnl|my_center|LOCUS_05340 660037 659261 gene locus_tag LOCUS_05350 660037 659261 CDS product RteC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107118.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05350 660472 661134 gene locus_tag LOCUS_05360 660472 661134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05360 661261 661605 gene locus_tag LOCUS_05370 661261 661605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05370 662793 661597 gene locus_tag LOCUS_05380 662793 661597 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429271.1 protein_id gnl|my_center|LOCUS_05380 663045 664133 gene locus_tag LOCUS_05390 663045 664133 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143046.1 protein_id gnl|my_center|LOCUS_05390 664141 665772 gene locus_tag LOCUS_05400 664141 665772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 665963 666625 gene locus_tag LOCUS_05410 gene ung 665963 666625 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802535.1 protein_id gnl|my_center|LOCUS_05410 667369 666641 gene locus_tag LOCUS_05420 667369 666641 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761172.1 protein_id gnl|my_center|LOCUS_05420 667696 667935 gene locus_tag LOCUS_05430 667696 667935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778611.1 protein_id gnl|my_center|LOCUS_05430 668908 668009 gene locus_tag LOCUS_05440 668908 668009 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796397.1 protein_id gnl|my_center|LOCUS_05440 669221 671467 gene locus_tag LOCUS_05450 669221 671467 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813448.1 protein_id gnl|my_center|LOCUS_05450 671469 672038 gene locus_tag LOCUS_05460 gene pnuC 671469 672038 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202077.1 protein_id gnl|my_center|LOCUS_05460 672066 672686 gene locus_tag LOCUS_05470 672066 672686 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202076.1 protein_id gnl|my_center|LOCUS_05470 674355 673054 gene locus_tag LOCUS_05480 gene thrC 674355 673054 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202074.1 protein_id gnl|my_center|LOCUS_05480 675609 674368 gene locus_tag LOCUS_05490 675609 674368 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763759.1 protein_id gnl|my_center|LOCUS_05490 678060 675625 gene locus_tag LOCUS_05500 gene thrA 678060 675625 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108282.1 protein_id gnl|my_center|LOCUS_05500 678450 679487 gene locus_tag LOCUS_05510 678450 679487 CDS product type I asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796414.1 protein_id gnl|my_center|LOCUS_05510 679612 680979 gene locus_tag LOCUS_05520 gene radA 679612 680979 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764082.1 protein_id gnl|my_center|LOCUS_05520 681014 682624 gene locus_tag LOCUS_05530 681014 682624 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108284.1 protein_id gnl|my_center|LOCUS_05530 682624 683217 gene locus_tag LOCUS_05540 682624 683217 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202071.1 protein_id gnl|my_center|LOCUS_05540 683284 685689 gene locus_tag LOCUS_05550 683284 685689 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202070.1 protein_id gnl|my_center|LOCUS_05550 686877 686005 gene locus_tag LOCUS_05560 686877 686005 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108287.1 protein_id gnl|my_center|LOCUS_05560 688941 687100 gene locus_tag LOCUS_05570 688941 687100 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108288.1 protein_id gnl|my_center|LOCUS_05570 689855 688938 gene locus_tag LOCUS_05580 gene metA 689855 688938 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796420.1 protein_id gnl|my_center|LOCUS_05580 690664 689963 gene locus_tag LOCUS_05590 690664 689963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 690776 690988 gene locus_tag LOCUS_05600 690776 690988 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002559159.1 protein_id gnl|my_center|LOCUS_05600 692618 691065 gene locus_tag LOCUS_05610 692618 691065 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108979.1 protein_id gnl|my_center|LOCUS_05610 694040 692658 gene locus_tag LOCUS_05620 694040 692658 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108981.1 protein_id gnl|my_center|LOCUS_05620 694718 697225 gene locus_tag LOCUS_05630 694718 697225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 698463 697270 gene locus_tag LOCUS_05640 698463 697270 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796424.1 protein_id gnl|my_center|LOCUS_05640 699760 698546 gene locus_tag LOCUS_05650 699760 698546 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763746.1 protein_id gnl|my_center|LOCUS_05650 701584 699773 gene locus_tag LOCUS_05660 701584 699773 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763745.1 protein_id gnl|my_center|LOCUS_05660 702140 701754 gene locus_tag LOCUS_05670 702140 701754 CDS product START-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763744.1 protein_id gnl|my_center|LOCUS_05670 702361 702435 gene locus_tag LOCUS_t00080 702361 702435 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 704250 702811 gene locus_tag LOCUS_05680 704250 702811 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764093.1 protein_id gnl|my_center|LOCUS_05680 705391 704270 gene locus_tag LOCUS_05690 705391 704270 CDS product sensor protein KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784495.1 protein_id gnl|my_center|LOCUS_05690 706167 705391 gene locus_tag LOCUS_05700 706167 705391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784491.1 protein_id gnl|my_center|LOCUS_05700 706745 706164 gene locus_tag LOCUS_05710 706745 706164 CDS product K(+)-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764090.1 protein_id gnl|my_center|LOCUS_05710 708761 706758 gene locus_tag LOCUS_05720 gene kdpB 708761 706758 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784488.1 protein_id gnl|my_center|LOCUS_05720 710538 708832 gene locus_tag LOCUS_05730 gene kdpA 710538 708832 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108291.1 protein_id gnl|my_center|LOCUS_05730 712736 711390 gene locus_tag LOCUS_05740 712736 711390 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796447.1 protein_id gnl|my_center|LOCUS_05740 712922 713932 gene locus_tag LOCUS_05750 712922 713932 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583758.1 protein_id gnl|my_center|LOCUS_05750 720242 714111 gene locus_tag LOCUS_05760 720242 714111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 720529 723105 gene locus_tag LOCUS_05770 720529 723105 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108297.1 protein_id gnl|my_center|LOCUS_05770 723115 723465 gene locus_tag LOCUS_05780 723115 723465 CDS product winged helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784476.1 protein_id gnl|my_center|LOCUS_05780 723584 724216 gene locus_tag LOCUS_05790 723584 724216 CDS product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763637.1 protein_id gnl|my_center|LOCUS_05790 724232 724858 gene locus_tag LOCUS_05800 724232 724858 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784469.1 protein_id gnl|my_center|LOCUS_05800 728041 724991 gene locus_tag LOCUS_05810 728041 724991 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108299.1 protein_id gnl|my_center|LOCUS_05810 729933 728044 gene locus_tag LOCUS_05820 729933 728044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 730785 729952 gene locus_tag LOCUS_05830 730785 729952 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801566.1 protein_id gnl|my_center|LOCUS_05830 731571 730804 gene locus_tag LOCUS_05840 731571 730804 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784454.1 protein_id gnl|my_center|LOCUS_05840 731726 732079 gene locus_tag LOCUS_05850 gene rplS 731726 732079 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778830.1 protein_id gnl|my_center|LOCUS_05850 735440 732375 gene locus_tag LOCUS_05860 735440 732375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 736767 735790 gene locus_tag LOCUS_05870 736767 735790 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763623.1 protein_id gnl|my_center|LOCUS_05870 736943 737659 gene locus_tag LOCUS_05880 736943 737659 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796460.1 protein_id gnl|my_center|LOCUS_05880 737699 738958 gene locus_tag LOCUS_05890 737699 738958 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763621.1 protein_id gnl|my_center|LOCUS_05890 738963 740207 gene locus_tag LOCUS_05900 738963 740207 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108314.1 protein_id gnl|my_center|LOCUS_05900 740300 741397 gene locus_tag LOCUS_05910 740300 741397 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763619.1 protein_id gnl|my_center|LOCUS_05910 741424 742737 gene locus_tag LOCUS_05920 741424 742737 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796464.1 protein_id gnl|my_center|LOCUS_05920 743685 742918 gene locus_tag LOCUS_05930 743685 742918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 745162 743669 gene locus_tag LOCUS_05940 745162 743669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 745242 746120 gene locus_tag LOCUS_05950 745242 746120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 746117 747214 gene locus_tag LOCUS_05960 746117 747214 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963970.1 protein_id gnl|my_center|LOCUS_05960 748386 747286 gene locus_tag LOCUS_05970 748386 747286 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795850.1 protein_id gnl|my_center|LOCUS_05970 749362 748370 gene locus_tag LOCUS_05980 749362 748370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963974.1 protein_id gnl|my_center|LOCUS_05980 749745 749359 gene locus_tag LOCUS_05990 749745 749359 CDS product FdtA/QdtA family cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802400.1 protein_id gnl|my_center|LOCUS_05990 750098 750685 gene locus_tag LOCUS_06000 750098 750685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 751928 751251 gene locus_tag LOCUS_06010 751928 751251 CDS product DUF4476 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784413.1 protein_id gnl|my_center|LOCUS_06010 752189 751956 gene locus_tag LOCUS_06020 752189 751956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 753223 752384 gene locus_tag LOCUS_06030 753223 752384 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108322.1 protein_id gnl|my_center|LOCUS_06030 753422 754423 gene locus_tag LOCUS_06040 753422 754423 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763609.1 protein_id gnl|my_center|LOCUS_06040 755446 754526 gene locus_tag LOCUS_06050 755446 754526 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765200.1 protein_id gnl|my_center|LOCUS_06050 756760 755519 gene locus_tag LOCUS_06060 756760 755519 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801628.1 protein_id gnl|my_center|LOCUS_06060 756976 758418 gene locus_tag LOCUS_06070 756976 758418 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784276.1 protein_id gnl|my_center|LOCUS_06070 758555 759520 gene locus_tag LOCUS_06080 gene glsA 758555 759520 CDS product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202007.1 protein_id gnl|my_center|LOCUS_06080 760642 759887 gene locus_tag LOCUS_06090 760642 759887 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784407.1 protein_id gnl|my_center|LOCUS_06090 760833 762446 gene locus_tag LOCUS_06100 760833 762446 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784405.1 protein_id gnl|my_center|LOCUS_06100 763843 762605 gene locus_tag LOCUS_06110 763843 762605 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108361.1 protein_id gnl|my_center|LOCUS_06110 764056 764130 gene locus_tag LOCUS_t00090 764056 764130 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 764143 764216 gene locus_tag LOCUS_t00100 764143 764216 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 764484 764960 gene locus_tag LOCUS_06120 gene argR 764484 764960 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796492.1 protein_id gnl|my_center|LOCUS_06120 765091 765669 gene locus_tag LOCUS_06130 765091 765669 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108960.1 protein_id gnl|my_center|LOCUS_06130 765685 766890 gene locus_tag LOCUS_06140 765685 766890 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778881.1 protein_id gnl|my_center|LOCUS_06140 766909 767877 gene locus_tag LOCUS_06150 gene argC 766909 767877 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796494.1 protein_id gnl|my_center|LOCUS_06150 767884 769008 gene locus_tag LOCUS_06160 767884 769008 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202045.1 protein_id gnl|my_center|LOCUS_06160 769443 770216 gene locus_tag LOCUS_06170 gene proC 769443 770216 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762694.1 protein_id gnl|my_center|LOCUS_06170 770273 770821 gene locus_tag LOCUS_06180 770273 770821 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784392.1 protein_id gnl|my_center|LOCUS_06180 770831 772492 gene locus_tag LOCUS_06190 770831 772492 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784390.1 protein_id gnl|my_center|LOCUS_06190 773387 776707 gene locus_tag LOCUS_06200 773387 776707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 777089 777004 gene locus_tag LOCUS_t00110 777089 777004 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 777178 777105 gene locus_tag LOCUS_t00120 777178 777105 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 777802 777350 gene locus_tag LOCUS_06210 777802 777350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 779152 777812 gene locus_tag LOCUS_06220 gene argH 779152 777812 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766984.1 protein_id gnl|my_center|LOCUS_06220 779618 779208 gene locus_tag LOCUS_06230 779618 779208 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796501.1 protein_id gnl|my_center|LOCUS_06230 780360 779722 gene locus_tag LOCUS_06240 gene pyrE 780360 779722 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762667.1 protein_id gnl|my_center|LOCUS_06240 780919 780440 gene locus_tag LOCUS_06250 780919 780440 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762666.1 protein_id gnl|my_center|LOCUS_06250 781752 780916 gene locus_tag LOCUS_06260 gene prmC 781752 780916 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766986.1 protein_id gnl|my_center|LOCUS_06260 781807 782847 gene locus_tag LOCUS_06270 gene ribD 781807 782847 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784375.1 protein_id gnl|my_center|LOCUS_06270 783040 784368 gene locus_tag LOCUS_06280 783040 784368 CDS product DUF6242 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202030.1 protein_id gnl|my_center|LOCUS_06280 784436 785140 gene locus_tag LOCUS_06290 784436 785140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 785145 785879 gene locus_tag LOCUS_06300 785145 785879 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784372.1 protein_id gnl|my_center|LOCUS_06300 785905 788556 gene locus_tag LOCUS_06310 785905 788556 CDS product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108949.1 protein_id gnl|my_center|LOCUS_06310 788582 789097 gene locus_tag LOCUS_06320 788582 789097 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784368.1 protein_id gnl|my_center|LOCUS_06320 789197 789667 gene locus_tag LOCUS_06330 789197 789667 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010536380.1 protein_id gnl|my_center|LOCUS_06330 789833 790675 gene locus_tag LOCUS_06340 gene murI 789833 790675 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202028.1 protein_id gnl|my_center|LOCUS_06340 791522 790767 gene locus_tag LOCUS_06350 791522 790767 CDS product fimbrillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766146.1 protein_id gnl|my_center|LOCUS_06350 793456 791543 gene locus_tag LOCUS_06360 793456 791543 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767054.1 protein_id gnl|my_center|LOCUS_06360 793841 794074 gene locus_tag LOCUS_06370 793841 794074 CDS product DUF2007-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108946.1 protein_id gnl|my_center|LOCUS_06370 794498 795580 gene locus_tag LOCUS_06380 gene proB 794498 795580 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202027.1 protein_id gnl|my_center|LOCUS_06380 795659 796909 gene locus_tag LOCUS_06390 795659 796909 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992045.1 protein_id gnl|my_center|LOCUS_06390 796910 797947 gene locus_tag LOCUS_06400 796910 797947 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202025.1 protein_id gnl|my_center|LOCUS_06400 797996 798952 gene locus_tag LOCUS_06410 797996 798952 CDS product acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762653.1 protein_id gnl|my_center|LOCUS_06410 800050 799640 gene locus_tag LOCUS_06420 800050 799640 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784350.1 protein_id gnl|my_center|LOCUS_06420 801213 800062 gene locus_tag LOCUS_06430 801213 800062 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813548.1 protein_id gnl|my_center|LOCUS_06430 802239 801262 gene locus_tag LOCUS_06440 802239 801262 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202023.1 protein_id gnl|my_center|LOCUS_06440 803315 802236 gene locus_tag LOCUS_06450 803315 802236 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796526.1 protein_id gnl|my_center|LOCUS_06450 803997 803353 gene locus_tag LOCUS_06460 803997 803353 CDS product PASTA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766997.1 protein_id gnl|my_center|LOCUS_06460 804361 804113 gene locus_tag LOCUS_06470 804361 804113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 804466 805032 gene locus_tag LOCUS_06480 gene efp 804466 805032 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766998.1 protein_id gnl|my_center|LOCUS_06480 805224 806621 gene locus_tag LOCUS_06490 805224 806621 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784328.1 protein_id gnl|my_center|LOCUS_06490 807692 806928 gene locus_tag LOCUS_06500 807692 806928 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784332.1 protein_id gnl|my_center|LOCUS_06500 808054 807743 gene locus_tag LOCUS_06510 808054 807743 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784330.1 protein_id gnl|my_center|LOCUS_06510 808828 808097 gene locus_tag LOCUS_06520 gene radC 808828 808097 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767010.1 protein_id gnl|my_center|LOCUS_06520 809872 808883 gene locus_tag LOCUS_06530 809872 808883 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784336.1 protein_id gnl|my_center|LOCUS_06530 811178 809982 gene locus_tag LOCUS_06540 811178 809982 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784326.1 protein_id gnl|my_center|LOCUS_06540 812217 811198 gene locus_tag LOCUS_06550 gene pta 812217 811198 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796541.1 protein_id gnl|my_center|LOCUS_06550 813909 812353 gene locus_tag LOCUS_06560 813909 812353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162484911.1 protein_id gnl|my_center|LOCUS_06560 814726 813929 gene locus_tag LOCUS_06570 814726 813929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796546.1 protein_id gnl|my_center|LOCUS_06570 815441 814758 gene locus_tag LOCUS_06580 815441 814758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784319.1 protein_id gnl|my_center|LOCUS_06580 815649 815987 gene locus_tag LOCUS_06590 815649 815987 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784314.1 protein_id gnl|my_center|LOCUS_06590 815984 816679 gene locus_tag LOCUS_06600 815984 816679 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784312.1 protein_id gnl|my_center|LOCUS_06600 816737 817654 gene locus_tag LOCUS_06610 816737 817654 CDS product DUF2156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801609.1 protein_id gnl|my_center|LOCUS_06610 817693 818706 gene locus_tag LOCUS_06620 817693 818706 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202020.1 protein_id gnl|my_center|LOCUS_06620 820952 819387 gene locus_tag LOCUS_06630 820952 819387 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108631.1 protein_id gnl|my_center|LOCUS_06630 822531 820957 gene locus_tag LOCUS_06640 822531 820957 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841352.1 protein_id gnl|my_center|LOCUS_06640 823169 822543 gene locus_tag LOCUS_06650 823169 822543 CDS product DUF3823 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053826137.1 protein_id gnl|my_center|LOCUS_06650 825071 823236 gene locus_tag LOCUS_06660 825071 823236 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801846.1 protein_id gnl|my_center|LOCUS_06660 828458 825081 gene locus_tag LOCUS_06670 828458 825081 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291394.1 protein_id gnl|my_center|LOCUS_06670 829675 828719 gene locus_tag LOCUS_06680 829675 828719 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763536.1 protein_id gnl|my_center|LOCUS_06680 830731 830144 gene locus_tag LOCUS_06690 830731 830144 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770321.1 protein_id gnl|my_center|LOCUS_06690 831531 830767 gene locus_tag LOCUS_06700 gene cdaA 831531 830767 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762592.1 protein_id gnl|my_center|LOCUS_06700 832405 831551 gene locus_tag LOCUS_06710 gene folP 832405 831551 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767053.1 protein_id gnl|my_center|LOCUS_06710 832576 834543 gene locus_tag LOCUS_06720 832576 834543 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767054.1 protein_id gnl|my_center|LOCUS_06720 834544 836568 gene locus_tag LOCUS_06730 834544 836568 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202008.1 protein_id gnl|my_center|LOCUS_06730 836674 837972 gene locus_tag LOCUS_06740 836674 837972 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108918.1 protein_id gnl|my_center|LOCUS_06740 838535 839905 gene locus_tag LOCUS_06750 838535 839905 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762587.1 protein_id gnl|my_center|LOCUS_06750 839902 840810 gene locus_tag LOCUS_06760 839902 840810 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202005.1 protein_id gnl|my_center|LOCUS_06760 841652 840990 gene locus_tag LOCUS_06770 841652 840990 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762585.1 protein_id gnl|my_center|LOCUS_06770 842448 841738 gene locus_tag LOCUS_06780 842448 841738 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202003.1 protein_id gnl|my_center|LOCUS_06780 844454 842448 gene locus_tag LOCUS_06790 844454 842448 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762583.1 protein_id gnl|my_center|LOCUS_06790 844727 845734 gene locus_tag LOCUS_06800 844727 845734 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784257.1 protein_id gnl|my_center|LOCUS_06800 847070 846018 gene locus_tag LOCUS_06810 847070 846018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 847906 847082 gene locus_tag LOCUS_06820 847906 847082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 849199 851532 gene locus_tag LOCUS_06830 849199 851532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108170.1 protein_id gnl|my_center|LOCUS_06830 852078 853898 gene locus_tag LOCUS_06840 852078 853898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 853987 855435 gene locus_tag LOCUS_06850 853987 855435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 855453 858623 gene locus_tag LOCUS_06860 855453 858623 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764127.1 protein_id gnl|my_center|LOCUS_06860 858691 860715 gene locus_tag LOCUS_06870 858691 860715 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791678.1 protein_id gnl|my_center|LOCUS_06870 860749 861564 gene locus_tag LOCUS_06880 860749 861564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 861714 863894 gene locus_tag LOCUS_06890 861714 863894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108861.1 protein_id gnl|my_center|LOCUS_06890 863934 866228 gene locus_tag LOCUS_06900 863934 866228 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762490.1 protein_id gnl|my_center|LOCUS_06900 867182 866496 gene locus_tag LOCUS_06910 867182 866496 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769271.1 protein_id gnl|my_center|LOCUS_06910 868507 867236 gene locus_tag LOCUS_06920 868507 867236 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201988.1 protein_id gnl|my_center|LOCUS_06920 869305 868514 gene locus_tag LOCUS_06930 gene ccsA 869305 868514 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201987.1 protein_id gnl|my_center|LOCUS_06930 870546 869302 gene locus_tag LOCUS_06940 870546 869302 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813632.1 protein_id gnl|my_center|LOCUS_06940 872031 870550 gene locus_tag LOCUS_06950 gene nrfA 872031 870550 CDS product ammonia-forming cytochrome c nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201986.1 protein_id gnl|my_center|LOCUS_06950 872672 872085 gene locus_tag LOCUS_06960 gene nrfH 872672 872085 CDS product cytochrome c nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201985.1 protein_id gnl|my_center|LOCUS_06960 873904 876108 gene locus_tag LOCUS_06970 873904 876108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 876129 878510 gene locus_tag LOCUS_06980 876129 878510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 878607 880553 gene locus_tag LOCUS_06990 878607 880553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 881021 881557 gene locus_tag LOCUS_07000 881021 881557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 881706 882278 gene locus_tag LOCUS_07010 881706 882278 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763969.1 protein_id gnl|my_center|LOCUS_07010 882309 882740 gene locus_tag LOCUS_07020 882309 882740 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766887.1 protein_id gnl|my_center|LOCUS_07020 882780 883238 gene locus_tag LOCUS_07030 882780 883238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 883709 884932 gene locus_tag LOCUS_07040 883709 884932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 884958 886112 gene locus_tag LOCUS_07050 884958 886112 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445149.1 protein_id gnl|my_center|LOCUS_07050 886346 886918 gene locus_tag LOCUS_07060 886346 886918 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763969.1 protein_id gnl|my_center|LOCUS_07060 886928 887491 gene locus_tag LOCUS_07070 886928 887491 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763969.1 protein_id gnl|my_center|LOCUS_07070 887607 888023 gene locus_tag LOCUS_07080 887607 888023 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766887.1 protein_id gnl|my_center|LOCUS_07080 888054 888467 gene locus_tag LOCUS_07090 888054 888467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 888625 888906 gene locus_tag LOCUS_07100 888625 888906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 888921 889211 gene locus_tag LOCUS_07110 888921 889211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 889298 889549 gene locus_tag LOCUS_07120 889298 889549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025814668.1 protein_id gnl|my_center|LOCUS_07120 889527 889922 gene locus_tag LOCUS_07130 889527 889922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203317.1 protein_id gnl|my_center|LOCUS_07130 890025 890384 gene locus_tag LOCUS_07140 890025 890384 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007485505.1 protein_id gnl|my_center|LOCUS_07140 891156 890437 gene locus_tag LOCUS_07150 891156 890437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 892081 891161 gene locus_tag LOCUS_07160 892081 891161 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005944378.1 protein_id gnl|my_center|LOCUS_07160 892430 892047 gene locus_tag LOCUS_07170 892430 892047 CDS product mobilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108661.1 protein_id gnl|my_center|LOCUS_07170 893543 892578 gene locus_tag LOCUS_07180 893543 892578 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816488.1 protein_id gnl|my_center|LOCUS_07180 894780 893707 gene locus_tag LOCUS_07190 894780 893707 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816490.1 protein_id gnl|my_center|LOCUS_07190 895073 894786 gene locus_tag LOCUS_07200 895073 894786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 896106 895198 gene locus_tag LOCUS_07210 896106 895198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 896426 896342 gene locus_tag LOCUS_t00130 896426 896342 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 896584 897669 gene locus_tag LOCUS_07220 896584 897669 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791384.1 protein_id gnl|my_center|LOCUS_07220 897821 898996 gene locus_tag LOCUS_07230 897821 898996 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764617.1 protein_id gnl|my_center|LOCUS_07230 899134 902502 gene locus_tag LOCUS_07240 899134 902502 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202182.1 protein_id gnl|my_center|LOCUS_07240 903605 902796 gene locus_tag LOCUS_07250 gene tatC 903605 902796 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760986.1 protein_id gnl|my_center|LOCUS_07250 903832 903608 gene locus_tag LOCUS_07260 gene tatA 903832 903608 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760985.1 protein_id gnl|my_center|LOCUS_07260 906396 903916 gene locus_tag LOCUS_07270 906396 903916 CDS product bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785097.1 protein_id gnl|my_center|LOCUS_07270 907367 906372 gene locus_tag LOCUS_07280 907367 906372 CDS product GSCFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796048.1 protein_id gnl|my_center|LOCUS_07280 910259 907467 gene locus_tag LOCUS_07290 910259 907467 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202178.1 protein_id gnl|my_center|LOCUS_07290 910479 913283 gene locus_tag LOCUS_07300 910479 913283 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769481.1 protein_id gnl|my_center|LOCUS_07300 913388 914974 gene locus_tag LOCUS_07310 913388 914974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 916314 915040 gene locus_tag LOCUS_07320 916314 915040 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202166.1 protein_id gnl|my_center|LOCUS_07320 916914 916660 gene locus_tag LOCUS_07330 916914 916660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 917439 917068 gene locus_tag LOCUS_07340 917439 917068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 917900 917670 gene locus_tag LOCUS_07350 917900 917670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 918802 918230 gene locus_tag LOCUS_07360 918802 918230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 924981 918916 gene locus_tag LOCUS_07370 924981 918916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 925433 925011 gene locus_tag LOCUS_07380 925433 925011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 927481 926210 gene locus_tag LOCUS_07390 927481 926210 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784900.1 protein_id gnl|my_center|LOCUS_07390 928528 927521 gene locus_tag LOCUS_07400 928528 927521 CDS product DUF4435 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784898.1 protein_id gnl|my_center|LOCUS_07400 929355 928525 gene locus_tag LOCUS_07410 929355 928525 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784896.1 protein_id gnl|my_center|LOCUS_07410 929448 930353 gene locus_tag LOCUS_07420 929448 930353 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764292.1 protein_id gnl|my_center|LOCUS_07420 931646 930456 gene locus_tag LOCUS_07430 931646 930456 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202735.1 protein_id gnl|my_center|LOCUS_07430 933057 931699 gene locus_tag LOCUS_07440 933057 931699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 935935 933719 gene locus_tag LOCUS_07450 935935 933719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 937035 935941 gene locus_tag LOCUS_07460 gene meaB 937035 935941 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784891.1 protein_id gnl|my_center|LOCUS_07460 938120 937053 gene locus_tag LOCUS_07470 938120 937053 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796193.1 protein_id gnl|my_center|LOCUS_07470 938661 938260 gene locus_tag LOCUS_07480 938661 938260 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763564.1 protein_id gnl|my_center|LOCUS_07480 939208 938714 gene locus_tag LOCUS_07490 gene greA 939208 938714 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765198.1 protein_id gnl|my_center|LOCUS_07490 940508 939357 gene locus_tag LOCUS_07500 940508 939357 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791376.1 protein_id gnl|my_center|LOCUS_07500 940654 942831 gene locus_tag LOCUS_07510 gene pnp 940654 942831 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791373.1 protein_id gnl|my_center|LOCUS_07510 942967 943527 gene locus_tag LOCUS_07520 942967 943527 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016269926.1 protein_id gnl|my_center|LOCUS_07520 943634 944584 gene locus_tag LOCUS_07530 943634 944584 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791368.1 protein_id gnl|my_center|LOCUS_07530 944821 948156 gene locus_tag LOCUS_07540 944821 948156 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695755.1 protein_id gnl|my_center|LOCUS_07540 948177 949784 gene locus_tag LOCUS_07550 948177 949784 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108353.1 protein_id gnl|my_center|LOCUS_07550 950196 949879 gene locus_tag LOCUS_07560 950196 949879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 950397 950846 gene locus_tag LOCUS_07570 950397 950846 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790451.1 protein_id gnl|my_center|LOCUS_07570 953509 950981 gene locus_tag LOCUS_07580 953509 950981 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784143.1 protein_id gnl|my_center|LOCUS_07580 953921 956191 gene locus_tag LOCUS_07590 953921 956191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 956214 957416 gene locus_tag LOCUS_07600 956214 957416 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767133.1 protein_id gnl|my_center|LOCUS_07600 957428 958462 gene locus_tag LOCUS_07610 957428 958462 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767132.1 protein_id gnl|my_center|LOCUS_07610 958478 961222 gene locus_tag LOCUS_07620 958478 961222 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762511.1 protein_id gnl|my_center|LOCUS_07620 961226 962260 gene locus_tag LOCUS_07630 961226 962260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 962818 962615 gene locus_tag LOCUS_07640 962818 962615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 962796 964382 gene locus_tag LOCUS_07650 962796 964382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 964644 969239 gene locus_tag LOCUS_07660 964644 969239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 969327 971162 gene locus_tag LOCUS_07670 969327 971162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 971165 973642 gene locus_tag LOCUS_07680 971165 973642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 974070 974417 gene locus_tag LOCUS_07690 974070 974417 CDS product DUF3795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032497467.1 protein_id gnl|my_center|LOCUS_07690 975727 974435 gene locus_tag LOCUS_07700 975727 974435 CDS product DUF4010 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767135.1 protein_id gnl|my_center|LOCUS_07700 976247 975774 gene locus_tag LOCUS_07710 976247 975774 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784138.1 protein_id gnl|my_center|LOCUS_07710 977334 976273 gene locus_tag LOCUS_07720 977334 976273 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108880.1 protein_id gnl|my_center|LOCUS_07720 977668 977501 gene locus_tag LOCUS_07730 977668 977501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 978671 977715 gene locus_tag LOCUS_07740 gene prfB 978671 977715 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108912216.1 protein_id gnl|my_center|LOCUS_07740 978962 981880 gene locus_tag LOCUS_07750 978962 981880 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303123.1 protein_id gnl|my_center|LOCUS_07750 983778 981970 gene locus_tag LOCUS_07760 983778 981970 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784128.1 protein_id gnl|my_center|LOCUS_07760 983868 984935 gene locus_tag LOCUS_07770 983868 984935 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767146.1 protein_id gnl|my_center|LOCUS_07770 986311 985124 gene locus_tag LOCUS_07780 986311 985124 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201946.1 protein_id gnl|my_center|LOCUS_07780 987442 986312 gene locus_tag LOCUS_07790 987442 986312 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201945.1 protein_id gnl|my_center|LOCUS_07790 989946 987466 gene locus_tag LOCUS_07800 989946 987466 CDS product DUF4965 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658082.1 protein_id gnl|my_center|LOCUS_07800 991928 989997 gene locus_tag LOCUS_07810 991928 989997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 994026 993301 gene locus_tag LOCUS_07820 994026 993301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 994272 995072 gene locus_tag LOCUS_07830 gene rsmA 994272 995072 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990848.1 protein_id gnl|my_center|LOCUS_07830 996637 995270 gene locus_tag LOCUS_07840 gene mobV 996637 995270 CDS product MobV family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202347.1 protein_id gnl|my_center|LOCUS_07840 997623 997231 gene locus_tag LOCUS_07850 997623 997231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 998873 997641 gene locus_tag LOCUS_07860 998873 997641 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765343.1 protein_id gnl|my_center|LOCUS_07860 999144 1001666 gene locus_tag LOCUS_07870 999144 1001666 CDS product glutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108848.1 protein_id gnl|my_center|LOCUS_07870 1001767 1004931 gene locus_tag LOCUS_07880 1001767 1004931 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291394.1 protein_id gnl|my_center|LOCUS_07880 1004939 1006816 gene locus_tag LOCUS_07890 1004939 1006816 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801846.1 protein_id gnl|my_center|LOCUS_07890 1006836 1007540 gene locus_tag LOCUS_07900 1006836 1007540 CDS product DUF3823 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291395.1 protein_id gnl|my_center|LOCUS_07900 1008726 1007620 gene locus_tag LOCUS_07910 1008726 1007620 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784057.1 protein_id gnl|my_center|LOCUS_07910 1009838 1008747 gene locus_tag LOCUS_07920 1009838 1008747 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767655.1 protein_id gnl|my_center|LOCUS_07920 1010039 1012102 gene locus_tag LOCUS_07930 1010039 1012102 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784055.1 protein_id gnl|my_center|LOCUS_07930 1012117 1014150 gene locus_tag LOCUS_07940 1012117 1014150 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658063.1 protein_id gnl|my_center|LOCUS_07940 1014195 1015991 gene locus_tag LOCUS_07950 1014195 1015991 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201936.1 protein_id gnl|my_center|LOCUS_07950 1016009 1019632 gene locus_tag LOCUS_07960 1016009 1019632 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201938.1 protein_id gnl|my_center|LOCUS_07960 1019797 1021326 gene locus_tag LOCUS_07970 1019797 1021326 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922507.1 protein_id gnl|my_center|LOCUS_07970 1021519 1023717 gene locus_tag LOCUS_07980 1021519 1023717 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767356.1 protein_id gnl|my_center|LOCUS_07980 1023744 1025237 gene locus_tag LOCUS_07990 1023744 1025237 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785076.1 protein_id gnl|my_center|LOCUS_07990 1025261 1026388 gene locus_tag LOCUS_08000 1025261 1026388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 1026405 1027958 gene locus_tag LOCUS_08010 1026405 1027958 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108631.1 protein_id gnl|my_center|LOCUS_08010 1027974 1029584 gene locus_tag LOCUS_08020 1027974 1029584 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841352.1 protein_id gnl|my_center|LOCUS_08020 1029612 1031021 gene locus_tag LOCUS_08030 1029612 1031021 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118042.1 protein_id gnl|my_center|LOCUS_08030 1031037 1032707 gene locus_tag LOCUS_08040 1031037 1032707 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062694127.1 protein_id gnl|my_center|LOCUS_08040 1032942 1034981 gene locus_tag LOCUS_08050 1032942 1034981 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767349.1 protein_id gnl|my_center|LOCUS_08050 1036438 1035398 gene locus_tag LOCUS_08060 1036438 1035398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 1036739 1036500 gene locus_tag LOCUS_08070 1036739 1036500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08070 1037083 1036886 gene locus_tag LOCUS_08080 1037083 1036886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 1038429 1037104 gene locus_tag LOCUS_08090 1038429 1037104 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203561.1 protein_id gnl|my_center|LOCUS_08090 1040584 1038443 gene locus_tag LOCUS_08100 1040584 1038443 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791796.1 protein_id gnl|my_center|LOCUS_08100 1041541 1040681 gene locus_tag LOCUS_08110 1041541 1040681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 1043700 1041553 gene locus_tag LOCUS_08120 1043700 1041553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 1044878 1043703 gene locus_tag LOCUS_08130 1044878 1043703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 1045649 1044897 gene locus_tag LOCUS_08140 1045649 1044897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 1046542 1045646 gene locus_tag LOCUS_08150 1046542 1045646 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661347.1 protein_id gnl|my_center|LOCUS_08150 1047761 1046544 gene locus_tag LOCUS_08160 1047761 1046544 CDS product erythromycin esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203592.1 protein_id gnl|my_center|LOCUS_08160 1048270 1047956 gene locus_tag LOCUS_08170 1048270 1047956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 1048719 1048426 gene locus_tag LOCUS_08180 1048719 1048426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 1050205 1049054 gene locus_tag LOCUS_08190 1050205 1049054 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203566.1 protein_id gnl|my_center|LOCUS_08190 1050698 1050384 gene locus_tag LOCUS_08200 1050698 1050384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 1051104 1050802 gene locus_tag LOCUS_08210 1051104 1050802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 1052327 1051101 gene locus_tag LOCUS_08220 1052327 1051101 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203566.1 protein_id gnl|my_center|LOCUS_08220 1052737 1052420 gene locus_tag LOCUS_08230 1052737 1052420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 1053989 1053513 gene locus_tag LOCUS_08240 1053989 1053513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 1055498 1054005 gene locus_tag LOCUS_08250 1055498 1054005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 1056393 1055986 gene locus_tag LOCUS_08260 1056393 1055986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 1057319 1056534 gene locus_tag LOCUS_08270 1057319 1056534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 1057610 1058818 gene locus_tag LOCUS_08280 1057610 1058818 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200755826.1 protein_id gnl|my_center|LOCUS_08280 1058850 1059212 gene locus_tag LOCUS_08290 1058850 1059212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108658.1 protein_id gnl|my_center|LOCUS_08290 1059564 1060769 gene locus_tag LOCUS_08300 1059564 1060769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 1061028 1061966 gene locus_tag LOCUS_08310 1061028 1061966 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816488.1 protein_id gnl|my_center|LOCUS_08310 1062143 1062499 gene locus_tag LOCUS_08320 1062143 1062499 CDS product mobilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108661.1 protein_id gnl|my_center|LOCUS_08320 1062499 1063437 gene locus_tag LOCUS_08330 1062499 1063437 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005944378.1 protein_id gnl|my_center|LOCUS_08330 1063705 1063983 gene locus_tag LOCUS_08340 1063705 1063983 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118195647.1 protein_id gnl|my_center|LOCUS_08340 1065081 1064005 gene locus_tag LOCUS_08350 1065081 1064005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 1065496 1065035 gene locus_tag LOCUS_08360 1065496 1065035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964284.1 protein_id gnl|my_center|LOCUS_08360 1065796 1068114 gene locus_tag LOCUS_08370 1065796 1068114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 1068126 1068344 gene locus_tag LOCUS_08380 1068126 1068344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 1068373 1068762 gene locus_tag LOCUS_08390 1068373 1068762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 1068912 1069268 gene locus_tag LOCUS_08400 1068912 1069268 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007478806.1 protein_id gnl|my_center|LOCUS_08400 1069544 1070176 gene locus_tag LOCUS_08410 1069544 1070176 CDS product BfmA/BtgA family mobilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202090.1 protein_id gnl|my_center|LOCUS_08410 1070180 1071124 gene locus_tag LOCUS_08420 1070180 1071124 CDS product DUF5712 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202089.1 protein_id gnl|my_center|LOCUS_08420 1071697 1072776 gene locus_tag LOCUS_08430 1071697 1072776 CDS product IS110-like element ISEc45 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000555401.1 protein_id gnl|my_center|LOCUS_08430 1073425 1073709 gene locus_tag LOCUS_08440 1073425 1073709 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202678.1 protein_id gnl|my_center|LOCUS_08440 1073706 1073984 gene locus_tag LOCUS_08450 1073706 1073984 CDS product DUF3876 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108233.1 protein_id gnl|my_center|LOCUS_08450 1074332 1075363 gene locus_tag LOCUS_08460 1074332 1075363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 1076390 1075413 gene locus_tag LOCUS_08470 1076390 1075413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 1076562 1077125 gene locus_tag LOCUS_08480 1076562 1077125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 1077131 1077553 gene locus_tag LOCUS_08490 1077131 1077553 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107123.1 protein_id gnl|my_center|LOCUS_08490 1078900 1077896 gene locus_tag LOCUS_08500 1078900 1077896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 1081159 1079462 gene locus_tag LOCUS_08510 1081159 1079462 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767669.1 protein_id gnl|my_center|LOCUS_08510 1082758 1081178 gene locus_tag LOCUS_08520 1082758 1081178 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841352.1 protein_id gnl|my_center|LOCUS_08520 1085283 1082773 gene locus_tag LOCUS_08530 1085283 1082773 CDS product glutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108848.1 protein_id gnl|my_center|LOCUS_08530 1085753 1085553 gene locus_tag LOCUS_08540 1085753 1085553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 1090195 1086197 gene locus_tag LOCUS_08550 1090195 1086197 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201933.1 protein_id gnl|my_center|LOCUS_08550 1091562 1090255 gene locus_tag LOCUS_08560 1091562 1090255 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108845.1 protein_id gnl|my_center|LOCUS_08560 1092119 1091559 gene locus_tag LOCUS_08570 1092119 1091559 CDS product DUF4292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784040.1 protein_id gnl|my_center|LOCUS_08570 1093867 1092116 gene locus_tag LOCUS_08580 1093867 1092116 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201932.1 protein_id gnl|my_center|LOCUS_08580 1094335 1093904 gene locus_tag LOCUS_08590 gene dut 1094335 1093904 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767650.1 protein_id gnl|my_center|LOCUS_08590 1094476 1095801 gene locus_tag LOCUS_08600 1094476 1095801 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555756.1 protein_id gnl|my_center|LOCUS_08600 1096771 1095773 gene locus_tag LOCUS_08610 1096771 1095773 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784031.1 protein_id gnl|my_center|LOCUS_08610 1097622 1096804 gene locus_tag LOCUS_08620 1097622 1096804 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108841.1 protein_id gnl|my_center|LOCUS_08620 1097884 1098387 gene locus_tag LOCUS_08630 1097884 1098387 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763722.1 protein_id gnl|my_center|LOCUS_08630 1098952 1099449 gene locus_tag LOCUS_08640 1098952 1099449 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796726.1 protein_id gnl|my_center|LOCUS_08640 1099555 1100484 gene locus_tag LOCUS_08650 gene rsmH 1099555 1100484 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763720.1 protein_id gnl|my_center|LOCUS_08650 1100501 1100857 gene locus_tag LOCUS_08660 1100501 1100857 CDS product FtsL-like putative cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763719.1 protein_id gnl|my_center|LOCUS_08660 1100944 1103046 gene locus_tag LOCUS_08670 1100944 1103046 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796729.1 protein_id gnl|my_center|LOCUS_08670 1103098 1104552 gene locus_tag LOCUS_08680 1103098 1104552 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108839.1 protein_id gnl|my_center|LOCUS_08680 1104560 1105828 gene locus_tag LOCUS_08690 gene mraY 1104560 1105828 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763716.1 protein_id gnl|my_center|LOCUS_08690 1105932 1107266 gene locus_tag LOCUS_08700 gene murD 1105932 1107266 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763714.1 protein_id gnl|my_center|LOCUS_08700 1107280 1108572 gene locus_tag LOCUS_08710 1107280 1108572 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784004.1 protein_id gnl|my_center|LOCUS_08710 1108579 1109703 gene locus_tag LOCUS_08720 gene murG 1108579 1109703 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784003.1 protein_id gnl|my_center|LOCUS_08720 1109726 1111117 gene locus_tag LOCUS_08730 gene murC 1109726 1111117 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763710.1 protein_id gnl|my_center|LOCUS_08730 1111166 1111906 gene locus_tag LOCUS_08740 1111166 1111906 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108836.1 protein_id gnl|my_center|LOCUS_08740 1111992 1113431 gene locus_tag LOCUS_08750 gene ftsA 1111992 1113431 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783999.1 protein_id gnl|my_center|LOCUS_08750 1113465 1114775 gene locus_tag LOCUS_08760 gene ftsZ 1113465 1114775 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783997.1 protein_id gnl|my_center|LOCUS_08760 1114876 1115325 gene locus_tag LOCUS_08770 1114876 1115325 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763705.1 protein_id gnl|my_center|LOCUS_08770 1116319 1115528 gene locus_tag LOCUS_08780 1116319 1115528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202894.1 protein_id gnl|my_center|LOCUS_08780 1116856 1117788 gene locus_tag LOCUS_08790 1116856 1117788 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203118.1 protein_id gnl|my_center|LOCUS_08790 1118867 1118139 gene locus_tag LOCUS_08800 gene recO 1118867 1118139 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108822.1 protein_id gnl|my_center|LOCUS_08800 1119155 1119227 gene locus_tag LOCUS_t00140 1119155 1119227 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1119267 1119521 gene locus_tag LOCUS_08810 gene rpsT 1119267 1119521 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767624.1 protein_id gnl|my_center|LOCUS_08810 1119721 1121691 gene locus_tag LOCUS_08820 gene gyrB 1119721 1121691 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783987.1 protein_id gnl|my_center|LOCUS_08820 1122601 1122020 gene locus_tag LOCUS_08830 1122601 1122020 CDS product DUF3109 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763683.1 protein_id gnl|my_center|LOCUS_08830 1124407 1122611 gene locus_tag LOCUS_08840 1124407 1122611 CDS product histidine kinase dimerization/phospho-acceptor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201926.1 protein_id gnl|my_center|LOCUS_08840 1125638 1124547 gene locus_tag LOCUS_08850 1125638 1124547 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801880.1 protein_id gnl|my_center|LOCUS_08850 1127287 1125773 gene locus_tag LOCUS_08860 gene gpmI 1127287 1125773 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783975.1 protein_id gnl|my_center|LOCUS_08860 1127565 1128491 gene locus_tag LOCUS_08870 1127565 1128491 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783972.1 protein_id gnl|my_center|LOCUS_08870 1128515 1128820 gene locus_tag LOCUS_08880 1128515 1128820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 1128813 1130540 gene locus_tag LOCUS_08890 1128813 1130540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 1130566 1132029 gene locus_tag LOCUS_08900 1130566 1132029 CDS product DUF5723 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767614.1 protein_id gnl|my_center|LOCUS_08900 1132820 1132215 gene locus_tag LOCUS_08910 1132820 1132215 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763678.1 protein_id gnl|my_center|LOCUS_08910 1135349 1133145 gene locus_tag LOCUS_08920 1135349 1133145 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767612.1 protein_id gnl|my_center|LOCUS_08920 1135559 1141582 gene locus_tag LOCUS_08930 1135559 1141582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 1141711 1144308 gene locus_tag LOCUS_08940 1141711 1144308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 1144384 1150344 gene locus_tag LOCUS_08950 1144384 1150344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 1150389 1156349 gene locus_tag LOCUS_08960 1150389 1156349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 1156582 1159029 gene locus_tag LOCUS_08970 1156582 1159029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 1159613 1161529 gene locus_tag LOCUS_08980 1159613 1161529 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840776.1 protein_id gnl|my_center|LOCUS_08980 1161553 1161969 gene locus_tag LOCUS_08990 1161553 1161969 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763608.1 protein_id gnl|my_center|LOCUS_08990 1162560 1161988 gene locus_tag LOCUS_09000 1162560 1161988 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802121.1 protein_id gnl|my_center|LOCUS_09000 1163177 1162938 gene locus_tag LOCUS_09010 1163177 1162938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 1164160 1163285 gene locus_tag LOCUS_09020 1164160 1163285 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108181.1 protein_id gnl|my_center|LOCUS_09020 1164666 1164346 gene locus_tag LOCUS_09030 1164666 1164346 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767610.1 protein_id gnl|my_center|LOCUS_09030 1166615 1164786 gene locus_tag LOCUS_09040 1166615 1164786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 1167915 1166704 gene locus_tag LOCUS_09050 1167915 1166704 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767609.1 protein_id gnl|my_center|LOCUS_09050 1169275 1167929 gene locus_tag LOCUS_09060 gene sufD 1169275 1167929 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767608.1 protein_id gnl|my_center|LOCUS_09060 1170068 1169316 gene locus_tag LOCUS_09070 gene sufC 1170068 1169316 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783928.1 protein_id gnl|my_center|LOCUS_09070 1171623 1170118 gene locus_tag LOCUS_09080 gene sufB 1171623 1170118 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767607.1 protein_id gnl|my_center|LOCUS_09080 1172129 1171623 gene locus_tag LOCUS_09090 1172129 1171623 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767606.1 protein_id gnl|my_center|LOCUS_09090 1175315 1172229 gene locus_tag LOCUS_09100 gene infB 1175315 1172229 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108813.1 protein_id gnl|my_center|LOCUS_09100 1176620 1175361 gene locus_tag LOCUS_09110 gene nusA 1176620 1175361 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763665.1 protein_id gnl|my_center|LOCUS_09110 1177090 1176623 gene locus_tag LOCUS_09120 gene rimP 1177090 1176623 CDS product ribosome assembly cofactor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783918.1 protein_id gnl|my_center|LOCUS_09120 1178029 1177343 gene locus_tag LOCUS_09130 1178029 1177343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937679.1 protein_id gnl|my_center|LOCUS_09130 1178920 1178462 gene locus_tag LOCUS_09140 1178920 1178462 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767437.1 protein_id gnl|my_center|LOCUS_09140 1179441 1179716 gene locus_tag LOCUS_09150 1179441 1179716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 1179691 1180452 gene locus_tag LOCUS_09160 1179691 1180452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202894.1 protein_id gnl|my_center|LOCUS_09160 1183129 1180604 gene locus_tag LOCUS_09170 1183129 1180604 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584086.1 protein_id gnl|my_center|LOCUS_09170 1184400 1183918 gene locus_tag LOCUS_09180 gene trxA 1184400 1183918 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788325.1 protein_id gnl|my_center|LOCUS_09180 1185456 1184422 gene locus_tag LOCUS_09190 1185456 1184422 CDS product TQO small subunit DoxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202970.1 protein_id gnl|my_center|LOCUS_09190 1185684 1185469 gene locus_tag LOCUS_09200 1185684 1185469 CDS product DUF6132 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788321.1 protein_id gnl|my_center|LOCUS_09200 1186286 1186038 gene locus_tag LOCUS_09210 1186286 1186038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 1186540 1187058 gene locus_tag LOCUS_09220 1186540 1187058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09220 1187708 1187463 gene locus_tag LOCUS_09230 1187708 1187463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 1188551 1187712 gene locus_tag LOCUS_09240 1188551 1187712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 1189180 1188800 gene locus_tag LOCUS_09250 1189180 1188800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 1189365 1189201 gene locus_tag LOCUS_09260 1189365 1189201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 1189679 1189425 gene locus_tag LOCUS_09270 1189679 1189425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 1189810 1189676 gene locus_tag LOCUS_09280 1189810 1189676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 1190152 1189898 gene locus_tag LOCUS_09290 1190152 1189898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812455.1 protein_id gnl|my_center|LOCUS_09290 1190666 1190256 gene locus_tag LOCUS_09300 1190666 1190256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 1191591 1190776 gene locus_tag LOCUS_09310 1191591 1190776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 1191613 1191816 gene locus_tag LOCUS_09320 1191613 1191816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 1192237 1191968 gene locus_tag LOCUS_09330 1192237 1191968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 1193765 1192278 gene locus_tag LOCUS_09340 1193765 1192278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 1194250 1194071 gene locus_tag LOCUS_09350 1194250 1194071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 1198122 1194772 gene locus_tag LOCUS_09360 1198122 1194772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 1201479 1198207 gene locus_tag LOCUS_09370 1201479 1198207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 1202830 1201664 gene locus_tag LOCUS_09380 1202830 1201664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 1203118 1203513 gene locus_tag LOCUS_09390 1203118 1203513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801898.1 protein_id gnl|my_center|LOCUS_09390 1204376 1203669 gene locus_tag LOCUS_09400 1204376 1203669 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796789.1 protein_id gnl|my_center|LOCUS_09400 1204502 1205242 gene locus_tag LOCUS_09410 1204502 1205242 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801900.1 protein_id gnl|my_center|LOCUS_09410 1205978 1205496 gene locus_tag LOCUS_09420 1205978 1205496 CDS product DUF4252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801902.1 protein_id gnl|my_center|LOCUS_09420 1206493 1205978 gene locus_tag LOCUS_09430 1206493 1205978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769198.1 protein_id gnl|my_center|LOCUS_09430 1206986 1206477 gene locus_tag LOCUS_09440 1206986 1206477 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763658.1 protein_id gnl|my_center|LOCUS_09440 1207820 1207047 gene locus_tag LOCUS_09450 gene argB 1207820 1207047 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767599.1 protein_id gnl|my_center|LOCUS_09450 1209865 1207973 gene locus_tag LOCUS_09460 gene speA 1209865 1207973 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783873.1 protein_id gnl|my_center|LOCUS_09460 1210512 1209985 gene locus_tag LOCUS_09470 1210512 1209985 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767597.1 protein_id gnl|my_center|LOCUS_09470 1211188 1210586 gene locus_tag LOCUS_09480 1211188 1210586 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783862.1 protein_id gnl|my_center|LOCUS_09480 1211303 1211935 gene locus_tag LOCUS_09490 1211303 1211935 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108811.1 protein_id gnl|my_center|LOCUS_09490 1213140 1211959 gene locus_tag LOCUS_09500 1213140 1211959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201898.1 protein_id gnl|my_center|LOCUS_09500 1215034 1213202 gene locus_tag LOCUS_09510 1215034 1213202 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783855.1 protein_id gnl|my_center|LOCUS_09510 1215241 1216080 gene locus_tag LOCUS_09520 1215241 1216080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 1217904 1217041 gene locus_tag LOCUS_09530 1217904 1217041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 1218936 1217959 gene locus_tag LOCUS_09540 1218936 1217959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 1220162 1218972 gene locus_tag LOCUS_09550 1220162 1218972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 1220244 1221302 gene locus_tag LOCUS_09560 1220244 1221302 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257269.1 protein_id gnl|my_center|LOCUS_09560 1221394 1222455 gene locus_tag LOCUS_09570 1221394 1222455 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257269.1 protein_id gnl|my_center|LOCUS_09570 1222966 1224945 gene locus_tag LOCUS_09580 1222966 1224945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 1228260 1225117 gene locus_tag LOCUS_09590 1228260 1225117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 1229705 1228296 gene locus_tag LOCUS_09600 1229705 1228296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 1230690 1229821 gene locus_tag LOCUS_09610 1230690 1229821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 1232021 1230810 gene locus_tag LOCUS_09620 1232021 1230810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 1233086 1232073 gene locus_tag LOCUS_09630 1233086 1232073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 1234006 1233221 gene locus_tag LOCUS_09640 1234006 1233221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 1236603 1234684 gene locus_tag LOCUS_09650 1236603 1234684 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303156.1 protein_id gnl|my_center|LOCUS_09650 1236742 1237872 gene locus_tag LOCUS_09660 1236742 1237872 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963743.1 protein_id gnl|my_center|LOCUS_09660 1238556 1237873 gene locus_tag LOCUS_09670 1238556 1237873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 1238556 1238747 gene locus_tag LOCUS_09680 1238556 1238747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 1240127 1239066 gene locus_tag LOCUS_09690 1240127 1239066 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225342.1 protein_id gnl|my_center|LOCUS_09690 1240998 1240234 gene locus_tag LOCUS_09700 1240998 1240234 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790934.1 protein_id gnl|my_center|LOCUS_09700 1242197 1241160 gene locus_tag LOCUS_09710 1242197 1241160 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108790.1 protein_id gnl|my_center|LOCUS_09710 1242806 1242201 gene locus_tag LOCUS_09720 1242806 1242201 CDS product DUF4254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964557.1 protein_id gnl|my_center|LOCUS_09720 1243060 1244139 gene locus_tag LOCUS_09730 gene pdxB 1243060 1244139 CDS product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201894.1 protein_id gnl|my_center|LOCUS_09730 1244683 1244111 gene locus_tag LOCUS_09740 gene purN 1244683 1244111 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108788.1 protein_id gnl|my_center|LOCUS_09740 1244833 1245069 gene locus_tag LOCUS_09750 1244833 1245069 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291965.1 protein_id gnl|my_center|LOCUS_09750 1245085 1246347 gene locus_tag LOCUS_09760 gene fabF 1245085 1246347 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201893.1 protein_id gnl|my_center|LOCUS_09760 1246352 1247233 gene locus_tag LOCUS_09770 gene rnc 1246352 1247233 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108787.1 protein_id gnl|my_center|LOCUS_09770 1247262 1248203 gene locus_tag LOCUS_09780 1247262 1248203 CDS product glycosyltransferase family 10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487428.1 protein_id gnl|my_center|LOCUS_09780 1249227 1248211 gene locus_tag LOCUS_09790 1249227 1248211 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767561.1 protein_id gnl|my_center|LOCUS_09790 1249549 1251057 gene locus_tag LOCUS_09800 1249549 1251057 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783832.1 protein_id gnl|my_center|LOCUS_09800 1252260 1251187 gene locus_tag LOCUS_09810 gene mnmA 1252260 1251187 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813829.1 protein_id gnl|my_center|LOCUS_09810 1252312 1255305 gene locus_tag LOCUS_09820 1252312 1255305 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201890.1 protein_id gnl|my_center|LOCUS_09820 1255350 1256171 gene locus_tag LOCUS_09830 1255350 1256171 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201882.1 protein_id gnl|my_center|LOCUS_09830 1256295 1258232 gene locus_tag LOCUS_09840 1256295 1258232 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784143.1 protein_id gnl|my_center|LOCUS_09840 1258335 1259810 gene locus_tag LOCUS_09850 gene cysS 1258335 1259810 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291350.1 protein_id gnl|my_center|LOCUS_09850 1260523 1262820 gene locus_tag LOCUS_09860 1260523 1262820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 1263306 1263710 gene locus_tag LOCUS_09870 1263306 1263710 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767551.1 protein_id gnl|my_center|LOCUS_09870 1264575 1263700 gene locus_tag LOCUS_09880 1264575 1263700 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762943.1 protein_id gnl|my_center|LOCUS_09880 1266427 1264526 gene locus_tag LOCUS_09890 1266427 1264526 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108779.1 protein_id gnl|my_center|LOCUS_09890 1266744 1267904 gene locus_tag LOCUS_09900 1266744 1267904 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783796.1 protein_id gnl|my_center|LOCUS_09900 1267931 1271134 gene locus_tag LOCUS_09910 1267931 1271134 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783792.1 protein_id gnl|my_center|LOCUS_09910 1271174 1272559 gene locus_tag LOCUS_09920 1271174 1272559 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783789.1 protein_id gnl|my_center|LOCUS_09920 1272650 1273420 gene locus_tag LOCUS_09930 gene lpxA 1272650 1273420 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762937.1 protein_id gnl|my_center|LOCUS_09930 1275337 1274348 gene locus_tag LOCUS_09940 1275337 1274348 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767372.1 protein_id gnl|my_center|LOCUS_09940 1276893 1275358 gene locus_tag LOCUS_09950 1276893 1275358 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767373.1 protein_id gnl|my_center|LOCUS_09950 1277120 1277530 gene locus_tag LOCUS_09960 1277120 1277530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761508.1 protein_id gnl|my_center|LOCUS_09960 1279981 1277663 gene locus_tag LOCUS_09970 1279981 1277663 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107290.1 protein_id gnl|my_center|LOCUS_09970 1280801 1280004 gene locus_tag LOCUS_09980 1280801 1280004 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766005.1 protein_id gnl|my_center|LOCUS_09980 1281490 1282995 gene locus_tag LOCUS_09990 1281490 1282995 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108622.1 protein_id gnl|my_center|LOCUS_09990 1284923 1283412 gene locus_tag LOCUS_10000 1284923 1283412 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784504.1 protein_id gnl|my_center|LOCUS_10000 1288093 1284944 gene locus_tag LOCUS_10010 1288093 1284944 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_10010 1289921 1288446 gene locus_tag LOCUS_10020 1289921 1288446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 1290979 1289945 gene locus_tag LOCUS_10030 1290979 1289945 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767698.1 protein_id gnl|my_center|LOCUS_10030 1292546 1291179 gene locus_tag LOCUS_10040 1292546 1291179 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767366.1 protein_id gnl|my_center|LOCUS_10040 1293071 1294153 gene locus_tag LOCUS_10050 1293071 1294153 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766357.1 protein_id gnl|my_center|LOCUS_10050 1298810 1294866 gene locus_tag LOCUS_10060 1298810 1294866 CDS product hybrid sensor histidine kinase/response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108527.1 protein_id gnl|my_center|LOCUS_10060 1299776 1299123 gene locus_tag LOCUS_10070 1299776 1299123 CDS product carbohydrate-binding family 9-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762936.1 protein_id gnl|my_center|LOCUS_10070 1299877 1300812 gene locus_tag LOCUS_10080 1299877 1300812 CDS product tRNA-dihydrouridine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767537.1 protein_id gnl|my_center|LOCUS_10080 1301530 1301087 gene locus_tag LOCUS_10090 1301530 1301087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762925.1 protein_id gnl|my_center|LOCUS_10090 1302964 1301696 gene locus_tag LOCUS_10100 1302964 1301696 CDS product DUF2851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769170.1 protein_id gnl|my_center|LOCUS_10100 1303049 1303777 gene locus_tag LOCUS_10110 gene dapB 1303049 1303777 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783772.1 protein_id gnl|my_center|LOCUS_10110 1303797 1305227 gene locus_tag LOCUS_10120 gene lepB 1303797 1305227 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108766.1 protein_id gnl|my_center|LOCUS_10120 1305365 1306198 gene locus_tag LOCUS_10130 gene lepB 1305365 1306198 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783767.1 protein_id gnl|my_center|LOCUS_10130 1306213 1306836 gene locus_tag LOCUS_10140 1306213 1306836 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783764.1 protein_id gnl|my_center|LOCUS_10140 1307060 1307584 gene locus_tag LOCUS_10150 1307060 1307584 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760954.1 protein_id gnl|my_center|LOCUS_10150 1307713 1308699 gene locus_tag LOCUS_10160 1307713 1308699 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785220.1 protein_id gnl|my_center|LOCUS_10160 1308856 1312161 gene locus_tag LOCUS_10170 1308856 1312161 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658407.1 protein_id gnl|my_center|LOCUS_10170 1312175 1313842 gene locus_tag LOCUS_10180 1312175 1313842 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769526.1 protein_id gnl|my_center|LOCUS_10180 1313869 1316097 gene locus_tag LOCUS_10190 1313869 1316097 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918421.1 protein_id gnl|my_center|LOCUS_10190 1316101 1318089 gene locus_tag LOCUS_10200 1316101 1318089 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108029.1 protein_id gnl|my_center|LOCUS_10200 1318154 1320349 gene locus_tag LOCUS_10210 1318154 1320349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 1320489 1322747 gene locus_tag LOCUS_10220 1320489 1322747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 1323749 1324312 gene locus_tag LOCUS_10230 1323749 1324312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 1324299 1324844 gene locus_tag LOCUS_10240 1324299 1324844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 1325083 1326717 gene locus_tag LOCUS_10250 1325083 1326717 CDS product DUF6377 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761694.1 protein_id gnl|my_center|LOCUS_10250 1326871 1327356 gene locus_tag LOCUS_10260 1326871 1327356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 1327719 1330631 gene locus_tag LOCUS_10270 1327719 1330631 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798907.1 protein_id gnl|my_center|LOCUS_10270 1330717 1332354 gene locus_tag LOCUS_10280 1330717 1332354 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789572.1 protein_id gnl|my_center|LOCUS_10280 1332467 1333753 gene locus_tag LOCUS_10290 1332467 1333753 CDS product histidine-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009040027.1 protein_id gnl|my_center|LOCUS_10290 1334996 1333872 gene locus_tag LOCUS_10300 1334996 1333872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 1336572 1335040 gene locus_tag LOCUS_10310 1336572 1335040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 1337408 1336629 gene locus_tag LOCUS_10320 1337408 1336629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 1339980 1338346 gene locus_tag LOCUS_10330 1339980 1338346 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695757.1 protein_id gnl|my_center|LOCUS_10330 1341950 1340715 gene locus_tag LOCUS_10340 1341950 1340715 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108756.1 protein_id gnl|my_center|LOCUS_10340 1342046 1342588 gene locus_tag LOCUS_10350 1342046 1342588 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762909.1 protein_id gnl|my_center|LOCUS_10350 1342585 1343190 gene locus_tag LOCUS_10360 1342585 1343190 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783748.1 protein_id gnl|my_center|LOCUS_10360 1343178 1344104 gene locus_tag LOCUS_10370 1343178 1344104 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762907.1 protein_id gnl|my_center|LOCUS_10370 1344349 1345404 gene locus_tag LOCUS_10380 1344349 1345404 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108754.1 protein_id gnl|my_center|LOCUS_10380 1345661 1347559 gene locus_tag LOCUS_10390 1345661 1347559 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108753.1 protein_id gnl|my_center|LOCUS_10390 1347867 1348667 gene locus_tag LOCUS_10400 1347867 1348667 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783741.1 protein_id gnl|my_center|LOCUS_10400 1350768 1348681 gene locus_tag LOCUS_10410 1350768 1348681 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201873.1 protein_id gnl|my_center|LOCUS_10410 1352198 1350843 gene locus_tag LOCUS_10420 1352198 1350843 CDS product TIGR00341 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762895.1 protein_id gnl|my_center|LOCUS_10420 1353646 1352201 gene locus_tag LOCUS_10430 1353646 1352201 CDS product polysaccharide biosynthesis C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108742.1 protein_id gnl|my_center|LOCUS_10430 1354729 1353695 gene locus_tag LOCUS_10440 gene ruvB 1354729 1353695 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783731.1 protein_id gnl|my_center|LOCUS_10440 1355176 1354904 gene locus_tag LOCUS_10450 1355176 1354904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 1356142 1355198 gene locus_tag LOCUS_10460 1356142 1355198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 1357354 1356176 gene locus_tag LOCUS_10470 1357354 1356176 CDS product 4Fe-4S cluster-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460830.1 protein_id gnl|my_center|LOCUS_10470 1359785 1357941 gene locus_tag LOCUS_10480 1359785 1357941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 1361432 1360779 gene locus_tag LOCUS_10490 1361432 1360779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 1362255 1361551 gene locus_tag LOCUS_10500 1362255 1361551 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783729.1 protein_id gnl|my_center|LOCUS_10500 1362388 1363392 gene locus_tag LOCUS_10510 1362388 1363392 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796268.1 protein_id gnl|my_center|LOCUS_10510 1363408 1364640 gene locus_tag LOCUS_10520 1363408 1364640 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783728.1 protein_id gnl|my_center|LOCUS_10520 1364655 1365071 gene locus_tag LOCUS_10530 gene ybeY 1364655 1365071 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108739.1 protein_id gnl|my_center|LOCUS_10530 1366223 1365333 gene locus_tag LOCUS_10540 1366223 1365333 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055229865.1 protein_id gnl|my_center|LOCUS_10540 1366367 1368379 gene locus_tag LOCUS_10550 1366367 1368379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 1368440 1370314 gene locus_tag LOCUS_10560 gene mnmG 1368440 1370314 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783704.1 protein_id gnl|my_center|LOCUS_10560 1370365 1370895 gene locus_tag LOCUS_10570 1370365 1370895 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762874.1 protein_id gnl|my_center|LOCUS_10570 1371149 1372969 gene locus_tag LOCUS_10580 gene uvrC 1371149 1372969 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783702.1 protein_id gnl|my_center|LOCUS_10580 1373138 1373590 gene locus_tag LOCUS_10590 gene dtd 1373138 1373590 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796976.1 protein_id gnl|my_center|LOCUS_10590 1373590 1373928 gene locus_tag LOCUS_10600 1373590 1373928 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762871.1 protein_id gnl|my_center|LOCUS_10600 1373915 1374817 gene locus_tag LOCUS_10610 gene deoC 1373915 1374817 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762870.1 protein_id gnl|my_center|LOCUS_10610 1375586 1376296 gene locus_tag LOCUS_10620 1375586 1376296 CDS product DUF1266 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801982.1 protein_id gnl|my_center|LOCUS_10620 1377078 1376374 gene locus_tag LOCUS_10630 1377078 1376374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10630 1377727 1377152 gene locus_tag LOCUS_10640 1377727 1377152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10640 1378796 1377960 gene locus_tag LOCUS_10650 1378796 1377960 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796989.1 protein_id gnl|my_center|LOCUS_10650 1379032 1381851 gene locus_tag LOCUS_10660 gene polA 1379032 1381851 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796991.1 protein_id gnl|my_center|LOCUS_10660 1381897 1383900 gene locus_tag LOCUS_10670 1381897 1383900 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202779.1 protein_id gnl|my_center|LOCUS_10670 1384282 1384097 gene locus_tag LOCUS_10680 1384282 1384097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 1384730 1384581 gene locus_tag LOCUS_10690 1384730 1384581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 1384756 1386585 gene locus_tag LOCUS_10700 1384756 1386585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 1386643 1389840 gene locus_tag LOCUS_10710 1386643 1389840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 1391848 1391075 gene locus_tag LOCUS_10720 1391848 1391075 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108722.1 protein_id gnl|my_center|LOCUS_10720 1393800 1391845 gene locus_tag LOCUS_10730 1393800 1391845 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201861.1 protein_id gnl|my_center|LOCUS_10730 1394007 1394903 gene locus_tag LOCUS_10740 1394007 1394903 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783689.1 protein_id gnl|my_center|LOCUS_10740 1394927 1396255 gene locus_tag LOCUS_10750 1394927 1396255 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010991905.1 protein_id gnl|my_center|LOCUS_10750 1396309 1398447 gene locus_tag LOCUS_10760 1396309 1398447 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555778.1 protein_id gnl|my_center|LOCUS_10760 1398475 1399749 gene locus_tag LOCUS_10770 gene purD 1398475 1399749 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108718.1 protein_id gnl|my_center|LOCUS_10770 1400651 1400208 gene locus_tag LOCUS_10780 1400651 1400208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 1400738 1401208 gene locus_tag LOCUS_10790 1400738 1401208 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783683.1 protein_id gnl|my_center|LOCUS_10790 1401216 1401866 gene locus_tag LOCUS_10800 gene mnmD 1401216 1401866 CDS product tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010991902.1 protein_id gnl|my_center|LOCUS_10800 1401881 1402768 gene locus_tag LOCUS_10810 1401881 1402768 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108714.1 protein_id gnl|my_center|LOCUS_10810 1402768 1403610 gene locus_tag LOCUS_10820 1402768 1403610 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062696006.1 protein_id gnl|my_center|LOCUS_10820 1403980 1407336 gene locus_tag LOCUS_10830 1403980 1407336 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783669.1 protein_id gnl|my_center|LOCUS_10830 1407354 1408013 gene locus_tag LOCUS_10840 1407354 1408013 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783668.1 protein_id gnl|my_center|LOCUS_10840 1408127 1409074 gene locus_tag LOCUS_10850 gene queG 1408127 1409074 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813933.1 protein_id gnl|my_center|LOCUS_10850 1409186 1411084 gene locus_tag LOCUS_10860 1409186 1411084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 1411446 1413425 gene locus_tag LOCUS_10870 1411446 1413425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 1415901 1413574 gene locus_tag LOCUS_10880 1415901 1413574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 1416178 1417749 gene locus_tag LOCUS_10890 1416178 1417749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 1422657 1418059 gene locus_tag LOCUS_10900 1422657 1418059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 1424303 1422684 gene locus_tag LOCUS_10910 1424303 1422684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 1425595 1424417 gene locus_tag LOCUS_10920 1425595 1424417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 1427016 1425760 gene locus_tag LOCUS_10930 1427016 1425760 CDS product DUF4861 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201856.1 protein_id gnl|my_center|LOCUS_10930 1430458 1427297 gene locus_tag LOCUS_10940 1430458 1427297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 1432332 1430476 gene locus_tag LOCUS_10950 1432332 1430476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 1434965 1432425 gene locus_tag LOCUS_10960 1434965 1432425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 1436865 1435123 gene locus_tag LOCUS_10970 1436865 1435123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 1439153 1437033 gene locus_tag LOCUS_10980 1439153 1437033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 1441071 1439212 gene locus_tag LOCUS_10990 1441071 1439212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 1441864 1441670 gene locus_tag LOCUS_11000 1441864 1441670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 1442026 1443042 gene locus_tag LOCUS_11010 1442026 1443042 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391455.1 protein_id gnl|my_center|LOCUS_11010 1443215 1443142 gene locus_tag LOCUS_t00150 1443215 1443142 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1444589 1443297 gene locus_tag LOCUS_11020 gene tyrS 1444589 1443297 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783655.1 protein_id gnl|my_center|LOCUS_11020 1445299 1444658 gene locus_tag LOCUS_11030 1445299 1444658 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783653.1 protein_id gnl|my_center|LOCUS_11030 1445902 1445522 gene locus_tag LOCUS_11040 gene rnpA 1445902 1445522 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783651.1 protein_id gnl|my_center|LOCUS_11040 1446764 1446012 gene locus_tag LOCUS_11050 1446764 1446012 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_11050 1448078 1447491 gene locus_tag LOCUS_11060 1448078 1447491 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802006.1 protein_id gnl|my_center|LOCUS_11060 1449721 1448168 gene locus_tag LOCUS_11070 1449721 1448168 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764979.1 protein_id gnl|my_center|LOCUS_11070 1451112 1450687 gene locus_tag LOCUS_11080 1451112 1450687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 1452840 1451254 gene locus_tag LOCUS_11090 1452840 1451254 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769667.1 protein_id gnl|my_center|LOCUS_11090 1454458 1453166 gene locus_tag LOCUS_11100 gene metK 1454458 1453166 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762826.1 protein_id gnl|my_center|LOCUS_11100 1454677 1454865 gene locus_tag LOCUS_11110 1454677 1454865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 1455560 1455105 gene locus_tag LOCUS_11120 gene folK 1455560 1455105 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783639.1 protein_id gnl|my_center|LOCUS_11120 1456646 1455591 gene locus_tag LOCUS_11130 gene queA 1456646 1455591 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783637.1 protein_id gnl|my_center|LOCUS_11130 1457379 1456666 gene locus_tag LOCUS_11140 gene truB 1457379 1456666 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783635.1 protein_id gnl|my_center|LOCUS_11140 1458204 1457404 gene locus_tag LOCUS_11150 1458204 1457404 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783633.1 protein_id gnl|my_center|LOCUS_11150 1458446 1458207 gene locus_tag LOCUS_11160 1458446 1458207 CDS product DUF3098 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762818.1 protein_id gnl|my_center|LOCUS_11160 1459407 1458526 gene locus_tag LOCUS_11170 1459407 1458526 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779718.1 protein_id gnl|my_center|LOCUS_11170 1460330 1459407 gene locus_tag LOCUS_11180 1460330 1459407 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767448.1 protein_id gnl|my_center|LOCUS_11180 1461722 1460547 gene locus_tag LOCUS_11190 1461722 1460547 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798870.1 protein_id gnl|my_center|LOCUS_11190 1463123 1461750 gene locus_tag LOCUS_11200 gene miaB 1463123 1461750 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783584.1 protein_id gnl|my_center|LOCUS_11200 1463668 1463486 gene locus_tag LOCUS_11210 1463668 1463486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 1464154 1464585 gene locus_tag LOCUS_11220 1464154 1464585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 1466326 1464650 gene locus_tag LOCUS_11230 1466326 1464650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109284.1 protein_id gnl|my_center|LOCUS_11230 1467187 1466999 gene locus_tag LOCUS_11240 1467187 1466999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 1467836 1467642 gene locus_tag LOCUS_11250 1467836 1467642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 1468201 1467833 gene locus_tag LOCUS_11260 1468201 1467833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 1468587 1468198 gene locus_tag LOCUS_11270 1468587 1468198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 1469227 1468871 gene locus_tag LOCUS_11280 1469227 1468871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 1470864 1469368 gene locus_tag LOCUS_11290 1470864 1469368 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022472115.1 protein_id gnl|my_center|LOCUS_11290 1471130 1471501 gene locus_tag LOCUS_11300 1471130 1471501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783583.1 protein_id gnl|my_center|LOCUS_11300 1471537 1473036 gene locus_tag LOCUS_11310 1471537 1473036 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797086.1 protein_id gnl|my_center|LOCUS_11310 1473919 1473209 gene locus_tag LOCUS_11320 1473919 1473209 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767434.1 protein_id gnl|my_center|LOCUS_11320 1474347 1474676 gene locus_tag LOCUS_11330 1474347 1474676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767435.1 protein_id gnl|my_center|LOCUS_11330 1474739 1475695 gene locus_tag LOCUS_11340 1474739 1475695 CDS product DUF4373 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767436.1 protein_id gnl|my_center|LOCUS_11340 1476258 1476698 gene locus_tag LOCUS_11350 1476258 1476698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108885.1 protein_id gnl|my_center|LOCUS_11350 1477120 1478223 gene locus_tag LOCUS_11360 1477120 1478223 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108152.1 protein_id gnl|my_center|LOCUS_11360 1479769 1478327 gene locus_tag LOCUS_11370 gene dacB 1479769 1478327 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201838.1 protein_id gnl|my_center|LOCUS_11370 1481227 1479884 gene locus_tag LOCUS_11380 gene lpdA 1481227 1479884 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797088.1 protein_id gnl|my_center|LOCUS_11380 1481648 1481232 gene locus_tag LOCUS_11390 1481648 1481232 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783575.1 protein_id gnl|my_center|LOCUS_11390 1481755 1483326 gene locus_tag LOCUS_11400 gene nadB 1481755 1483326 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108697.1 protein_id gnl|my_center|LOCUS_11400 1483494 1486634 gene locus_tag LOCUS_11410 1483494 1486634 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765000.1 protein_id gnl|my_center|LOCUS_11410 1487152 1488846 gene locus_tag LOCUS_11420 1487152 1488846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 1493536 1488953 gene locus_tag LOCUS_11430 1493536 1488953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 1494098 1496839 gene locus_tag LOCUS_11440 1494098 1496839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 1497544 1496966 gene locus_tag LOCUS_11450 1497544 1496966 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762794.1 protein_id gnl|my_center|LOCUS_11450 1497817 1499502 gene locus_tag LOCUS_11460 gene sulP 1497817 1499502 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108696.1 protein_id gnl|my_center|LOCUS_11460 1500361 1499588 gene locus_tag LOCUS_11470 1500361 1499588 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108683.1 protein_id gnl|my_center|LOCUS_11470 1502691 1500664 gene locus_tag LOCUS_11480 1502691 1500664 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108682.1 protein_id gnl|my_center|LOCUS_11480 1502788 1503393 gene locus_tag LOCUS_11490 1502788 1503393 CDS product DUF4294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201836.1 protein_id gnl|my_center|LOCUS_11490 1504015 1503467 gene locus_tag LOCUS_11500 1504015 1503467 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762785.1 protein_id gnl|my_center|LOCUS_11500 1504475 1505413 gene locus_tag LOCUS_11510 gene nadA 1504475 1505413 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762783.1 protein_id gnl|my_center|LOCUS_11510 1505498 1506100 gene locus_tag LOCUS_11520 1505498 1506100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 1507277 1506204 gene locus_tag LOCUS_11530 1507277 1506204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 1509637 1507274 gene locus_tag LOCUS_11540 1509637 1507274 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962444.1 protein_id gnl|my_center|LOCUS_11540 1510233 1509649 gene locus_tag LOCUS_11550 1510233 1509649 CDS product non-canonical purine NTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783551.1 protein_id gnl|my_center|LOCUS_11550 1510406 1511668 gene locus_tag LOCUS_11560 1510406 1511668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 1512485 1514041 gene locus_tag LOCUS_11570 1512485 1514041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 1514046 1515365 gene locus_tag LOCUS_11580 1514046 1515365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 1516344 1515427 gene locus_tag LOCUS_11590 1516344 1515427 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108649.1 protein_id gnl|my_center|LOCUS_11590 1519194 1516363 gene locus_tag LOCUS_11600 gene leuS 1519194 1516363 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203753.1 protein_id gnl|my_center|LOCUS_11600 1519728 1520312 gene locus_tag LOCUS_11610 1519728 1520312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303162.1 protein_id gnl|my_center|LOCUS_11610 1520316 1520612 gene locus_tag LOCUS_11620 1520316 1520612 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763041.1 protein_id gnl|my_center|LOCUS_11620 1520687 1522036 gene locus_tag LOCUS_11630 gene creD 1520687 1522036 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107678.1 protein_id gnl|my_center|LOCUS_11630 1523934 1522444 gene locus_tag LOCUS_11640 1523934 1522444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 1524321 1525964 gene locus_tag LOCUS_11650 1524321 1525964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 1527619 1526543 gene locus_tag LOCUS_11660 1527619 1526543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 1529576 1528404 gene locus_tag LOCUS_11670 1529576 1528404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 1530138 1532753 gene locus_tag LOCUS_11680 gene mutS 1530138 1532753 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203750.1 protein_id gnl|my_center|LOCUS_11680 1532885 1533949 gene locus_tag LOCUS_11690 1532885 1533949 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456695.1 protein_id gnl|my_center|LOCUS_11690 1534093 1536108 gene locus_tag LOCUS_11700 1534093 1536108 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658063.1 protein_id gnl|my_center|LOCUS_11700 1536121 1540179 gene locus_tag LOCUS_11710 1536121 1540179 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203715.1 protein_id gnl|my_center|LOCUS_11710 1540381 1543401 gene locus_tag LOCUS_11720 1540381 1543401 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767240.1 protein_id gnl|my_center|LOCUS_11720 1543424 1545130 gene locus_tag LOCUS_11730 1543424 1545130 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767239.1 protein_id gnl|my_center|LOCUS_11730 1545444 1547252 gene locus_tag LOCUS_11740 1545444 1547252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 1547329 1550388 gene locus_tag LOCUS_11750 1547329 1550388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 1551849 1550515 gene locus_tag LOCUS_11760 1551849 1550515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 1553771 1551846 gene locus_tag LOCUS_11770 1553771 1551846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 1554527 1553886 gene locus_tag LOCUS_11780 1554527 1553886 CDS product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291289.1 protein_id gnl|my_center|LOCUS_11780 1555357 1554524 gene locus_tag LOCUS_11790 gene lgt 1555357 1554524 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783541.1 protein_id gnl|my_center|LOCUS_11790 1556289 1555369 gene locus_tag LOCUS_11800 1556289 1555369 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108643.1 protein_id gnl|my_center|LOCUS_11800 1557426 1556323 gene locus_tag LOCUS_11810 gene ychF 1557426 1556323 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108642.1 protein_id gnl|my_center|LOCUS_11810 1557877 1559349 gene locus_tag LOCUS_11820 1557877 1559349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 1559679 1560233 gene locus_tag LOCUS_11830 1559679 1560233 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801526.1 protein_id gnl|my_center|LOCUS_11830 1560317 1561249 gene locus_tag LOCUS_11840 1560317 1561249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 1561336 1564707 gene locus_tag LOCUS_11850 1561336 1564707 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658407.1 protein_id gnl|my_center|LOCUS_11850 1564731 1566467 gene locus_tag LOCUS_11860 1564731 1566467 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791109.1 protein_id gnl|my_center|LOCUS_11860 1566479 1567261 gene locus_tag LOCUS_11870 1566479 1567261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 1567271 1568320 gene locus_tag LOCUS_11880 1567271 1568320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 1568409 1569959 gene locus_tag LOCUS_11890 1568409 1569959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 1570070 1572232 gene locus_tag LOCUS_11900 1570070 1572232 CDS product alpha-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918428.1 protein_id gnl|my_center|LOCUS_11900 1572233 1573411 gene locus_tag LOCUS_11910 1572233 1573411 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107778.1 protein_id gnl|my_center|LOCUS_11910 1573434 1574678 gene locus_tag LOCUS_11920 1573434 1574678 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693828.1 protein_id gnl|my_center|LOCUS_11920 1574695 1575780 gene locus_tag LOCUS_11930 1574695 1575780 CDS product heparan-alpha-glucosaminide N-acetyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201990.1 protein_id gnl|my_center|LOCUS_11930 1575790 1577958 gene locus_tag LOCUS_11940 1575790 1577958 CDS product alpha-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107267.1 protein_id gnl|my_center|LOCUS_11940 1578550 1579503 gene locus_tag LOCUS_11950 1578550 1579503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 1579505 1580083 gene locus_tag LOCUS_11960 1579505 1580083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 1580097 1580699 gene locus_tag LOCUS_11970 1580097 1580699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 1580845 1581804 gene locus_tag LOCUS_11980 1580845 1581804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 1581806 1582384 gene locus_tag LOCUS_11990 1581806 1582384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 1582387 1583439 gene locus_tag LOCUS_12000 1582387 1583439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 1583666 1584784 gene locus_tag LOCUS_12010 1583666 1584784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 1585169 1585336 gene locus_tag LOCUS_12020 1585169 1585336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 1585400 1585669 gene locus_tag LOCUS_12030 1585400 1585669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 1585927 1587018 gene locus_tag LOCUS_12040 1585927 1587018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 1587073 1590474 gene locus_tag LOCUS_12050 1587073 1590474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 1590478 1590858 gene locus_tag LOCUS_12060 1590478 1590858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 1590908 1591312 gene locus_tag LOCUS_12070 1590908 1591312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 1591351 1594734 gene locus_tag LOCUS_12080 1591351 1594734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 1595473 1594910 gene locus_tag LOCUS_12090 1595473 1594910 CDS product DUF3575 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202498.1 protein_id gnl|my_center|LOCUS_12090 1596956 1595490 gene locus_tag LOCUS_12100 1596956 1595490 CDS product FimB/Mfa2 family fimbrial subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202479.1 protein_id gnl|my_center|LOCUS_12100 1598089 1597046 gene locus_tag LOCUS_12110 1598089 1597046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202478.1 protein_id gnl|my_center|LOCUS_12110 1599177 1598107 gene locus_tag LOCUS_12120 1599177 1598107 CDS product FimB/Mfa2 family fimbrial subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009127789.1 protein_id gnl|my_center|LOCUS_12120 1600087 1599221 gene locus_tag LOCUS_12130 1600087 1599221 CDS product FimB/Mfa2 family fimbrial subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786370.1 protein_id gnl|my_center|LOCUS_12130 1600394 1601593 gene locus_tag LOCUS_12140 gene fucP 1600394 1601593 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703668.1 protein_id gnl|my_center|LOCUS_12140 1601563 1602624 gene locus_tag LOCUS_12150 1601563 1602624 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032814311.1 protein_id gnl|my_center|LOCUS_12150 1602638 1603177 gene locus_tag LOCUS_12160 1602638 1603177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 1603704 1603192 gene locus_tag LOCUS_12170 1603704 1603192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 1603901 1604848 gene locus_tag LOCUS_12180 gene cysK 1603901 1604848 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203747.1 protein_id gnl|my_center|LOCUS_12180 1606997 1605066 gene locus_tag LOCUS_12190 1606997 1605066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 1608896 1607181 gene locus_tag LOCUS_12200 1608896 1607181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 1609423 1608941 gene locus_tag LOCUS_12210 1609423 1608941 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783533.1 protein_id gnl|my_center|LOCUS_12210 1611583 1609442 gene locus_tag LOCUS_12220 gene rnr 1611583 1609442 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783524.1 protein_id gnl|my_center|LOCUS_12220 1611899 1612813 gene locus_tag LOCUS_12230 1611899 1612813 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783522.1 protein_id gnl|my_center|LOCUS_12230 1612859 1613866 gene locus_tag LOCUS_12240 1612859 1613866 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783520.1 protein_id gnl|my_center|LOCUS_12240 1613857 1614822 gene locus_tag LOCUS_12250 1613857 1614822 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783517.1 protein_id gnl|my_center|LOCUS_12250 1614937 1615854 gene locus_tag LOCUS_12260 1614937 1615854 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203118.1 protein_id gnl|my_center|LOCUS_12260 1618430 1615947 gene locus_tag LOCUS_12270 1618430 1615947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 1620283 1618538 gene locus_tag LOCUS_12280 1620283 1618538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 1621233 1622294 gene locus_tag LOCUS_12290 1621233 1622294 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225342.1 protein_id gnl|my_center|LOCUS_12290 1622480 1623445 gene locus_tag LOCUS_12300 gene bla 1622480 1623445 CDS product class A beta-lactamase, subclass A2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109295.1 protein_id gnl|my_center|LOCUS_12300 1624860 1623538 gene locus_tag LOCUS_12310 1624860 1623538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 1626339 1625224 gene locus_tag LOCUS_12320 1626339 1625224 CDS product DUF6371 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005822199.1 protein_id gnl|my_center|LOCUS_12320 1627449 1626343 gene locus_tag LOCUS_12330 1627449 1626343 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120046688.1 protein_id gnl|my_center|LOCUS_12330 1627820 1627446 gene locus_tag LOCUS_12340 1627820 1627446 CDS product excisionase family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040312278.1 protein_id gnl|my_center|LOCUS_12340 1628877 1628020 gene locus_tag LOCUS_12350 1628877 1628020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 1630243 1629125 gene locus_tag LOCUS_12360 1630243 1629125 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007557695.1 protein_id gnl|my_center|LOCUS_12360 1631209 1630385 gene locus_tag LOCUS_12370 1631209 1630385 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107183.1 protein_id gnl|my_center|LOCUS_12370 1632109 1631618 gene locus_tag LOCUS_12380 1632109 1631618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 1635047 1632096 gene locus_tag LOCUS_12390 1635047 1632096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 1636336 1635068 gene locus_tag LOCUS_12400 1636336 1635068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 1639068 1637248 gene locus_tag LOCUS_12410 1639068 1637248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 1640131 1639151 gene locus_tag LOCUS_12420 gene dusB 1640131 1639151 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797153.1 protein_id gnl|my_center|LOCUS_12420 1640223 1641512 gene locus_tag LOCUS_12430 1640223 1641512 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761719.1 protein_id gnl|my_center|LOCUS_12430 1641518 1641919 gene locus_tag LOCUS_12440 1641518 1641919 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783508.1 protein_id gnl|my_center|LOCUS_12440 1641919 1643043 gene locus_tag LOCUS_12450 gene dprA 1641919 1643043 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048698553.1 protein_id gnl|my_center|LOCUS_12450 1643469 1644707 gene locus_tag LOCUS_12460 1643469 1644707 CDS product DUF3575 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108610.1 protein_id gnl|my_center|LOCUS_12460 1644855 1645769 gene locus_tag LOCUS_12470 1644855 1645769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 1645816 1646742 gene locus_tag LOCUS_12480 1645816 1646742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 1647029 1647736 gene locus_tag LOCUS_12490 1647029 1647736 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108608.1 protein_id gnl|my_center|LOCUS_12490 1647974 1650325 gene locus_tag LOCUS_12500 1647974 1650325 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203741.1 protein_id gnl|my_center|LOCUS_12500 1650399 1651601 gene locus_tag LOCUS_12510 1650399 1651601 CDS product DUF4374 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783495.1 protein_id gnl|my_center|LOCUS_12510 1651605 1652741 gene locus_tag LOCUS_12520 1651605 1652741 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203740.1 protein_id gnl|my_center|LOCUS_12520 1653589 1652834 gene locus_tag LOCUS_12530 1653589 1652834 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783491.1 protein_id gnl|my_center|LOCUS_12530 1655561 1653618 gene locus_tag LOCUS_12540 1655561 1653618 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783490.1 protein_id gnl|my_center|LOCUS_12540 1656295 1655600 gene locus_tag LOCUS_12550 1656295 1655600 CDS product succinate dehydrogenase/fumarate reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783488.1 protein_id gnl|my_center|LOCUS_12550 1657174 1656449 gene locus_tag LOCUS_12560 1657174 1656449 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783483.1 protein_id gnl|my_center|LOCUS_12560 1657423 1658046 gene locus_tag LOCUS_12570 1657423 1658046 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783481.1 protein_id gnl|my_center|LOCUS_12570 1659810 1658176 gene locus_tag LOCUS_12580 1659810 1658176 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797168.1 protein_id gnl|my_center|LOCUS_12580 1660284 1659832 gene locus_tag LOCUS_12590 gene coaD 1660284 1659832 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761751.1 protein_id gnl|my_center|LOCUS_12590 1662158 1660281 gene locus_tag LOCUS_12600 1662158 1660281 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783474.1 protein_id gnl|my_center|LOCUS_12600 1663303 1662167 gene locus_tag LOCUS_12610 1663303 1662167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783472.1 protein_id gnl|my_center|LOCUS_12610 1666366 1664417 gene locus_tag LOCUS_12620 1666366 1664417 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203543.1 protein_id gnl|my_center|LOCUS_12620 1667109 1668863 gene locus_tag LOCUS_12630 1667109 1668863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108178.1 protein_id gnl|my_center|LOCUS_12630 1669028 1669444 gene locus_tag LOCUS_12640 1669028 1669444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 1669741 1669983 gene locus_tag LOCUS_12650 1669741 1669983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 1670111 1671292 gene locus_tag LOCUS_12660 1670111 1671292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 1671294 1673447 gene locus_tag LOCUS_12670 1671294 1673447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 1673457 1674329 gene locus_tag LOCUS_12680 1673457 1674329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 1674384 1674713 gene locus_tag LOCUS_12690 1674384 1674713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 1675102 1677333 gene locus_tag LOCUS_12700 1675102 1677333 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791796.1 protein_id gnl|my_center|LOCUS_12700 1677333 1678643 gene locus_tag LOCUS_12710 1677333 1678643 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203561.1 protein_id gnl|my_center|LOCUS_12710 1679156 1679815 gene locus_tag LOCUS_12720 1679156 1679815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 1680946 1679933 gene locus_tag LOCUS_12730 1680946 1679933 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783471.1 protein_id gnl|my_center|LOCUS_12730 1681053 1682819 gene locus_tag LOCUS_12740 1681053 1682819 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203738.1 protein_id gnl|my_center|LOCUS_12740 1684831 1683023 gene locus_tag LOCUS_12750 1684831 1683023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 1686393 1685188 gene locus_tag LOCUS_12760 1686393 1685188 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303089.1 protein_id gnl|my_center|LOCUS_12760 1686800 1686408 gene locus_tag LOCUS_12770 1686800 1686408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 1687544 1686903 gene locus_tag LOCUS_12780 1687544 1686903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 1688170 1687577 gene locus_tag LOCUS_12790 1688170 1687577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 1689437 1688448 gene locus_tag LOCUS_12800 1689437 1688448 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795630.1 protein_id gnl|my_center|LOCUS_12800 1690800 1689565 gene locus_tag LOCUS_12810 1690800 1689565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 1691263 1691188 gene locus_tag LOCUS_t00160 1691263 1691188 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1691509 1692924 gene locus_tag LOCUS_12820 1691509 1692924 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121702.1 protein_id gnl|my_center|LOCUS_12820 1693564 1693262 gene locus_tag LOCUS_12830 1693564 1693262 CDS product DUF4491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797188.1 protein_id gnl|my_center|LOCUS_12830 1694032 1693568 gene locus_tag LOCUS_12840 1694032 1693568 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005928359.1 protein_id gnl|my_center|LOCUS_12840 1695053 1694187 gene locus_tag LOCUS_12850 1695053 1694187 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761810.1 protein_id gnl|my_center|LOCUS_12850 1695660 1695070 gene locus_tag LOCUS_12860 1695660 1695070 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203724.1 protein_id gnl|my_center|LOCUS_12860 1695858 1696556 gene locus_tag LOCUS_12870 1695858 1696556 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791915.1 protein_id gnl|my_center|LOCUS_12870 1697312 1696566 gene locus_tag LOCUS_12880 1697312 1696566 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203723.1 protein_id gnl|my_center|LOCUS_12880 1698570 1697305 gene locus_tag LOCUS_12890 1698570 1697305 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203722.1 protein_id gnl|my_center|LOCUS_12890 1698675 1699877 gene locus_tag LOCUS_12900 gene wecC 1698675 1699877 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791918.1 protein_id gnl|my_center|LOCUS_12900 1699928 1701058 gene locus_tag LOCUS_12910 gene wecB 1699928 1701058 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791919.1 protein_id gnl|my_center|LOCUS_12910 1702249 1701053 gene locus_tag LOCUS_12920 1702249 1701053 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814093.1 protein_id gnl|my_center|LOCUS_12920 1703241 1702246 gene locus_tag LOCUS_12930 1703241 1702246 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201896.1 protein_id gnl|my_center|LOCUS_12930 1704525 1703341 gene locus_tag LOCUS_12940 1704525 1703341 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203720.1 protein_id gnl|my_center|LOCUS_12940 1705961 1704522 gene locus_tag LOCUS_12950 1705961 1704522 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814097.1 protein_id gnl|my_center|LOCUS_12950 1708112 1706073 gene locus_tag LOCUS_12960 gene metG 1708112 1706073 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791925.1 protein_id gnl|my_center|LOCUS_12960 1715374 1708388 gene locus_tag LOCUS_12970 1715374 1708388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 1717966 1715396 gene locus_tag LOCUS_12980 1717966 1715396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 1719230 1717995 gene locus_tag LOCUS_12990 1719230 1717995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 1719794 1721854 gene locus_tag LOCUS_13000 1719794 1721854 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108532.1 protein_id gnl|my_center|LOCUS_13000 1721991 1722992 gene locus_tag LOCUS_13010 1721991 1722992 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201939.1 protein_id gnl|my_center|LOCUS_13010 1723014 1725053 gene locus_tag LOCUS_13020 1723014 1725053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791934.1 protein_id gnl|my_center|LOCUS_13020 1726868 1725330 gene locus_tag LOCUS_13030 1726868 1725330 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661626.1 protein_id gnl|my_center|LOCUS_13030 1727931 1726897 gene locus_tag LOCUS_13040 1727931 1726897 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791938.1 protein_id gnl|my_center|LOCUS_13040 1729665 1728043 gene locus_tag LOCUS_13050 1729665 1728043 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761919.1 protein_id gnl|my_center|LOCUS_13050 1730827 1729880 gene locus_tag LOCUS_13060 gene xerD 1730827 1729880 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791940.1 protein_id gnl|my_center|LOCUS_13060 1730900 1731322 gene locus_tag LOCUS_13070 gene aroQ 1730900 1731322 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761921.1 protein_id gnl|my_center|LOCUS_13070 1731352 1732809 gene locus_tag LOCUS_13080 gene pyk 1731352 1732809 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791942.1 protein_id gnl|my_center|LOCUS_13080 1732822 1733463 gene locus_tag LOCUS_13090 1732822 1733463 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791943.1 protein_id gnl|my_center|LOCUS_13090 1733794 1735098 gene locus_tag LOCUS_13100 1733794 1735098 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107435.1 protein_id gnl|my_center|LOCUS_13100 1735309 1738275 gene locus_tag LOCUS_13110 1735309 1738275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 1738551 1738886 gene locus_tag LOCUS_13120 gene rbfA 1738551 1738886 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761924.1 protein_id gnl|my_center|LOCUS_13120 1738883 1740115 gene locus_tag LOCUS_13130 1738883 1740115 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765300.1 protein_id gnl|my_center|LOCUS_13130 1740328 1740531 gene locus_tag LOCUS_13140 1740328 1740531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 1743888 1740934 gene locus_tag LOCUS_13150 1743888 1740934 CDS product glycosyl hydrolase 115 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108855.1 protein_id gnl|my_center|LOCUS_13150 1744128 1746470 gene locus_tag LOCUS_13160 gene topA 1744128 1746470 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791192.1 protein_id gnl|my_center|LOCUS_13160 1748787 1746598 gene locus_tag LOCUS_13170 1748787 1746598 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108651.1 protein_id gnl|my_center|LOCUS_13170 1750996 1748840 gene locus_tag LOCUS_13180 1750996 1748840 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108652.1 protein_id gnl|my_center|LOCUS_13180 1753134 1751149 gene locus_tag LOCUS_13190 1753134 1751149 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108653.1 protein_id gnl|my_center|LOCUS_13190 1757325 1753297 gene locus_tag LOCUS_13200 1757325 1753297 CDS product hybrid sensor histidine kinase/response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108655.1 protein_id gnl|my_center|LOCUS_13200 1757501 1759960 gene locus_tag LOCUS_13210 1757501 1759960 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108674.1 protein_id gnl|my_center|LOCUS_13210 1761029 1760088 gene locus_tag LOCUS_13220 1761029 1760088 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203118.1 protein_id gnl|my_center|LOCUS_13220 1761651 1761427 gene locus_tag LOCUS_13230 1761651 1761427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 1764099 1761730 gene locus_tag LOCUS_13240 1764099 1761730 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048698132.1 protein_id gnl|my_center|LOCUS_13240 1765865 1764096 gene locus_tag LOCUS_13250 1765865 1764096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 1767594 1766011 gene locus_tag LOCUS_13260 1767594 1766011 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108773.1 protein_id gnl|my_center|LOCUS_13260 1770700 1767614 gene locus_tag LOCUS_13270 1770700 1767614 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 protein_id gnl|my_center|LOCUS_13270 1771386 1774340 gene locus_tag LOCUS_13280 1771386 1774340 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303084.1 protein_id gnl|my_center|LOCUS_13280 1774677 1776485 gene locus_tag LOCUS_13290 1774677 1776485 CDS product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108511.1 protein_id gnl|my_center|LOCUS_13290 1776503 1778221 gene locus_tag LOCUS_13300 1776503 1778221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 1778964 1779536 gene locus_tag LOCUS_13310 1778964 1779536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 1779533 1780090 gene locus_tag LOCUS_13320 1779533 1780090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 1780297 1781040 gene locus_tag LOCUS_13330 1780297 1781040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 1781237 1782130 gene locus_tag LOCUS_13340 1781237 1782130 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775503.1 protein_id gnl|my_center|LOCUS_13340 1782734 1784029 gene locus_tag LOCUS_13350 1782734 1784029 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202166.1 protein_id gnl|my_center|LOCUS_13350 1784041 1786707 gene locus_tag LOCUS_13360 1784041 1786707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 1786818 1789799 gene locus_tag LOCUS_13370 1786818 1789799 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 protein_id gnl|my_center|LOCUS_13370 1789812 1791395 gene locus_tag LOCUS_13380 1789812 1791395 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405544.1 protein_id gnl|my_center|LOCUS_13380 1791407 1792726 gene locus_tag LOCUS_13390 1791407 1792726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 1792805 1794328 gene locus_tag LOCUS_13400 1792805 1794328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 1794403 1795503 gene locus_tag LOCUS_13410 1794403 1795503 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785016.1 protein_id gnl|my_center|LOCUS_13410 1795544 1796185 gene locus_tag LOCUS_13420 1795544 1796185 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798635.1 protein_id gnl|my_center|LOCUS_13420 1796232 1797251 gene locus_tag LOCUS_13430 1796232 1797251 CDS product methylcobamide--CoM methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107209.1 protein_id gnl|my_center|LOCUS_13430 1797248 1797940 gene locus_tag LOCUS_13440 1797248 1797940 CDS product vitamin B12 dependent-methionine synthase activation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813226.1 protein_id gnl|my_center|LOCUS_13440 1797949 1798962 gene locus_tag LOCUS_13450 1797949 1798962 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583099.1 protein_id gnl|my_center|LOCUS_13450 1799067 1800290 gene locus_tag LOCUS_13460 1799067 1800290 CDS product 4-O-beta-D-mannosyl-D-glucose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202169.1 protein_id gnl|my_center|LOCUS_13460 1800315 1801685 gene locus_tag LOCUS_13470 1800315 1801685 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032496674.1 protein_id gnl|my_center|LOCUS_13470 1801686 1802882 gene locus_tag LOCUS_13480 1801686 1802882 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202171.1 protein_id gnl|my_center|LOCUS_13480 1803378 1804769 gene locus_tag LOCUS_13490 1803378 1804769 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202206.1 protein_id gnl|my_center|LOCUS_13490 1804783 1808118 gene locus_tag LOCUS_13500 1804783 1808118 CDS product DUF5107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109240.1 protein_id gnl|my_center|LOCUS_13500 1808115 1809128 gene locus_tag LOCUS_13510 1808115 1809128 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108509.1 protein_id gnl|my_center|LOCUS_13510 1810023 1809130 gene locus_tag LOCUS_13520 1810023 1809130 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109238.1 protein_id gnl|my_center|LOCUS_13520 1812571 1810073 gene locus_tag LOCUS_13530 1812571 1810073 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797373.1 protein_id gnl|my_center|LOCUS_13530 1814070 1812652 gene locus_tag LOCUS_13540 gene ahcY 1814070 1812652 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781763.1 protein_id gnl|my_center|LOCUS_13540 1814254 1815825 gene locus_tag LOCUS_13550 1814254 1815825 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791952.1 protein_id gnl|my_center|LOCUS_13550 1817467 1815818 gene locus_tag LOCUS_13560 1817467 1815818 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108477.1 protein_id gnl|my_center|LOCUS_13560 1818074 1817499 gene locus_tag LOCUS_13570 1818074 1817499 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781772.1 protein_id gnl|my_center|LOCUS_13570 1818592 1818323 gene locus_tag LOCUS_13580 gene rpsO 1818592 1818323 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761978.1 protein_id gnl|my_center|LOCUS_13580 1818751 1820550 gene locus_tag LOCUS_13590 gene typA 1818751 1820550 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791956.1 protein_id gnl|my_center|LOCUS_13590 1820751 1822208 gene locus_tag LOCUS_13600 1820751 1822208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 1822407 1823864 gene locus_tag LOCUS_13610 1822407 1823864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 1825985 1824378 gene locus_tag LOCUS_13620 gene pckA 1825985 1824378 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791971.1 protein_id gnl|my_center|LOCUS_13620 1826254 1826907 gene locus_tag LOCUS_13630 gene upp 1826254 1826907 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761972.1 protein_id gnl|my_center|LOCUS_13630 1827027 1828142 gene locus_tag LOCUS_13640 1827027 1828142 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201948.1 protein_id gnl|my_center|LOCUS_13640 1828264 1829016 gene locus_tag LOCUS_13650 1828264 1829016 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803918.1 protein_id gnl|my_center|LOCUS_13650 1830141 1829131 gene locus_tag LOCUS_13660 1830141 1829131 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791975.1 protein_id gnl|my_center|LOCUS_13660 1831995 1830145 gene locus_tag LOCUS_13670 1831995 1830145 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791976.1 protein_id gnl|my_center|LOCUS_13670 1832501 1832573 gene locus_tag LOCUS_t00170 1832501 1832573 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1834496 1832844 gene locus_tag LOCUS_13680 1834496 1832844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 1834732 1838286 gene locus_tag LOCUS_13690 1834732 1838286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 1838902 1838438 gene locus_tag LOCUS_13700 1838902 1838438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 1839729 1838971 gene locus_tag LOCUS_13710 1839729 1838971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 1840364 1839804 gene locus_tag LOCUS_13720 1840364 1839804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 1840986 1840372 gene locus_tag LOCUS_13730 1840986 1840372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 1841655 1841074 gene locus_tag LOCUS_13740 1841655 1841074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 1845213 1842178 gene locus_tag LOCUS_13750 gene secDF 1845213 1842178 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765303.1 protein_id gnl|my_center|LOCUS_13750 1847763 1845676 gene locus_tag LOCUS_13760 1847763 1845676 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765304.1 protein_id gnl|my_center|LOCUS_13760 1848916 1847819 gene locus_tag LOCUS_13770 1848916 1847819 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791183.1 protein_id gnl|my_center|LOCUS_13770 1849819 1848920 gene locus_tag LOCUS_13780 1849819 1848920 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791185.1 protein_id gnl|my_center|LOCUS_13780 1850525 1849800 gene locus_tag LOCUS_13790 1850525 1849800 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203690.1 protein_id gnl|my_center|LOCUS_13790 1850749 1851021 gene locus_tag LOCUS_13800 1850749 1851021 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761933.1 protein_id gnl|my_center|LOCUS_13800 1851107 1852900 gene locus_tag LOCUS_13810 gene argS 1851107 1852900 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797416.1 protein_id gnl|my_center|LOCUS_13810 1853126 1853599 gene locus_tag LOCUS_13820 1853126 1853599 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108908.1 protein_id gnl|my_center|LOCUS_13820 1855439 1853694 gene locus_tag LOCUS_13830 1855439 1853694 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791194.1 protein_id gnl|my_center|LOCUS_13830 1858418 1855443 gene locus_tag LOCUS_13840 1858418 1855443 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797422.1 protein_id gnl|my_center|LOCUS_13840 1858701 1859069 gene locus_tag LOCUS_13850 1858701 1859069 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787498.1 protein_id gnl|my_center|LOCUS_13850 1859580 1859059 gene locus_tag LOCUS_13860 1859580 1859059 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791198.1 protein_id gnl|my_center|LOCUS_13860 1859824 1860390 gene locus_tag LOCUS_13870 gene ahpC 1859824 1860390 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761950.1 protein_id gnl|my_center|LOCUS_13870 1860480 1862030 gene locus_tag LOCUS_13880 gene ahpF 1860480 1862030 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695883.1 protein_id gnl|my_center|LOCUS_13880 1862205 1863008 gene locus_tag LOCUS_13890 1862205 1863008 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108488.1 protein_id gnl|my_center|LOCUS_13890 1863035 1863724 gene locus_tag LOCUS_13900 1863035 1863724 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108487.1 protein_id gnl|my_center|LOCUS_13900 1863864 1863790 gene locus_tag LOCUS_t00180 1863864 1863790 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1863967 1863893 gene locus_tag LOCUS_t00190 1863967 1863893 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1863968 1865032 gene locus_tag LOCUS_13910 1863968 1865032 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108486.1 protein_id gnl|my_center|LOCUS_13910 1865080 1866756 gene locus_tag LOCUS_13920 1865080 1866756 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 protein_id gnl|my_center|LOCUS_13920 1867111 1867362 gene locus_tag LOCUS_13930 1867111 1867362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 1867527 1867838 gene locus_tag LOCUS_13940 1867527 1867838 CDS product DUF1905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084855.1 protein_id gnl|my_center|LOCUS_13940 1867891 1868661 gene locus_tag LOCUS_13950 1867891 1868661 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108741.1 protein_id gnl|my_center|LOCUS_13950 1870648 1868801 gene locus_tag LOCUS_13960 1870648 1868801 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203674.1 protein_id gnl|my_center|LOCUS_13960 1871235 1870726 gene locus_tag LOCUS_13970 gene purE 1871235 1870726 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763604.1 protein_id gnl|my_center|LOCUS_13970 1871721 1871341 gene locus_tag LOCUS_13980 gene gcvH 1871721 1871341 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765165.1 protein_id gnl|my_center|LOCUS_13980 1871922 1874192 gene locus_tag LOCUS_13990 1871922 1874192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 1876616 1874919 gene locus_tag LOCUS_14000 1876616 1874919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 1877990 1876653 gene locus_tag LOCUS_14010 1877990 1876653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 1879203 1877998 gene locus_tag LOCUS_14020 1879203 1877998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 1880940 1879219 gene locus_tag LOCUS_14030 1880940 1879219 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762846.1 protein_id gnl|my_center|LOCUS_14030 1884240 1880965 gene locus_tag LOCUS_14040 1884240 1880965 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108709.1 protein_id gnl|my_center|LOCUS_14040 1885482 1884805 gene locus_tag LOCUS_14050 1885482 1884805 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791307.1 protein_id gnl|my_center|LOCUS_14050 1887011 1885530 gene locus_tag LOCUS_14060 gene rpoN 1887011 1885530 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203672.1 protein_id gnl|my_center|LOCUS_14060 1887227 1888288 gene locus_tag LOCUS_14070 1887227 1888288 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225342.1 protein_id gnl|my_center|LOCUS_14070 1888474 1889847 gene locus_tag LOCUS_14080 1888474 1889847 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108334.1 protein_id gnl|my_center|LOCUS_14080 1891852 1890299 gene locus_tag LOCUS_14090 1891852 1890299 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761913.1 protein_id gnl|my_center|LOCUS_14090 1892091 1893644 gene locus_tag LOCUS_14100 1892091 1893644 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108631.1 protein_id gnl|my_center|LOCUS_14100 1893666 1895021 gene locus_tag LOCUS_14110 1893666 1895021 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767670.1 protein_id gnl|my_center|LOCUS_14110 1895035 1896441 gene locus_tag LOCUS_14120 1895035 1896441 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767667.1 protein_id gnl|my_center|LOCUS_14120 1896771 1897343 gene locus_tag LOCUS_14130 1896771 1897343 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785889.1 protein_id gnl|my_center|LOCUS_14130 1897423 1898406 gene locus_tag LOCUS_14140 1897423 1898406 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202057.1 protein_id gnl|my_center|LOCUS_14140 1898627 1901956 gene locus_tag LOCUS_14150 1898627 1901956 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_14150 1901982 1903469 gene locus_tag LOCUS_14160 1901982 1903469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 1903540 1904898 gene locus_tag LOCUS_14170 1903540 1904898 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767670.1 protein_id gnl|my_center|LOCUS_14170 1906676 1905003 gene locus_tag LOCUS_14180 1906676 1905003 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763594.1 protein_id gnl|my_center|LOCUS_14180 1906759 1908456 gene locus_tag LOCUS_14190 1906759 1908456 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765170.1 protein_id gnl|my_center|LOCUS_14190 1908763 1908596 gene locus_tag LOCUS_14200 1908763 1908596 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763586.1 protein_id gnl|my_center|LOCUS_14200 1908904 1909443 gene locus_tag LOCUS_14210 1908904 1909443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 1909719 1914191 gene locus_tag LOCUS_14220 1909719 1914191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 1914263 1915882 gene locus_tag LOCUS_14230 1914263 1915882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 1916046 1918736 gene locus_tag LOCUS_14240 1916046 1918736 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203665.1 protein_id gnl|my_center|LOCUS_14240 1918733 1919359 gene locus_tag LOCUS_14250 1918733 1919359 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791331.1 protein_id gnl|my_center|LOCUS_14250 1919368 1920297 gene locus_tag LOCUS_14260 1919368 1920297 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203664.1 protein_id gnl|my_center|LOCUS_14260 1920935 1921441 gene locus_tag LOCUS_14270 1920935 1921441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 1921486 1922304 gene locus_tag LOCUS_14280 1921486 1922304 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108347.1 protein_id gnl|my_center|LOCUS_14280 1922297 1922968 gene locus_tag LOCUS_14290 1922297 1922968 CDS product DUF2975 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791337.1 protein_id gnl|my_center|LOCUS_14290 1922982 1923626 gene locus_tag LOCUS_14300 1922982 1923626 CDS product DUF2975 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763580.1 protein_id gnl|my_center|LOCUS_14300 1923647 1923859 gene locus_tag LOCUS_14310 1923647 1923859 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791339.1 protein_id gnl|my_center|LOCUS_14310 1924378 1923950 gene locus_tag LOCUS_14320 1924378 1923950 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791341.1 protein_id gnl|my_center|LOCUS_14320 1925412 1924429 gene locus_tag LOCUS_14330 1925412 1924429 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108349.1 protein_id gnl|my_center|LOCUS_14330 1926451 1925504 gene locus_tag LOCUS_14340 1926451 1925504 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108350.1 protein_id gnl|my_center|LOCUS_14340 1926583 1927491 gene locus_tag LOCUS_14350 1926583 1927491 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791349.1 protein_id gnl|my_center|LOCUS_14350 1927519 1928580 gene locus_tag LOCUS_14360 gene buk 1927519 1928580 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814251.1 protein_id gnl|my_center|LOCUS_14360 1928900 1929862 gene locus_tag LOCUS_14370 1928900 1929862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769801.1 protein_id gnl|my_center|LOCUS_14370 1929988 1931808 gene locus_tag LOCUS_14380 1929988 1931808 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767207.1 protein_id gnl|my_center|LOCUS_14380 1933387 1932038 gene locus_tag LOCUS_14390 1933387 1932038 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108887.1 protein_id gnl|my_center|LOCUS_14390 1936059 1933669 gene locus_tag LOCUS_14400 gene bglX 1936059 1933669 CDS product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108888.1 protein_id gnl|my_center|LOCUS_14400 1937613 1936090 gene locus_tag LOCUS_14410 1937613 1936090 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108889.1 protein_id gnl|my_center|LOCUS_14410 1940780 1937727 gene locus_tag LOCUS_14420 1940780 1937727 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769257.1 protein_id gnl|my_center|LOCUS_14420 1941971 1941066 gene locus_tag LOCUS_14430 1941971 1941066 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762527.1 protein_id gnl|my_center|LOCUS_14430 1942119 1942037 gene locus_tag LOCUS_t00200 1942119 1942037 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1943237 1942203 gene locus_tag LOCUS_14440 1943237 1942203 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801668.1 protein_id gnl|my_center|LOCUS_14440 1944129 1943260 gene locus_tag LOCUS_14450 1944129 1943260 CDS product DUF3316 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762529.1 protein_id gnl|my_center|LOCUS_14450 1946844 1944163 gene locus_tag LOCUS_14460 1946844 1944163 CDS product DNA gyrase/topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048696320.1 protein_id gnl|my_center|LOCUS_14460 1947190 1948731 gene locus_tag LOCUS_14470 1947190 1948731 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784203.1 protein_id gnl|my_center|LOCUS_14470 1948743 1949408 gene locus_tag LOCUS_14480 1948743 1949408 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762560.1 protein_id gnl|my_center|LOCUS_14480 1950132 1949506 gene locus_tag LOCUS_14490 1950132 1949506 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895475.1 protein_id gnl|my_center|LOCUS_14490 1950304 1951146 gene locus_tag LOCUS_14500 1950304 1951146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 1951355 1951206 gene locus_tag LOCUS_14510 1951355 1951206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 1952348 1951452 gene locus_tag LOCUS_14520 1952348 1951452 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203645.1 protein_id gnl|my_center|LOCUS_14520 1953368 1952466 gene locus_tag LOCUS_14530 1953368 1952466 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_14530 1953740 1955635 gene locus_tag LOCUS_14540 1953740 1955635 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695098.1 protein_id gnl|my_center|LOCUS_14540 1956831 1955866 gene locus_tag LOCUS_14550 1956831 1955866 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107933.1 protein_id gnl|my_center|LOCUS_14550 1957119 1957802 gene locus_tag LOCUS_14560 1957119 1957802 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108463.1 protein_id gnl|my_center|LOCUS_14560 1958837 1957866 gene locus_tag LOCUS_14570 1958837 1957866 CDS product FimB/Mfa2 family fimbrial subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797605.1 protein_id gnl|my_center|LOCUS_14570 1959069 1959626 gene locus_tag LOCUS_14580 1959069 1959626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770196.1 protein_id gnl|my_center|LOCUS_14580 1959674 1960237 gene locus_tag LOCUS_14590 1959674 1960237 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791480.1 protein_id gnl|my_center|LOCUS_14590 1960307 1960528 gene locus_tag LOCUS_14600 1960307 1960528 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_14600 1961788 1960601 gene locus_tag LOCUS_14610 1961788 1960601 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814336.1 protein_id gnl|my_center|LOCUS_14610 1963042 1961981 gene locus_tag LOCUS_14620 gene ansB 1963042 1961981 CDS product L-asparaginase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791484.1 protein_id gnl|my_center|LOCUS_14620 1964388 1963078 gene locus_tag LOCUS_14630 1964388 1963078 CDS product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791486.1 protein_id gnl|my_center|LOCUS_14630 1964548 1965981 gene locus_tag LOCUS_14640 gene aspA 1964548 1965981 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791488.1 protein_id gnl|my_center|LOCUS_14640 1966564 1967532 gene locus_tag LOCUS_14650 1966564 1967532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 1967547 1968983 gene locus_tag LOCUS_14660 gene gldK 1967547 1968983 CDS product gliding motility lipoprotein GldK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964075.1 protein_id gnl|my_center|LOCUS_14660 1968986 1969816 gene locus_tag LOCUS_14670 1968986 1969816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 1969826 1971322 gene locus_tag LOCUS_14680 gene gldM 1969826 1971322 CDS product gliding motility protein GldM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964073.1 protein_id gnl|my_center|LOCUS_14680 1971350 1972462 gene locus_tag LOCUS_14690 gene gldN 1971350 1972462 CDS product gliding motility protein GldN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964072.1 protein_id gnl|my_center|LOCUS_14690 1972537 1973121 gene locus_tag LOCUS_14700 1972537 1973121 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203608.1 protein_id gnl|my_center|LOCUS_14700 1973198 1975654 gene locus_tag LOCUS_14710 gene priA 1973198 1975654 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203607.1 protein_id gnl|my_center|LOCUS_14710 1975680 1977479 gene locus_tag LOCUS_14720 1975680 1977479 CDS product DUF4091 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108456.1 protein_id gnl|my_center|LOCUS_14720 1977540 1978013 gene locus_tag LOCUS_14730 1977540 1978013 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765417.1 protein_id gnl|my_center|LOCUS_14730 1978802 1978026 gene locus_tag LOCUS_14740 1978802 1978026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 1980859 1978799 gene locus_tag LOCUS_14750 1980859 1978799 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762019.1 protein_id gnl|my_center|LOCUS_14750 1980954 1982471 gene locus_tag LOCUS_14760 gene gltX 1980954 1982471 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765418.1 protein_id gnl|my_center|LOCUS_14760 1982484 1983704 gene locus_tag LOCUS_14770 1982484 1983704 CDS product glycosyltransferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765419.1 protein_id gnl|my_center|LOCUS_14770 1985925 1984042 gene locus_tag LOCUS_14780 1985925 1984042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 1986741 1986220 gene locus_tag LOCUS_14790 1986741 1986220 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765423.1 protein_id gnl|my_center|LOCUS_14790 1988550 1986769 gene locus_tag LOCUS_14800 1988550 1986769 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765424.1 protein_id gnl|my_center|LOCUS_14800 1990514 1988784 gene locus_tag LOCUS_14810 1990514 1988784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 1990871 1991446 gene locus_tag LOCUS_14820 1990871 1991446 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790890.1 protein_id gnl|my_center|LOCUS_14820 1991844 1994021 gene locus_tag LOCUS_14830 1991844 1994021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 1994042 1996417 gene locus_tag LOCUS_14840 1994042 1996417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 1996507 1998438 gene locus_tag LOCUS_14850 1996507 1998438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 1998579 2000504 gene locus_tag LOCUS_14860 1998579 2000504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 2000674 2000946 gene locus_tag LOCUS_14870 2000674 2000946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 2001020 2001901 gene locus_tag LOCUS_14880 gene xerC 2001020 2001901 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804122.1 protein_id gnl|my_center|LOCUS_14880 2001917 2002216 gene locus_tag LOCUS_14890 gene raiA 2001917 2002216 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762025.1 protein_id gnl|my_center|LOCUS_14890 2002313 2002387 gene locus_tag LOCUS_t00210 2002313 2002387 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2002420 2002503 gene locus_tag LOCUS_t00220 2002420 2002503 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 2002539 2002612 gene locus_tag LOCUS_t00230 2002539 2002612 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2002626 2002698 gene locus_tag LOCUS_t00240 2002626 2002698 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2002747 2003931 gene locus_tag LOCUS_14900 gene tuf 2002747 2003931 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782155.1 protein_id gnl|my_center|LOCUS_14900 2003986 2004059 gene locus_tag LOCUS_t00250 2003986 2004059 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 2004073 2004264 gene locus_tag LOCUS_14910 gene secE 2004073 2004264 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782157.1 protein_id gnl|my_center|LOCUS_14910 2004277 2004819 gene locus_tag LOCUS_14920 gene nusG 2004277 2004819 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782159.1 protein_id gnl|my_center|LOCUS_14920 2004877 2005320 gene locus_tag LOCUS_14930 gene rplK 2004877 2005320 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791514.1 protein_id gnl|my_center|LOCUS_14930 2005336 2006034 gene locus_tag LOCUS_14940 gene rplA 2005336 2006034 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782161.1 protein_id gnl|my_center|LOCUS_14940 2006050 2006568 gene locus_tag LOCUS_14950 gene rplJ 2006050 2006568 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762028.1 protein_id gnl|my_center|LOCUS_14950 2006615 2006989 gene locus_tag LOCUS_14960 gene rplL 2006615 2006989 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558082.1 protein_id gnl|my_center|LOCUS_14960 2007094 2010906 gene locus_tag LOCUS_14970 gene rpoB 2007094 2010906 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791521.1 protein_id gnl|my_center|LOCUS_14970 2011019 2015302 gene locus_tag LOCUS_14980 gene rpoC 2011019 2015302 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108455.1 protein_id gnl|my_center|LOCUS_14980 2015502 2015822 gene locus_tag LOCUS_14990 2015502 2015822 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791533.1 protein_id gnl|my_center|LOCUS_14990 2016137 2016547 gene locus_tag LOCUS_15000 gene rpsL 2016137 2016547 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675419.1 protein_id gnl|my_center|LOCUS_15000 2016772 2017161 gene locus_tag LOCUS_15010 gene rpsG 2016772 2017161 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762032.1 protein_id gnl|my_center|LOCUS_15010 2017215 2019332 gene locus_tag LOCUS_15020 gene fusA 2017215 2019332 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762033.1 protein_id gnl|my_center|LOCUS_15020 2019418 2019723 gene locus_tag LOCUS_15030 gene rpsJ 2019418 2019723 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558075.1 protein_id gnl|my_center|LOCUS_15030 2019742 2020359 gene locus_tag LOCUS_15040 gene rplC 2019742 2020359 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782189.1 protein_id gnl|my_center|LOCUS_15040 2020359 2020985 gene locus_tag LOCUS_15050 gene rplD 2020359 2020985 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762035.1 protein_id gnl|my_center|LOCUS_15050 2021002 2021292 gene locus_tag LOCUS_15060 gene rplW 2021002 2021292 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791542.1 protein_id gnl|my_center|LOCUS_15060 2021298 2022122 gene locus_tag LOCUS_15070 gene rplB 2021298 2022122 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791545.1 protein_id gnl|my_center|LOCUS_15070 2022143 2022412 gene locus_tag LOCUS_15080 gene rpsS 2022143 2022412 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782197.1 protein_id gnl|my_center|LOCUS_15080 2022448 2022852 gene locus_tag LOCUS_15090 gene rplV 2022448 2022852 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558069.1 protein_id gnl|my_center|LOCUS_15090 2022863 2023600 gene locus_tag LOCUS_15100 gene rpsC 2022863 2023600 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762038.1 protein_id gnl|my_center|LOCUS_15100 2023624 2024058 gene locus_tag LOCUS_15110 gene rplP 2023624 2024058 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791549.1 protein_id gnl|my_center|LOCUS_15110 2024064 2024261 gene locus_tag LOCUS_15120 gene rpmC 2024064 2024261 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782204.1 protein_id gnl|my_center|LOCUS_15120 2024258 2024527 gene locus_tag LOCUS_15130 gene rpsQ 2024258 2024527 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770213.1 protein_id gnl|my_center|LOCUS_15130 2024530 2024895 gene locus_tag LOCUS_15140 gene rplN 2024530 2024895 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296340.1 protein_id gnl|my_center|LOCUS_15140 2024916 2025245 gene locus_tag LOCUS_15150 gene rplX 2024916 2025245 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791554.1 protein_id gnl|my_center|LOCUS_15150 2025245 2025802 gene locus_tag LOCUS_15160 gene rplE 2025245 2025802 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675434.1 protein_id gnl|my_center|LOCUS_15160 2025808 2026107 gene locus_tag LOCUS_15170 gene rpsN 2025808 2026107 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791558.1 protein_id gnl|my_center|LOCUS_15170 2026160 2026555 gene locus_tag LOCUS_15180 gene rpsH 2026160 2026555 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782213.1 protein_id gnl|my_center|LOCUS_15180 2026570 2027139 gene locus_tag LOCUS_15190 gene rplF 2026570 2027139 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791561.1 protein_id gnl|my_center|LOCUS_15190 2027161 2027505 gene locus_tag LOCUS_15200 gene rplR 2027161 2027505 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791562.1 protein_id gnl|my_center|LOCUS_15200 2027511 2028029 gene locus_tag LOCUS_15210 gene rpsE 2027511 2028029 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791564.1 protein_id gnl|my_center|LOCUS_15210 2028039 2028215 gene locus_tag LOCUS_15220 gene rpmD 2028039 2028215 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296332.1 protein_id gnl|my_center|LOCUS_15220 2028246 2028692 gene locus_tag LOCUS_15230 gene rplO 2028246 2028692 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804135.1 protein_id gnl|my_center|LOCUS_15230 2028697 2030037 gene locus_tag LOCUS_15240 gene secY 2028697 2030037 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762047.1 protein_id gnl|my_center|LOCUS_15240 2030050 2030847 gene locus_tag LOCUS_15250 gene map 2030050 2030847 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108453.1 protein_id gnl|my_center|LOCUS_15250 2030849 2031067 gene locus_tag LOCUS_15260 gene infA 2030849 2031067 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558052.1 protein_id gnl|my_center|LOCUS_15260 2031227 2031607 gene locus_tag LOCUS_15270 gene rpsM 2031227 2031607 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558050.1 protein_id gnl|my_center|LOCUS_15270 2031619 2032008 gene locus_tag LOCUS_15280 gene rpsK 2031619 2032008 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296327.1 protein_id gnl|my_center|LOCUS_15280 2032126 2032731 gene locus_tag LOCUS_15290 gene rpsD 2032126 2032731 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791575.1 protein_id gnl|my_center|LOCUS_15290 2032743 2033735 gene locus_tag LOCUS_15300 2032743 2033735 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762051.1 protein_id gnl|my_center|LOCUS_15300 2033739 2034218 gene locus_tag LOCUS_15310 gene rplQ 2033739 2034218 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791577.1 protein_id gnl|my_center|LOCUS_15310 2034346 2034753 gene locus_tag LOCUS_15320 2034346 2034753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765431.1 protein_id gnl|my_center|LOCUS_15320 2034860 2035399 gene locus_tag LOCUS_15330 2034860 2035399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791581.1 protein_id gnl|my_center|LOCUS_15330 2037244 2035430 gene locus_tag LOCUS_15340 2037244 2035430 CDS product MutS family DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009293016.1 protein_id gnl|my_center|LOCUS_15340 2037735 2038364 gene locus_tag LOCUS_15350 2037735 2038364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203601.1 protein_id gnl|my_center|LOCUS_15350 2038478 2040463 gene locus_tag LOCUS_15360 2038478 2040463 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765435.1 protein_id gnl|my_center|LOCUS_15360 2040466 2041368 gene locus_tag LOCUS_15370 gene ftcD 2040466 2041368 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765436.1 protein_id gnl|my_center|LOCUS_15370 2041375 2042628 gene locus_tag LOCUS_15380 gene hutI 2041375 2042628 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108451.1 protein_id gnl|my_center|LOCUS_15380 2042661 2043290 gene locus_tag LOCUS_15390 2042661 2043290 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203598.1 protein_id gnl|my_center|LOCUS_15390 2043287 2044783 gene locus_tag LOCUS_15400 gene hutH 2043287 2044783 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108449.1 protein_id gnl|my_center|LOCUS_15400 2045471 2046154 gene locus_tag LOCUS_15410 2045471 2046154 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108448.1 protein_id gnl|my_center|LOCUS_15410 2046182 2047531 gene locus_tag LOCUS_15420 2046182 2047531 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762063.1 protein_id gnl|my_center|LOCUS_15420 2047561 2048577 gene locus_tag LOCUS_15430 2047561 2048577 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762064.1 protein_id gnl|my_center|LOCUS_15430 2048667 2051825 gene locus_tag LOCUS_15440 2048667 2051825 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804147.1 protein_id gnl|my_center|LOCUS_15440 2051860 2052153 gene locus_tag LOCUS_15450 2051860 2052153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762066.1 protein_id gnl|my_center|LOCUS_15450 2052204 2052398 gene locus_tag LOCUS_15460 2052204 2052398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 2052373 2053644 gene locus_tag LOCUS_15470 2052373 2053644 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203597.1 protein_id gnl|my_center|LOCUS_15470 2053754 2054527 gene locus_tag LOCUS_15480 2053754 2054527 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182127386.1 protein_id gnl|my_center|LOCUS_15480 2054508 2056001 gene locus_tag LOCUS_15490 2054508 2056001 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804150.1 protein_id gnl|my_center|LOCUS_15490 2058340 2056010 gene locus_tag LOCUS_15500 2058340 2056010 CDS product glycoside hydrolase family 20 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107277.1 protein_id gnl|my_center|LOCUS_15500 2059388 2060907 gene locus_tag LOCUS_r00010 2059388 2060907 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2061060 2061134 gene locus_tag LOCUS_t00260 2061060 2061134 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 2061211 2061285 gene locus_tag LOCUS_t00270 2061211 2061285 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2061416 2064288 gene locus_tag LOCUS_r00020 2061416 2064288 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2064366 2064472 gene locus_tag LOCUS_r00030 2064366 2064472 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2064674 2065819 gene locus_tag LOCUS_15510 2064674 2065819 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 protein_id gnl|my_center|LOCUS_15510 2065977 2066558 gene locus_tag LOCUS_15520 2065977 2066558 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814383.1 protein_id gnl|my_center|LOCUS_15520 2066572 2066757 gene locus_tag LOCUS_15530 gene rpmF 2066572 2066757 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002562387.1 protein_id gnl|my_center|LOCUS_15530 2066861 2067865 gene locus_tag LOCUS_15540 2066861 2067865 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791878.1 protein_id gnl|my_center|LOCUS_15540 2067955 2068836 gene locus_tag LOCUS_15550 gene era 2067955 2068836 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760765.1 protein_id gnl|my_center|LOCUS_15550 2068885 2070198 gene locus_tag LOCUS_15560 gene der 2068885 2070198 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782289.1 protein_id gnl|my_center|LOCUS_15560 2070281 2070928 gene locus_tag LOCUS_15570 2070281 2070928 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791874.1 protein_id gnl|my_center|LOCUS_15570 2073617 2071713 gene locus_tag LOCUS_15580 2073617 2071713 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788403.1 protein_id gnl|my_center|LOCUS_15580 2074632 2073847 gene locus_tag LOCUS_15590 2074632 2073847 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764109.1 protein_id gnl|my_center|LOCUS_15590 2075372 2074629 gene locus_tag LOCUS_15600 2075372 2074629 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791870.1 protein_id gnl|my_center|LOCUS_15600 2075447 2076211 gene locus_tag LOCUS_15610 gene lptB 2075447 2076211 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760767.1 protein_id gnl|my_center|LOCUS_15610 2076714 2078069 gene locus_tag LOCUS_15620 gene tig 2076714 2078069 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791866.1 protein_id gnl|my_center|LOCUS_15620 2078212 2078874 gene locus_tag LOCUS_15630 gene clpP 2078212 2078874 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297164.1 protein_id gnl|my_center|LOCUS_15630 2078877 2080124 gene locus_tag LOCUS_15640 gene clpX 2078877 2080124 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791864.1 protein_id gnl|my_center|LOCUS_15640 2080290 2082470 gene locus_tag LOCUS_15650 gene recQ 2080290 2082470 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791861.1 protein_id gnl|my_center|LOCUS_15650 2082557 2084032 gene locus_tag LOCUS_15660 gene guaB 2082557 2084032 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791859.1 protein_id gnl|my_center|LOCUS_15660 2084210 2085754 gene locus_tag LOCUS_15670 2084210 2085754 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203579.1 protein_id gnl|my_center|LOCUS_15670 2085896 2086657 gene locus_tag LOCUS_15680 2085896 2086657 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814398.1 protein_id gnl|my_center|LOCUS_15680 2086667 2088058 gene locus_tag LOCUS_15690 2086667 2088058 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760775.1 protein_id gnl|my_center|LOCUS_15690 2088100 2089701 gene locus_tag LOCUS_15700 2088100 2089701 CDS product OstA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993642.1 protein_id gnl|my_center|LOCUS_15700 2089706 2090014 gene locus_tag LOCUS_15710 2089706 2090014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791850.1 protein_id gnl|my_center|LOCUS_15710 2090033 2091919 gene locus_tag LOCUS_15720 gene mutL 2090033 2091919 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760778.1 protein_id gnl|my_center|LOCUS_15720 2092390 2093562 gene locus_tag LOCUS_15730 2092390 2093562 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791792.1 protein_id gnl|my_center|LOCUS_15730 2094743 2093646 gene locus_tag LOCUS_15740 gene trpS 2094743 2093646 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791788.1 protein_id gnl|my_center|LOCUS_15740 2095575 2094814 gene locus_tag LOCUS_15750 2095575 2094814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 2097882 2096029 gene locus_tag LOCUS_15760 2097882 2096029 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767027.1 protein_id gnl|my_center|LOCUS_15760 2099718 2097916 gene locus_tag LOCUS_15770 2099718 2097916 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391425.1 protein_id gnl|my_center|LOCUS_15770 2100293 2099925 gene locus_tag LOCUS_15780 2100293 2099925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 2101830 2100286 gene locus_tag LOCUS_15790 2101830 2100286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 2104118 2102031 gene locus_tag LOCUS_15800 2104118 2102031 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658102.1 protein_id gnl|my_center|LOCUS_15800 2104952 2104179 gene locus_tag LOCUS_15810 2104952 2104179 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203682.1 protein_id gnl|my_center|LOCUS_15810 2105377 2108427 gene locus_tag LOCUS_15820 2105377 2108427 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767240.1 protein_id gnl|my_center|LOCUS_15820 2108440 2110065 gene locus_tag LOCUS_15830 2108440 2110065 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107292.1 protein_id gnl|my_center|LOCUS_15830 2110359 2111255 gene locus_tag LOCUS_15840 2110359 2111255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 2111555 2114782 gene locus_tag LOCUS_15850 gene carB 2111555 2114782 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799108.1 protein_id gnl|my_center|LOCUS_15850 2116599 2114902 gene locus_tag LOCUS_15860 2116599 2114902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 2117895 2116687 gene locus_tag LOCUS_15870 2117895 2116687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108708.1 protein_id gnl|my_center|LOCUS_15870 2119700 2117892 gene locus_tag LOCUS_15880 2119700 2117892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 2120487 2120029 gene locus_tag LOCUS_15890 2120487 2120029 CDS product copper resistance protein NlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789670.1 protein_id gnl|my_center|LOCUS_15890 2120588 2121361 gene locus_tag LOCUS_15900 gene yaaA 2120588 2121361 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109003.1 protein_id gnl|my_center|LOCUS_15900 2121366 2121914 gene locus_tag LOCUS_15910 2121366 2121914 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791762.1 protein_id gnl|my_center|LOCUS_15910 2122614 2122689 gene locus_tag LOCUS_t00280 2122614 2122689 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2122720 2122795 gene locus_tag LOCUS_t00290 2122720 2122795 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2122996 2124342 gene locus_tag LOCUS_15920 gene purB 2122996 2124342 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760796.1 protein_id gnl|my_center|LOCUS_15920 2124400 2125791 gene locus_tag LOCUS_15930 2124400 2125791 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791757.1 protein_id gnl|my_center|LOCUS_15930 2125813 2127216 gene locus_tag LOCUS_15940 gene asnS 2125813 2127216 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760798.1 protein_id gnl|my_center|LOCUS_15940 2127365 2127856 gene locus_tag LOCUS_15950 2127365 2127856 CDS product DUF4488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760799.1 protein_id gnl|my_center|LOCUS_15950 2127984 2129750 gene locus_tag LOCUS_15960 2127984 2129750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 2130069 2130530 gene locus_tag LOCUS_15970 gene rplM 2130069 2130530 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782434.1 protein_id gnl|my_center|LOCUS_15970 2130537 2130923 gene locus_tag LOCUS_15980 gene rpsI 2130537 2130923 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109004.1 protein_id gnl|my_center|LOCUS_15980 2131041 2131877 gene locus_tag LOCUS_15990 gene rpsB 2131041 2131877 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760802.1 protein_id gnl|my_center|LOCUS_15990 2132003 2132827 gene locus_tag LOCUS_16000 gene tsf 2132003 2132827 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791746.1 protein_id gnl|my_center|LOCUS_16000 2133547 2133200 gene locus_tag LOCUS_16010 2133547 2133200 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791744.1 protein_id gnl|my_center|LOCUS_16010 2133657 2136269 gene locus_tag LOCUS_16020 2133657 2136269 CDS product DUF5686 and carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055271316.1 protein_id gnl|my_center|LOCUS_16020 2136361 2137032 gene locus_tag LOCUS_16030 2136361 2137032 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770252.1 protein_id gnl|my_center|LOCUS_16030 2137032 2137646 gene locus_tag LOCUS_16040 2137032 2137646 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791742.1 protein_id gnl|my_center|LOCUS_16040 2137807 2141556 gene locus_tag LOCUS_16050 gene porU 2137807 2141556 CDS product type IX secretion system sortase PorU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_16050 2141715 2145308 gene locus_tag LOCUS_16060 gene porU 2141715 2145308 CDS product type IX secretion system sortase PorU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_16060 2145389 2146579 gene locus_tag LOCUS_16070 gene porV 2145389 2146579 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_16070 2146681 2147160 gene locus_tag LOCUS_16080 gene ispF 2146681 2147160 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764145.1 protein_id gnl|my_center|LOCUS_16080 2148045 2147164 gene locus_tag LOCUS_16090 2148045 2147164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791738.1 protein_id gnl|my_center|LOCUS_16090 2148171 2148953 gene locus_tag LOCUS_16100 2148171 2148953 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764105.1 protein_id gnl|my_center|LOCUS_16100 2149361 2151067 gene locus_tag LOCUS_16110 2149361 2151067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 2151200 2155699 gene locus_tag LOCUS_16120 2151200 2155699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 2156527 2155772 gene locus_tag LOCUS_16130 2156527 2155772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 2156583 2157674 gene locus_tag LOCUS_16140 gene mnmA 2156583 2157674 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764148.1 protein_id gnl|my_center|LOCUS_16140 2157708 2159063 gene locus_tag LOCUS_16150 2157708 2159063 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764149.1 protein_id gnl|my_center|LOCUS_16150 2159060 2160316 gene locus_tag LOCUS_16160 gene xseA 2159060 2160316 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764150.1 protein_id gnl|my_center|LOCUS_16160 2160320 2160529 gene locus_tag LOCUS_16170 gene xseB 2160320 2160529 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760813.1 protein_id gnl|my_center|LOCUS_16170 2160579 2161598 gene locus_tag LOCUS_16180 2160579 2161598 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004305537.1 protein_id gnl|my_center|LOCUS_16180 2161631 2162221 gene locus_tag LOCUS_16190 2161631 2162221 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760815.1 protein_id gnl|my_center|LOCUS_16190 2162345 2163100 gene locus_tag LOCUS_16200 gene trmB 2162345 2163100 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840567.1 protein_id gnl|my_center|LOCUS_16200 2163120 2164226 gene locus_tag LOCUS_16210 2163120 2164226 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791723.1 protein_id gnl|my_center|LOCUS_16210 2165583 2164606 gene locus_tag LOCUS_16220 2165583 2164606 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658101.1 protein_id gnl|my_center|LOCUS_16220 2165781 2167850 gene locus_tag LOCUS_16230 2165781 2167850 CDS product pyruvate formate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797468.1 protein_id gnl|my_center|LOCUS_16230 2167864 2169186 gene locus_tag LOCUS_16240 2167864 2169186 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797467.1 protein_id gnl|my_center|LOCUS_16240 2169198 2171645 gene locus_tag LOCUS_16250 2169198 2171645 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658103.1 protein_id gnl|my_center|LOCUS_16250 2171891 2173222 gene locus_tag LOCUS_16260 2171891 2173222 CDS product IPT/TIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767664.1 protein_id gnl|my_center|LOCUS_16260 2173250 2175391 gene locus_tag LOCUS_16270 2173250 2175391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 2175463 2176524 gene locus_tag LOCUS_16280 2175463 2176524 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225342.1 protein_id gnl|my_center|LOCUS_16280 2176773 2178341 gene locus_tag LOCUS_16290 2176773 2178341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 2178528 2181071 gene locus_tag LOCUS_16300 2178528 2181071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 2181227 2184481 gene locus_tag LOCUS_16310 2181227 2184481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 2184503 2191183 gene locus_tag LOCUS_16320 2184503 2191183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 2192139 2191396 gene locus_tag LOCUS_16330 2192139 2191396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 2192338 2193291 gene locus_tag LOCUS_16340 2192338 2193291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 2193305 2195320 gene locus_tag LOCUS_16350 2193305 2195320 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767662.1 protein_id gnl|my_center|LOCUS_16350 2195313 2196317 gene locus_tag LOCUS_16360 2195313 2196317 CDS product DUF4973 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767661.1 protein_id gnl|my_center|LOCUS_16360 2196332 2197456 gene locus_tag LOCUS_16370 2196332 2197456 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770127.1 protein_id gnl|my_center|LOCUS_16370 2197779 2200952 gene locus_tag LOCUS_16380 2197779 2200952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 2202344 2201106 gene locus_tag LOCUS_16390 2202344 2201106 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203542.1 protein_id gnl|my_center|LOCUS_16390 2203387 2202344 gene locus_tag LOCUS_16400 2203387 2202344 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791708.1 protein_id gnl|my_center|LOCUS_16400 2204527 2203535 gene locus_tag LOCUS_16410 2204527 2203535 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799152.1 protein_id gnl|my_center|LOCUS_16410 2206041 2204569 gene locus_tag LOCUS_16420 2206041 2204569 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791704.1 protein_id gnl|my_center|LOCUS_16420 2207584 2206712 gene locus_tag LOCUS_16430 2207584 2206712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791694.1 protein_id gnl|my_center|LOCUS_16430 2207908 2208849 gene locus_tag LOCUS_16440 gene mdh 2207908 2208849 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760830.1 protein_id gnl|my_center|LOCUS_16440 2208949 2209143 gene locus_tag LOCUS_16450 2208949 2209143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 2209151 2210701 gene locus_tag LOCUS_16460 2209151 2210701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 2216955 2210827 gene locus_tag LOCUS_16470 2216955 2210827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 2219174 2217036 gene locus_tag LOCUS_16480 2219174 2217036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 2219489 2221186 gene locus_tag LOCUS_16490 2219489 2221186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 2222095 2221778 gene locus_tag LOCUS_16500 2222095 2221778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 2222621 2224140 gene locus_tag LOCUS_r00040 2222621 2224140 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2224293 2224367 gene locus_tag LOCUS_t00300 2224293 2224367 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 2224444 2224518 gene locus_tag LOCUS_t00310 2224444 2224518 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2224649 2227521 gene locus_tag LOCUS_r00050 2224649 2227521 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2227599 2227705 gene locus_tag LOCUS_r00060 2227599 2227705 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2229113 2228871 gene locus_tag LOCUS_16510 2229113 2228871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 2229010 2229372 gene locus_tag LOCUS_16520 2229010 2229372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 2229520 2230332 gene locus_tag LOCUS_16530 2229520 2230332 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792006.1 protein_id gnl|my_center|LOCUS_16530 2230360 2230965 gene locus_tag LOCUS_16540 2230360 2230965 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792004.1 protein_id gnl|my_center|LOCUS_16540 2230978 2231628 gene locus_tag LOCUS_16550 2230978 2231628 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792003.1 protein_id gnl|my_center|LOCUS_16550 2231659 2232474 gene locus_tag LOCUS_16560 2231659 2232474 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792001.1 protein_id gnl|my_center|LOCUS_16560 2232476 2233423 gene locus_tag LOCUS_16570 2232476 2233423 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791999.1 protein_id gnl|my_center|LOCUS_16570 2233443 2234876 gene locus_tag LOCUS_16580 2233443 2234876 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203594.1 protein_id gnl|my_center|LOCUS_16580 2235188 2235115 gene locus_tag LOCUS_t00320 2235188 2235115 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2235428 2236018 gene locus_tag LOCUS_16590 2235428 2236018 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792010.1 protein_id gnl|my_center|LOCUS_16590 2236034 2236780 gene locus_tag LOCUS_16600 gene fabG 2236034 2236780 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762708.1 protein_id gnl|my_center|LOCUS_16600 2236790 2237461 gene locus_tag LOCUS_16610 2236790 2237461 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766957.1 protein_id gnl|my_center|LOCUS_16610 2238131 2237568 gene locus_tag LOCUS_16620 2238131 2237568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 2238572 2238324 gene locus_tag LOCUS_16630 2238572 2238324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 2238873 2238649 gene locus_tag LOCUS_16640 2238873 2238649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 2241006 2239618 gene locus_tag LOCUS_16650 2241006 2239618 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762735.1 protein_id gnl|my_center|LOCUS_16650 2241129 2241929 gene locus_tag LOCUS_16660 2241129 2241929 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762736.1 protein_id gnl|my_center|LOCUS_16660 2241974 2243212 gene locus_tag LOCUS_16670 2241974 2243212 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792023.1 protein_id gnl|my_center|LOCUS_16670 2243259 2244611 gene locus_tag LOCUS_16680 2243259 2244611 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804263.1 protein_id gnl|my_center|LOCUS_16680 2244629 2246965 gene locus_tag LOCUS_16690 2244629 2246965 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108984.1 protein_id gnl|my_center|LOCUS_16690 2247101 2251636 gene locus_tag LOCUS_16700 2247101 2251636 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203588.1 protein_id gnl|my_center|LOCUS_16700 2251641 2254019 gene locus_tag LOCUS_16710 2251641 2254019 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203587.1 protein_id gnl|my_center|LOCUS_16710 2254143 2255045 gene locus_tag LOCUS_16720 2254143 2255045 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_16720 2255216 2256202 gene locus_tag LOCUS_16730 2255216 2256202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 2256212 2257186 gene locus_tag LOCUS_16740 2256212 2257186 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494136.1 protein_id gnl|my_center|LOCUS_16740 2257275 2258117 gene locus_tag LOCUS_16750 2257275 2258117 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965644.1 protein_id gnl|my_center|LOCUS_16750 2259401 2258112 gene locus_tag LOCUS_16760 2259401 2258112 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963428.1 protein_id gnl|my_center|LOCUS_16760 2260410 2259415 gene locus_tag LOCUS_16770 2260410 2259415 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963429.1 protein_id gnl|my_center|LOCUS_16770 2260616 2261872 gene locus_tag LOCUS_16780 2260616 2261872 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786996.1 protein_id gnl|my_center|LOCUS_16780 2262663 2264624 gene locus_tag LOCUS_16790 2262663 2264624 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108986.1 protein_id gnl|my_center|LOCUS_16790 2264702 2266696 gene locus_tag LOCUS_16800 2264702 2266696 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814533.1 protein_id gnl|my_center|LOCUS_16800 2266848 2268371 gene locus_tag LOCUS_16810 gene purH 2266848 2268371 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792044.1 protein_id gnl|my_center|LOCUS_16810 2268431 2269453 gene locus_tag LOCUS_16820 2268431 2269453 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762747.1 protein_id gnl|my_center|LOCUS_16820 2269464 2270306 gene locus_tag LOCUS_16830 gene mreC 2269464 2270306 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766925.1 protein_id gnl|my_center|LOCUS_16830 2270607 2270419 gene locus_tag LOCUS_16840 2270607 2270419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 2270806 2272662 gene locus_tag LOCUS_16850 gene mrdA 2270806 2272662 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792058.1 protein_id gnl|my_center|LOCUS_16850 2272643 2274100 gene locus_tag LOCUS_16860 gene rodA 2272643 2274100 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792061.1 protein_id gnl|my_center|LOCUS_16860 2274569 2274102 gene locus_tag LOCUS_16870 2274569 2274102 CDS product gliding motility lipoprotein GldH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799202.1 protein_id gnl|my_center|LOCUS_16870 2276121 2274547 gene locus_tag LOCUS_16880 gene ricT 2276121 2274547 CDS product regulatory iron-sulfur-containing complex subunit RicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203582.1 protein_id gnl|my_center|LOCUS_16880 2277325 2276216 gene locus_tag LOCUS_16890 2277325 2276216 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799206.1 protein_id gnl|my_center|LOCUS_16890 2278330 2277377 gene locus_tag LOCUS_16900 gene metF 2278330 2277377 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766920.1 protein_id gnl|my_center|LOCUS_16900 2279721 2281240 gene locus_tag LOCUS_r00070 2279721 2281240 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2281393 2281467 gene locus_tag LOCUS_t00330 2281393 2281467 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 2281544 2281618 gene locus_tag LOCUS_t00340 2281544 2281618 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2281749 2284621 gene locus_tag LOCUS_r00080 2281749 2284621 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2284699 2284805 gene locus_tag LOCUS_r00090 2284699 2284805 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2286052 2285180 gene locus_tag LOCUS_16910 2286052 2285180 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203537.1 protein_id gnl|my_center|LOCUS_16910 2286156 2286869 gene locus_tag LOCUS_16920 2286156 2286869 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760838.1 protein_id gnl|my_center|LOCUS_16920 2286869 2287591 gene locus_tag LOCUS_16930 2286869 2287591 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791129.1 protein_id gnl|my_center|LOCUS_16930 2287600 2288019 gene locus_tag LOCUS_16940 2287600 2288019 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791127.1 protein_id gnl|my_center|LOCUS_16940 2288023 2288859 gene locus_tag LOCUS_16950 2288023 2288859 CDS product TonB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203535.1 protein_id gnl|my_center|LOCUS_16950 2288884 2289435 gene locus_tag LOCUS_16960 2288884 2289435 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760842.1 protein_id gnl|my_center|LOCUS_16960 2289440 2290108 gene locus_tag LOCUS_16970 2289440 2290108 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791123.1 protein_id gnl|my_center|LOCUS_16970 2290096 2292192 gene locus_tag LOCUS_16980 gene recG 2290096 2292192 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791121.1 protein_id gnl|my_center|LOCUS_16980 2292414 2292878 gene locus_tag LOCUS_16990 gene ndk 2292414 2292878 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770040.1 protein_id gnl|my_center|LOCUS_16990 2292896 2293780 gene locus_tag LOCUS_17000 2292896 2293780 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770039.1 protein_id gnl|my_center|LOCUS_17000 2293972 2294514 gene locus_tag LOCUS_17010 2293972 2294514 CDS product DUF1599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109023.1 protein_id gnl|my_center|LOCUS_17010 2294798 2295865 gene locus_tag LOCUS_17020 2294798 2295865 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105100232.1 protein_id gnl|my_center|LOCUS_17020 2295917 2296672 gene locus_tag LOCUS_17030 gene tpiA 2295917 2296672 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791115.1 protein_id gnl|my_center|LOCUS_17030 2296729 2297172 gene locus_tag LOCUS_17040 2296729 2297172 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760850.1 protein_id gnl|my_center|LOCUS_17040 2297180 2297761 gene locus_tag LOCUS_17050 gene folE 2297180 2297761 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760851.1 protein_id gnl|my_center|LOCUS_17050 2300335 2298302 gene locus_tag LOCUS_17060 gene dnaG 2300335 2298302 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802118.1 protein_id gnl|my_center|LOCUS_17060 2300506 2301429 gene locus_tag LOCUS_17070 2300506 2301429 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203118.1 protein_id gnl|my_center|LOCUS_17070 2302358 2301585 gene locus_tag LOCUS_17080 2302358 2301585 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760853.1 protein_id gnl|my_center|LOCUS_17080 2303489 2302425 gene locus_tag LOCUS_17090 2303489 2302425 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791103.1 protein_id gnl|my_center|LOCUS_17090 2304981 2303776 gene locus_tag LOCUS_17100 2304981 2303776 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760855.1 protein_id gnl|my_center|LOCUS_17100 2305804 2304956 gene locus_tag LOCUS_17110 2305804 2304956 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760856.1 protein_id gnl|my_center|LOCUS_17110 2307138 2306170 gene locus_tag LOCUS_17120 2307138 2306170 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203527.1 protein_id gnl|my_center|LOCUS_17120 2309142 2307244 gene locus_tag LOCUS_17130 2309142 2307244 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203526.1 protein_id gnl|my_center|LOCUS_17130 2310958 2309234 gene locus_tag LOCUS_17140 gene recJ 2310958 2309234 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760859.1 protein_id gnl|my_center|LOCUS_17140 2311798 2311139 gene locus_tag LOCUS_17150 2311798 2311139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 2312428 2311907 gene locus_tag LOCUS_17160 2312428 2311907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 2313330 2312896 gene locus_tag LOCUS_17170 2313330 2312896 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791034.1 protein_id gnl|my_center|LOCUS_17170 2313411 2313974 gene locus_tag LOCUS_17180 2313411 2313974 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109029.1 protein_id gnl|my_center|LOCUS_17180 2313983 2315773 gene locus_tag LOCUS_17190 2313983 2315773 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029327287.1 protein_id gnl|my_center|LOCUS_17190 2315800 2316798 gene locus_tag LOCUS_17200 gene fmt 2315800 2316798 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770001.1 protein_id gnl|my_center|LOCUS_17200 2316931 2317524 gene locus_tag LOCUS_17210 2316931 2317524 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_17210 2317849 2318499 gene locus_tag LOCUS_17220 gene rpe 2317849 2318499 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802152.1 protein_id gnl|my_center|LOCUS_17220 2318745 2320664 gene locus_tag LOCUS_17230 2318745 2320664 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203504.1 protein_id gnl|my_center|LOCUS_17230 2320717 2321769 gene locus_tag LOCUS_17240 2320717 2321769 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760868.1 protein_id gnl|my_center|LOCUS_17240 2321887 2322594 gene locus_tag LOCUS_17250 2321887 2322594 CDS product DUF4827 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657631.1 protein_id gnl|my_center|LOCUS_17250 2322635 2324026 gene locus_tag LOCUS_17260 gene glmM 2322635 2324026 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791020.1 protein_id gnl|my_center|LOCUS_17260 2324923 2324456 gene locus_tag LOCUS_17270 2324923 2324456 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766442.1 protein_id gnl|my_center|LOCUS_17270 2325355 2325005 gene locus_tag LOCUS_17280 2325355 2325005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764599.1 protein_id gnl|my_center|LOCUS_17280 2325832 2325362 gene locus_tag LOCUS_17290 2325832 2325362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 2326222 2327787 gene locus_tag LOCUS_17300 2326222 2327787 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766109.1 protein_id gnl|my_center|LOCUS_17300 2329049 2328447 gene locus_tag LOCUS_17310 2329049 2328447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 2329986 2328985 gene locus_tag LOCUS_17320 2329986 2328985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 2330338 2330880 gene locus_tag LOCUS_17330 2330338 2330880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 2331079 2331621 gene locus_tag LOCUS_17340 2331079 2331621 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802164.1 protein_id gnl|my_center|LOCUS_17340 2332155 2331628 gene locus_tag LOCUS_17350 2332155 2331628 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760888.1 protein_id gnl|my_center|LOCUS_17350 2333413 2332178 gene locus_tag LOCUS_17360 2333413 2332178 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203495.1 protein_id gnl|my_center|LOCUS_17360 2333496 2334548 gene locus_tag LOCUS_17370 2333496 2334548 CDS product DUF2027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203494.1 protein_id gnl|my_center|LOCUS_17370 2334980 2334624 gene locus_tag LOCUS_17380 2334980 2334624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790982.1 protein_id gnl|my_center|LOCUS_17380 2335831 2335229 gene locus_tag LOCUS_17390 2335831 2335229 CDS product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798230.1 protein_id gnl|my_center|LOCUS_17390 2336166 2335828 gene locus_tag LOCUS_17400 2336166 2335828 CDS product LysO family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763960.1 protein_id gnl|my_center|LOCUS_17400 2336884 2336204 gene locus_tag LOCUS_17410 2336884 2336204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 2338015 2336984 gene locus_tag LOCUS_17420 2338015 2336984 CDS product DUF4249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763957.1 protein_id gnl|my_center|LOCUS_17420 2340747 2338021 gene locus_tag LOCUS_17430 2340747 2338021 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203489.1 protein_id gnl|my_center|LOCUS_17430 2341634 2340744 gene locus_tag LOCUS_17440 2341634 2340744 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790969.1 protein_id gnl|my_center|LOCUS_17440 2342064 2341645 gene locus_tag LOCUS_17450 2342064 2341645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763954.1 protein_id gnl|my_center|LOCUS_17450 2342707 2342153 gene locus_tag LOCUS_17460 2342707 2342153 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798225.1 protein_id gnl|my_center|LOCUS_17460 2343918 2342770 gene locus_tag LOCUS_17470 gene hemW 2343918 2342770 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203488.1 protein_id gnl|my_center|LOCUS_17470 2344390 2344806 gene locus_tag LOCUS_17480 2344390 2344806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 2344895 2345143 gene locus_tag LOCUS_17490 2344895 2345143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 2345140 2345319 gene locus_tag LOCUS_17500 2345140 2345319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 2346154 2348310 gene locus_tag LOCUS_17510 2346154 2348310 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763951.1 protein_id gnl|my_center|LOCUS_17510 2348575 2350128 gene locus_tag LOCUS_17520 2348575 2350128 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790953.1 protein_id gnl|my_center|LOCUS_17520 2350133 2350834 gene locus_tag LOCUS_17530 2350133 2350834 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005678712.1 protein_id gnl|my_center|LOCUS_17530 2351083 2350907 gene locus_tag LOCUS_17540 2351083 2350907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 2351650 2351204 gene locus_tag LOCUS_17550 2351650 2351204 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790948.1 protein_id gnl|my_center|LOCUS_17550 2351814 2352158 gene locus_tag LOCUS_17560 gene rpsF 2351814 2352158 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759739.1 protein_id gnl|my_center|LOCUS_17560 2352161 2352433 gene locus_tag LOCUS_17570 gene rpsR 2352161 2352433 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790946.1 protein_id gnl|my_center|LOCUS_17570 2352448 2352891 gene locus_tag LOCUS_17580 gene rplI 2352448 2352891 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769978.1 protein_id gnl|my_center|LOCUS_17580 2353501 2353250 gene locus_tag LOCUS_17590 2353501 2353250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 2355304 2353631 gene locus_tag LOCUS_17600 2355304 2353631 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798215.1 protein_id gnl|my_center|LOCUS_17600 2355477 2356793 gene locus_tag LOCUS_17610 gene mtaB 2355477 2356793 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763943.1 protein_id gnl|my_center|LOCUS_17610 2356797 2357828 gene locus_tag LOCUS_17620 2356797 2357828 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759752.1 protein_id gnl|my_center|LOCUS_17620 2357828 2358358 gene locus_tag LOCUS_17630 2357828 2358358 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790931.1 protein_id gnl|my_center|LOCUS_17630 2360326 2358938 gene locus_tag LOCUS_17640 2360326 2358938 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203446.1 protein_id gnl|my_center|LOCUS_17640 2361450 2360374 gene locus_tag LOCUS_17650 gene aroC 2361450 2360374 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802245.1 protein_id gnl|my_center|LOCUS_17650 2362381 2361524 gene locus_tag LOCUS_17660 2362381 2361524 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022470046.1 protein_id gnl|my_center|LOCUS_17660 2362565 2365873 gene locus_tag LOCUS_17670 2362565 2365873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 2367359 2366175 gene locus_tag LOCUS_17680 2367359 2366175 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405075.1 protein_id gnl|my_center|LOCUS_17680 2368158 2367457 gene locus_tag LOCUS_17690 2368158 2367457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 2368954 2368187 gene locus_tag LOCUS_17700 2368954 2368187 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798129.1 protein_id gnl|my_center|LOCUS_17700 2370111 2368975 gene locus_tag LOCUS_17710 2370111 2368975 CDS product PCMD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766479.1 protein_id gnl|my_center|LOCUS_17710 2370453 2371736 gene locus_tag LOCUS_17720 2370453 2371736 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798122.1 protein_id gnl|my_center|LOCUS_17720 2372474 2371881 gene locus_tag LOCUS_17730 2372474 2371881 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790721.1 protein_id gnl|my_center|LOCUS_17730 2373373 2375178 gene locus_tag LOCUS_17740 gene ilvD 2373373 2375178 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761033.1 protein_id gnl|my_center|LOCUS_17740 2375248 2376942 gene locus_tag LOCUS_17750 gene ilvB 2375248 2376942 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790701.1 protein_id gnl|my_center|LOCUS_17750 2377031 2377588 gene locus_tag LOCUS_17760 gene ilvN 2377031 2377588 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790699.1 protein_id gnl|my_center|LOCUS_17760 2377596 2378195 gene locus_tag LOCUS_17770 2377596 2378195 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766475.1 protein_id gnl|my_center|LOCUS_17770 2378262 2379323 gene locus_tag LOCUS_17780 2378262 2379323 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225342.1 protein_id gnl|my_center|LOCUS_17780 2379524 2379661 gene locus_tag LOCUS_17790 2379524 2379661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 2379724 2380770 gene locus_tag LOCUS_17800 gene ilvC 2379724 2380770 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790693.1 protein_id gnl|my_center|LOCUS_17800 2380910 2383594 gene locus_tag LOCUS_17810 2380910 2383594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 2388154 2383736 gene locus_tag LOCUS_17820 2388154 2383736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 2389239 2388157 gene locus_tag LOCUS_17830 2389239 2388157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 2391459 2389546 gene locus_tag LOCUS_17840 2391459 2389546 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695901.1 protein_id gnl|my_center|LOCUS_17840 2391832 2394081 gene locus_tag LOCUS_17850 2391832 2394081 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108124.1 protein_id gnl|my_center|LOCUS_17850 2394109 2395302 gene locus_tag LOCUS_17860 gene icd 2394109 2395302 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108123.1 protein_id gnl|my_center|LOCUS_17860 2395318 2396661 gene locus_tag LOCUS_17870 2395318 2396661 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790680.1 protein_id gnl|my_center|LOCUS_17870 2396798 2397565 gene locus_tag LOCUS_17880 2396798 2397565 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657484.1 protein_id gnl|my_center|LOCUS_17880 2397591 2398814 gene locus_tag LOCUS_17890 2397591 2398814 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769934.1 protein_id gnl|my_center|LOCUS_17890 2398814 2399662 gene locus_tag LOCUS_17900 2398814 2399662 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108118.1 protein_id gnl|my_center|LOCUS_17900 2400795 2399815 gene locus_tag LOCUS_17910 gene pfkA 2400795 2399815 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761048.1 protein_id gnl|my_center|LOCUS_17910 2401056 2402045 gene locus_tag LOCUS_17920 2401056 2402045 CDS product Tsr26 family tyrosine-type DNA invertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797599.1 protein_id gnl|my_center|LOCUS_17920 2402462 2402755 gene locus_tag LOCUS_17930 2402462 2402755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 2402778 2404091 gene locus_tag LOCUS_17940 2402778 2404091 CDS product DUF3575 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108610.1 protein_id gnl|my_center|LOCUS_17940 2404088 2405122 gene locus_tag LOCUS_17950 2404088 2405122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 2405179 2406315 gene locus_tag LOCUS_17960 2405179 2406315 CDS product fimbrillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203742.1 protein_id gnl|my_center|LOCUS_17960 2406403 2407455 gene locus_tag LOCUS_17970 2406403 2407455 CDS product fimbrillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203742.1 protein_id gnl|my_center|LOCUS_17970 2407526 2409238 gene locus_tag LOCUS_17980 2407526 2409238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 2410215 2409337 gene locus_tag LOCUS_17990 2410215 2409337 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797949.1 protein_id gnl|my_center|LOCUS_17990 2410926 2410291 gene locus_tag LOCUS_18000 gene cmk 2410926 2410291 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761050.1 protein_id gnl|my_center|LOCUS_18000 2412013 2411075 gene locus_tag LOCUS_18010 gene porQ 2412013 2411075 CDS product type IX secretion system protein PorQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963823.1 protein_id gnl|my_center|LOCUS_18010 2412155 2412841 gene locus_tag LOCUS_18020 2412155 2412841 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761051.1 protein_id gnl|my_center|LOCUS_18020 2412870 2413898 gene locus_tag LOCUS_18030 2412870 2413898 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203421.1 protein_id gnl|my_center|LOCUS_18030 2413905 2414606 gene locus_tag LOCUS_18040 2413905 2414606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790656.1 protein_id gnl|my_center|LOCUS_18040 2414618 2415394 gene locus_tag LOCUS_18050 2414618 2415394 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108111.1 protein_id gnl|my_center|LOCUS_18050 2415516 2415604 gene locus_tag LOCUS_t00350 2415516 2415604 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2415679 2416485 gene locus_tag LOCUS_18060 2415679 2416485 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790652.1 protein_id gnl|my_center|LOCUS_18060 2416492 2416977 gene locus_tag LOCUS_18070 2416492 2416977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761056.1 protein_id gnl|my_center|LOCUS_18070 2417110 2417607 gene locus_tag LOCUS_18080 2417110 2417607 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790648.1 protein_id gnl|my_center|LOCUS_18080 2417607 2418071 gene locus_tag LOCUS_18090 2417607 2418071 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781259.1 protein_id gnl|my_center|LOCUS_18090 2418755 2418222 gene locus_tag LOCUS_18100 2418755 2418222 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766462.1 protein_id gnl|my_center|LOCUS_18100 2420149 2418869 gene locus_tag LOCUS_18110 2420149 2418869 CDS product IgA Peptidase M64 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766461.1 protein_id gnl|my_center|LOCUS_18110 2420300 2420782 gene locus_tag LOCUS_18120 2420300 2420782 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790644.1 protein_id gnl|my_center|LOCUS_18120 2421384 2420890 gene locus_tag LOCUS_18130 2421384 2420890 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766460.1 protein_id gnl|my_center|LOCUS_18130 2422224 2421430 gene locus_tag LOCUS_18140 2422224 2421430 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761063.1 protein_id gnl|my_center|LOCUS_18140 2423852 2422611 gene locus_tag LOCUS_18150 gene cls 2423852 2422611 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203419.1 protein_id gnl|my_center|LOCUS_18150 2424646 2424320 gene locus_tag LOCUS_18160 2424646 2424320 CDS product DUF5056 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790636.1 protein_id gnl|my_center|LOCUS_18160 2425178 2424630 gene locus_tag LOCUS_18170 2425178 2424630 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761066.1 protein_id gnl|my_center|LOCUS_18170 2425834 2425175 gene locus_tag LOCUS_18180 2425834 2425175 CDS product DUF6249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790632.1 protein_id gnl|my_center|LOCUS_18180 2425940 2427415 gene locus_tag LOCUS_18190 2425940 2427415 CDS product rRNA cytosine-C5-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203417.1 protein_id gnl|my_center|LOCUS_18190 2427968 2428438 gene locus_tag LOCUS_18200 2427968 2428438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 2428506 2429441 gene locus_tag LOCUS_18210 2428506 2429441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 2429467 2431323 gene locus_tag LOCUS_18220 2429467 2431323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18220 2431355 2431525 gene locus_tag LOCUS_18230 2431355 2431525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 2432694 2431516 gene locus_tag LOCUS_18240 2432694 2431516 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790620.1 protein_id gnl|my_center|LOCUS_18240 2436021 2432887 gene locus_tag LOCUS_18250 2436021 2432887 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790618.1 protein_id gnl|my_center|LOCUS_18250 2437299 2436070 gene locus_tag LOCUS_18260 2437299 2436070 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657461.1 protein_id gnl|my_center|LOCUS_18260 2439819 2438182 gene locus_tag LOCUS_18270 2439819 2438182 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797936.1 protein_id gnl|my_center|LOCUS_18270 2439935 2440345 gene locus_tag LOCUS_18280 2439935 2440345 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790608.1 protein_id gnl|my_center|LOCUS_18280 2442830 2440527 gene locus_tag LOCUS_18290 2442830 2440527 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790607.1 protein_id gnl|my_center|LOCUS_18290 2444953 2442836 gene locus_tag LOCUS_18300 2444953 2442836 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657449.1 protein_id gnl|my_center|LOCUS_18300 2444969 2445460 gene locus_tag LOCUS_18310 2444969 2445460 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766431.1 protein_id gnl|my_center|LOCUS_18310 2446308 2445463 gene locus_tag LOCUS_18320 2446308 2445463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109018.1 protein_id gnl|my_center|LOCUS_18320 2446906 2446367 gene locus_tag LOCUS_18330 2446906 2446367 CDS product DUF5034 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109017.1 protein_id gnl|my_center|LOCUS_18330 2447162 2447950 gene locus_tag LOCUS_18340 gene rfbA 2447162 2447950 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108090.1 protein_id gnl|my_center|LOCUS_18340 2447973 2449112 gene locus_tag LOCUS_18350 gene rfbB 2447973 2449112 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203413.1 protein_id gnl|my_center|LOCUS_18350 2450049 2449156 gene locus_tag LOCUS_18360 2450049 2449156 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766430.1 protein_id gnl|my_center|LOCUS_18360 2450471 2451424 gene locus_tag LOCUS_18370 2450471 2451424 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203412.1 protein_id gnl|my_center|LOCUS_18370 2451831 2451463 gene locus_tag LOCUS_18380 gene folB 2451831 2451463 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759754.1 protein_id gnl|my_center|LOCUS_18380 2455253 2452554 gene locus_tag LOCUS_18390 2455253 2452554 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203461.1 protein_id gnl|my_center|LOCUS_18390 2457969 2455432 gene locus_tag LOCUS_18400 2457969 2455432 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769973.1 protein_id gnl|my_center|LOCUS_18400 2458256 2458996 gene locus_tag LOCUS_18410 2458256 2458996 CDS product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763940.1 protein_id gnl|my_center|LOCUS_18410 2460516 2459095 gene locus_tag LOCUS_18420 gene dnaA 2460516 2459095 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759760.1 protein_id gnl|my_center|LOCUS_18420 2461761 2460868 gene locus_tag LOCUS_18430 2461761 2460868 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790918.1 protein_id gnl|my_center|LOCUS_18430 2462907 2461771 gene locus_tag LOCUS_18440 2462907 2461771 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840465.1 protein_id gnl|my_center|LOCUS_18440 2463157 2464053 gene locus_tag LOCUS_18450 2463157 2464053 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790916.1 protein_id gnl|my_center|LOCUS_18450 2464232 2465425 gene locus_tag LOCUS_18460 2464232 2465425 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777415.1 protein_id gnl|my_center|LOCUS_18460 2465537 2466460 gene locus_tag LOCUS_18470 2465537 2466460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 2466592 2466879 gene locus_tag LOCUS_18480 2466592 2466879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 2466885 2467958 gene locus_tag LOCUS_18490 2466885 2467958 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203014.1 protein_id gnl|my_center|LOCUS_18490 2468123 2469088 gene locus_tag LOCUS_18500 2468123 2469088 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816488.1 protein_id gnl|my_center|LOCUS_18500 2469234 2469617 gene locus_tag LOCUS_18510 2469234 2469617 CDS product mobilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108661.1 protein_id gnl|my_center|LOCUS_18510 2469583 2470503 gene locus_tag LOCUS_18520 2469583 2470503 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005944378.1 protein_id gnl|my_center|LOCUS_18520 2470508 2471227 gene locus_tag LOCUS_18530 2470508 2471227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 2471639 2471280 gene locus_tag LOCUS_18540 2471639 2471280 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007485505.1 protein_id gnl|my_center|LOCUS_18540 2472138 2471743 gene locus_tag LOCUS_18550 2472138 2471743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203317.1 protein_id gnl|my_center|LOCUS_18550 2472355 2472116 gene locus_tag LOCUS_18560 2472355 2472116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292732.1 protein_id gnl|my_center|LOCUS_18560 2473319 2472387 gene locus_tag LOCUS_18570 2473319 2472387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 2473942 2473316 gene locus_tag LOCUS_18580 2473942 2473316 CDS product Type 1 glutamine amidotransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723214.1 protein_id gnl|my_center|LOCUS_18580 2475754 2474948 gene locus_tag LOCUS_18590 2475754 2474948 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797186.1 protein_id gnl|my_center|LOCUS_18590 2476782 2475751 gene locus_tag LOCUS_18600 2476782 2475751 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661662.1 protein_id gnl|my_center|LOCUS_18600 2478058 2476844 gene locus_tag LOCUS_18610 2478058 2476844 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107684.1 protein_id gnl|my_center|LOCUS_18610 2481222 2478169 gene locus_tag LOCUS_18620 2481222 2478169 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764996.1 protein_id gnl|my_center|LOCUS_18620 2482298 2481219 gene locus_tag LOCUS_18630 2482298 2481219 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203727.1 protein_id gnl|my_center|LOCUS_18630 2483534 2482686 gene locus_tag LOCUS_18640 2483534 2482686 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764795.1 protein_id gnl|my_center|LOCUS_18640 2484777 2485568 gene locus_tag LOCUS_18650 2484777 2485568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202894.1 protein_id gnl|my_center|LOCUS_18650 2486755 2485592 gene locus_tag LOCUS_18660 2486755 2485592 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108150.1 protein_id gnl|my_center|LOCUS_18660 2486830 2487366 gene locus_tag LOCUS_18670 2486830 2487366 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203456.1 protein_id gnl|my_center|LOCUS_18670 2487512 2490169 gene locus_tag LOCUS_18680 2487512 2490169 CDS product putative LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203455.1 protein_id gnl|my_center|LOCUS_18680 2491073 2490411 gene locus_tag LOCUS_18690 gene ung 2491073 2490411 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798174.1 protein_id gnl|my_center|LOCUS_18690 2492135 2491098 gene locus_tag LOCUS_18700 gene asnA 2492135 2491098 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790904.1 protein_id gnl|my_center|LOCUS_18700 2492357 2492429 gene locus_tag LOCUS_t00360 2492357 2492429 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2493298 2492588 gene locus_tag LOCUS_18710 2493298 2492588 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798173.1 protein_id gnl|my_center|LOCUS_18710 2493361 2493906 gene locus_tag LOCUS_18720 2493361 2493906 CDS product DUF5035 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203454.1 protein_id gnl|my_center|LOCUS_18720 2495776 2493995 gene locus_tag LOCUS_18730 2495776 2493995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 2495937 2499089 gene locus_tag LOCUS_18740 2495937 2499089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 2500544 2499207 gene locus_tag LOCUS_18750 2500544 2499207 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759774.1 protein_id gnl|my_center|LOCUS_18750 2501569 2500574 gene locus_tag LOCUS_18760 2501569 2500574 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781396.1 protein_id gnl|my_center|LOCUS_18760 2503450 2501678 gene locus_tag LOCUS_18770 gene lysS 2503450 2501678 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802230.1 protein_id gnl|my_center|LOCUS_18770 2504303 2505604 gene locus_tag LOCUS_18780 2504303 2505604 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798170.1 protein_id gnl|my_center|LOCUS_18780 2505755 2507065 gene locus_tag LOCUS_18790 2505755 2507065 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839735.1 protein_id gnl|my_center|LOCUS_18790 2507652 2507074 gene locus_tag LOCUS_18800 2507652 2507074 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790890.1 protein_id gnl|my_center|LOCUS_18800 2509033 2507639 gene locus_tag LOCUS_18810 2509033 2507639 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292596.1 protein_id gnl|my_center|LOCUS_18810 2509132 2509761 gene locus_tag LOCUS_18820 2509132 2509761 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_18820 2511645 2509876 gene locus_tag LOCUS_18830 2511645 2509876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 2513632 2511698 gene locus_tag LOCUS_18840 2513632 2511698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 2514975 2513653 gene locus_tag LOCUS_18850 2514975 2513653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 2517011 2515344 gene locus_tag LOCUS_18860 2517011 2515344 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766579.1 protein_id gnl|my_center|LOCUS_18860 2517239 2519137 gene locus_tag LOCUS_18870 gene mutA 2517239 2519137 CDS product methylmalonyl-CoA mutase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203449.1 protein_id gnl|my_center|LOCUS_18870 2519139 2521286 gene locus_tag LOCUS_18880 gene scpA 2519139 2521286 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790883.1 protein_id gnl|my_center|LOCUS_18880 2521539 2523653 gene locus_tag LOCUS_18890 2521539 2523653 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817457.1 protein_id gnl|my_center|LOCUS_18890 2524124 2526100 gene locus_tag LOCUS_18900 2524124 2526100 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964499.1 protein_id gnl|my_center|LOCUS_18900 2526228 2527292 gene locus_tag LOCUS_18910 2526228 2527292 CDS product linear amide C-N hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769957.1 protein_id gnl|my_center|LOCUS_18910 2527913 2527335 gene locus_tag LOCUS_18920 gene nadD 2527913 2527335 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797930.1 protein_id gnl|my_center|LOCUS_18920 2528475 2527906 gene locus_tag LOCUS_18930 gene gmk 2528475 2527906 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048695834.1 protein_id gnl|my_center|LOCUS_18930 2529417 2528551 gene locus_tag LOCUS_18940 2529417 2528551 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761103.1 protein_id gnl|my_center|LOCUS_18940 2529959 2529783 gene locus_tag LOCUS_18950 2529959 2529783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 2530564 2538315 gene locus_tag LOCUS_18960 2530564 2538315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 2540613 2538490 gene locus_tag LOCUS_18970 2540613 2538490 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202779.1 protein_id gnl|my_center|LOCUS_18970 2540789 2541478 gene locus_tag LOCUS_18980 gene tsaB 2540789 2541478 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790587.1 protein_id gnl|my_center|LOCUS_18980 2541590 2542141 gene locus_tag LOCUS_18990 2541590 2542141 CDS product DUF4290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790584.1 protein_id gnl|my_center|LOCUS_18990 2542167 2543471 gene locus_tag LOCUS_19000 gene murA 2542167 2543471 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790583.1 protein_id gnl|my_center|LOCUS_19000 2543468 2544013 gene locus_tag LOCUS_19010 gene rimM 2543468 2544013 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761107.1 protein_id gnl|my_center|LOCUS_19010 2544217 2545077 gene locus_tag LOCUS_19020 2544217 2545077 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817352.1 protein_id gnl|my_center|LOCUS_19020 2545080 2546255 gene locus_tag LOCUS_19030 2545080 2546255 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766370.1 protein_id gnl|my_center|LOCUS_19030 2546282 2547625 gene locus_tag LOCUS_19040 gene rseP 2546282 2547625 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203410.1 protein_id gnl|my_center|LOCUS_19040 2550717 2547787 gene locus_tag LOCUS_19050 2550717 2547787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 2554819 2550818 gene locus_tag LOCUS_19060 2554819 2550818 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108633.1 protein_id gnl|my_center|LOCUS_19060 2557159 2555198 gene locus_tag LOCUS_19070 2557159 2555198 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108524.1 protein_id gnl|my_center|LOCUS_19070 2558158 2557181 gene locus_tag LOCUS_19080 2558158 2557181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 2559861 2558182 gene locus_tag LOCUS_19090 2559861 2558182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 2562966 2559880 gene locus_tag LOCUS_19100 2562966 2559880 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 protein_id gnl|my_center|LOCUS_19100 2564967 2563132 gene locus_tag LOCUS_19110 2564967 2563132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 2566920 2565046 gene locus_tag LOCUS_19120 2566920 2565046 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201936.1 protein_id gnl|my_center|LOCUS_19120 2568877 2567477 gene locus_tag LOCUS_19130 2568877 2567477 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766368.1 protein_id gnl|my_center|LOCUS_19130 2569944 2569135 gene locus_tag LOCUS_19140 2569944 2569135 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202509.1 protein_id gnl|my_center|LOCUS_19140 2570044 2570313 gene locus_tag LOCUS_19150 2570044 2570313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 2571160 2570684 gene locus_tag LOCUS_19160 gene nrdG 2571160 2570684 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203409.1 protein_id gnl|my_center|LOCUS_19160 2573550 2571157 gene locus_tag LOCUS_19170 2573550 2571157 CDS product anaerobic ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790561.1 protein_id gnl|my_center|LOCUS_19170 2574170 2574658 gene locus_tag LOCUS_19180 2574170 2574658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 2575382 2574729 gene locus_tag LOCUS_19190 2575382 2574729 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817347.1 protein_id gnl|my_center|LOCUS_19190 2577348 2575474 gene locus_tag LOCUS_19200 2577348 2575474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 2579363 2577366 gene locus_tag LOCUS_19210 2579363 2577366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 2579715 2579368 gene locus_tag LOCUS_19220 2579715 2579368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 2580793 2579870 gene locus_tag LOCUS_19230 2580793 2579870 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203408.1 protein_id gnl|my_center|LOCUS_19230 2581003 2581593 gene locus_tag LOCUS_19240 gene ruvA 2581003 2581593 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790555.1 protein_id gnl|my_center|LOCUS_19240 2581689 2589020 gene locus_tag LOCUS_19250 gene sprA 2581689 2589020 CDS product cell surface protein SprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062175791.1 protein_id gnl|my_center|LOCUS_19250 2589031 2590017 gene locus_tag LOCUS_19260 2589031 2590017 CDS product DUF3843 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761131.1 protein_id gnl|my_center|LOCUS_19260 2590351 2590133 gene locus_tag LOCUS_19270 2590351 2590133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 2590471 2591172 gene locus_tag LOCUS_19280 gene rpiA 2590471 2591172 CDS product ribose 5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790542.1 protein_id gnl|my_center|LOCUS_19280 2591694 2591173 gene locus_tag LOCUS_19290 2591694 2591173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 2592601 2591765 gene locus_tag LOCUS_19300 2592601 2591765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790485.1 protein_id gnl|my_center|LOCUS_19300 2592806 2594239 gene locus_tag LOCUS_19310 2592806 2594239 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303110.1 protein_id gnl|my_center|LOCUS_19310 2594467 2596623 gene locus_tag LOCUS_19320 2594467 2596623 CDS product WD40 repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790480.1 protein_id gnl|my_center|LOCUS_19320 2596631 2599405 gene locus_tag LOCUS_19330 2596631 2599405 CDS product caspase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790478.1 protein_id gnl|my_center|LOCUS_19330 2599611 2600489 gene locus_tag LOCUS_19340 2599611 2600489 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211685.1 protein_id gnl|my_center|LOCUS_19340 2601620 2600751 gene locus_tag LOCUS_19350 2601620 2600751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 2602097 2601633 gene locus_tag LOCUS_19360 2602097 2601633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 2602866 2602549 gene locus_tag LOCUS_19370 2602866 2602549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 2603050 2602871 gene locus_tag LOCUS_19380 2603050 2602871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 2605753 2604077 gene locus_tag LOCUS_19390 gene malL 2605753 2604077 CDS product oligo-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415207.1 protein_id gnl|my_center|LOCUS_19390 2605830 2607299 gene locus_tag LOCUS_19400 2605830 2607299 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203184.1 protein_id gnl|my_center|LOCUS_19400 2607303 2608220 gene locus_tag LOCUS_19410 2607303 2608220 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203185.1 protein_id gnl|my_center|LOCUS_19410 2608367 2609347 gene locus_tag LOCUS_19420 2608367 2609347 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783903.1 protein_id gnl|my_center|LOCUS_19420 2609418 2611190 gene locus_tag LOCUS_19430 gene fucI 2609418 2611190 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779363.1 protein_id gnl|my_center|LOCUS_19430 2611222 2611860 gene locus_tag LOCUS_19440 2611222 2611860 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783908.1 protein_id gnl|my_center|LOCUS_19440 2611857 2613251 gene locus_tag LOCUS_19450 2611857 2613251 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783910.1 protein_id gnl|my_center|LOCUS_19450 2613267 2613653 gene locus_tag LOCUS_19460 2613267 2613653 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764989.1 protein_id gnl|my_center|LOCUS_19460 2613682 2614998 gene locus_tag LOCUS_19470 gene fucP 2613682 2614998 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201906.1 protein_id gnl|my_center|LOCUS_19470 2616320 2615148 gene locus_tag LOCUS_19480 2616320 2615148 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790476.1 protein_id gnl|my_center|LOCUS_19480 2617825 2616488 gene locus_tag LOCUS_19490 gene gdhA 2617825 2616488 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766346.1 protein_id gnl|my_center|LOCUS_19490 2620151 2618037 gene locus_tag LOCUS_19500 2620151 2618037 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073344531.1 protein_id gnl|my_center|LOCUS_19500 2620517 2622850 gene locus_tag LOCUS_19510 2620517 2622850 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764307.1 protein_id gnl|my_center|LOCUS_19510 2622931 2625903 gene locus_tag LOCUS_19520 2622931 2625903 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761136.1 protein_id gnl|my_center|LOCUS_19520 2627542 2626208 gene locus_tag LOCUS_19530 2627542 2626208 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108072.1 protein_id gnl|my_center|LOCUS_19530 2630227 2627939 gene locus_tag LOCUS_19540 2630227 2627939 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790429.1 protein_id gnl|my_center|LOCUS_19540 2630858 2630409 gene locus_tag LOCUS_19550 2630858 2630409 CDS product PepSY-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790420.1 protein_id gnl|my_center|LOCUS_19550 2631799 2630951 gene locus_tag LOCUS_19560 2631799 2630951 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108071.1 protein_id gnl|my_center|LOCUS_19560 2631997 2633148 gene locus_tag LOCUS_19570 2631997 2633148 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108070.1 protein_id gnl|my_center|LOCUS_19570 2633152 2636349 gene locus_tag LOCUS_19580 2633152 2636349 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203349.1 protein_id gnl|my_center|LOCUS_19580 2636575 2637942 gene locus_tag LOCUS_19590 2636575 2637942 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303116.1 protein_id gnl|my_center|LOCUS_19590 2637967 2638575 gene locus_tag LOCUS_19600 2637967 2638575 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108067.1 protein_id gnl|my_center|LOCUS_19600 2639991 2638711 gene locus_tag LOCUS_19610 2639991 2638711 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_19610 2640136 2641197 gene locus_tag LOCUS_19620 2640136 2641197 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797797.1 protein_id gnl|my_center|LOCUS_19620 2642043 2642300 gene locus_tag LOCUS_19630 2642043 2642300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797802.1 protein_id gnl|my_center|LOCUS_19630 2642314 2643387 gene locus_tag LOCUS_19640 2642314 2643387 CDS product choloylglycine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263137.1 protein_id gnl|my_center|LOCUS_19640 2644582 2643416 gene locus_tag LOCUS_19650 2644582 2643416 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803026.1 protein_id gnl|my_center|LOCUS_19650 2645839 2644661 gene locus_tag LOCUS_19660 gene pncB 2645839 2644661 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203338.1 protein_id gnl|my_center|LOCUS_19660 2646772 2645993 gene locus_tag LOCUS_19670 2646772 2645993 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203333.1 protein_id gnl|my_center|LOCUS_19670 2647856 2647353 gene locus_tag LOCUS_19680 2647856 2647353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797760.1 protein_id gnl|my_center|LOCUS_19680 2647919 2648116 gene locus_tag LOCUS_19690 2647919 2648116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 2648160 2649023 gene locus_tag LOCUS_19700 2648160 2649023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769810.1 protein_id gnl|my_center|LOCUS_19700 2649023 2649424 gene locus_tag LOCUS_19710 2649023 2649424 CDS product DUF393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790233.1 protein_id gnl|my_center|LOCUS_19710 2650294 2649437 gene locus_tag LOCUS_19720 2650294 2649437 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108046.1 protein_id gnl|my_center|LOCUS_19720 2650449 2650724 gene locus_tag LOCUS_19730 2650449 2650724 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762348.1 protein_id gnl|my_center|LOCUS_19730 2651159 2650920 gene locus_tag LOCUS_19740 2651159 2650920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 2652376 2651258 gene locus_tag LOCUS_19750 2652376 2651258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 2652581 2653408 gene locus_tag LOCUS_19760 2652581 2653408 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435784.1 protein_id gnl|my_center|LOCUS_19760 2653769 2655061 gene locus_tag LOCUS_19770 2653769 2655061 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108042.1 protein_id gnl|my_center|LOCUS_19770 2655075 2655707 gene locus_tag LOCUS_19780 2655075 2655707 CDS product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108273.1 protein_id gnl|my_center|LOCUS_19780 2656885 2655911 gene locus_tag LOCUS_19790 2656885 2655911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 2657136 2656882 gene locus_tag LOCUS_19800 2657136 2656882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 2658827 2657829 gene locus_tag LOCUS_19810 2658827 2657829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 2659575 2659120 gene locus_tag LOCUS_19820 2659575 2659120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 2660636 2659572 gene locus_tag LOCUS_19830 2660636 2659572 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125692940.1 protein_id gnl|my_center|LOCUS_19830 2661935 2661015 gene locus_tag LOCUS_19840 2661935 2661015 CDS product DUF5712 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202089.1 protein_id gnl|my_center|LOCUS_19840 2662524 2661940 gene locus_tag LOCUS_19850 2662524 2661940 CDS product BfmA/BtgA family mobilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202090.1 protein_id gnl|my_center|LOCUS_19850 2663141 2662809 gene locus_tag LOCUS_19860 2663141 2662809 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007478806.1 protein_id gnl|my_center|LOCUS_19860 2663677 2663297 gene locus_tag LOCUS_19870 2663677 2663297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 2664487 2664008 gene locus_tag LOCUS_19880 2664487 2664008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 2664912 2664529 gene locus_tag LOCUS_19890 2664912 2664529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 2665251 2665003 gene locus_tag LOCUS_19900 2665251 2665003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 2666273 2665317 gene locus_tag LOCUS_19910 2666273 2665317 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965886.1 protein_id gnl|my_center|LOCUS_19910 2666886 2666263 gene locus_tag LOCUS_19920 2666886 2666263 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971537.1 protein_id gnl|my_center|LOCUS_19920 2667100 2667414 gene locus_tag LOCUS_19930 2667100 2667414 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007478800.1 protein_id gnl|my_center|LOCUS_19930 2667401 2667694 gene locus_tag LOCUS_19940 2667401 2667694 CDS product DUF3876 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007478799.1 protein_id gnl|my_center|LOCUS_19940 2667776 2668069 gene locus_tag LOCUS_19950 2667776 2668069 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202095.1 protein_id gnl|my_center|LOCUS_19950 2668329 2668625 gene locus_tag LOCUS_19960 2668329 2668625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 2668632 2668925 gene locus_tag LOCUS_19970 2668632 2668925 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108660.1 protein_id gnl|my_center|LOCUS_19970 2669203 2668922 gene locus_tag LOCUS_19980 2669203 2668922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 2670552 2669326 gene locus_tag LOCUS_19990 2670552 2669326 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008149802.1 protein_id gnl|my_center|LOCUS_19990 2672040 2671411 gene locus_tag LOCUS_20000 2672040 2671411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203312.1 protein_id gnl|my_center|LOCUS_20000 2672894 2672040 gene locus_tag LOCUS_20010 2672894 2672040 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203311.1 protein_id gnl|my_center|LOCUS_20010 2673301 2672918 gene locus_tag LOCUS_20020 2673301 2672918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203310.1 protein_id gnl|my_center|LOCUS_20020 2673659 2673309 gene locus_tag LOCUS_20030 2673659 2673309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203309.1 protein_id gnl|my_center|LOCUS_20030 2673966 2673673 gene locus_tag LOCUS_20040 2673966 2673673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203308.1 protein_id gnl|my_center|LOCUS_20040 2674443 2673979 gene locus_tag LOCUS_20050 2674443 2673979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007569765.1 protein_id gnl|my_center|LOCUS_20050 2674985 2674515 gene locus_tag LOCUS_20060 2674985 2674515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203306.1 protein_id gnl|my_center|LOCUS_20060 2676272 2675679 gene locus_tag LOCUS_20070 2676272 2675679 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810751.1 protein_id gnl|my_center|LOCUS_20070 2677582 2676569 gene locus_tag LOCUS_20080 2677582 2676569 CDS product DUF3871 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203302.1 protein_id gnl|my_center|LOCUS_20080 2678469 2677954 gene locus_tag LOCUS_20090 2678469 2677954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 2680941 2679133 gene locus_tag LOCUS_20100 2680941 2679133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107539.1 protein_id gnl|my_center|LOCUS_20100 2681485 2681003 gene locus_tag LOCUS_20110 2681485 2681003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 2681426 2681620 gene locus_tag LOCUS_20120 2681426 2681620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 2682714 2681713 gene locus_tag LOCUS_20130 2682714 2681713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 2683990 2682791 gene locus_tag LOCUS_20140 2683990 2682791 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203295.1 protein_id gnl|my_center|LOCUS_20140 2684197 2684124 gene locus_tag LOCUS_t00370 2684197 2684124 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 2685372 2684341 gene locus_tag LOCUS_20150 gene thiL 2685372 2684341 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203294.1 protein_id gnl|my_center|LOCUS_20150 2686205 2685396 gene locus_tag LOCUS_20160 2686205 2685396 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789915.1 protein_id gnl|my_center|LOCUS_20160 2687274 2686177 gene locus_tag LOCUS_20170 gene lpxK 2687274 2686177 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292736.1 protein_id gnl|my_center|LOCUS_20170 2689063 2687285 gene locus_tag LOCUS_20180 gene sppA 2689063 2687285 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203293.1 protein_id gnl|my_center|LOCUS_20180 2689782 2689270 gene locus_tag LOCUS_20190 2689782 2689270 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203292.1 protein_id gnl|my_center|LOCUS_20190 2690289 2690083 gene locus_tag LOCUS_20200 2690289 2690083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 2690787 2692306 gene locus_tag LOCUS_r00100 2690787 2692306 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2692459 2692533 gene locus_tag LOCUS_t00380 2692459 2692533 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 2692610 2692684 gene locus_tag LOCUS_t00390 2692610 2692684 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2692815 2695687 gene locus_tag LOCUS_r00110 2692815 2695687 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2695765 2695871 gene locus_tag LOCUS_r00120 2695765 2695871 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2696074 2696340 gene locus_tag LOCUS_20210 2696074 2696340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 2696781 2698277 gene locus_tag LOCUS_20220 2696781 2698277 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789851.1 protein_id gnl|my_center|LOCUS_20220 2698307 2699701 gene locus_tag LOCUS_20230 gene leuC 2698307 2699701 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799043.1 protein_id gnl|my_center|LOCUS_20230 2699737 2700324 gene locus_tag LOCUS_20240 gene leuD 2699737 2700324 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789845.1 protein_id gnl|my_center|LOCUS_20240 2700552 2702084 gene locus_tag LOCUS_20250 2700552 2702084 CDS product alpha-isopropylmalate synthase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789843.1 protein_id gnl|my_center|LOCUS_20250 2702181 2703242 gene locus_tag LOCUS_20260 gene leuB 2702181 2703242 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789841.1 protein_id gnl|my_center|LOCUS_20260 2703995 2703270 gene locus_tag LOCUS_20270 2703995 2703270 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789818.1 protein_id gnl|my_center|LOCUS_20270 2705736 2703976 gene locus_tag LOCUS_20280 2705736 2703976 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661313.1 protein_id gnl|my_center|LOCUS_20280 2705903 2706859 gene locus_tag LOCUS_20290 gene cysK 2705903 2706859 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767706.1 protein_id gnl|my_center|LOCUS_20290 2707017 2707796 gene locus_tag LOCUS_20300 2707017 2707796 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789811.1 protein_id gnl|my_center|LOCUS_20300 2709961 2708150 gene locus_tag LOCUS_20310 gene recQ 2709961 2708150 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055229616.1 protein_id gnl|my_center|LOCUS_20310 2710254 2710721 gene locus_tag LOCUS_20320 2710254 2710721 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789808.1 protein_id gnl|my_center|LOCUS_20320 2710835 2712886 gene locus_tag LOCUS_20330 2710835 2712886 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769535.1 protein_id gnl|my_center|LOCUS_20330 2712969 2713628 gene locus_tag LOCUS_20340 2712969 2713628 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789797.1 protein_id gnl|my_center|LOCUS_20340 2713700 2714188 gene locus_tag LOCUS_20350 2713700 2714188 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789793.1 protein_id gnl|my_center|LOCUS_20350 2714185 2715456 gene locus_tag LOCUS_20360 2714185 2715456 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763215.1 protein_id gnl|my_center|LOCUS_20360 2715526 2716836 gene locus_tag LOCUS_20370 2715526 2716836 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769537.1 protein_id gnl|my_center|LOCUS_20370 2716958 2717641 gene locus_tag LOCUS_20380 2716958 2717641 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789787.1 protein_id gnl|my_center|LOCUS_20380 2717895 2719259 gene locus_tag LOCUS_20390 gene hisS 2717895 2719259 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767712.1 protein_id gnl|my_center|LOCUS_20390 2720305 2721369 gene locus_tag LOCUS_20400 2720305 2721369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 2721409 2722284 gene locus_tag LOCUS_20410 2721409 2722284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 2722463 2723515 gene locus_tag LOCUS_20420 2722463 2723515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 2723522 2724574 gene locus_tag LOCUS_20430 2723522 2724574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 2724581 2725636 gene locus_tag LOCUS_20440 2724581 2725636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 2725643 2727001 gene locus_tag LOCUS_20450 2725643 2727001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 2727004 2731854 gene locus_tag LOCUS_20460 2727004 2731854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 2733248 2732040 gene locus_tag LOCUS_20470 gene hydF 2733248 2732040 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108016.1 protein_id gnl|my_center|LOCUS_20470 2734669 2733251 gene locus_tag LOCUS_20480 gene hydG 2734669 2733251 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108015.1 protein_id gnl|my_center|LOCUS_20480 2735746 2734700 gene locus_tag LOCUS_20490 gene hydE 2735746 2734700 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108014.1 protein_id gnl|my_center|LOCUS_20490 2737196 2735730 gene locus_tag LOCUS_20500 2737196 2735730 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763223.1 protein_id gnl|my_center|LOCUS_20500 2737594 2738655 gene locus_tag LOCUS_20510 2737594 2738655 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225342.1 protein_id gnl|my_center|LOCUS_20510 2738905 2740473 gene locus_tag LOCUS_20520 2738905 2740473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 2740660 2743203 gene locus_tag LOCUS_20530 2740660 2743203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 2743359 2746613 gene locus_tag LOCUS_20540 2743359 2746613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 2746635 2753315 gene locus_tag LOCUS_20550 2746635 2753315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 2754271 2753528 gene locus_tag LOCUS_20560 2754271 2753528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 2755079 2754288 gene locus_tag LOCUS_20570 2755079 2754288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 2756789 2755083 gene locus_tag LOCUS_20580 2756789 2755083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 2757291 2756797 gene locus_tag LOCUS_20590 2757291 2756797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 2757459 2761223 gene locus_tag LOCUS_20600 2757459 2761223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 2764381 2761784 gene locus_tag LOCUS_20610 2764381 2761784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 2765819 2764569 gene locus_tag LOCUS_20620 2765819 2764569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201881.1 protein_id gnl|my_center|LOCUS_20620 2766028 2766300 gene locus_tag LOCUS_20630 2766028 2766300 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010539043.1 protein_id gnl|my_center|LOCUS_20630 2766343 2767980 gene locus_tag LOCUS_20640 gene groL 2766343 2767980 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763228.1 protein_id gnl|my_center|LOCUS_20640 2768125 2769822 gene locus_tag LOCUS_20650 2768125 2769822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 2770035 2774210 gene locus_tag LOCUS_20660 2770035 2774210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 2774558 2774776 gene locus_tag LOCUS_20670 2774558 2774776 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789734.1 protein_id gnl|my_center|LOCUS_20670 2775267 2774848 gene locus_tag LOCUS_20680 2775267 2774848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108002.1 protein_id gnl|my_center|LOCUS_20680 2775433 2775984 gene locus_tag LOCUS_20690 2775433 2775984 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789731.1 protein_id gnl|my_center|LOCUS_20690 2775988 2776359 gene locus_tag LOCUS_20700 2775988 2776359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767734.1 protein_id gnl|my_center|LOCUS_20700 2776421 2776786 gene locus_tag LOCUS_20710 2776421 2776786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 2776916 2777929 gene locus_tag LOCUS_20720 2776916 2777929 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798984.1 protein_id gnl|my_center|LOCUS_20720 2778072 2779025 gene locus_tag LOCUS_20730 2778072 2779025 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789714.1 protein_id gnl|my_center|LOCUS_20730 2779042 2779353 gene locus_tag LOCUS_20740 2779042 2779353 CDS product chaperone modulator CbpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767738.1 protein_id gnl|my_center|LOCUS_20740 2782134 2780428 gene locus_tag LOCUS_20750 2782134 2780428 CDS product Acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789707.1 protein_id gnl|my_center|LOCUS_20750 2783158 2782139 gene locus_tag LOCUS_20760 2783158 2782139 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798976.1 protein_id gnl|my_center|LOCUS_20760 2784033 2783161 gene locus_tag LOCUS_20770 2784033 2783161 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789703.1 protein_id gnl|my_center|LOCUS_20770 2784884 2784204 gene locus_tag LOCUS_20780 2784884 2784204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107993.1 protein_id gnl|my_center|LOCUS_20780 2786154 2784967 gene locus_tag LOCUS_20790 2786154 2784967 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107980.1 protein_id gnl|my_center|LOCUS_20790 2786332 2788422 gene locus_tag LOCUS_20800 2786332 2788422 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107975.1 protein_id gnl|my_center|LOCUS_20800 2788444 2789289 gene locus_tag LOCUS_20810 2788444 2789289 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203249.1 protein_id gnl|my_center|LOCUS_20810 2790480 2789605 gene locus_tag LOCUS_20820 2790480 2789605 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767778.1 protein_id gnl|my_center|LOCUS_20820 2790873 2793926 gene locus_tag LOCUS_20830 2790873 2793926 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016266957.1 protein_id gnl|my_center|LOCUS_20830 2793954 2795591 gene locus_tag LOCUS_20840 2793954 2795591 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767780.1 protein_id gnl|my_center|LOCUS_20840 2795606 2796793 gene locus_tag LOCUS_20850 2795606 2796793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 2796871 2799360 gene locus_tag LOCUS_20860 2796871 2799360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 2799472 2801286 gene locus_tag LOCUS_20870 2799472 2801286 CDS product DUF4980 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767782.1 protein_id gnl|my_center|LOCUS_20870 2801291 2802457 gene locus_tag LOCUS_20880 2801291 2802457 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203242.1 protein_id gnl|my_center|LOCUS_20880 2802502 2803386 gene locus_tag LOCUS_20890 2802502 2803386 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789633.1 protein_id gnl|my_center|LOCUS_20890 2803979 2803506 gene locus_tag LOCUS_20900 2803979 2803506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 2805036 2805227 gene locus_tag LOCUS_20910 2805036 2805227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 2805276 2807975 gene locus_tag LOCUS_20920 2805276 2807975 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172461661.1 protein_id gnl|my_center|LOCUS_20920 2808019 2810871 gene locus_tag LOCUS_20930 2808019 2810871 CDS product bifunctional fucokinase/fucose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108144.1 protein_id gnl|my_center|LOCUS_20930 2812320 2811043 gene locus_tag LOCUS_20940 2812320 2811043 CDS product LruC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292941.1 protein_id gnl|my_center|LOCUS_20940 2812478 2812813 gene locus_tag LOCUS_20950 2812478 2812813 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802790.1 protein_id gnl|my_center|LOCUS_20950 2813165 2812833 gene locus_tag LOCUS_20960 2813165 2812833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 2817035 2813481 gene locus_tag LOCUS_20970 gene nifJ 2817035 2813481 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789619.1 protein_id gnl|my_center|LOCUS_20970 2818390 2817068 gene locus_tag LOCUS_20980 2818390 2817068 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203237.1 protein_id gnl|my_center|LOCUS_20980 2818980 2820176 gene locus_tag LOCUS_20990 2818980 2820176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107960.1 protein_id gnl|my_center|LOCUS_20990 2821643 2820186 gene locus_tag LOCUS_21000 2821643 2820186 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789610.1 protein_id gnl|my_center|LOCUS_21000 2821772 2822002 gene locus_tag LOCUS_21010 2821772 2822002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780694.1 protein_id gnl|my_center|LOCUS_21010 2822007 2822492 gene locus_tag LOCUS_21020 2822007 2822492 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763307.1 protein_id gnl|my_center|LOCUS_21020 2822598 2824532 gene locus_tag LOCUS_21030 2822598 2824532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 2827416 2824642 gene locus_tag LOCUS_21040 gene uvrA 2827416 2824642 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789604.1 protein_id gnl|my_center|LOCUS_21040 2827690 2829534 gene locus_tag LOCUS_21050 2827690 2829534 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107957.1 protein_id gnl|my_center|LOCUS_21050 2829641 2831104 gene locus_tag LOCUS_21060 2829641 2831104 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798918.1 protein_id gnl|my_center|LOCUS_21060 2831780 2831232 gene locus_tag LOCUS_21070 2831780 2831232 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763311.1 protein_id gnl|my_center|LOCUS_21070 2832350 2831805 gene locus_tag LOCUS_21080 2832350 2831805 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763312.1 protein_id gnl|my_center|LOCUS_21080 2836369 2832347 gene locus_tag LOCUS_21090 2836369 2832347 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789596.1 protein_id gnl|my_center|LOCUS_21090 2840356 2836652 gene locus_tag LOCUS_21100 gene purL 2840356 2836652 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767801.1 protein_id gnl|my_center|LOCUS_21100 2841380 2840592 gene locus_tag LOCUS_21110 2841380 2840592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 2842969 2841638 gene locus_tag LOCUS_21120 2842969 2841638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 2844285 2842978 gene locus_tag LOCUS_21130 2844285 2842978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 2846620 2844290 gene locus_tag LOCUS_21140 2846620 2844290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 2847908 2846712 gene locus_tag LOCUS_21150 2847908 2846712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 2848721 2849374 gene locus_tag LOCUS_21160 2848721 2849374 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786014.1 protein_id gnl|my_center|LOCUS_21160 2849425 2849967 gene locus_tag LOCUS_21170 2849425 2849967 CDS product DUF4924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786016.1 protein_id gnl|my_center|LOCUS_21170 2849969 2850829 gene locus_tag LOCUS_21180 gene rfbD 2849969 2850829 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786018.1 protein_id gnl|my_center|LOCUS_21180 2850826 2852394 gene locus_tag LOCUS_21190 2850826 2852394 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763318.1 protein_id gnl|my_center|LOCUS_21190 2856775 2852501 gene locus_tag LOCUS_21200 2856775 2852501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 2858534 2856795 gene locus_tag LOCUS_21210 2858534 2856795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 2859785 2858547 gene locus_tag LOCUS_21220 2859785 2858547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 2860967 2859807 gene locus_tag LOCUS_21230 2860967 2859807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 2862963 2860969 gene locus_tag LOCUS_21240 2862963 2860969 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202481.1 protein_id gnl|my_center|LOCUS_21240 2865052 2863598 gene locus_tag LOCUS_21250 2865052 2863598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 2867840 2866092 gene locus_tag LOCUS_21260 2867840 2866092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 2868099 2868740 gene locus_tag LOCUS_21270 2868099 2868740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 2868769 2870025 gene locus_tag LOCUS_21280 2868769 2870025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 2871410 2870124 gene locus_tag LOCUS_21290 2871410 2870124 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789589.1 protein_id gnl|my_center|LOCUS_21290 2874491 2871414 gene locus_tag LOCUS_21300 2874491 2871414 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798910.1 protein_id gnl|my_center|LOCUS_21300 2875550 2874498 gene locus_tag LOCUS_21310 2875550 2874498 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789585.1 protein_id gnl|my_center|LOCUS_21310 2878025 2875719 gene locus_tag LOCUS_21320 2878025 2875719 CDS product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292939.1 protein_id gnl|my_center|LOCUS_21320 2879444 2878077 gene locus_tag LOCUS_21330 2879444 2878077 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814920.1 protein_id gnl|my_center|LOCUS_21330 2880468 2879458 gene locus_tag LOCUS_21340 2880468 2879458 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_21340 2881175 2884144 gene locus_tag LOCUS_21350 2881175 2884144 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798907.1 protein_id gnl|my_center|LOCUS_21350 2884164 2885717 gene locus_tag LOCUS_21360 2884164 2885717 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789572.1 protein_id gnl|my_center|LOCUS_21360 2885738 2886847 gene locus_tag LOCUS_21370 2885738 2886847 CDS product SusF/SusE family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767006.1 protein_id gnl|my_center|LOCUS_21370 2886825 2888249 gene locus_tag LOCUS_21380 2886825 2888249 CDS product DUF5115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767007.1 protein_id gnl|my_center|LOCUS_21380 2888297 2888737 gene locus_tag LOCUS_21390 2888297 2888737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 2888741 2891428 gene locus_tag LOCUS_21400 2888741 2891428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 2893482 2891566 gene locus_tag LOCUS_21410 2893482 2891566 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767054.1 protein_id gnl|my_center|LOCUS_21410 2893958 2893704 gene locus_tag LOCUS_21420 2893958 2893704 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005678397.1 protein_id gnl|my_center|LOCUS_21420 2894135 2895151 gene locus_tag LOCUS_21430 2894135 2895151 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769604.1 protein_id gnl|my_center|LOCUS_21430 2895329 2896333 gene locus_tag LOCUS_21440 2895329 2896333 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798895.1 protein_id gnl|my_center|LOCUS_21440 2896713 2896411 gene locus_tag LOCUS_21450 2896713 2896411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 2897144 2896776 gene locus_tag LOCUS_21460 2897144 2896776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 2898240 2897176 gene locus_tag LOCUS_21470 2898240 2897176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 2899745 2898903 gene locus_tag LOCUS_21480 2899745 2898903 CDS product KilA-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102407668.1 protein_id gnl|my_center|LOCUS_21480 2900578 2899793 gene locus_tag LOCUS_21490 2900578 2899793 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202330.1 protein_id gnl|my_center|LOCUS_21490 2902195 2900678 gene locus_tag LOCUS_21500 2902195 2900678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 2905968 2903341 gene locus_tag LOCUS_21510 2905968 2903341 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201960.1 protein_id gnl|my_center|LOCUS_21510 2907715 2906246 gene locus_tag LOCUS_21520 2907715 2906246 CDS product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762491.1 protein_id gnl|my_center|LOCUS_21520 2909170 2907764 gene locus_tag LOCUS_21530 2909170 2907764 CDS product glycoside hydrolase family 76 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108751.1 protein_id gnl|my_center|LOCUS_21530 2909372 2913265 gene locus_tag LOCUS_21540 2909372 2913265 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108752.1 protein_id gnl|my_center|LOCUS_21540 2915557 2913707 gene locus_tag LOCUS_21550 2915557 2913707 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203224.1 protein_id gnl|my_center|LOCUS_21550 2916903 2915743 gene locus_tag LOCUS_21560 2916903 2915743 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107939.1 protein_id gnl|my_center|LOCUS_21560 2917348 2916905 gene locus_tag LOCUS_21570 2917348 2916905 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763362.1 protein_id gnl|my_center|LOCUS_21570 2918306 2917374 gene locus_tag LOCUS_21580 2918306 2917374 CDS product OadG family transporter subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767844.1 protein_id gnl|my_center|LOCUS_21580 2919891 2918338 gene locus_tag LOCUS_21590 2919891 2918338 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763364.1 protein_id gnl|my_center|LOCUS_21590 2920438 2920034 gene locus_tag LOCUS_21600 gene mce 2920438 2920034 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789532.1 protein_id gnl|my_center|LOCUS_21600 2922978 2920540 gene locus_tag LOCUS_21610 2922978 2920540 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963280.1 protein_id gnl|my_center|LOCUS_21610 2924005 2923022 gene locus_tag LOCUS_21620 2924005 2923022 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661159.1 protein_id gnl|my_center|LOCUS_21620 2925086 2924025 gene locus_tag LOCUS_21630 2925086 2924025 CDS product clostripain-related cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107416.1 protein_id gnl|my_center|LOCUS_21630 2925279 2925821 gene locus_tag LOCUS_21640 2925279 2925821 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789526.1 protein_id gnl|my_center|LOCUS_21640 2926115 2927149 gene locus_tag LOCUS_21650 2926115 2927149 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202122.1 protein_id gnl|my_center|LOCUS_21650 2927770 2928504 gene locus_tag LOCUS_21660 2927770 2928504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 2928728 2931865 gene locus_tag LOCUS_21670 2928728 2931865 CDS product virulence factor SrfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267841.1 protein_id gnl|my_center|LOCUS_21670 2931880 2934891 gene locus_tag LOCUS_21680 2931880 2934891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 2934892 2937024 gene locus_tag LOCUS_21690 2934892 2937024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 2937100 2937399 gene locus_tag LOCUS_21700 2937100 2937399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 2937477 2938361 gene locus_tag LOCUS_21710 2937477 2938361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 2938385 2939866 gene locus_tag LOCUS_21720 2938385 2939866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 2939976 2943143 gene locus_tag LOCUS_21730 2939976 2943143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 2943148 2943930 gene locus_tag LOCUS_21740 2943148 2943930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 2943965 2945122 gene locus_tag LOCUS_21750 2943965 2945122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 2945492 2946292 gene locus_tag LOCUS_21760 2945492 2946292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 2946351 2947562 gene locus_tag LOCUS_21770 2946351 2947562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 2947552 2949447 gene locus_tag LOCUS_21780 2947552 2949447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 2949438 2949773 gene locus_tag LOCUS_21790 2949438 2949773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 2950770 2951522 gene locus_tag LOCUS_21800 2950770 2951522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 2951929 2951711 gene locus_tag LOCUS_21810 2951929 2951711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 2952033 2952569 gene locus_tag LOCUS_21820 2952033 2952569 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203222.1 protein_id gnl|my_center|LOCUS_21820 2952572 2952907 gene locus_tag LOCUS_21830 2952572 2952907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789521.1 protein_id gnl|my_center|LOCUS_21830 2952904 2953698 gene locus_tag LOCUS_21840 2952904 2953698 CDS product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203221.1 protein_id gnl|my_center|LOCUS_21840 2953784 2954305 gene locus_tag LOCUS_21850 2953784 2954305 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767850.1 protein_id gnl|my_center|LOCUS_21850 2954359 2954940 gene locus_tag LOCUS_21860 2954359 2954940 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107938.1 protein_id gnl|my_center|LOCUS_21860 2957533 2955329 gene locus_tag LOCUS_21870 2957533 2955329 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107937.1 protein_id gnl|my_center|LOCUS_21870 2958565 2957600 gene locus_tag LOCUS_21880 2958565 2957600 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062694697.1 protein_id gnl|my_center|LOCUS_21880 2959953 2958697 gene locus_tag LOCUS_21890 2959953 2958697 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203214.1 protein_id gnl|my_center|LOCUS_21890 2960825 2960148 gene locus_tag LOCUS_21900 gene nth 2960825 2960148 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203213.1 protein_id gnl|my_center|LOCUS_21900 2962018 2960822 gene locus_tag LOCUS_21910 2962018 2960822 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763377.1 protein_id gnl|my_center|LOCUS_21910 2963136 2962117 gene locus_tag LOCUS_21920 gene pheS 2963136 2962117 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789293.1 protein_id gnl|my_center|LOCUS_21920 2963691 2963542 gene locus_tag LOCUS_21930 2963691 2963542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 2964327 2964061 gene locus_tag LOCUS_21940 2964327 2964061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 2964242 2964418 gene locus_tag LOCUS_21950 2964242 2964418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 2964418 2964885 gene locus_tag LOCUS_21960 2964418 2964885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793705.1 protein_id gnl|my_center|LOCUS_21960 2964987 2965871 gene locus_tag LOCUS_21970 2964987 2965871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 2965858 2966172 gene locus_tag LOCUS_21980 2965858 2966172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 2966870 2966292 gene locus_tag LOCUS_21990 2966870 2966292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 2967738 2967358 gene locus_tag LOCUS_22000 2967738 2967358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 2968685 2967735 gene locus_tag LOCUS_22010 2968685 2967735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 2969141 2968821 gene locus_tag LOCUS_22020 2969141 2968821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 2970508 2969525 gene locus_tag LOCUS_22030 2970508 2969525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 2972348 2971446 gene locus_tag LOCUS_22040 2972348 2971446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 2972533 2972345 gene locus_tag LOCUS_22050 2972533 2972345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 2973114 2972596 gene locus_tag LOCUS_22060 2973114 2972596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 2973775 2973146 gene locus_tag LOCUS_22070 2973775 2973146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 2974602 2973769 gene locus_tag LOCUS_22080 2974602 2973769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 2975860 2974706 gene locus_tag LOCUS_22090 2975860 2974706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 2976627 2976064 gene locus_tag LOCUS_22100 2976627 2976064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 2978425 2976839 gene locus_tag LOCUS_22110 2978425 2976839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 2979588 2978560 gene locus_tag LOCUS_22120 2979588 2978560 CDS product toxin-antitoxin system YwqK family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107963.1 protein_id gnl|my_center|LOCUS_22120 2980654 2979914 gene locus_tag LOCUS_22130 2980654 2979914 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203021.1 protein_id gnl|my_center|LOCUS_22130 2982409 2981618 gene locus_tag LOCUS_22140 2982409 2981618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014298724.1 protein_id gnl|my_center|LOCUS_22140 2984164 2982839 gene locus_tag LOCUS_22150 gene mobV 2984164 2982839 CDS product MobV family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202347.1 protein_id gnl|my_center|LOCUS_22150 2984855 2985196 gene locus_tag LOCUS_22160 2984855 2985196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 2985707 2985258 gene locus_tag LOCUS_22170 2985707 2985258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22170 2986467 2985634 gene locus_tag LOCUS_22180 2986467 2985634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22180 2987887 2986712 gene locus_tag LOCUS_22190 2987887 2986712 CDS product phage integrase SAM-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135036145.1 protein_id gnl|my_center|LOCUS_22190 2988105 2988031 gene locus_tag LOCUS_t00400 2988105 2988031 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2988220 2988522 gene locus_tag LOCUS_22200 2988220 2988522 CDS product DUF4286 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767861.1 protein_id gnl|my_center|LOCUS_22200 2988519 2989085 gene locus_tag LOCUS_22210 gene ruvC 2988519 2989085 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199350787.1 protein_id gnl|my_center|LOCUS_22210 2989129 2991126 gene locus_tag LOCUS_22220 gene pulA 2989129 2991126 CDS product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203210.1 protein_id gnl|my_center|LOCUS_22220 2992042 2991260 gene locus_tag LOCUS_22230 2992042 2991260 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080508.1 protein_id gnl|my_center|LOCUS_22230 2993874 2992054 gene locus_tag LOCUS_22240 2993874 2992054 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170848663.1 protein_id gnl|my_center|LOCUS_22240 2994090 2994836 gene locus_tag LOCUS_22250 gene gpmA 2994090 2994836 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789269.1 protein_id gnl|my_center|LOCUS_22250 2994862 2995914 gene locus_tag LOCUS_22260 2994862 2995914 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763387.1 protein_id gnl|my_center|LOCUS_22260 2997183 2996017 gene locus_tag LOCUS_22270 2997183 2996017 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762107.1 protein_id gnl|my_center|LOCUS_22270 2997908 2997252 gene locus_tag LOCUS_22280 gene fsa 2997908 2997252 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107927.1 protein_id gnl|my_center|LOCUS_22280 3000162 2998114 gene locus_tag LOCUS_22290 3000162 2998114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 3004349 3000399 gene locus_tag LOCUS_22300 3004349 3000399 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107906.1 protein_id gnl|my_center|LOCUS_22300 3005866 3004415 gene locus_tag LOCUS_22310 3005866 3004415 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769340.1 protein_id gnl|my_center|LOCUS_22310 3006793 3007812 gene locus_tag LOCUS_22320 3006793 3007812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 3007906 3010470 gene locus_tag LOCUS_22330 3007906 3010470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 3010483 3013770 gene locus_tag LOCUS_22340 3010483 3013770 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202162.1 protein_id gnl|my_center|LOCUS_22340 3013786 3015702 gene locus_tag LOCUS_22350 3013786 3015702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 3015819 3018140 gene locus_tag LOCUS_22360 3015819 3018140 CDS product glycoside hydrolase family 20 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107900.1 protein_id gnl|my_center|LOCUS_22360 3018304 3019857 gene locus_tag LOCUS_22370 3018304 3019857 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555796.1 protein_id gnl|my_center|LOCUS_22370 3019941 3022205 gene locus_tag LOCUS_22380 3019941 3022205 CDS product glycoside hydrolase family 20 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107900.1 protein_id gnl|my_center|LOCUS_22380 3022224 3025283 gene locus_tag LOCUS_22390 3022224 3025283 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048694946.1 protein_id gnl|my_center|LOCUS_22390 3025295 3026929 gene locus_tag LOCUS_22400 3025295 3026929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 3026946 3029675 gene locus_tag LOCUS_22410 3026946 3029675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 3031745 3029799 gene locus_tag LOCUS_22420 3031745 3029799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 3034220 3031842 gene locus_tag LOCUS_22430 3034220 3031842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 3036445 3034241 gene locus_tag LOCUS_22440 3036445 3034241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 3036950 3037246 gene locus_tag LOCUS_22450 3036950 3037246 CDS product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789182.1 protein_id gnl|my_center|LOCUS_22450 3039721 3037289 gene locus_tag LOCUS_22460 3039721 3037289 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108688.1 protein_id gnl|my_center|LOCUS_22460 3040983 3039943 gene locus_tag LOCUS_22470 3040983 3039943 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841461.1 protein_id gnl|my_center|LOCUS_22470 3042400 3040976 gene locus_tag LOCUS_22480 3042400 3040976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962820.1 protein_id gnl|my_center|LOCUS_22480 3043987 3042527 gene locus_tag LOCUS_22490 3043987 3042527 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767909.1 protein_id gnl|my_center|LOCUS_22490 3044150 3044383 gene locus_tag LOCUS_22500 3044150 3044383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789240.1 protein_id gnl|my_center|LOCUS_22500 3044411 3045022 gene locus_tag LOCUS_22510 3044411 3045022 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762117.1 protein_id gnl|my_center|LOCUS_22510 3045651 3045313 gene locus_tag LOCUS_22520 3045651 3045313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767910.1 protein_id gnl|my_center|LOCUS_22520 3045950 3045651 gene locus_tag LOCUS_22530 3045950 3045651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 3046096 3047913 gene locus_tag LOCUS_22540 3046096 3047913 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802867.1 protein_id gnl|my_center|LOCUS_22540 3048424 3048032 gene locus_tag LOCUS_22550 3048424 3048032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784803.1 protein_id gnl|my_center|LOCUS_22550 3048736 3048662 gene locus_tag LOCUS_t00410 3048736 3048662 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 3049884 3048811 gene locus_tag LOCUS_22560 3049884 3048811 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203192.1 protein_id gnl|my_center|LOCUS_22560 3051022 3050141 gene locus_tag LOCUS_22570 gene folD 3051022 3050141 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780414.1 protein_id gnl|my_center|LOCUS_22570 3052781 3051459 gene locus_tag LOCUS_22580 gene ffh 3052781 3051459 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767918.1 protein_id gnl|my_center|LOCUS_22580 3054174 3052852 gene locus_tag LOCUS_22590 3054174 3052852 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203189.1 protein_id gnl|my_center|LOCUS_22590 3055981 3054215 gene locus_tag LOCUS_22600 3055981 3054215 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203188.1 protein_id gnl|my_center|LOCUS_22600 3057960 3056170 gene locus_tag LOCUS_22610 3057960 3056170 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203187.1 protein_id gnl|my_center|LOCUS_22610 3060224 3058182 gene locus_tag LOCUS_22620 gene rho 3060224 3058182 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798804.1 protein_id gnl|my_center|LOCUS_22620 3060493 3061329 gene locus_tag LOCUS_22630 3060493 3061329 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062694770.1 protein_id gnl|my_center|LOCUS_22630 3062840 3061551 gene locus_tag LOCUS_22640 gene tilS 3062840 3061551 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107882.1 protein_id gnl|my_center|LOCUS_22640 3063002 3065473 gene locus_tag LOCUS_22650 gene feoB 3063002 3065473 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795491.1 protein_id gnl|my_center|LOCUS_22650 3065740 3065812 gene locus_tag LOCUS_t00420 3065740 3065812 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 3066439 3066146 gene locus_tag LOCUS_22660 3066439 3066146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 3067030 3066698 gene locus_tag LOCUS_22670 3067030 3066698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 3067222 3067049 gene locus_tag LOCUS_22680 3067222 3067049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 3067398 3067234 gene locus_tag LOCUS_22690 3067398 3067234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 3067567 3067833 gene locus_tag LOCUS_22700 3067567 3067833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 3067830 3068063 gene locus_tag LOCUS_22710 3067830 3068063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 3068487 3068684 gene locus_tag LOCUS_22720 3068487 3068684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 3068677 3069294 gene locus_tag LOCUS_22730 3068677 3069294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 3069530 3070027 gene locus_tag LOCUS_22740 3069530 3070027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 3070552 3070259 gene locus_tag LOCUS_22750 3070552 3070259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 3070943 3070557 gene locus_tag LOCUS_22760 3070943 3070557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 3071766 3070948 gene locus_tag LOCUS_22770 3071766 3070948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 3073271 3072150 gene locus_tag LOCUS_22780 3073271 3072150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 3073597 3073268 gene locus_tag LOCUS_22790 3073597 3073268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 3073933 3073601 gene locus_tag LOCUS_22800 3073933 3073601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 3075301 3074183 gene locus_tag LOCUS_22810 3075301 3074183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 3076807 3075488 gene locus_tag LOCUS_22820 3076807 3075488 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767676.1 protein_id gnl|my_center|LOCUS_22820 3077200 3077880 gene locus_tag LOCUS_22830 3077200 3077880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241895.1 protein_id gnl|my_center|LOCUS_22830 3078422 3078198 gene locus_tag LOCUS_22840 3078422 3078198 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763800.1 protein_id gnl|my_center|LOCUS_22840 3078694 3078620 gene locus_tag LOCUS_t00430 3078694 3078620 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3078833 3079441 gene locus_tag LOCUS_22850 3078833 3079441 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107875.1 protein_id gnl|my_center|LOCUS_22850 3080354 3079617 gene locus_tag LOCUS_22860 3080354 3079617 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762145.1 protein_id gnl|my_center|LOCUS_22860 3080456 3080644 gene locus_tag LOCUS_22870 3080456 3080644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 3081117 3080731 gene locus_tag LOCUS_22880 3081117 3080731 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786184.1 protein_id gnl|my_center|LOCUS_22880 3082142 3081129 gene locus_tag LOCUS_22890 3082142 3081129 CDS product DUF4468 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795332.1 protein_id gnl|my_center|LOCUS_22890 3082945 3082214 gene locus_tag LOCUS_22900 3082945 3082214 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107872.1 protein_id gnl|my_center|LOCUS_22900 3083656 3083012 gene locus_tag LOCUS_22910 gene pdxH 3083656 3083012 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786189.1 protein_id gnl|my_center|LOCUS_22910 3084392 3083688 gene locus_tag LOCUS_22920 3084392 3083688 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767943.1 protein_id gnl|my_center|LOCUS_22920 3085457 3084438 gene locus_tag LOCUS_22930 3085457 3084438 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107870.1 protein_id gnl|my_center|LOCUS_22930 3085779 3087194 gene locus_tag LOCUS_22940 3085779 3087194 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795325.1 protein_id gnl|my_center|LOCUS_22940 3088953 3087667 gene locus_tag LOCUS_22950 3088953 3087667 CDS product DcaP family trimeric outer membrane transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202431.1 protein_id gnl|my_center|LOCUS_22950 3089115 3089612 gene locus_tag LOCUS_22960 3089115 3089612 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786203.1 protein_id gnl|my_center|LOCUS_22960 3089766 3090446 gene locus_tag LOCUS_22970 3089766 3090446 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762200.1 protein_id gnl|my_center|LOCUS_22970 3090460 3091134 gene locus_tag LOCUS_22980 gene queC 3090460 3091134 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762201.1 protein_id gnl|my_center|LOCUS_22980 3091204 3091659 gene locus_tag LOCUS_22990 gene queF 3091204 3091659 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786209.1 protein_id gnl|my_center|LOCUS_22990 3092037 3093863 gene locus_tag LOCUS_23000 3092037 3093863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 3093860 3096058 gene locus_tag LOCUS_23010 3093860 3096058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 3098122 3096179 gene locus_tag LOCUS_23020 3098122 3096179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 3098400 3101774 gene locus_tag LOCUS_23030 3098400 3101774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 3102361 3101888 gene locus_tag LOCUS_23040 gene rlmH 3102361 3101888 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107863.1 protein_id gnl|my_center|LOCUS_23040 3102489 3102881 gene locus_tag LOCUS_23050 3102489 3102881 CDS product DUF4783 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786212.1 protein_id gnl|my_center|LOCUS_23050 3102874 3103722 gene locus_tag LOCUS_23060 gene nadC 3102874 3103722 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762206.1 protein_id gnl|my_center|LOCUS_23060 3103894 3104439 gene locus_tag LOCUS_23070 3103894 3104439 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795316.1 protein_id gnl|my_center|LOCUS_23070 3104423 3105481 gene locus_tag LOCUS_23080 3104423 3105481 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992462.1 protein_id gnl|my_center|LOCUS_23080 3105502 3106023 gene locus_tag LOCUS_23090 3105502 3106023 CDS product DUF4943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762209.1 protein_id gnl|my_center|LOCUS_23090 3106045 3106746 gene locus_tag LOCUS_23100 3106045 3106746 CDS product DUF4858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303197.1 protein_id gnl|my_center|LOCUS_23100 3106866 3107807 gene locus_tag LOCUS_23110 3106866 3107807 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202434.1 protein_id gnl|my_center|LOCUS_23110 3109054 3107948 gene locus_tag LOCUS_23120 gene ald 3109054 3107948 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795308.1 protein_id gnl|my_center|LOCUS_23120 3109254 3110903 gene locus_tag LOCUS_23130 3109254 3110903 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202435.1 protein_id gnl|my_center|LOCUS_23130 3110947 3112584 gene locus_tag LOCUS_23140 3110947 3112584 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786228.1 protein_id gnl|my_center|LOCUS_23140 3112765 3114510 gene locus_tag LOCUS_23150 3112765 3114510 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786230.1 protein_id gnl|my_center|LOCUS_23150 3114758 3115657 gene locus_tag LOCUS_23160 3114758 3115657 CDS product histidine decarboxylase, pyruvoyl type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786245.1 protein_id gnl|my_center|LOCUS_23160 3116576 3115794 gene locus_tag LOCUS_23170 gene nudC 3116576 3115794 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107851.1 protein_id gnl|my_center|LOCUS_23170 3118618 3117026 gene locus_tag LOCUS_23180 3118618 3117026 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767969.1 protein_id gnl|my_center|LOCUS_23180 3119223 3119489 gene locus_tag LOCUS_23190 3119223 3119489 CDS product LysO family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803434.1 protein_id gnl|my_center|LOCUS_23190 3119479 3120099 gene locus_tag LOCUS_23200 3119479 3120099 CDS product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803436.1 protein_id gnl|my_center|LOCUS_23200 3120622 3120113 gene locus_tag LOCUS_23210 3120622 3120113 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986394.1 protein_id gnl|my_center|LOCUS_23210 3122055 3120679 gene locus_tag LOCUS_23220 3122055 3120679 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107850.1 protein_id gnl|my_center|LOCUS_23220 3122712 3122128 gene locus_tag LOCUS_23230 3122712 3122128 CDS product DUF417 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764769.1 protein_id gnl|my_center|LOCUS_23230 3123640 3122801 gene locus_tag LOCUS_23240 3123640 3122801 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768221.1 protein_id gnl|my_center|LOCUS_23240 3124128 3123649 gene locus_tag LOCUS_23250 gene cdd 3124128 3123649 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762228.1 protein_id gnl|my_center|LOCUS_23250 3124244 3125149 gene locus_tag LOCUS_23260 3124244 3125149 CDS product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107847.1 protein_id gnl|my_center|LOCUS_23260 3125326 3126573 gene locus_tag LOCUS_23270 3125326 3126573 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107845.1 protein_id gnl|my_center|LOCUS_23270 3126674 3127978 gene locus_tag LOCUS_23280 3126674 3127978 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202445.1 protein_id gnl|my_center|LOCUS_23280 3127991 3129274 gene locus_tag LOCUS_23290 3127991 3129274 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202446.1 protein_id gnl|my_center|LOCUS_23290 3129309 3129974 gene locus_tag LOCUS_23300 3129309 3129974 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786290.1 protein_id gnl|my_center|LOCUS_23300 3129971 3131287 gene locus_tag LOCUS_23310 3129971 3131287 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816640.1 protein_id gnl|my_center|LOCUS_23310 3131300 3132544 gene locus_tag LOCUS_23320 3131300 3132544 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202451.1 protein_id gnl|my_center|LOCUS_23320 3132636 3135239 gene locus_tag LOCUS_23330 3132636 3135239 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202452.1 protein_id gnl|my_center|LOCUS_23330 3135377 3136852 gene locus_tag LOCUS_23340 3135377 3136852 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107843.1 protein_id gnl|my_center|LOCUS_23340 3136951 3138303 gene locus_tag LOCUS_23350 3136951 3138303 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786303.1 protein_id gnl|my_center|LOCUS_23350 3138511 3139611 gene locus_tag LOCUS_23360 3138511 3139611 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107842.1 protein_id gnl|my_center|LOCUS_23360 3139741 3140271 gene locus_tag LOCUS_23370 3139741 3140271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 3141743 3140682 gene locus_tag LOCUS_23380 3141743 3140682 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225342.1 protein_id gnl|my_center|LOCUS_23380 3141844 3142047 gene locus_tag LOCUS_23390 3141844 3142047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 3143758 3142118 gene locus_tag LOCUS_23400 gene aspD 3143758 3142118 CDS product aspartate 4-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303153.1 protein_id gnl|my_center|LOCUS_23400 3145671 3143977 gene locus_tag LOCUS_23410 gene aspT 3145671 3143977 CDS product aspartate-alanine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107422.1 protein_id gnl|my_center|LOCUS_23410 3146026 3147315 gene locus_tag LOCUS_23420 3146026 3147315 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762240.1 protein_id gnl|my_center|LOCUS_23420 3147327 3148043 gene locus_tag LOCUS_23430 3147327 3148043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 3148044 3148910 gene locus_tag LOCUS_23440 3148044 3148910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 3148907 3149842 gene locus_tag LOCUS_23450 3148907 3149842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 3149823 3150815 gene locus_tag LOCUS_23460 3149823 3150815 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555689.1 protein_id gnl|my_center|LOCUS_23460 3150812 3151528 gene locus_tag LOCUS_23470 3150812 3151528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 3152704 3151667 gene locus_tag LOCUS_23480 3152704 3151667 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801276.1 protein_id gnl|my_center|LOCUS_23480 3153005 3156046 gene locus_tag LOCUS_23490 3153005 3156046 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760375.1 protein_id gnl|my_center|LOCUS_23490 3156071 3157639 gene locus_tag LOCUS_23500 3156071 3157639 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760507.1 protein_id gnl|my_center|LOCUS_23500 3157661 3159940 gene locus_tag LOCUS_23510 3157661 3159940 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108680.1 protein_id gnl|my_center|LOCUS_23510 3160037 3161932 gene locus_tag LOCUS_23520 3160037 3161932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 3163643 3162069 gene locus_tag LOCUS_23530 3163643 3162069 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786352.1 protein_id gnl|my_center|LOCUS_23530 3164193 3163918 gene locus_tag LOCUS_23540 3164193 3163918 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776335.1 protein_id gnl|my_center|LOCUS_23540 3164402 3165442 gene locus_tag LOCUS_23550 gene mutY 3164402 3165442 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291960.1 protein_id gnl|my_center|LOCUS_23550 3165506 3165949 gene locus_tag LOCUS_23560 gene ssb 3165506 3165949 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795194.1 protein_id gnl|my_center|LOCUS_23560 3166047 3167384 gene locus_tag LOCUS_23570 3166047 3167384 CDS product gliding motility-associated protein GldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795192.1 protein_id gnl|my_center|LOCUS_23570 3167390 3168037 gene locus_tag LOCUS_23580 3167390 3168037 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291961.1 protein_id gnl|my_center|LOCUS_23580 3169463 3168090 gene locus_tag LOCUS_23590 3169463 3168090 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107821.1 protein_id gnl|my_center|LOCUS_23590 3170327 3169599 gene locus_tag LOCUS_23600 3170327 3169599 CDS product DUF6064 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765763.1 protein_id gnl|my_center|LOCUS_23600 3170825 3170328 gene locus_tag LOCUS_23610 3170825 3170328 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787995.1 protein_id gnl|my_center|LOCUS_23610 3171091 3170822 gene locus_tag LOCUS_23620 3171091 3170822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 3172881 3171193 gene locus_tag LOCUS_23630 3172881 3171193 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793588.1 protein_id gnl|my_center|LOCUS_23630 3173875 3176907 gene locus_tag LOCUS_23640 3173875 3176907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 3177124 3178467 gene locus_tag LOCUS_23650 3177124 3178467 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986486.1 protein_id gnl|my_center|LOCUS_23650 3179760 3178627 gene locus_tag LOCUS_23660 3179760 3178627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 3181757 3179760 gene locus_tag LOCUS_23670 3181757 3179760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800687.1 protein_id gnl|my_center|LOCUS_23670 3183818 3181770 gene locus_tag LOCUS_23680 3183818 3181770 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202481.1 protein_id gnl|my_center|LOCUS_23680 3184546 3184376 gene locus_tag LOCUS_23690 3184546 3184376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 3184845 3185654 gene locus_tag LOCUS_23700 3184845 3185654 CDS product DUF5106 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107815.1 protein_id gnl|my_center|LOCUS_23700 3186637 3185825 gene locus_tag LOCUS_23710 3186637 3185825 CDS product DUF4373 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203523.1 protein_id gnl|my_center|LOCUS_23710 3187043 3186735 gene locus_tag LOCUS_23720 3187043 3186735 CDS product SH3 beta-barrel fold-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202459.1 protein_id gnl|my_center|LOCUS_23720 3187588 3187247 gene locus_tag LOCUS_23730 3187588 3187247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 3188060 3187821 gene locus_tag LOCUS_23740 3188060 3187821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 3188156 3188689 gene locus_tag LOCUS_23750 gene upbY 3188156 3188689 CDS product capsular polysaccharide transcription antiterminator UpbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786813.1 protein_id gnl|my_center|LOCUS_23750 3188715 3189209 gene locus_tag LOCUS_23760 3188715 3189209 CDS product UpxZ family transcription anti-terminator antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203398.1 protein_id gnl|my_center|LOCUS_23760 3189284 3190765 gene locus_tag LOCUS_23770 3189284 3190765 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202937.1 protein_id gnl|my_center|LOCUS_23770 3190750 3191859 gene locus_tag LOCUS_23780 3190750 3191859 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202936.1 protein_id gnl|my_center|LOCUS_23780 3191871 3193055 gene locus_tag LOCUS_23790 3191871 3193055 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108800.1 protein_id gnl|my_center|LOCUS_23790 3193068 3193340 gene locus_tag LOCUS_23800 3193068 3193340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 3193589 3194590 gene locus_tag LOCUS_23810 3193589 3194590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 3194665 3195075 gene locus_tag LOCUS_23820 3194665 3195075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 3195122 3195400 gene locus_tag LOCUS_23830 3195122 3195400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 3195641 3196021 gene locus_tag LOCUS_23840 3195641 3196021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 3196388 3197446 gene locus_tag LOCUS_23850 3196388 3197446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 3197459 3198568 gene locus_tag LOCUS_23860 3197459 3198568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 3198602 3199417 gene locus_tag LOCUS_23870 3198602 3199417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 3199428 3200660 gene locus_tag LOCUS_23880 3199428 3200660 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203511.1 protein_id gnl|my_center|LOCUS_23880 3200626 3201231 gene locus_tag LOCUS_23890 3200626 3201231 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203510.1 protein_id gnl|my_center|LOCUS_23890 3201264 3202484 gene locus_tag LOCUS_23900 3201264 3202484 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202424.1 protein_id gnl|my_center|LOCUS_23900 3202599 3203141 gene locus_tag LOCUS_23910 3202599 3203141 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795339.1 protein_id gnl|my_center|LOCUS_23910 3203488 3203955 gene locus_tag LOCUS_23920 3203488 3203955 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202158.1 protein_id gnl|my_center|LOCUS_23920 3204211 3204765 gene locus_tag LOCUS_23930 3204211 3204765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 3205793 3204987 gene locus_tag LOCUS_23940 3205793 3204987 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024997765.1 protein_id gnl|my_center|LOCUS_23940 3206602 3205790 gene locus_tag LOCUS_23950 3206602 3205790 CDS product type IV toxin-antitoxin system AbiEi family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120708963.1 protein_id gnl|my_center|LOCUS_23950 3207277 3207074 gene locus_tag LOCUS_23960 3207277 3207074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 3209052 3207274 gene locus_tag LOCUS_23970 3209052 3207274 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786392.1 protein_id gnl|my_center|LOCUS_23970 3209747 3209058 gene locus_tag LOCUS_23980 3209747 3209058 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786394.1 protein_id gnl|my_center|LOCUS_23980 3209926 3211119 gene locus_tag LOCUS_23990 3209926 3211119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786395.1 protein_id gnl|my_center|LOCUS_23990 3211209 3212030 gene locus_tag LOCUS_24000 3211209 3212030 CDS product DUF3805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786399.1 protein_id gnl|my_center|LOCUS_24000 3212031 3213899 gene locus_tag LOCUS_24010 3212031 3213899 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795166.1 protein_id gnl|my_center|LOCUS_24010 3213896 3214732 gene locus_tag LOCUS_24020 3213896 3214732 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786401.1 protein_id gnl|my_center|LOCUS_24020 3218560 3214913 gene locus_tag LOCUS_24030 3218560 3214913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 3219914 3218589 gene locus_tag LOCUS_24040 3219914 3218589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 3220187 3221881 gene locus_tag LOCUS_24050 3220187 3221881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 3223792 3221924 gene locus_tag LOCUS_24060 3223792 3221924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 3228230 3224064 gene locus_tag LOCUS_24070 3228230 3224064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 3228924 3228367 gene locus_tag LOCUS_24080 3228924 3228367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 3230293 3229232 gene locus_tag LOCUS_24090 3230293 3229232 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225342.1 protein_id gnl|my_center|LOCUS_24090 3231558 3230377 gene locus_tag LOCUS_24100 3231558 3230377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 3232914 3231679 gene locus_tag LOCUS_24110 3232914 3231679 CDS product fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762299.1 protein_id gnl|my_center|LOCUS_24110 3233088 3234287 gene locus_tag LOCUS_24120 3233088 3234287 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776370.1 protein_id gnl|my_center|LOCUS_24120 3234284 3235528 gene locus_tag LOCUS_24130 3234284 3235528 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768269.1 protein_id gnl|my_center|LOCUS_24130 3236461 3235529 gene locus_tag LOCUS_24140 3236461 3235529 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108968.1 protein_id gnl|my_center|LOCUS_24140 3237665 3236493 gene locus_tag LOCUS_24150 3237665 3236493 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795161.1 protein_id gnl|my_center|LOCUS_24150 3238746 3237736 gene locus_tag LOCUS_24160 3238746 3237736 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107805.1 protein_id gnl|my_center|LOCUS_24160 3239301 3238816 gene locus_tag LOCUS_24170 gene trxA 3239301 3238816 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107795.1 protein_id gnl|my_center|LOCUS_24170 3240315 3239671 gene locus_tag LOCUS_24180 gene bioD 3240315 3239671 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795149.1 protein_id gnl|my_center|LOCUS_24180 3241067 3240312 gene locus_tag LOCUS_24190 gene bioC 3241067 3240312 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107785.1 protein_id gnl|my_center|LOCUS_24190 3241743 3241072 gene locus_tag LOCUS_24200 3241743 3241072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24200 3242947 3241748 gene locus_tag LOCUS_24210 3242947 3241748 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107783.1 protein_id gnl|my_center|LOCUS_24210 3245358 3242962 gene locus_tag LOCUS_24220 gene bioA 3245358 3242962 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107782.1 protein_id gnl|my_center|LOCUS_24220 3245508 3247067 gene locus_tag LOCUS_24230 3245508 3247067 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107814.1 protein_id gnl|my_center|LOCUS_24230 3248210 3247119 gene locus_tag LOCUS_24240 3248210 3247119 CDS product DUF4421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107781.1 protein_id gnl|my_center|LOCUS_24240 3248354 3251482 gene locus_tag LOCUS_24250 3248354 3251482 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107780.1 protein_id gnl|my_center|LOCUS_24250 3251493 3252962 gene locus_tag LOCUS_24260 3251493 3252962 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762337.1 protein_id gnl|my_center|LOCUS_24260 3254739 3253042 gene locus_tag LOCUS_24270 3254739 3253042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 3257244 3254923 gene locus_tag LOCUS_24280 3257244 3254923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 3259972 3257996 gene locus_tag LOCUS_24290 3259972 3257996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 3262405 3260510 gene locus_tag LOCUS_24300 3262405 3260510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 3264953 3262806 gene locus_tag LOCUS_24310 3264953 3262806 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108651.1 protein_id gnl|my_center|LOCUS_24310 3266320 3265064 gene locus_tag LOCUS_24320 3266320 3265064 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107792.1 protein_id gnl|my_center|LOCUS_24320 3268210 3266762 gene locus_tag LOCUS_24330 3268210 3266762 CDS product DUF3868 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786444.1 protein_id gnl|my_center|LOCUS_24330 3268753 3268238 gene locus_tag LOCUS_24340 3268753 3268238 CDS product DUF3575 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107790.1 protein_id gnl|my_center|LOCUS_24340 3269030 3270574 gene locus_tag LOCUS_24350 3269030 3270574 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800651.1 protein_id gnl|my_center|LOCUS_24350 3270594 3272105 gene locus_tag LOCUS_24360 gene accC 3270594 3272105 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202499.1 protein_id gnl|my_center|LOCUS_24360 3272114 3272644 gene locus_tag LOCUS_24370 3272114 3272644 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786452.1 protein_id gnl|my_center|LOCUS_24370 3273706 3272756 gene locus_tag LOCUS_24380 3273706 3272756 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055270852.1 protein_id gnl|my_center|LOCUS_24380 3273853 3274998 gene locus_tag LOCUS_24390 3273853 3274998 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769686.1 protein_id gnl|my_center|LOCUS_24390 3275493 3275672 gene locus_tag LOCUS_24400 3275493 3275672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 3275745 3276653 gene locus_tag LOCUS_24410 3275745 3276653 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202722.1 protein_id gnl|my_center|LOCUS_24410 3276743 3277744 gene locus_tag LOCUS_24420 3276743 3277744 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202721.1 protein_id gnl|my_center|LOCUS_24420 3278644 3277808 gene locus_tag LOCUS_24430 3278644 3277808 CDS product fimbrillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790340.1 protein_id gnl|my_center|LOCUS_24430 3279550 3278672 gene locus_tag LOCUS_24440 3279550 3278672 CDS product fimbrillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797807.1 protein_id gnl|my_center|LOCUS_24440 3279894 3280526 gene locus_tag LOCUS_24450 3279894 3280526 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787510.1 protein_id gnl|my_center|LOCUS_24450 3280624 3281763 gene locus_tag LOCUS_24460 3280624 3281763 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764054.1 protein_id gnl|my_center|LOCUS_24460 3282040 3281966 gene locus_tag LOCUS_t00440 3282040 3281966 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 3282160 3282086 gene locus_tag LOCUS_t00450 3282160 3282086 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 3282529 3283386 gene locus_tag LOCUS_24470 gene purU 3282529 3283386 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762395.1 protein_id gnl|my_center|LOCUS_24470 3283401 3283991 gene locus_tag LOCUS_24480 gene hisH 3283401 3283991 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803062.1 protein_id gnl|my_center|LOCUS_24480 3284125 3284844 gene locus_tag LOCUS_24490 gene hisA 3284125 3284844 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764911.1 protein_id gnl|my_center|LOCUS_24490 3284873 3285628 gene locus_tag LOCUS_24500 gene hisF 3284873 3285628 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203119.1 protein_id gnl|my_center|LOCUS_24500 3285661 3286272 gene locus_tag LOCUS_24510 gene hisIE 3285661 3286272 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788819.1 protein_id gnl|my_center|LOCUS_24510 3286257 3286949 gene locus_tag LOCUS_24520 3286257 3286949 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762400.1 protein_id gnl|my_center|LOCUS_24520 3286985 3288304 gene locus_tag LOCUS_24530 3286985 3288304 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788816.1 protein_id gnl|my_center|LOCUS_24530 3288381 3289541 gene locus_tag LOCUS_24540 gene lysA 3288381 3289541 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762402.1 protein_id gnl|my_center|LOCUS_24540 3289631 3290110 gene locus_tag LOCUS_24550 3289631 3290110 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788812.1 protein_id gnl|my_center|LOCUS_24550 3290326 3293595 gene locus_tag LOCUS_24560 3290326 3293595 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765900.1 protein_id gnl|my_center|LOCUS_24560 3293595 3295853 gene locus_tag LOCUS_24570 3293595 3295853 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203234.1 protein_id gnl|my_center|LOCUS_24570 3296250 3295843 gene locus_tag LOCUS_24580 3296250 3295843 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762404.1 protein_id gnl|my_center|LOCUS_24580 3297486 3296299 gene locus_tag LOCUS_24590 gene kbl 3297486 3296299 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203088.1 protein_id gnl|my_center|LOCUS_24590 3297773 3298672 gene locus_tag LOCUS_24600 3297773 3298672 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762406.1 protein_id gnl|my_center|LOCUS_24600 3298672 3299523 gene locus_tag LOCUS_24610 3298672 3299523 CDS product DUF4348 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762407.1 protein_id gnl|my_center|LOCUS_24610 3299760 3300761 gene locus_tag LOCUS_24620 gene murB 3299760 3300761 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764915.1 protein_id gnl|my_center|LOCUS_24620 3300765 3301520 gene locus_tag LOCUS_24630 3300765 3301520 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203087.1 protein_id gnl|my_center|LOCUS_24630 3301586 3303220 gene locus_tag LOCUS_24640 3301586 3303220 CDS product DUF3352 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203086.1 protein_id gnl|my_center|LOCUS_24640 3304093 3303602 gene locus_tag LOCUS_24650 3304093 3303602 CDS product DUF3127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788752.1 protein_id gnl|my_center|LOCUS_24650 3304127 3305251 gene locus_tag LOCUS_24660 gene dnaN 3304127 3305251 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788748.1 protein_id gnl|my_center|LOCUS_24660 3305277 3306056 gene locus_tag LOCUS_24670 3305277 3306056 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762413.1 protein_id gnl|my_center|LOCUS_24670 3306059 3307258 gene locus_tag LOCUS_24680 gene coaBC 3306059 3307258 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788745.1 protein_id gnl|my_center|LOCUS_24680 3307255 3308223 gene locus_tag LOCUS_24690 3307255 3308223 CDS product DUF4835 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103015543.1 protein_id gnl|my_center|LOCUS_24690 3308227 3309888 gene locus_tag LOCUS_24700 gene recN 3308227 3309888 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203085.1 protein_id gnl|my_center|LOCUS_24700 3309910 3310656 gene locus_tag LOCUS_24710 gene rlmB 3309910 3310656 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788741.1 protein_id gnl|my_center|LOCUS_24710 3310741 3312393 gene locus_tag LOCUS_24720 3310741 3312393 CDS product tetratricopeptide repeat-containing serine protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788738.1 protein_id gnl|my_center|LOCUS_24720 3312715 3313089 gene locus_tag LOCUS_24730 3312715 3313089 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788735.1 protein_id gnl|my_center|LOCUS_24730 3314355 3313057 gene locus_tag LOCUS_24740 3314355 3313057 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788733.1 protein_id gnl|my_center|LOCUS_24740 3314489 3315814 gene locus_tag LOCUS_24750 3314489 3315814 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788731.1 protein_id gnl|my_center|LOCUS_24750 3315860 3316078 gene locus_tag LOCUS_24760 3315860 3316078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 3316104 3317912 gene locus_tag LOCUS_24770 3316104 3317912 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788730.1 protein_id gnl|my_center|LOCUS_24770 3318986 3318012 gene locus_tag LOCUS_24780 3318986 3318012 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203072.1 protein_id gnl|my_center|LOCUS_24780 3319671 3319000 gene locus_tag LOCUS_24790 3319671 3319000 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538563.1 protein_id gnl|my_center|LOCUS_24790 3320277 3319813 gene locus_tag LOCUS_24800 3320277 3319813 CDS product DUF4494 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762440.1 protein_id gnl|my_center|LOCUS_24800 3321052 3321279 gene locus_tag LOCUS_24810 3321052 3321279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 3321454 3322029 gene locus_tag LOCUS_24820 3321454 3322029 CDS product UpxY family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790534.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24820 3322073 3322549 gene locus_tag LOCUS_24830 3322073 3322549 CDS product UpxZ family transcription anti-terminator antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203521.1 protein_id gnl|my_center|LOCUS_24830 3322737 3324191 gene locus_tag LOCUS_24840 3322737 3324191 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202937.1 protein_id gnl|my_center|LOCUS_24840 3324206 3325318 gene locus_tag LOCUS_24850 3324206 3325318 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202936.1 protein_id gnl|my_center|LOCUS_24850 3325322 3325552 gene locus_tag LOCUS_24860 3325322 3325552 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775528.1 protein_id gnl|my_center|LOCUS_24860 3325552 3326604 gene locus_tag LOCUS_24870 3325552 3326604 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202154.1 protein_id gnl|my_center|LOCUS_24870 3326608 3327369 gene locus_tag LOCUS_24880 3326608 3327369 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801362.1 protein_id gnl|my_center|LOCUS_24880 3327372 3328385 gene locus_tag LOCUS_24890 3327372 3328385 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198211.1 protein_id gnl|my_center|LOCUS_24890 3328401 3329036 gene locus_tag LOCUS_24900 gene vioB 3328401 3329036 CDS product dTDP-4-amino-4,6-dideoxy-D-glucose acetyltransferase VioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382700.1 protein_id gnl|my_center|LOCUS_24900 3329071 3330195 gene locus_tag LOCUS_24910 3329071 3330195 CDS product TDP-N-acetylfucosamine:lipid II N-acetylfucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189471990.1 protein_id gnl|my_center|LOCUS_24910 3330648 3331382 gene locus_tag LOCUS_24920 3330648 3331382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 3331389 3332303 gene locus_tag LOCUS_24930 3331389 3332303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 3332310 3333041 gene locus_tag LOCUS_24940 3332310 3333041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 3333038 3334123 gene locus_tag LOCUS_24950 3333038 3334123 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476096.1 protein_id gnl|my_center|LOCUS_24950 3334160 3335128 gene locus_tag LOCUS_24960 3334160 3335128 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963429.1 protein_id gnl|my_center|LOCUS_24960 3335166 3336431 gene locus_tag LOCUS_24970 3335166 3336431 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795347.1 protein_id gnl|my_center|LOCUS_24970 3336436 3337572 gene locus_tag LOCUS_24980 3336436 3337572 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073061.1 protein_id gnl|my_center|LOCUS_24980 3337569 3338543 gene locus_tag LOCUS_24990 3337569 3338543 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786859.1 protein_id gnl|my_center|LOCUS_24990 3338682 3339635 gene locus_tag LOCUS_25000 3338682 3339635 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786860.1 protein_id gnl|my_center|LOCUS_25000 3341603 3339720 gene locus_tag LOCUS_25010 3341603 3339720 CDS product fimbrillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203331.1 protein_id gnl|my_center|LOCUS_25010 3343505 3341610 gene locus_tag LOCUS_25020 3343505 3341610 CDS product fimbrillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203331.1 protein_id gnl|my_center|LOCUS_25020 3344003 3344659 gene locus_tag LOCUS_25030 gene mpi 3344003 3344659 CDS product serine-type multi-promoter DNA invertase Mpi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788600.1 protein_id gnl|my_center|LOCUS_25030 3345416 3344844 gene locus_tag LOCUS_25040 3345416 3344844 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788598.1 protein_id gnl|my_center|LOCUS_25040 3345632 3346135 gene locus_tag LOCUS_25050 gene tpx 3345632 3346135 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538561.1 protein_id gnl|my_center|LOCUS_25050 3346297 3347181 gene locus_tag LOCUS_25060 3346297 3347181 CDS product DUF3078 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_25060 3347913 3347275 gene locus_tag LOCUS_25070 3347913 3347275 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788593.1 protein_id gnl|my_center|LOCUS_25070 3349429 3347963 gene locus_tag LOCUS_25080 3349429 3347963 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788591.1 protein_id gnl|my_center|LOCUS_25080 3351237 3349498 gene locus_tag LOCUS_25090 3351237 3349498 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107711.1 protein_id gnl|my_center|LOCUS_25090 3352074 3351298 gene locus_tag LOCUS_25100 3352074 3351298 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803239.1 protein_id gnl|my_center|LOCUS_25100 3352287 3353483 gene locus_tag LOCUS_25110 gene pstC 3352287 3353483 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788582.1 protein_id gnl|my_center|LOCUS_25110 3353486 3354361 gene locus_tag LOCUS_25120 gene pstA 3353486 3354361 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788578.1 protein_id gnl|my_center|LOCUS_25120 3354365 3355117 gene locus_tag LOCUS_25130 gene pstB 3354365 3355117 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788575.1 protein_id gnl|my_center|LOCUS_25130 3355184 3355873 gene locus_tag LOCUS_25140 gene phoU 3355184 3355873 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788573.1 protein_id gnl|my_center|LOCUS_25140 3356326 3356505 gene locus_tag LOCUS_25150 3356326 3356505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 3356586 3357494 gene locus_tag LOCUS_25160 3356586 3357494 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203118.1 protein_id gnl|my_center|LOCUS_25160 3357716 3358807 gene locus_tag LOCUS_25170 3357716 3358807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 3360258 3358882 gene locus_tag LOCUS_25180 gene gntK 3360258 3358882 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876638.1 protein_id gnl|my_center|LOCUS_25180 3361454 3360294 gene locus_tag LOCUS_25190 3361454 3360294 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763289.1 protein_id gnl|my_center|LOCUS_25190 3363131 3361656 gene locus_tag LOCUS_25200 3363131 3361656 CDS product beta-fructofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296814.1 protein_id gnl|my_center|LOCUS_25200 3364678 3363152 gene locus_tag LOCUS_25210 3364678 3363152 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026811032.1 protein_id gnl|my_center|LOCUS_25210 3366484 3364724 gene locus_tag LOCUS_25220 3366484 3364724 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783447.1 protein_id gnl|my_center|LOCUS_25220 3369664 3366485 gene locus_tag LOCUS_25230 3369664 3366485 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016266957.1 protein_id gnl|my_center|LOCUS_25230 3372239 3370170 gene locus_tag LOCUS_25240 3372239 3370170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 3374086 3373103 gene locus_tag LOCUS_25250 3374086 3373103 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262593.1 protein_id gnl|my_center|LOCUS_25250 3374322 3374161 gene locus_tag LOCUS_25260 3374322 3374161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 3375015 3374698 gene locus_tag LOCUS_25270 3375015 3374698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 3375223 3375828 gene locus_tag LOCUS_25280 3375223 3375828 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538541.1 protein_id gnl|my_center|LOCUS_25280 3375834 3376370 gene locus_tag LOCUS_25290 3375834 3376370 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107707.1 protein_id gnl|my_center|LOCUS_25290 3377771 3376452 gene locus_tag LOCUS_25300 3377771 3376452 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788563.1 protein_id gnl|my_center|LOCUS_25300 3378290 3379267 gene locus_tag LOCUS_25310 3378290 3379267 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107705.1 protein_id gnl|my_center|LOCUS_25310 3379414 3380433 gene locus_tag LOCUS_25320 3379414 3380433 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107704.1 protein_id gnl|my_center|LOCUS_25320 3380669 3382207 gene locus_tag LOCUS_25330 3380669 3382207 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_25330 3382395 3383255 gene locus_tag LOCUS_25340 3382395 3383255 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_25340 3383447 3383848 gene locus_tag LOCUS_25350 3383447 3383848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798505.1 protein_id gnl|my_center|LOCUS_25350 3383994 3385130 gene locus_tag LOCUS_25360 3383994 3385130 CDS product clostripain-related cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107701.1 protein_id gnl|my_center|LOCUS_25360 3385140 3386315 gene locus_tag LOCUS_25370 3385140 3386315 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107853.1 protein_id gnl|my_center|LOCUS_25370 3386476 3386997 gene locus_tag LOCUS_25380 3386476 3386997 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791444.1 protein_id gnl|my_center|LOCUS_25380 3387383 3387231 gene locus_tag LOCUS_25390 3387383 3387231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 3387953 3389472 gene locus_tag LOCUS_r00130 3387953 3389472 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3389625 3389699 gene locus_tag LOCUS_t00460 3389625 3389699 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 3389776 3389850 gene locus_tag LOCUS_t00470 3389776 3389850 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3389981 3392853 gene locus_tag LOCUS_r00140 3389981 3392853 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3392931 3393037 gene locus_tag LOCUS_r00150 3392931 3393037 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3393339 3393929 gene locus_tag LOCUS_25400 3393339 3393929 CDS product V-type ATP synthase subunit E family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788438.1 protein_id gnl|my_center|LOCUS_25400 3393941 3394780 gene locus_tag LOCUS_25410 3393941 3394780 CDS product DUF2764 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788436.1 protein_id gnl|my_center|LOCUS_25410 3394798 3396555 gene locus_tag LOCUS_25420 3394798 3396555 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788434.1 protein_id gnl|my_center|LOCUS_25420 3396590 3397918 gene locus_tag LOCUS_25430 3396590 3397918 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762991.1 protein_id gnl|my_center|LOCUS_25430 3397951 3398556 gene locus_tag LOCUS_25440 3397951 3398556 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681263.1 protein_id gnl|my_center|LOCUS_25440 3398553 3400370 gene locus_tag LOCUS_25450 3398553 3400370 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105100251.1 protein_id gnl|my_center|LOCUS_25450 3400413 3400874 gene locus_tag LOCUS_25460 3400413 3400874 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675599.1 protein_id gnl|my_center|LOCUS_25460 3401083 3402744 gene locus_tag LOCUS_25470 3401083 3402744 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793275.1 protein_id gnl|my_center|LOCUS_25470 3402779 3405343 gene locus_tag LOCUS_25480 3402779 3405343 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803825.1 protein_id gnl|my_center|LOCUS_25480 3407135 3405390 gene locus_tag LOCUS_25490 3407135 3405390 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766785.1 protein_id gnl|my_center|LOCUS_25490 3409740 3407359 gene locus_tag LOCUS_25500 3409740 3407359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 3411054 3409954 gene locus_tag LOCUS_25510 3411054 3409954 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815367.1 protein_id gnl|my_center|LOCUS_25510 3411191 3412579 gene locus_tag LOCUS_25520 gene potA 3411191 3412579 CDS product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769055.1 protein_id gnl|my_center|LOCUS_25520 3412677 3413474 gene locus_tag LOCUS_25530 3412677 3413474 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778456.1 protein_id gnl|my_center|LOCUS_25530 3413468 3414274 gene locus_tag LOCUS_25540 3413468 3414274 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993119.1 protein_id gnl|my_center|LOCUS_25540 3414305 3415627 gene locus_tag LOCUS_25550 3414305 3415627 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107690.1 protein_id gnl|my_center|LOCUS_25550 3416409 3416759 gene locus_tag LOCUS_25560 3416409 3416759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 3418167 3416839 gene locus_tag LOCUS_25570 3418167 3416839 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765564.1 protein_id gnl|my_center|LOCUS_25570 3418861 3418184 gene locus_tag LOCUS_25580 3418861 3418184 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761359.1 protein_id gnl|my_center|LOCUS_25580 3422110 3418985 gene locus_tag LOCUS_25590 3422110 3418985 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765563.1 protein_id gnl|my_center|LOCUS_25590 3423225 3422128 gene locus_tag LOCUS_25600 3423225 3422128 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765562.1 protein_id gnl|my_center|LOCUS_25600 3424513 3423227 gene locus_tag LOCUS_25610 3424513 3423227 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107396.1 protein_id gnl|my_center|LOCUS_25610 3425053 3425745 gene locus_tag LOCUS_25620 3425053 3425745 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263190.1 protein_id gnl|my_center|LOCUS_25620 3425813 3426721 gene locus_tag LOCUS_25630 gene bla 3425813 3426721 CDS product class A beta-lactamase, subclass A2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109295.1 protein_id gnl|my_center|LOCUS_25630 3426852 3427562 gene locus_tag LOCUS_25640 3426852 3427562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 3427565 3429091 gene locus_tag LOCUS_25650 3427565 3429091 CDS product putative Ig domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108613.1 protein_id gnl|my_center|LOCUS_25650 3430137 3429187 gene locus_tag LOCUS_25660 3430137 3429187 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202784.1 protein_id gnl|my_center|LOCUS_25660 3431866 3430199 gene locus_tag LOCUS_25670 3431866 3430199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 3432523 3431981 gene locus_tag LOCUS_25680 3432523 3431981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 3433521 3432631 gene locus_tag LOCUS_25690 3433521 3432631 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769011.1 protein_id gnl|my_center|LOCUS_25690 3433684 3434940 gene locus_tag LOCUS_25700 3433684 3434940 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788229.1 protein_id gnl|my_center|LOCUS_25700 3434953 3435852 gene locus_tag LOCUS_25710 3434953 3435852 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788227.1 protein_id gnl|my_center|LOCUS_25710 3435845 3437332 gene locus_tag LOCUS_25720 3435845 3437332 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202953.1 protein_id gnl|my_center|LOCUS_25720 3437338 3438492 gene locus_tag LOCUS_25730 3437338 3438492 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202952.1 protein_id gnl|my_center|LOCUS_25730 3438588 3439613 gene locus_tag LOCUS_25740 3438588 3439613 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202951.1 protein_id gnl|my_center|LOCUS_25740 3440880 3440452 gene locus_tag LOCUS_25750 3440880 3440452 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763145.1 protein_id gnl|my_center|LOCUS_25750 3441578 3441108 gene locus_tag LOCUS_25760 3441578 3441108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107329.1 protein_id gnl|my_center|LOCUS_25760 3442279 3441647 gene locus_tag LOCUS_25770 3442279 3441647 CDS product KilA-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004804477.1 protein_id gnl|my_center|LOCUS_25770 3444722 3442686 gene locus_tag LOCUS_25780 gene uvrB 3444722 3442686 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763156.1 protein_id gnl|my_center|LOCUS_25780 3447278 3444816 gene locus_tag LOCUS_25790 3447278 3444816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764126.1 protein_id gnl|my_center|LOCUS_25790 3447582 3448616 gene locus_tag LOCUS_25800 3447582 3448616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 3448636 3451149 gene locus_tag LOCUS_25810 3448636 3451149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 3451447 3453630 gene locus_tag LOCUS_25820 3451447 3453630 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108964.1 protein_id gnl|my_center|LOCUS_25820 3453662 3454966 gene locus_tag LOCUS_25830 3453662 3454966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 3455102 3458197 gene locus_tag LOCUS_25840 3455102 3458197 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764127.1 protein_id gnl|my_center|LOCUS_25840 3458209 3460005 gene locus_tag LOCUS_25850 3458209 3460005 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764128.1 protein_id gnl|my_center|LOCUS_25850 3460020 3460802 gene locus_tag LOCUS_25860 3460020 3460802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 3460814 3462790 gene locus_tag LOCUS_25870 3460814 3462790 CDS product GxGYxYP family putative glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760786.1 protein_id gnl|my_center|LOCUS_25870 3462783 3463655 gene locus_tag LOCUS_25880 3462783 3463655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 3463936 3465927 gene locus_tag LOCUS_25890 3463936 3465927 CDS product GxGYxYP family putative glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764130.1 protein_id gnl|my_center|LOCUS_25890 3466239 3467408 gene locus_tag LOCUS_25900 3466239 3467408 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788204.1 protein_id gnl|my_center|LOCUS_25900 3467424 3467849 gene locus_tag LOCUS_25910 3467424 3467849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778250.1 protein_id gnl|my_center|LOCUS_25910 3467942 3468745 gene locus_tag LOCUS_25920 gene bamD 3467942 3468745 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763159.1 protein_id gnl|my_center|LOCUS_25920 3468761 3469096 gene locus_tag LOCUS_25930 3468761 3469096 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004299989.1 protein_id gnl|my_center|LOCUS_25930 3469225 3469671 gene locus_tag LOCUS_25940 3469225 3469671 CDS product DUF4293 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788196.1 protein_id gnl|my_center|LOCUS_25940 3469902 3470477 gene locus_tag LOCUS_25950 3469902 3470477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25950 3472201 3471473 gene locus_tag LOCUS_25960 3472201 3471473 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788195.1 protein_id gnl|my_center|LOCUS_25960 3473921 3472203 gene locus_tag LOCUS_25970 3473921 3472203 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202945.1 protein_id gnl|my_center|LOCUS_25970 3474122 3474811 gene locus_tag LOCUS_25980 3474122 3474811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 3474819 3477656 gene locus_tag LOCUS_25990 gene uvrA 3474819 3477656 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788190.1 protein_id gnl|my_center|LOCUS_25990 3477660 3478139 gene locus_tag LOCUS_26000 gene ybaK 3477660 3478139 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763164.1 protein_id gnl|my_center|LOCUS_26000 3478206 3479738 gene locus_tag LOCUS_26010 3478206 3479738 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788185.1 protein_id gnl|my_center|LOCUS_26010 3480333 3479836 gene locus_tag LOCUS_26020 3480333 3479836 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765089.1 protein_id gnl|my_center|LOCUS_26020 3480571 3480897 gene locus_tag LOCUS_26030 3480571 3480897 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032813353.1 protein_id gnl|my_center|LOCUS_26030 3480920 3482017 gene locus_tag LOCUS_26040 3480920 3482017 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202943.1 protein_id gnl|my_center|LOCUS_26040 3482173 3483168 gene locus_tag LOCUS_26050 3482173 3483168 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765092.1 protein_id gnl|my_center|LOCUS_26050 3483190 3483696 gene locus_tag LOCUS_26060 3483190 3483696 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107336.1 protein_id gnl|my_center|LOCUS_26060 3487829 3483804 gene locus_tag LOCUS_26070 3487829 3483804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 3489658 3487907 gene locus_tag LOCUS_26080 3489658 3487907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 3491330 3489696 gene locus_tag LOCUS_26090 3491330 3489696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 3491902 3491651 gene locus_tag LOCUS_26100 3491902 3491651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 3491808 3493511 gene locus_tag LOCUS_26110 3491808 3493511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 3495813 3493717 gene locus_tag LOCUS_26120 3495813 3493717 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107338.1 protein_id gnl|my_center|LOCUS_26120 3497615 3496284 gene locus_tag LOCUS_26130 3497615 3496284 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788174.1 protein_id gnl|my_center|LOCUS_26130 3499590 3497734 gene locus_tag LOCUS_26140 gene yidC 3499590 3497734 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815482.1 protein_id gnl|my_center|LOCUS_26140 3501327 3499615 gene locus_tag LOCUS_26150 3501327 3499615 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763175.1 protein_id gnl|my_center|LOCUS_26150 3502048 3503436 gene locus_tag LOCUS_26160 3502048 3503436 CDS product DUF3078 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788166.1 protein_id gnl|my_center|LOCUS_26160 3503617 3504036 gene locus_tag LOCUS_26170 3503617 3504036 CDS product SoxR reducing system RseC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765125.1 protein_id gnl|my_center|LOCUS_26170 3504044 3504958 gene locus_tag LOCUS_26180 3504044 3504958 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761242.1 protein_id gnl|my_center|LOCUS_26180 3504994 3506331 gene locus_tag LOCUS_26190 gene rsxC 3504994 3506331 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107360.1 protein_id gnl|my_center|LOCUS_26190 3506338 3507330 gene locus_tag LOCUS_26200 3506338 3507330 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788156.1 protein_id gnl|my_center|LOCUS_26200 3507327 3507977 gene locus_tag LOCUS_26210 3507327 3507977 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202941.1 protein_id gnl|my_center|LOCUS_26210 3507995 3508579 gene locus_tag LOCUS_26220 3507995 3508579 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788152.1 protein_id gnl|my_center|LOCUS_26220 3508591 3509163 gene locus_tag LOCUS_26230 gene rsxA 3508591 3509163 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778198.1 protein_id gnl|my_center|LOCUS_26230 3509358 3510392 gene locus_tag LOCUS_26240 gene galE 3509358 3510392 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107362.1 protein_id gnl|my_center|LOCUS_26240 3511442 3510618 gene locus_tag LOCUS_26250 gene ispE 3511442 3510618 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107363.1 protein_id gnl|my_center|LOCUS_26250 3511655 3513208 gene locus_tag LOCUS_26260 gene dnaB 3511655 3513208 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788141.1 protein_id gnl|my_center|LOCUS_26260 3513391 3515853 gene locus_tag LOCUS_26270 gene pheT 3513391 3515853 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202920.1 protein_id gnl|my_center|LOCUS_26270 3515905 3516636 gene locus_tag LOCUS_26280 3515905 3516636 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768977.1 protein_id gnl|my_center|LOCUS_26280 3516636 3516881 gene locus_tag LOCUS_26290 3516636 3516881 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788104.1 protein_id gnl|my_center|LOCUS_26290 3517229 3516951 gene locus_tag LOCUS_26300 3517229 3516951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 3517529 3518782 gene locus_tag LOCUS_26310 3517529 3518782 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788100.1 protein_id gnl|my_center|LOCUS_26310 3518793 3519398 gene locus_tag LOCUS_26320 3518793 3519398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 3519487 3520251 gene locus_tag LOCUS_26330 3519487 3520251 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788098.1 protein_id gnl|my_center|LOCUS_26330 3520663 3520256 gene locus_tag LOCUS_26340 3520663 3520256 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788096.1 protein_id gnl|my_center|LOCUS_26340 3520738 3521202 gene locus_tag LOCUS_26350 3520738 3521202 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793479.1 protein_id gnl|my_center|LOCUS_26350 3521353 3521553 gene locus_tag LOCUS_26360 3521353 3521553 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788091.1 protein_id gnl|my_center|LOCUS_26360 3521900 3523681 gene locus_tag LOCUS_26370 gene lepA 3521900 3523681 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788089.1 protein_id gnl|my_center|LOCUS_26370 3523889 3524998 gene locus_tag LOCUS_26380 3523889 3524998 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788087.1 protein_id gnl|my_center|LOCUS_26380 3525040 3526353 gene locus_tag LOCUS_26390 gene nhaA 3525040 3526353 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788084.1 protein_id gnl|my_center|LOCUS_26390 3527684 3526449 gene locus_tag LOCUS_26400 gene rmuC 3527684 3526449 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793488.1 protein_id gnl|my_center|LOCUS_26400 3528617 3527763 gene locus_tag LOCUS_26410 gene map 3528617 3527763 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202916.1 protein_id gnl|my_center|LOCUS_26410 3529565 3530167 gene locus_tag LOCUS_26420 gene cas6 3529565 3530167 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768973.1 protein_id gnl|my_center|LOCUS_26420 3530171 3530740 gene locus_tag LOCUS_26430 3530171 3530740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768972.1 protein_id gnl|my_center|LOCUS_26430 3530733 3532880 gene locus_tag LOCUS_26440 3530733 3532880 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202915.1 protein_id gnl|my_center|LOCUS_26440 3532884 3534209 gene locus_tag LOCUS_26450 3532884 3534209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768970.1 protein_id gnl|my_center|LOCUS_26450 3534221 3535282 gene locus_tag LOCUS_26460 3534221 3535282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768969.1 protein_id gnl|my_center|LOCUS_26460 3535342 3535854 gene locus_tag LOCUS_26470 gene cas4 3535342 3535854 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768968.1 protein_id gnl|my_center|LOCUS_26470 3535851 3536867 gene locus_tag LOCUS_26480 gene cas1b 3535851 3536867 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768967.1 protein_id gnl|my_center|LOCUS_26480 3536867 3537130 gene locus_tag LOCUS_26490 gene cas2 3536867 3537130 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202914.1 protein_id gnl|my_center|LOCUS_26490 3537345 3538015 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgttaattgtaccgtttggaattgaaat 3538152 3539510 gene locus_tag LOCUS_26500 3538152 3539510 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108266.1 protein_id gnl|my_center|LOCUS_26500 3541183 3539546 gene locus_tag LOCUS_26510 3541183 3539546 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765520.1 protein_id gnl|my_center|LOCUS_26510 3542743 3541727 gene locus_tag LOCUS_26520 3542743 3541727 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202737.1 protein_id gnl|my_center|LOCUS_26520 3544241 3543081 gene locus_tag LOCUS_26530 3544241 3543081 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129649887.1 protein_id gnl|my_center|LOCUS_26530 3545019 3544267 gene locus_tag LOCUS_26540 3545019 3544267 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087367.1 protein_id gnl|my_center|LOCUS_26540 3546217 3545153 gene locus_tag LOCUS_26550 3546217 3545153 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020079396.1 protein_id gnl|my_center|LOCUS_26550 3546371 3546222 gene locus_tag LOCUS_26560 3546371 3546222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 3547311 3546739 gene locus_tag LOCUS_26570 3547311 3546739 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202636.1 protein_id gnl|my_center|LOCUS_26570 3548146 3547313 gene locus_tag LOCUS_26580 3548146 3547313 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202637.1 protein_id gnl|my_center|LOCUS_26580 3549089 3548277 gene locus_tag LOCUS_26590 3549089 3548277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 3549871 3549308 gene locus_tag LOCUS_26600 3549871 3549308 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005818015.1 protein_id gnl|my_center|LOCUS_26600 3550921 3549875 gene locus_tag LOCUS_26610 3550921 3549875 CDS product cyclophilin-like fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107751.1 protein_id gnl|my_center|LOCUS_26610 3551130 3550918 gene locus_tag LOCUS_26620 3551130 3550918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 3552180 3551329 gene locus_tag LOCUS_26630 3552180 3551329 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787284.1 protein_id gnl|my_center|LOCUS_26630 3552565 3552170 gene locus_tag LOCUS_26640 3552565 3552170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26640 3553469 3552645 gene locus_tag LOCUS_26650 3553469 3552645 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202637.1 protein_id gnl|my_center|LOCUS_26650 3554476 3553481 gene locus_tag LOCUS_26660 3554476 3553481 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202726.1 protein_id gnl|my_center|LOCUS_26660 3555639 3554488 gene locus_tag LOCUS_26670 3555639 3554488 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202725.1 protein_id gnl|my_center|LOCUS_26670 3555796 3556692 gene locus_tag LOCUS_26680 3555796 3556692 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764893.1 protein_id gnl|my_center|LOCUS_26680 3556710 3557540 gene locus_tag LOCUS_26690 3556710 3557540 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107417.1 protein_id gnl|my_center|LOCUS_26690 3558829 3557570 gene locus_tag LOCUS_26700 3558829 3557570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 3559938 3558895 gene locus_tag LOCUS_26710 3559938 3558895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 3560630 3559953 gene locus_tag LOCUS_26720 3560630 3559953 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788535.1 protein_id gnl|my_center|LOCUS_26720 3560927 3560637 gene locus_tag LOCUS_26730 3560927 3560637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 3564090 3560968 gene locus_tag LOCUS_26740 3564090 3560968 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947845.1 protein_id gnl|my_center|LOCUS_26740 3564992 3564087 gene locus_tag LOCUS_26750 3564992 3564087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 3566306 3565011 gene locus_tag LOCUS_26760 3566306 3565011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 3566572 3566997 gene locus_tag LOCUS_26770 3566572 3566997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788076.1 protein_id gnl|my_center|LOCUS_26770 3567002 3567433 gene locus_tag LOCUS_26780 3567002 3567433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788073.1 protein_id gnl|my_center|LOCUS_26780 3568455 3567529 gene locus_tag LOCUS_26790 3568455 3567529 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765521.1 protein_id gnl|my_center|LOCUS_26790 3569887 3568469 gene locus_tag LOCUS_26800 gene rlmD 3569887 3568469 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788070.1 protein_id gnl|my_center|LOCUS_26800 3570088 3572808 gene locus_tag LOCUS_26810 gene ppdK 3570088 3572808 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202911.1 protein_id gnl|my_center|LOCUS_26810 3573026 3573544 gene locus_tag LOCUS_26820 3573026 3573544 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788062.1 protein_id gnl|my_center|LOCUS_26820 3574317 3573709 gene locus_tag LOCUS_26830 3574317 3573709 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761321.1 protein_id gnl|my_center|LOCUS_26830 3575071 3574379 gene locus_tag LOCUS_26840 3575071 3574379 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788057.1 protein_id gnl|my_center|LOCUS_26840 3576209 3575091 gene locus_tag LOCUS_26850 gene thiH 3576209 3575091 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107371.1 protein_id gnl|my_center|LOCUS_26850 3576626 3576267 gene locus_tag LOCUS_26860 3576626 3576267 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 protein_id gnl|my_center|LOCUS_26860 3578311 3576629 gene locus_tag LOCUS_26870 gene thiC 3578311 3576629 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107372.1 protein_id gnl|my_center|LOCUS_26870 3579097 3578321 gene locus_tag LOCUS_26880 3579097 3578321 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788045.1 protein_id gnl|my_center|LOCUS_26880 3579719 3579102 gene locus_tag LOCUS_26890 3579719 3579102 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107374.1 protein_id gnl|my_center|LOCUS_26890 3579925 3579725 gene locus_tag LOCUS_26900 gene thiS 3579925 3579725 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765536.1 protein_id gnl|my_center|LOCUS_26900 3580828 3580316 gene locus_tag LOCUS_26910 gene fldA 3580828 3580316 CDS product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793355.1 protein_id gnl|my_center|LOCUS_26910 3582394 3581006 gene locus_tag LOCUS_26920 gene dnaB 3582394 3581006 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055229347.1 protein_id gnl|my_center|LOCUS_26920 3583024 3582398 gene locus_tag LOCUS_26930 3583024 3582398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 3583376 3583110 gene locus_tag LOCUS_26940 3583376 3583110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 3583566 3584486 gene locus_tag LOCUS_26950 3583566 3584486 CDS product Tsr19 family tyrosine-type DNA invertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009293248.1 protein_id gnl|my_center|LOCUS_26950 3585220 3584993 gene locus_tag LOCUS_26960 3585220 3584993 CDS product DUF4248 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790540.1 protein_id gnl|my_center|LOCUS_26960 3585427 3586296 gene locus_tag LOCUS_26970 3585427 3586296 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108099.1 protein_id gnl|my_center|LOCUS_26970 3586599 3587069 gene locus_tag LOCUS_26980 3586599 3587069 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802390.1 protein_id gnl|my_center|LOCUS_26980 3587124 3587390 gene locus_tag LOCUS_26990 3587124 3587390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107836.1 protein_id gnl|my_center|LOCUS_26990 3587390 3587839 gene locus_tag LOCUS_27000 3587390 3587839 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765882.1 protein_id gnl|my_center|LOCUS_27000 3588007 3589308 gene locus_tag LOCUS_27010 3588007 3589308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 3589341 3589847 gene locus_tag LOCUS_27020 3589341 3589847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 3589865 3591022 gene locus_tag LOCUS_27030 3589865 3591022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 3591103 3591921 gene locus_tag LOCUS_27040 3591103 3591921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 3591997 3593007 gene locus_tag LOCUS_27050 3591997 3593007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 3593014 3595344 gene locus_tag LOCUS_27060 3593014 3595344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 3595567 3597630 gene locus_tag LOCUS_27070 3595567 3597630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108614.1 protein_id gnl|my_center|LOCUS_27070 3597663 3598826 gene locus_tag LOCUS_27080 3597663 3598826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108615.1 protein_id gnl|my_center|LOCUS_27080 3600057 3598882 gene locus_tag LOCUS_27090 3600057 3598882 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788311.1 protein_id gnl|my_center|LOCUS_27090 3600304 3601008 gene locus_tag LOCUS_27100 3600304 3601008 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202968.1 protein_id gnl|my_center|LOCUS_27100 3600998 3601603 gene locus_tag LOCUS_27110 3600998 3601603 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788304.1 protein_id gnl|my_center|LOCUS_27110 3603139 3602090 gene locus_tag LOCUS_27120 3603139 3602090 CDS product leucine-rich repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794961.1 protein_id gnl|my_center|LOCUS_27120 3603242 3604117 gene locus_tag LOCUS_27130 3603242 3604117 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107670.1 protein_id gnl|my_center|LOCUS_27130 3606346 3604217 gene locus_tag LOCUS_27140 3606346 3604217 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072067041.1 protein_id gnl|my_center|LOCUS_27140 3606508 3608370 gene locus_tag LOCUS_27150 3606508 3608370 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107668.1 protein_id gnl|my_center|LOCUS_27150 3608374 3610125 gene locus_tag LOCUS_27160 3608374 3610125 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202604.1 protein_id gnl|my_center|LOCUS_27160 3610125 3610592 gene locus_tag LOCUS_27170 3610125 3610592 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794873.1 protein_id gnl|my_center|LOCUS_27170 3610730 3611011 gene locus_tag LOCUS_27180 3610730 3611011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786780.1 protein_id gnl|my_center|LOCUS_27180 3611098 3613428 gene locus_tag LOCUS_27190 3611098 3613428 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768395.1 protein_id gnl|my_center|LOCUS_27190 3613562 3614452 gene locus_tag LOCUS_27200 3613562 3614452 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763406.1 protein_id gnl|my_center|LOCUS_27200 3615043 3614462 gene locus_tag LOCUS_27210 3615043 3614462 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786786.1 protein_id gnl|my_center|LOCUS_27210 3615574 3615816 gene locus_tag LOCUS_27220 3615574 3615816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107467.1 protein_id gnl|my_center|LOCUS_27220 3616321 3616249 gene locus_tag LOCUS_t00480 3616321 3616249 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3616474 3616387 gene locus_tag LOCUS_t00490 3616474 3616387 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3617425 3617871 gene locus_tag LOCUS_27230 3617425 3617871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786789.1 protein_id gnl|my_center|LOCUS_27230 3618001 3619386 gene locus_tag LOCUS_27240 3618001 3619386 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202606.1 protein_id gnl|my_center|LOCUS_27240 3619423 3621087 gene locus_tag LOCUS_27250 3619423 3621087 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786793.1 protein_id gnl|my_center|LOCUS_27250 3621153 3623147 gene locus_tag LOCUS_27260 3621153 3623147 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794862.1 protein_id gnl|my_center|LOCUS_27260 3624635 3623538 gene locus_tag LOCUS_27270 3624635 3623538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786796.1 protein_id gnl|my_center|LOCUS_27270 3626456 3624798 gene locus_tag LOCUS_27280 3626456 3624798 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786798.1 protein_id gnl|my_center|LOCUS_27280 3627686 3626616 gene locus_tag LOCUS_27290 3627686 3626616 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763415.1 protein_id gnl|my_center|LOCUS_27290 3628768 3627701 gene locus_tag LOCUS_27300 gene gmd 3628768 3627701 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786803.1 protein_id gnl|my_center|LOCUS_27300 3628982 3630262 gene locus_tag LOCUS_27310 3628982 3630262 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659589.1 protein_id gnl|my_center|LOCUS_27310 3631517 3630930 gene locus_tag LOCUS_27320 3631517 3630930 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107376.1 protein_id gnl|my_center|LOCUS_27320 3633361 3631700 gene locus_tag LOCUS_27330 3633361 3631700 CDS product RHS repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107377.1 protein_id gnl|my_center|LOCUS_27330 3633499 3635922 gene locus_tag LOCUS_27340 3633499 3635922 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202910.1 protein_id gnl|my_center|LOCUS_27340 3635933 3636613 gene locus_tag LOCUS_27350 3635933 3636613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107379.1 protein_id gnl|my_center|LOCUS_27350 3636850 3637471 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctgttaattgtaccgattgtggaattgaaac 3638144 3637587 gene locus_tag LOCUS_27360 3638144 3637587 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761351.1 protein_id gnl|my_center|LOCUS_27360 3638306 3639400 gene locus_tag LOCUS_27370 gene nspC 3638306 3639400 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107393.1 protein_id gnl|my_center|LOCUS_27370 3639519 3639592 gene locus_tag LOCUS_t00500 3639519 3639592 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3639622 3639704 gene locus_tag LOCUS_t00510 3639622 3639704 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3639743 3639827 gene locus_tag LOCUS_t00520 3639743 3639827 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3639843 3639916 gene locus_tag LOCUS_t00530 3639843 3639916 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3639943 3640025 gene locus_tag LOCUS_t00540 3639943 3640025 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3640062 3640135 gene locus_tag LOCUS_t00550 3640062 3640135 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3640517 3640729 gene locus_tag LOCUS_27380 3640517 3640729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 3640735 3641130 gene locus_tag LOCUS_27390 3640735 3641130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787390.1 protein_id gnl|my_center|LOCUS_27390 3641127 3642425 gene locus_tag LOCUS_27400 3641127 3642425 CDS product DUF3440 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763519.1 protein_id gnl|my_center|LOCUS_27400 3642422 3642967 gene locus_tag LOCUS_27410 3642422 3642967 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787394.1 protein_id gnl|my_center|LOCUS_27410 3643508 3644026 gene locus_tag LOCUS_27420 3643508 3644026 CDS product DUF3575 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202750.1 protein_id gnl|my_center|LOCUS_27420 3644068 3645525 gene locus_tag LOCUS_27430 3644068 3645525 CDS product DUF3868 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794258.1 protein_id gnl|my_center|LOCUS_27430 3645561 3647108 gene locus_tag LOCUS_27440 3645561 3647108 CDS product Mfa1 family fimbria major subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787397.1 protein_id gnl|my_center|LOCUS_27440 3647121 3648101 gene locus_tag LOCUS_27450 3647121 3648101 CDS product FimB/Mfa2 family fimbrial subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794256.1 protein_id gnl|my_center|LOCUS_27450 3649226 3648264 gene locus_tag LOCUS_27460 3649226 3648264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202752.1 protein_id gnl|my_center|LOCUS_27460 3650441 3649482 gene locus_tag LOCUS_27470 3650441 3649482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202753.1 protein_id gnl|my_center|LOCUS_27470 3650676 3651611 gene locus_tag LOCUS_27480 3650676 3651611 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763529.1 protein_id gnl|my_center|LOCUS_27480 3651634 3652761 gene locus_tag LOCUS_27490 3651634 3652761 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787406.1 protein_id gnl|my_center|LOCUS_27490 3652837 3653238 gene locus_tag LOCUS_27500 3652837 3653238 CDS product DUF2809 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093444.1 protein_id gnl|my_center|LOCUS_27500 3655080 3653197 gene locus_tag LOCUS_27510 gene cbiD 3655080 3653197 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993058.1 protein_id gnl|my_center|LOCUS_27510 3656882 3655077 gene locus_tag LOCUS_27520 gene cobM 3656882 3655077 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788023.1 protein_id gnl|my_center|LOCUS_27520 3658135 3656879 gene locus_tag LOCUS_27530 3658135 3656879 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788021.1 protein_id gnl|my_center|LOCUS_27530 3659572 3658136 gene locus_tag LOCUS_27540 gene cobJ 3659572 3658136 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788019.1 protein_id gnl|my_center|LOCUS_27540 3661902 3659695 gene locus_tag LOCUS_27550 3661902 3659695 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555650.1 protein_id gnl|my_center|LOCUS_27550 3663153 3662035 gene locus_tag LOCUS_27560 3663153 3662035 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868810.1 protein_id gnl|my_center|LOCUS_27560 3665204 3663177 gene locus_tag LOCUS_27570 3665204 3663177 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555650.1 protein_id gnl|my_center|LOCUS_27570 3665670 3667025 gene locus_tag LOCUS_27580 3665670 3667025 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202899.1 protein_id gnl|my_center|LOCUS_27580 3667058 3667633 gene locus_tag LOCUS_27590 3667058 3667633 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555647.1 protein_id gnl|my_center|LOCUS_27590 3667849 3667640 gene locus_tag LOCUS_27600 3667849 3667640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767859.1 protein_id gnl|my_center|LOCUS_27600 3669159 3667924 gene locus_tag LOCUS_27610 3669159 3667924 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803622.1 protein_id gnl|my_center|LOCUS_27610 3670339 3669143 gene locus_tag LOCUS_27620 3670339 3669143 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107545.1 protein_id gnl|my_center|LOCUS_27620 3671332 3670343 gene locus_tag LOCUS_27630 3671332 3670343 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777960.1 protein_id gnl|my_center|LOCUS_27630 3672769 3671345 gene locus_tag LOCUS_27640 3672769 3671345 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202896.1 protein_id gnl|my_center|LOCUS_27640 3673176 3674660 gene locus_tag LOCUS_27650 3673176 3674660 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787973.1 protein_id gnl|my_center|LOCUS_27650 3674653 3675669 gene locus_tag LOCUS_27660 gene cobD 3674653 3675669 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768909.1 protein_id gnl|my_center|LOCUS_27660 3675706 3676698 gene locus_tag LOCUS_27670 gene cbiB 3675706 3676698 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803605.1 protein_id gnl|my_center|LOCUS_27670 3677206 3676643 gene locus_tag LOCUS_27680 gene cobC 3677206 3676643 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787967.1 protein_id gnl|my_center|LOCUS_27680 3677814 3677197 gene locus_tag LOCUS_27690 3677814 3677197 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292396.1 protein_id gnl|my_center|LOCUS_27690 3679073 3678036 gene locus_tag LOCUS_27700 gene cobT 3679073 3678036 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202890.1 protein_id gnl|my_center|LOCUS_27700 3679675 3679166 gene locus_tag LOCUS_27710 gene cobU 3679675 3679166 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202889.1 protein_id gnl|my_center|LOCUS_27710 3679819 3679893 gene locus_tag LOCUS_t00560 3679819 3679893 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3680296 3680484 gene locus_tag LOCUS_27720 3680296 3680484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 3680564 3680956 gene locus_tag LOCUS_27730 3680564 3680956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 3681725 3681129 gene locus_tag LOCUS_27740 3681725 3681129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 3682416 3683909 gene locus_tag LOCUS_27750 gene proS 3682416 3683909 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107525.1 protein_id gnl|my_center|LOCUS_27750 3684631 3684125 gene locus_tag LOCUS_27760 gene bfr 3684631 3684125 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677991.1 protein_id gnl|my_center|LOCUS_27760 3684789 3685466 gene locus_tag LOCUS_27770 3684789 3685466 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788535.1 protein_id gnl|my_center|LOCUS_27770 3685473 3686747 gene locus_tag LOCUS_27780 3685473 3686747 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107523.1 protein_id gnl|my_center|LOCUS_27780 3686866 3687309 gene locus_tag LOCUS_27790 3686866 3687309 CDS product PepSY-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765741.1 protein_id gnl|my_center|LOCUS_27790 3687322 3688173 gene locus_tag LOCUS_27800 3687322 3688173 CDS product PepSY-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202990.1 protein_id gnl|my_center|LOCUS_27800 3688430 3688756 gene locus_tag LOCUS_27810 3688430 3688756 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787945.1 protein_id gnl|my_center|LOCUS_27810 3689403 3688876 gene locus_tag LOCUS_27820 3689403 3688876 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765001.1 protein_id gnl|my_center|LOCUS_27820 3689642 3689917 gene locus_tag LOCUS_27830 3689642 3689917 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763033.1 protein_id gnl|my_center|LOCUS_27830 3694342 3689894 gene locus_tag LOCUS_27840 3694342 3689894 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107519.1 protein_id gnl|my_center|LOCUS_27840 3694398 3695597 gene locus_tag LOCUS_27850 gene tsaD 3694398 3695597 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107518.1 protein_id gnl|my_center|LOCUS_27850 3695614 3696846 gene locus_tag LOCUS_27860 3695614 3696846 CDS product CinA family nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202865.1 protein_id gnl|my_center|LOCUS_27860 3697003 3697227 gene locus_tag LOCUS_27870 gene rpmB 3697003 3697227 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765736.1 protein_id gnl|my_center|LOCUS_27870 3697249 3697437 gene locus_tag LOCUS_27880 gene rpmG 3697249 3697437 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002560155.1 protein_id gnl|my_center|LOCUS_27880 3697458 3697616 gene locus_tag LOCUS_27890 3697458 3697616 CDS product DUF4295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963552.1 protein_id gnl|my_center|LOCUS_27890 3698049 3699008 gene locus_tag LOCUS_27900 gene ftsY 3698049 3699008 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787934.1 protein_id gnl|my_center|LOCUS_27900 3699005 3700303 gene locus_tag LOCUS_27910 gene rimO 3699005 3700303 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787933.1 protein_id gnl|my_center|LOCUS_27910 3700378 3700650 gene locus_tag LOCUS_27920 3700378 3700650 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761575.1 protein_id gnl|my_center|LOCUS_27920 3700664 3701890 gene locus_tag LOCUS_27930 3700664 3701890 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765733.1 protein_id gnl|my_center|LOCUS_27930 3702128 3703123 gene locus_tag LOCUS_27940 3702128 3703123 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787927.1 protein_id gnl|my_center|LOCUS_27940 3703180 3704049 gene locus_tag LOCUS_27950 3703180 3704049 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_27950 3704059 3705132 gene locus_tag LOCUS_27960 3704059 3705132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202862.1 protein_id gnl|my_center|LOCUS_27960 3705228 3706211 gene locus_tag LOCUS_27970 3705228 3706211 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_27970 3706300 3707328 gene locus_tag LOCUS_27980 3706300 3707328 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787920.1 protein_id gnl|my_center|LOCUS_27980 3707331 3708050 gene locus_tag LOCUS_27990 3707331 3708050 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803588.1 protein_id gnl|my_center|LOCUS_27990 3708085 3709923 gene locus_tag LOCUS_28000 3708085 3709923 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025814212.1 protein_id gnl|my_center|LOCUS_28000 3709938 3710774 gene locus_tag LOCUS_28010 3709938 3710774 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787899.1 protein_id gnl|my_center|LOCUS_28010 3711061 3711351 gene locus_tag LOCUS_28020 3711061 3711351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761566.1 protein_id gnl|my_center|LOCUS_28020 3711431 3712561 gene locus_tag LOCUS_28030 3711431 3712561 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765729.1 protein_id gnl|my_center|LOCUS_28030 3714013 3712817 gene locus_tag LOCUS_28040 3714013 3712817 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787888.1 protein_id gnl|my_center|LOCUS_28040 3716643 3714067 gene locus_tag LOCUS_28050 gene gyrA 3716643 3714067 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765727.1 protein_id gnl|my_center|LOCUS_28050 3717157 3719697 gene locus_tag LOCUS_28060 3717157 3719697 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202860.1 protein_id gnl|my_center|LOCUS_28060 3719805 3721850 gene locus_tag LOCUS_28070 gene htpG 3719805 3721850 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202859.1 protein_id gnl|my_center|LOCUS_28070 3722019 3724316 gene locus_tag LOCUS_28080 3722019 3724316 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768894.1 protein_id gnl|my_center|LOCUS_28080 3724395 3724469 gene locus_tag LOCUS_t00570 3724395 3724469 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3724493 3724567 gene locus_tag LOCUS_t00580 3724493 3724567 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3724586 3724660 gene locus_tag LOCUS_t00590 3724586 3724660 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3725723 3724830 gene locus_tag LOCUS_28090 gene dapA 3725723 3724830 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202857.1 protein_id gnl|my_center|LOCUS_28090 3727827 3725827 gene locus_tag LOCUS_28100 gene ligA 3727827 3725827 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202856.1 protein_id gnl|my_center|LOCUS_28100 3727903 3728580 gene locus_tag LOCUS_28110 gene trmD 3727903 3728580 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765722.1 protein_id gnl|my_center|LOCUS_28110 3729704 3728793 gene locus_tag LOCUS_28120 3729704 3728793 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765720.1 protein_id gnl|my_center|LOCUS_28120 3730468 3729692 gene locus_tag LOCUS_28130 3730468 3729692 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793749.1 protein_id gnl|my_center|LOCUS_28130 3731005 3730538 gene locus_tag LOCUS_28140 3731005 3730538 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793753.1 protein_id gnl|my_center|LOCUS_28140 3733180 3732161 gene locus_tag LOCUS_28150 gene holA 3733180 3732161 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787842.1 protein_id gnl|my_center|LOCUS_28150 3734034 3733249 gene locus_tag LOCUS_28160 3734034 3733249 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787839.1 protein_id gnl|my_center|LOCUS_28160 3734087 3734536 gene locus_tag LOCUS_28170 3734087 3734536 CDS product type I restriction enzyme HsdR N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793759.1 protein_id gnl|my_center|LOCUS_28170 3737759 3734619 gene locus_tag LOCUS_28180 3737759 3734619 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202854.1 protein_id gnl|my_center|LOCUS_28180 3738866 3737820 gene locus_tag LOCUS_28190 3738866 3737820 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292376.1 protein_id gnl|my_center|LOCUS_28190 3740374 3738980 gene locus_tag LOCUS_28200 3740374 3738980 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202853.1 protein_id gnl|my_center|LOCUS_28200 3741371 3740541 gene locus_tag LOCUS_28210 3741371 3740541 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761550.1 protein_id gnl|my_center|LOCUS_28210 3742472 3741378 gene locus_tag LOCUS_28220 3742472 3741378 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765714.1 protein_id gnl|my_center|LOCUS_28220 3742990 3742604 gene locus_tag LOCUS_28230 3742990 3742604 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803565.1 protein_id gnl|my_center|LOCUS_28230 3743088 3743519 gene locus_tag LOCUS_28240 3743088 3743519 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706840.1 protein_id gnl|my_center|LOCUS_28240 3743554 3744006 gene locus_tag LOCUS_28250 3743554 3744006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 3744563 3744087 gene locus_tag LOCUS_28260 gene nuoE 3744563 3744087 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766748.1 protein_id gnl|my_center|LOCUS_28260 3746348 3744582 gene locus_tag LOCUS_28270 3746348 3744582 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766747.1 protein_id gnl|my_center|LOCUS_28270 3748267 3746360 gene locus_tag LOCUS_28280 gene nuoF 3748267 3746360 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766746.1 protein_id gnl|my_center|LOCUS_28280 3748730 3748446 gene locus_tag LOCUS_28290 3748730 3748446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202851.1 protein_id gnl|my_center|LOCUS_28290 3749527 3748727 gene locus_tag LOCUS_28300 3749527 3748727 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768886.1 protein_id gnl|my_center|LOCUS_28300 3750185 3749565 gene locus_tag LOCUS_28310 3750185 3749565 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787813.1 protein_id gnl|my_center|LOCUS_28310 3750542 3750339 gene locus_tag LOCUS_28320 3750542 3750339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 3750943 3751473 gene locus_tag LOCUS_28330 3750943 3751473 CDS product DUF2148 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761545.1 protein_id gnl|my_center|LOCUS_28330 3751527 3752564 gene locus_tag LOCUS_28340 3751527 3752564 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765713.1 protein_id gnl|my_center|LOCUS_28340 3752607 3753491 gene locus_tag LOCUS_28350 3752607 3753491 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761543.1 protein_id gnl|my_center|LOCUS_28350 3753810 3757247 gene locus_tag LOCUS_28360 3753810 3757247 CDS product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048696927.1 protein_id gnl|my_center|LOCUS_28360 3757678 3757295 gene locus_tag LOCUS_28370 3757678 3757295 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787805.1 protein_id gnl|my_center|LOCUS_28370 3759436 3757679 gene locus_tag LOCUS_28380 gene aspS 3759436 3757679 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765710.1 protein_id gnl|my_center|LOCUS_28380 3760516 3759494 gene locus_tag LOCUS_28390 3760516 3759494 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761539.1 protein_id gnl|my_center|LOCUS_28390 3760739 3761923 gene locus_tag LOCUS_28400 3760739 3761923 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761538.1 protein_id gnl|my_center|LOCUS_28400 3762212 3762030 gene locus_tag LOCUS_28410 3762212 3762030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 3762504 3762259 gene locus_tag LOCUS_28420 3762504 3762259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 3762840 3762915 gene locus_tag LOCUS_t00600 3762840 3762915 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3762953 3763028 gene locus_tag LOCUS_t00610 3762953 3763028 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3763779 3763075 gene locus_tag LOCUS_28430 3763779 3763075 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202815.1 protein_id gnl|my_center|LOCUS_28430 3763966 3766434 gene locus_tag LOCUS_28440 gene lon 3763966 3766434 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793926.1 protein_id gnl|my_center|LOCUS_28440 3766431 3767561 gene locus_tag LOCUS_28450 gene tgt 3766431 3767561 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761519.1 protein_id gnl|my_center|LOCUS_28450 3767565 3768662 gene locus_tag LOCUS_28460 3767565 3768662 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761518.1 protein_id gnl|my_center|LOCUS_28460 3769338 3768835 gene locus_tag LOCUS_28470 3769338 3768835 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107474.1 protein_id gnl|my_center|LOCUS_28470 3769604 3770827 gene locus_tag LOCUS_28480 gene serB 3769604 3770827 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793930.1 protein_id gnl|my_center|LOCUS_28480 3770879 3772117 gene locus_tag LOCUS_28490 3770879 3772117 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787725.1 protein_id gnl|my_center|LOCUS_28490 3772939 3772142 gene locus_tag LOCUS_28500 3772939 3772142 CDS product DUF4738 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787724.1 protein_id gnl|my_center|LOCUS_28500 3774291 3772975 gene locus_tag LOCUS_28510 3774291 3772975 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107472.1 protein_id gnl|my_center|LOCUS_28510 3774867 3774319 gene locus_tag LOCUS_28520 gene rfbC 3774867 3774319 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787720.1 protein_id gnl|my_center|LOCUS_28520 3776276 3774870 gene locus_tag LOCUS_28530 3776276 3774870 CDS product capsule assembly Wzi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786397.1 protein_id gnl|my_center|LOCUS_28530 3776984 3776280 gene locus_tag LOCUS_28540 3776984 3776280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 3777624 3777151 gene locus_tag LOCUS_28550 3777624 3777151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 3778099 3777641 gene locus_tag LOCUS_28560 gene pssD 3778099 3777641 CDS product PssD/Cps14F family polysaccharide biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065325.1 protein_id gnl|my_center|LOCUS_28560 3778995 3778099 gene locus_tag LOCUS_28570 3778995 3778099 CDS product ATP-grasp fold amidoligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107724.1 protein_id gnl|my_center|LOCUS_28570 3780004 3779012 gene locus_tag LOCUS_28580 3780004 3779012 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205352220.1 protein_id gnl|my_center|LOCUS_28580 3781627 3782556 gene locus_tag LOCUS_28590 3781627 3782556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 3782559 3783434 gene locus_tag LOCUS_28600 3782559 3783434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 3783713 3784420 gene locus_tag LOCUS_28610 3783713 3784420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 3784417 3785616 gene locus_tag LOCUS_28620 3784417 3785616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 3786178 3786456 gene locus_tag LOCUS_28630 3786178 3786456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 3788248 3787574 gene locus_tag LOCUS_28640 3788248 3787574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 3789356 3788310 gene locus_tag LOCUS_28650 3789356 3788310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 3790281 3789358 gene locus_tag LOCUS_28660 3790281 3789358 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014568758.1 protein_id gnl|my_center|LOCUS_28660 3791200 3790295 gene locus_tag LOCUS_28670 3791200 3790295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 3792476 3791187 gene locus_tag LOCUS_28680 3792476 3791187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 3793981 3792473 gene locus_tag LOCUS_28690 3793981 3792473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 3795564 3793981 gene locus_tag LOCUS_28700 3795564 3793981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 3796379 3795576 gene locus_tag LOCUS_28710 3796379 3795576 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766005.1 protein_id gnl|my_center|LOCUS_28710 3798209 3796500 gene locus_tag LOCUS_28720 3798209 3796500 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202181.1 protein_id gnl|my_center|LOCUS_28720 3798541 3799617 gene locus_tag LOCUS_28730 3798541 3799617 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815896.1 protein_id gnl|my_center|LOCUS_28730 3799645 3800172 gene locus_tag LOCUS_28740 3799645 3800172 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787716.1 protein_id gnl|my_center|LOCUS_28740 3800427 3800579 gene locus_tag LOCUS_28750 3800427 3800579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 3800759 3802141 gene locus_tag LOCUS_28760 3800759 3802141 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107468.1 protein_id gnl|my_center|LOCUS_28760 3802231 3803034 gene locus_tag LOCUS_28770 3802231 3803034 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787710.1 protein_id gnl|my_center|LOCUS_28770 3803123 3803196 gene locus_tag LOCUS_t00620 3803123 3803196 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3804207 3803287 gene locus_tag LOCUS_28780 3804207 3803287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790572.1 protein_id gnl|my_center|LOCUS_28780 3804428 3805789 gene locus_tag LOCUS_28790 3804428 3805789 CDS product DUF5690 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801181.1 protein_id gnl|my_center|LOCUS_28790 3805786 3806625 gene locus_tag LOCUS_28800 gene phnX 3805786 3806625 CDS product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797923.1 protein_id gnl|my_center|LOCUS_28800 3806606 3807775 gene locus_tag LOCUS_28810 3806606 3807775 CDS product 2-aminoethylphosphonate--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790568.1 protein_id gnl|my_center|LOCUS_28810 3808485 3807898 gene locus_tag LOCUS_28820 3808485 3807898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 3808691 3808618 gene locus_tag LOCUS_t00630 3808691 3808618 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3808965 3810257 gene locus_tag LOCUS_28830 3808965 3810257 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786418.1 protein_id gnl|my_center|LOCUS_28830 3810606 3811052 gene locus_tag LOCUS_28840 3810606 3811052 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803505.1 protein_id gnl|my_center|LOCUS_28840 3811170 3811724 gene locus_tag LOCUS_28850 3811170 3811724 CDS product DUF3332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787692.1 protein_id gnl|my_center|LOCUS_28850 3814080 3811816 gene locus_tag LOCUS_28860 3814080 3811816 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202810.1 protein_id gnl|my_center|LOCUS_28860 3815476 3814280 gene locus_tag LOCUS_28870 3815476 3814280 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107462.1 protein_id gnl|my_center|LOCUS_28870 3815963 3815601 gene locus_tag LOCUS_28880 3815963 3815601 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761500.1 protein_id gnl|my_center|LOCUS_28880 3816148 3816912 gene locus_tag LOCUS_28890 3816148 3816912 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787685.1 protein_id gnl|my_center|LOCUS_28890 3817114 3816863 gene locus_tag LOCUS_28900 3817114 3816863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787682.1 protein_id gnl|my_center|LOCUS_28900 3818164 3817115 gene locus_tag LOCUS_28910 3818164 3817115 CDS product DUF4296 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107460.1 protein_id gnl|my_center|LOCUS_28910 3818805 3818161 gene locus_tag LOCUS_28920 3818805 3818161 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787678.1 protein_id gnl|my_center|LOCUS_28920 3819291 3818911 gene locus_tag LOCUS_28930 3819291 3818911 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777736.1 protein_id gnl|my_center|LOCUS_28930 3822765 3819340 gene locus_tag LOCUS_28940 gene ileS 3822765 3819340 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202809.1 protein_id gnl|my_center|LOCUS_28940 3823054 3824058 gene locus_tag LOCUS_28950 3823054 3824058 CDS product DUF2776 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202808.1 protein_id gnl|my_center|LOCUS_28950 3824966 3825562 gene locus_tag LOCUS_28960 3824966 3825562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28960 3825961 3826344 gene locus_tag LOCUS_28970 3825961 3826344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 3826362 3827750 gene locus_tag LOCUS_28980 3826362 3827750 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793956.1 protein_id gnl|my_center|LOCUS_28980 3828055 3827810 gene locus_tag LOCUS_28990 3828055 3827810 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787659.1 protein_id gnl|my_center|LOCUS_28990 3828412 3829230 gene locus_tag LOCUS_29000 gene thiD 3828412 3829230 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202801.1 protein_id gnl|my_center|LOCUS_29000 3829350 3830237 gene locus_tag LOCUS_29010 gene fabD 3829350 3830237 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793967.1 protein_id gnl|my_center|LOCUS_29010 3830490 3831653 gene locus_tag LOCUS_29020 gene sucC 3830490 3831653 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777701.1 protein_id gnl|my_center|LOCUS_29020 3831650 3832519 gene locus_tag LOCUS_29030 gene sucD 3831650 3832519 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765646.1 protein_id gnl|my_center|LOCUS_29030 3832532 3832705 gene locus_tag LOCUS_29040 3832532 3832705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 3835191 3833689 gene locus_tag LOCUS_29050 3835191 3833689 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555722.1 protein_id gnl|my_center|LOCUS_29050 3835438 3836646 gene locus_tag LOCUS_29060 3835438 3836646 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660204.1 protein_id gnl|my_center|LOCUS_29060 3836652 3837314 gene locus_tag LOCUS_29070 3836652 3837314 CDS product ElyC/SanA/YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202947.1 protein_id gnl|my_center|LOCUS_29070 3838036 3837497 gene locus_tag LOCUS_29080 3838036 3837497 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107760.1 protein_id gnl|my_center|LOCUS_29080 3838292 3839785 gene locus_tag LOCUS_29090 3838292 3839785 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802512.1 protein_id gnl|my_center|LOCUS_29090 3840535 3839939 gene locus_tag LOCUS_29100 3840535 3839939 CDS product type 1 glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203132.1 protein_id gnl|my_center|LOCUS_29100 3840738 3840983 gene locus_tag LOCUS_29110 3840738 3840983 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788894.1 protein_id gnl|my_center|LOCUS_29110 3842291 3841122 gene locus_tag LOCUS_29120 3842291 3841122 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095819.1 protein_id gnl|my_center|LOCUS_29120 3842482 3842796 gene locus_tag LOCUS_29130 3842482 3842796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 3842787 3842933 gene locus_tag LOCUS_29140 3842787 3842933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 3844154 3843120 gene locus_tag LOCUS_29150 3844154 3843120 CDS product toxin-antitoxin system YwqK family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107963.1 protein_id gnl|my_center|LOCUS_29150 3845105 3844332 gene locus_tag LOCUS_29160 3845105 3844332 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763964.1 protein_id gnl|my_center|LOCUS_29160 3845216 3845875 gene locus_tag LOCUS_29170 3845216 3845875 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763965.1 protein_id gnl|my_center|LOCUS_29170 3846735 3846034 gene locus_tag LOCUS_29180 3846735 3846034 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962235.1 protein_id gnl|my_center|LOCUS_29180 3848379 3848900 gene locus_tag LOCUS_29190 3848379 3848900 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020461.1 protein_id gnl|my_center|LOCUS_29190 3848915 3849766 gene locus_tag LOCUS_29200 3848915 3849766 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107747.1 protein_id gnl|my_center|LOCUS_29200 3849912 3850256 gene locus_tag LOCUS_29210 3849912 3850256 CDS product TIGR04076 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459853.1 protein_id gnl|my_center|LOCUS_29210 3850350 3851471 gene locus_tag LOCUS_29220 3850350 3851471 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082494.1 protein_id gnl|my_center|LOCUS_29220 3851530 3852039 gene locus_tag LOCUS_29230 3851530 3852039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761477.1 protein_id gnl|my_center|LOCUS_29230 3852045 3852440 gene locus_tag LOCUS_29240 3852045 3852440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 3852470 3853399 gene locus_tag LOCUS_29250 3852470 3853399 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107441.1 protein_id gnl|my_center|LOCUS_29250 3853404 3854927 gene locus_tag LOCUS_29260 3853404 3854927 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765637.1 protein_id gnl|my_center|LOCUS_29260 3855085 3855894 gene locus_tag LOCUS_29270 3855085 3855894 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761475.1 protein_id gnl|my_center|LOCUS_29270 3855882 3856940 gene locus_tag LOCUS_29280 3855882 3856940 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768800.1 protein_id gnl|my_center|LOCUS_29280 3856956 3858653 gene locus_tag LOCUS_29290 3856956 3858653 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202799.1 protein_id gnl|my_center|LOCUS_29290 3858760 3859749 gene locus_tag LOCUS_29300 3858760 3859749 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202798.1 protein_id gnl|my_center|LOCUS_29300 3859733 3860329 gene locus_tag LOCUS_29310 3859733 3860329 CDS product aminotransferase class IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794135.1 protein_id gnl|my_center|LOCUS_29310 3860638 3861309 gene locus_tag LOCUS_29320 3860638 3861309 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787603.1 protein_id gnl|my_center|LOCUS_29320 3861347 3861793 gene locus_tag LOCUS_29330 3861347 3861793 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761472.1 protein_id gnl|my_center|LOCUS_29330 3861811 3863823 gene locus_tag LOCUS_29340 3861811 3863823 CDS product alpha amylase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787605.1 protein_id gnl|my_center|LOCUS_29340 3864235 3863927 gene locus_tag LOCUS_29350 3864235 3863927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 3864596 3864198 gene locus_tag LOCUS_29360 3864596 3864198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29360 3866373 3865642 gene locus_tag LOCUS_29370 3866373 3865642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787597.1 protein_id gnl|my_center|LOCUS_29370 3866591 3867031 gene locus_tag LOCUS_29380 gene umuD 3866591 3867031 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768414.1 protein_id gnl|my_center|LOCUS_29380 3867031 3868281 gene locus_tag LOCUS_29390 3867031 3868281 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768413.1 protein_id gnl|my_center|LOCUS_29390 3868316 3868504 gene locus_tag LOCUS_29400 3868316 3868504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29400 3868518 3868883 gene locus_tag LOCUS_29410 3868518 3868883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29410 3870071 3869343 gene locus_tag LOCUS_29420 3870071 3869343 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107566.1 protein_id gnl|my_center|LOCUS_29420 3870836 3870123 gene locus_tag LOCUS_29430 3870836 3870123 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789656.1 protein_id gnl|my_center|LOCUS_29430 3871364 3871050 gene locus_tag LOCUS_29440 3871364 3871050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 3871486 3871983 gene locus_tag LOCUS_29450 3871486 3871983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 3872406 3873797 gene locus_tag LOCUS_29460 3872406 3873797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 3873873 3874313 gene locus_tag LOCUS_29470 3873873 3874313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 3874505 3874798 gene locus_tag LOCUS_29480 3874505 3874798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 3874814 3875086 gene locus_tag LOCUS_29490 3874814 3875086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 3875079 3875672 gene locus_tag LOCUS_29500 3875079 3875672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 3875659 3877011 gene locus_tag LOCUS_29510 gene dnaB 3875659 3877011 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256839.1 protein_id gnl|my_center|LOCUS_29510 3877015 3878235 gene locus_tag LOCUS_29520 3877015 3878235 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113850176.1 protein_id gnl|my_center|LOCUS_29520 3878238 3878480 gene locus_tag LOCUS_29530 3878238 3878480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 3878562 3878855 gene locus_tag LOCUS_29540 3878562 3878855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 3879004 3879447 gene locus_tag LOCUS_29550 3879004 3879447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 3879510 3879935 gene locus_tag LOCUS_29560 3879510 3879935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 3879932 3880291 gene locus_tag LOCUS_29570 3879932 3880291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 3880288 3880635 gene locus_tag LOCUS_29580 3880288 3880635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 3880632 3881255 gene locus_tag LOCUS_29590 3880632 3881255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 3881248 3886005 gene locus_tag LOCUS_29600 3881248 3886005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 3886007 3886423 gene locus_tag LOCUS_29610 3886007 3886423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 3886420 3886818 gene locus_tag LOCUS_29620 3886420 3886818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 3886918 3887100 gene locus_tag LOCUS_29630 3886918 3887100 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793631.1 protein_id gnl|my_center|LOCUS_29630 3887151 3887591 gene locus_tag LOCUS_29640 3887151 3887591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 3888011 3887673 gene locus_tag LOCUS_29650 3888011 3887673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 3888915 3888076 gene locus_tag LOCUS_29660 3888915 3888076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 3889584 3888943 gene locus_tag LOCUS_29670 3889584 3888943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 3889910 3889605 gene locus_tag LOCUS_29680 3889910 3889605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 3890092 3890256 gene locus_tag LOCUS_29690 3890092 3890256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 3890269 3890604 gene locus_tag LOCUS_29700 3890269 3890604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 3890654 3890917 gene locus_tag LOCUS_29710 3890654 3890917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 3890924 3891325 gene locus_tag LOCUS_29720 3890924 3891325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 3891322 3891657 gene locus_tag LOCUS_29730 3891322 3891657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 3893802 3891916 gene locus_tag LOCUS_29740 3893802 3891916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 3898435 3893873 gene locus_tag LOCUS_29750 3898435 3893873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 3899795 3899721 gene locus_tag LOCUS_t00640 3899795 3899721 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3901303 3899885 gene locus_tag LOCUS_29760 3901303 3899885 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202795.1 protein_id gnl|my_center|LOCUS_29760 3902066 3901332 gene locus_tag LOCUS_29770 3902066 3901332 CDS product DUF5932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761423.1 protein_id gnl|my_center|LOCUS_29770 3906158 3902091 gene locus_tag LOCUS_29780 3906158 3902091 CDS product DUF5113 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107427.1 protein_id gnl|my_center|LOCUS_29780 3906574 3907512 gene locus_tag LOCUS_29790 3906574 3907512 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768748.1 protein_id gnl|my_center|LOCUS_29790 3908057 3908335 gene locus_tag LOCUS_29800 3908057 3908335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 3910426 3909272 gene locus_tag LOCUS_29810 3910426 3909272 CDS product phosphatidylinositol-4-phosphate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787585.1 protein_id gnl|my_center|LOCUS_29810 3911800 3910514 gene locus_tag LOCUS_29820 3911800 3910514 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202792.1 protein_id gnl|my_center|LOCUS_29820 3912552 3911797 gene locus_tag LOCUS_29830 gene kdsB 3912552 3911797 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761419.1 protein_id gnl|my_center|LOCUS_29830 3912867 3912559 gene locus_tag LOCUS_29840 3912867 3912559 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761418.1 protein_id gnl|my_center|LOCUS_29840 3915209 3912975 gene locus_tag LOCUS_29850 3915209 3912975 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107425.1 protein_id gnl|my_center|LOCUS_29850 3915598 3916521 gene locus_tag LOCUS_29860 gene pyrB 3915598 3916521 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787548.1 protein_id gnl|my_center|LOCUS_29860 3916540 3917001 gene locus_tag LOCUS_29870 gene pyrI 3916540 3917001 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787546.1 protein_id gnl|my_center|LOCUS_29870 3917035 3917613 gene locus_tag LOCUS_29880 3917035 3917613 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803433.1 protein_id gnl|my_center|LOCUS_29880 3917646 3918350 gene locus_tag LOCUS_29890 3917646 3918350 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761413.1 protein_id gnl|my_center|LOCUS_29890 3918480 3919760 gene locus_tag LOCUS_29900 3918480 3919760 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787540.1 protein_id gnl|my_center|LOCUS_29900 3919923 3920630 gene locus_tag LOCUS_29910 3919923 3920630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787535.1 protein_id gnl|my_center|LOCUS_29910 3922432 3920765 gene locus_tag LOCUS_29920 3922432 3920765 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787533.1 protein_id gnl|my_center|LOCUS_29920 3924652 3922601 gene locus_tag LOCUS_29930 3924652 3922601 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202778.1 protein_id gnl|my_center|LOCUS_29930 3924972 3926555 gene locus_tag LOCUS_29940 3924972 3926555 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803428.1 protein_id gnl|my_center|LOCUS_29940 3926564 3927262 gene locus_tag LOCUS_29950 3926564 3927262 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787526.1 protein_id gnl|my_center|LOCUS_29950 3927381 3927914 gene locus_tag LOCUS_29960 3927381 3927914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765599.1 protein_id gnl|my_center|LOCUS_29960 3927948 3928835 gene locus_tag LOCUS_29970 3927948 3928835 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803426.1 protein_id gnl|my_center|LOCUS_29970 3928878 3930092 gene locus_tag LOCUS_29980 3928878 3930092 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787705.1 protein_id gnl|my_center|LOCUS_29980 3931144 3930113 gene locus_tag LOCUS_29990 3931144 3930113 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202775.1 protein_id gnl|my_center|LOCUS_29990 3932178 3931141 gene locus_tag LOCUS_30000 3932178 3931141 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787518.1 protein_id gnl|my_center|LOCUS_30000 3933338 3932190 gene locus_tag LOCUS_30010 3933338 3932190 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202774.1 protein_id gnl|my_center|LOCUS_30010 3933434 3934144 gene locus_tag LOCUS_30020 3933434 3934144 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787514.1 protein_id gnl|my_center|LOCUS_30020 3934176 3934520 gene locus_tag LOCUS_30030 3934176 3934520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 3934596 3935699 gene locus_tag LOCUS_30040 3934596 3935699 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022471043.1 protein_id gnl|my_center|LOCUS_30040 3935689 3938781 gene locus_tag LOCUS_30050 3935689 3938781 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109387.1 protein_id gnl|my_center|LOCUS_30050 3938778 3940037 gene locus_tag LOCUS_30060 3938778 3940037 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109388.1 protein_id gnl|my_center|LOCUS_30060 3940498 3941262 gene locus_tag LOCUS_30070 3940498 3941262 CDS product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990768.1 protein_id gnl|my_center|LOCUS_30070 3942985 3941348 gene locus_tag LOCUS_30080 3942985 3941348 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107555.1 protein_id gnl|my_center|LOCUS_30080 3944609 3943470 gene locus_tag LOCUS_30090 3944609 3943470 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202157.1 protein_id gnl|my_center|LOCUS_30090 3945339 3944713 gene locus_tag LOCUS_30100 3945339 3944713 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801359.1 protein_id gnl|my_center|LOCUS_30100 3946076 3945336 gene locus_tag LOCUS_30110 3946076 3945336 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801362.1 protein_id gnl|my_center|LOCUS_30110 3946221 3946081 gene locus_tag LOCUS_30120 3946221 3946081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 3947439 3946378 gene locus_tag LOCUS_30130 3947439 3946378 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225342.1 protein_id gnl|my_center|LOCUS_30130 3948515 3947511 gene locus_tag LOCUS_30140 3948515 3947511 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202154.1 protein_id gnl|my_center|LOCUS_30140 3948780 3948553 gene locus_tag LOCUS_30150 3948780 3948553 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775528.1 protein_id gnl|my_center|LOCUS_30150 3949658 3948777 gene locus_tag LOCUS_30160 gene fabD 3949658 3948777 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793967.1 protein_id gnl|my_center|LOCUS_30160 3950356 3949706 gene locus_tag LOCUS_30170 3950356 3949706 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775527.1 protein_id gnl|my_center|LOCUS_30170 3950971 3950363 gene locus_tag LOCUS_30180 3950971 3950363 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202264.1 protein_id gnl|my_center|LOCUS_30180 3952309 3951182 gene locus_tag LOCUS_30190 3952309 3951182 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202152.1 protein_id gnl|my_center|LOCUS_30190 3954405 3953302 gene locus_tag LOCUS_30200 3954405 3953302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 3955294 3954413 gene locus_tag LOCUS_30210 3955294 3954413 CDS product ATP-grasp fold amidoligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107724.1 protein_id gnl|my_center|LOCUS_30210 3955744 3955313 gene locus_tag LOCUS_30220 3955744 3955313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 3955818 3956063 gene locus_tag LOCUS_30230 3955818 3956063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 3957838 3956534 gene locus_tag LOCUS_30240 3957838 3956534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 3958979 3957816 gene locus_tag LOCUS_30250 3958979 3957816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 3960203 3959010 gene locus_tag LOCUS_30260 3960203 3959010 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203720.1 protein_id gnl|my_center|LOCUS_30260 3961189 3960200 gene locus_tag LOCUS_30270 3961189 3960200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 3961822 3961370 gene locus_tag LOCUS_30280 3961822 3961370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30280 3962354 3961887 gene locus_tag LOCUS_30290 3962354 3961887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 3962611 3962375 gene locus_tag LOCUS_30300 3962611 3962375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 3964025 3962928 gene locus_tag LOCUS_30310 3964025 3962928 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202469.1 protein_id gnl|my_center|LOCUS_30310 3965161 3963968 gene locus_tag LOCUS_30320 3965161 3963968 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039964.1 protein_id gnl|my_center|LOCUS_30320 3966663 3965236 gene locus_tag LOCUS_30330 3966663 3965236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 3968162 3966843 gene locus_tag LOCUS_30340 3968162 3966843 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107343.1 protein_id gnl|my_center|LOCUS_30340 3968681 3968193 gene locus_tag LOCUS_30350 3968681 3968193 CDS product UpxZ family transcription anti-terminator antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202140.1 protein_id gnl|my_center|LOCUS_30350 3969278 3968730 gene locus_tag LOCUS_30360 gene upgY 3969278 3968730 CDS product capsular polysaccharide transcription antiterminator UpgY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784914.1 protein_id gnl|my_center|LOCUS_30360 3969704 3969492 gene locus_tag LOCUS_30370 3969704 3969492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 3970041 3970226 gene locus_tag LOCUS_30380 3970041 3970226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 3971868 3971278 gene locus_tag LOCUS_30390 3971868 3971278 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787429.1 protein_id gnl|my_center|LOCUS_30390 3971981 3973636 gene locus_tag LOCUS_30400 gene hcp 3971981 3973636 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023062937.1 protein_id gnl|my_center|LOCUS_30400 3973645 3974382 gene locus_tag LOCUS_30410 gene ric 3973645 3974382 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814727.1 protein_id gnl|my_center|LOCUS_30410 3974578 3974504 gene locus_tag LOCUS_t00650 3974578 3974504 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 3974765 3976081 gene locus_tag LOCUS_30420 3974765 3976081 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763512.1 protein_id gnl|my_center|LOCUS_30420 3976153 3976746 gene locus_tag LOCUS_30430 3976153 3976746 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787276.1 protein_id gnl|my_center|LOCUS_30430 3977297 3976752 gene locus_tag LOCUS_30440 3977297 3976752 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787274.1 protein_id gnl|my_center|LOCUS_30440 3978054 3977302 gene locus_tag LOCUS_30450 3978054 3977302 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256941.1 protein_id gnl|my_center|LOCUS_30450 3979496 3978057 gene locus_tag LOCUS_30460 gene hpnJ 3979496 3978057 CDS product hopanoid biosynthesis associated radical SAM protein HpnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941811.1 protein_id gnl|my_center|LOCUS_30460 3979979 3979521 gene locus_tag LOCUS_30470 3979979 3979521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202710.1 protein_id gnl|my_center|LOCUS_30470 3980618 3980001 gene locus_tag LOCUS_30480 gene recR 3980618 3980001 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763508.1 protein_id gnl|my_center|LOCUS_30480 3981134 3982144 gene locus_tag LOCUS_30490 3981134 3982144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 3982157 3982762 gene locus_tag LOCUS_30500 gene yihA 3982157 3982762 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794469.1 protein_id gnl|my_center|LOCUS_30500 3982771 3983367 gene locus_tag LOCUS_30510 3982771 3983367 CDS product DUF4923 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765853.1 protein_id gnl|my_center|LOCUS_30510 3984638 3983547 gene locus_tag LOCUS_30520 3984638 3983547 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107212.1 protein_id gnl|my_center|LOCUS_30520 3984823 3985215 gene locus_tag LOCUS_30530 3984823 3985215 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763504.1 protein_id gnl|my_center|LOCUS_30530 3985328 3987316 gene locus_tag LOCUS_30540 3985328 3987316 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763503.1 protein_id gnl|my_center|LOCUS_30540 3987333 3990629 gene locus_tag LOCUS_30550 3987333 3990629 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202201.1 protein_id gnl|my_center|LOCUS_30550 3990631 3991416 gene locus_tag LOCUS_30560 3990631 3991416 CDS product DUF1460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794479.1 protein_id gnl|my_center|LOCUS_30560 3991445 3992122 gene locus_tag LOCUS_30570 3991445 3992122 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267339.1 protein_id gnl|my_center|LOCUS_30570 3992809 3992144 gene locus_tag LOCUS_30580 gene lipB 3992809 3992144 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765857.1 protein_id gnl|my_center|LOCUS_30580 3995077 3992861 gene locus_tag LOCUS_30590 3995077 3992861 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787240.1 protein_id gnl|my_center|LOCUS_30590 3995385 3995188 gene locus_tag LOCUS_30600 3995385 3995188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 3995773 3995570 gene locus_tag LOCUS_30610 3995773 3995570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 3996835 3996017 gene locus_tag LOCUS_30620 3996835 3996017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 3997594 3997283 gene locus_tag LOCUS_30630 3997594 3997283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 3999858 3997636 gene locus_tag LOCUS_30640 3999858 3997636 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055269995.1 protein_id gnl|my_center|LOCUS_30640 4000797 4001573 gene locus_tag LOCUS_30650 4000797 4001573 CDS product RsiV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787233.1 protein_id gnl|my_center|LOCUS_30650 4001611 4002231 gene locus_tag LOCUS_30660 gene rsmG 4001611 4002231 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765865.1 protein_id gnl|my_center|LOCUS_30660 4002257 4002895 gene locus_tag LOCUS_30670 4002257 4002895 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763490.1 protein_id gnl|my_center|LOCUS_30670 4002963 4005809 gene locus_tag LOCUS_30680 gene gcvP 4002963 4005809 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202698.1 protein_id gnl|my_center|LOCUS_30680 4006456 4005890 gene locus_tag LOCUS_30690 4006456 4005890 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765867.1 protein_id gnl|my_center|LOCUS_30690 4007549 4006461 gene locus_tag LOCUS_30700 4007549 4006461 CDS product HpaII family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794495.1 protein_id gnl|my_center|LOCUS_30700 4008284 4007562 gene locus_tag LOCUS_30710 4008284 4007562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 4008460 4008663 gene locus_tag LOCUS_30720 4008460 4008663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 4008881 4010239 gene locus_tag LOCUS_30730 4008881 4010239 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108882.1 protein_id gnl|my_center|LOCUS_30730 4011101 4010472 gene locus_tag LOCUS_30740 4011101 4010472 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794496.1 protein_id gnl|my_center|LOCUS_30740 4012436 4011189 gene locus_tag LOCUS_30750 4012436 4011189 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763485.1 protein_id gnl|my_center|LOCUS_30750 4013389 4012466 gene locus_tag LOCUS_30760 4013389 4012466 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765870.1 protein_id gnl|my_center|LOCUS_30760 4014575 4013502 gene locus_tag LOCUS_30770 gene serC 4014575 4013502 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763483.1 protein_id gnl|my_center|LOCUS_30770 4016425 4015094 gene locus_tag LOCUS_30780 4016425 4015094 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107635.1 protein_id gnl|my_center|LOCUS_30780 4017841 4016570 gene locus_tag LOCUS_30790 gene nqrF 4017841 4016570 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787210.1 protein_id gnl|my_center|LOCUS_30790 4018496 4017864 gene locus_tag LOCUS_30800 gene nqrE 4018496 4017864 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787208.1 protein_id gnl|my_center|LOCUS_30800 4019245 4018613 gene locus_tag LOCUS_30810 4019245 4018613 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787205.1 protein_id gnl|my_center|LOCUS_30810 4019939 4019262 gene locus_tag LOCUS_30820 4019939 4019262 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787203.1 protein_id gnl|my_center|LOCUS_30820 4021132 4019954 gene locus_tag LOCUS_30830 4021132 4019954 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787201.1 protein_id gnl|my_center|LOCUS_30830 4022517 4021168 gene locus_tag LOCUS_30840 4022517 4021168 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787198.1 protein_id gnl|my_center|LOCUS_30840 4024369 4023020 gene locus_tag LOCUS_30850 4024369 4023020 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794507.1 protein_id gnl|my_center|LOCUS_30850 4024608 4025861 gene locus_tag LOCUS_30860 4024608 4025861 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202696.1 protein_id gnl|my_center|LOCUS_30860 4025941 4026690 gene locus_tag LOCUS_30870 4025941 4026690 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765877.1 protein_id gnl|my_center|LOCUS_30870 4026727 4028967 gene locus_tag LOCUS_30880 4026727 4028967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794512.1 protein_id gnl|my_center|LOCUS_30880 4029065 4030321 gene locus_tag LOCUS_30890 4029065 4030321 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202694.1 protein_id gnl|my_center|LOCUS_30890 4030318 4031217 gene locus_tag LOCUS_30900 4030318 4031217 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202693.1 protein_id gnl|my_center|LOCUS_30900 4031230 4032393 gene locus_tag LOCUS_30910 4031230 4032393 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765881.1 protein_id gnl|my_center|LOCUS_30910 4032474 4033601 gene locus_tag LOCUS_30920 4032474 4033601 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240438.1 protein_id gnl|my_center|LOCUS_30920 4034478 4033621 gene locus_tag LOCUS_30930 4034478 4033621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108129.1 protein_id gnl|my_center|LOCUS_30930 4035009 4035959 gene locus_tag LOCUS_30940 4035009 4035959 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054958832.1 protein_id gnl|my_center|LOCUS_30940 4035981 4037441 gene locus_tag LOCUS_30950 4035981 4037441 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765891.1 protein_id gnl|my_center|LOCUS_30950 4037459 4038616 gene locus_tag LOCUS_30960 4037459 4038616 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765892.1 protein_id gnl|my_center|LOCUS_30960 4038632 4039831 gene locus_tag LOCUS_30970 4038632 4039831 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768487.1 protein_id gnl|my_center|LOCUS_30970 4039866 4042532 gene locus_tag LOCUS_30980 4039866 4042532 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202686.1 protein_id gnl|my_center|LOCUS_30980 4043009 4043719 gene locus_tag LOCUS_30990 4043009 4043719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 4046380 4043843 gene locus_tag LOCUS_31000 4046380 4043843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 4049189 4046403 gene locus_tag LOCUS_31010 4049189 4046403 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787151.1 protein_id gnl|my_center|LOCUS_31010 4051100 4049406 gene locus_tag LOCUS_31020 gene ettA 4051100 4049406 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776885.1 protein_id gnl|my_center|LOCUS_31020 4051333 4051406 gene locus_tag LOCUS_t00660 4051333 4051406 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4051648 4052868 gene locus_tag LOCUS_31030 4051648 4052868 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102408502.1 protein_id gnl|my_center|LOCUS_31030 4053445 4053152 gene locus_tag LOCUS_31040 4053445 4053152 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202095.1 protein_id gnl|my_center|LOCUS_31040 4053792 4053499 gene locus_tag LOCUS_31050 4053792 4053499 CDS product DUF3876 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007478799.1 protein_id gnl|my_center|LOCUS_31050 4054093 4053779 gene locus_tag LOCUS_31060 4054093 4053779 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007478800.1 protein_id gnl|my_center|LOCUS_31060 4054720 4055256 gene locus_tag LOCUS_31070 4054720 4055256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 4055339 4055827 gene locus_tag LOCUS_31080 4055339 4055827 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108259.1 protein_id gnl|my_center|LOCUS_31080 4056204 4057007 gene locus_tag LOCUS_31090 4056204 4057007 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279230.1 protein_id gnl|my_center|LOCUS_31090 4057047 4057673 gene locus_tag LOCUS_31100 4057047 4057673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 4057803 4058135 gene locus_tag LOCUS_31110 4057803 4058135 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007478806.1 protein_id gnl|my_center|LOCUS_31110 4058420 4059004 gene locus_tag LOCUS_31120 4058420 4059004 CDS product BfmA/BtgA family mobilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202090.1 protein_id gnl|my_center|LOCUS_31120 4058997 4059989 gene locus_tag LOCUS_31130 4058997 4059989 CDS product DUF5712 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202089.1 protein_id gnl|my_center|LOCUS_31130 4060240 4062108 gene locus_tag LOCUS_31140 4060240 4062108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 4062113 4063669 gene locus_tag LOCUS_31150 4062113 4063669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 4063666 4064934 gene locus_tag LOCUS_31160 4063666 4064934 CDS product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606740.1 protein_id gnl|my_center|LOCUS_31160 4064931 4065749 gene locus_tag LOCUS_31170 4064931 4065749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 4066515 4066769 gene locus_tag LOCUS_31180 4066515 4066769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 4066858 4069149 gene locus_tag LOCUS_31190 4066858 4069149 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107420.1 protein_id gnl|my_center|LOCUS_31190 4069210 4069395 gene locus_tag LOCUS_31200 4069210 4069395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 4069557 4070258 gene locus_tag LOCUS_31210 4069557 4070258 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992090.1 protein_id gnl|my_center|LOCUS_31210 4070516 4070995 gene locus_tag LOCUS_31220 4070516 4070995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 4071255 4070992 gene locus_tag LOCUS_31230 4071255 4070992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 4071369 4072715 gene locus_tag LOCUS_31240 4071369 4072715 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763445.1 protein_id gnl|my_center|LOCUS_31240 4072788 4073489 gene locus_tag LOCUS_31250 4072788 4073489 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786956.1 protein_id gnl|my_center|LOCUS_31250 4073590 4074198 gene locus_tag LOCUS_31260 gene mtgA 4073590 4074198 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107650.1 protein_id gnl|my_center|LOCUS_31260 4074284 4075483 gene locus_tag LOCUS_31270 4074284 4075483 CDS product DUF5103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962586.1 protein_id gnl|my_center|LOCUS_31270 4077409 4075634 gene locus_tag LOCUS_31280 4077409 4075634 CDS product pyruvate carboxylase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794777.1 protein_id gnl|my_center|LOCUS_31280 4078183 4077680 gene locus_tag LOCUS_31290 4078183 4077680 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763441.1 protein_id gnl|my_center|LOCUS_31290 4078570 4079055 gene locus_tag LOCUS_31300 4078570 4079055 CDS product DUF4251 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202632.1 protein_id gnl|my_center|LOCUS_31300 4079738 4079115 gene locus_tag LOCUS_31310 4079738 4079115 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765911.1 protein_id gnl|my_center|LOCUS_31310 4079823 4080911 gene locus_tag LOCUS_31320 gene wecB 4079823 4080911 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555698.1 protein_id gnl|my_center|LOCUS_31320 4082057 4080918 gene locus_tag LOCUS_31330 4082057 4080918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 4082187 4084787 gene locus_tag LOCUS_31340 4082187 4084787 CDS product DUF5686 and carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107653.1 protein_id gnl|my_center|LOCUS_31340 4084808 4086079 gene locus_tag LOCUS_31350 4084808 4086079 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765915.1 protein_id gnl|my_center|LOCUS_31350 4086105 4087061 gene locus_tag LOCUS_31360 4086105 4087061 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786931.1 protein_id gnl|my_center|LOCUS_31360 4088077 4090881 gene locus_tag LOCUS_31370 4088077 4090881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 4091464 4094265 gene locus_tag LOCUS_31380 4091464 4094265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 4095521 4094373 gene locus_tag LOCUS_31390 gene cydB 4095521 4094373 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786920.1 protein_id gnl|my_center|LOCUS_31390 4097104 4095548 gene locus_tag LOCUS_31400 4097104 4095548 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763430.1 protein_id gnl|my_center|LOCUS_31400 4097459 4097148 gene locus_tag LOCUS_31410 4097459 4097148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 4099760 4097463 gene locus_tag LOCUS_31420 4099760 4097463 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202762.1 protein_id gnl|my_center|LOCUS_31420 4102114 4099781 gene locus_tag LOCUS_31430 4102114 4099781 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107404.1 protein_id gnl|my_center|LOCUS_31430 4102818 4102141 gene locus_tag LOCUS_31440 4102818 4102141 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761370.1 protein_id gnl|my_center|LOCUS_31440 4103272 4104090 gene locus_tag LOCUS_31450 4103272 4104090 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761368.1 protein_id gnl|my_center|LOCUS_31450 4104065 4104730 gene locus_tag LOCUS_31460 4104065 4104730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 4104832 4106163 gene locus_tag LOCUS_31470 4104832 4106163 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107402.1 protein_id gnl|my_center|LOCUS_31470 4106241 4107473 gene locus_tag LOCUS_31480 4106241 4107473 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107401.1 protein_id gnl|my_center|LOCUS_31480 4107631 4109082 gene locus_tag LOCUS_31490 4107631 4109082 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787423.1 protein_id gnl|my_center|LOCUS_31490 4109314 4110975 gene locus_tag LOCUS_31500 4109314 4110975 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107399.1 protein_id gnl|my_center|LOCUS_31500 4111592 4111206 gene locus_tag LOCUS_31510 4111592 4111206 CDS product DUF3037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817730.1 protein_id gnl|my_center|LOCUS_31510 4112373 4111570 gene locus_tag LOCUS_31520 4112373 4111570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794237.1 protein_id gnl|my_center|LOCUS_31520 4114896 4112788 gene locus_tag LOCUS_31530 4114896 4112788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 4117289 4115076 gene locus_tag LOCUS_31540 4117289 4115076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 4119495 4117375 gene locus_tag LOCUS_31550 4119495 4117375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 4120502 4119915 gene locus_tag LOCUS_31560 4120502 4119915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765005.1 protein_id gnl|my_center|LOCUS_31560 4120786 4120499 gene locus_tag LOCUS_31570 4120786 4120499 CDS product DUF2089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763038.1 protein_id gnl|my_center|LOCUS_31570 4121765 4120797 gene locus_tag LOCUS_31580 4121765 4120797 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004349090.1 protein_id gnl|my_center|LOCUS_31580 4123370 4122030 gene locus_tag LOCUS_31590 4123370 4122030 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794243.1 protein_id gnl|my_center|LOCUS_31590 4126630 4123382 gene locus_tag LOCUS_31600 4126630 4123382 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202757.1 protein_id gnl|my_center|LOCUS_31600 4129441 4126811 gene locus_tag LOCUS_31610 4129441 4126811 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202756.1 protein_id gnl|my_center|LOCUS_31610 4132545 4129849 gene locus_tag LOCUS_31620 4132545 4129849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 4133655 4132561 gene locus_tag LOCUS_31630 4133655 4132561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 4135965 4133683 gene locus_tag LOCUS_31640 4135965 4133683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 4137158 4135965 gene locus_tag LOCUS_31650 4137158 4135965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 4137837 4141016 gene locus_tag LOCUS_31660 4137837 4141016 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107599.1 protein_id gnl|my_center|LOCUS_31660 4141020 4143917 gene locus_tag LOCUS_31670 4141020 4143917 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202754.1 protein_id gnl|my_center|LOCUS_31670 4146500 4143960 gene locus_tag LOCUS_31680 4146500 4143960 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202769.1 protein_id gnl|my_center|LOCUS_31680 4147609 4146725 gene locus_tag LOCUS_31690 4147609 4146725 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202768.1 protein_id gnl|my_center|LOCUS_31690 4149289 4147703 gene locus_tag LOCUS_31700 gene atpA 4149289 4147703 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787491.1 protein_id gnl|my_center|LOCUS_31700 4149849 4149289 gene locus_tag LOCUS_31710 4149849 4149289 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761392.1 protein_id gnl|my_center|LOCUS_31710 4150373 4149873 gene locus_tag LOCUS_31720 gene atpF 4150373 4149873 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787487.1 protein_id gnl|my_center|LOCUS_31720 4150722 4150465 gene locus_tag LOCUS_31730 4150722 4150465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 4151890 4150787 gene locus_tag LOCUS_31740 gene atpB 4151890 4150787 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107411.1 protein_id gnl|my_center|LOCUS_31740 4152305 4151874 gene locus_tag LOCUS_31750 4152305 4151874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765589.1 protein_id gnl|my_center|LOCUS_31750 4152593 4152348 gene locus_tag LOCUS_31760 gene atpC 4152593 4152348 CDS product ATP synthase F1 subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107410.1 protein_id gnl|my_center|LOCUS_31760 4154120 4152600 gene locus_tag LOCUS_31770 gene atpD 4154120 4152600 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761388.1 protein_id gnl|my_center|LOCUS_31770 4156041 4154875 gene locus_tag LOCUS_31780 gene purT 4156041 4154875 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765582.1 protein_id gnl|my_center|LOCUS_31780 4157642 4156125 gene locus_tag LOCUS_31790 4157642 4156125 CDS product DUF4301 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107406.1 protein_id gnl|my_center|LOCUS_31790 4157761 4159977 gene locus_tag LOCUS_31800 4157761 4159977 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107405.1 protein_id gnl|my_center|LOCUS_31800 4160028 4160390 gene locus_tag LOCUS_31810 4160028 4160390 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794207.1 protein_id gnl|my_center|LOCUS_31810 4161517 4160438 gene locus_tag LOCUS_31820 4161517 4160438 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761375.1 protein_id gnl|my_center|LOCUS_31820 4162419 4161598 gene locus_tag LOCUS_31830 gene panB 4162419 4161598 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787461.1 protein_id gnl|my_center|LOCUS_31830 4163264 4162617 gene locus_tag LOCUS_31840 4163264 4162617 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761373.1 protein_id gnl|my_center|LOCUS_31840 4163392 4164768 gene locus_tag LOCUS_31850 4163392 4164768 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787452.1 protein_id gnl|my_center|LOCUS_31850 4164939 4166303 gene locus_tag LOCUS_31860 4164939 4166303 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786913.1 protein_id gnl|my_center|LOCUS_31860 4166430 4166669 gene locus_tag LOCUS_31870 4166430 4166669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 4166682 4167896 gene locus_tag LOCUS_31880 4166682 4167896 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107657.1 protein_id gnl|my_center|LOCUS_31880 4167902 4168648 gene locus_tag LOCUS_31890 4167902 4168648 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763426.1 protein_id gnl|my_center|LOCUS_31890 4168661 4169881 gene locus_tag LOCUS_31900 4168661 4169881 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786907.1 protein_id gnl|my_center|LOCUS_31900 4169918 4170970 gene locus_tag LOCUS_31910 4169918 4170970 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786905.1 protein_id gnl|my_center|LOCUS_31910 4171060 4171758 gene locus_tag LOCUS_31920 4171060 4171758 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817185.1 protein_id gnl|my_center|LOCUS_31920 4172453 4172217 gene locus_tag LOCUS_31930 4172453 4172217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 4172975 4173190 gene locus_tag LOCUS_31940 4172975 4173190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763408.1 protein_id gnl|my_center|LOCUS_31940 4173955 4173242 gene locus_tag LOCUS_31950 gene pgl 4173955 4173242 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786873.1 protein_id gnl|my_center|LOCUS_31950 4175448 4173952 gene locus_tag LOCUS_31960 gene zwf 4175448 4173952 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763420.1 protein_id gnl|my_center|LOCUS_31960 4176935 4175460 gene locus_tag LOCUS_31970 gene gnd 4176935 4175460 CDS product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107660.1 protein_id gnl|my_center|LOCUS_31970 4177113 4176919 gene locus_tag LOCUS_31980 4177113 4176919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 4177049 4178239 gene locus_tag LOCUS_31990 4177049 4178239 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808836.1 protein_id gnl|my_center|LOCUS_31990 4178366 4178605 gene locus_tag LOCUS_32000 4178366 4178605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32000 4179469 4180011 gene locus_tag LOCUS_32010 gene upfY 4179469 4180011 CDS product capsular polysaccharide transcription antiterminator UpfY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202460.1 protein_id gnl|my_center|LOCUS_32010 4180019 4180498 gene locus_tag LOCUS_32020 4180019 4180498 CDS product UpxZ family transcription anti-terminator antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202461.1 protein_id gnl|my_center|LOCUS_32020 4180760 4182088 gene locus_tag LOCUS_32030 4180760 4182088 CDS product O-antigen export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107240.1 protein_id gnl|my_center|LOCUS_32030 4182097 4183278 gene locus_tag LOCUS_32040 4182097 4183278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 4183597 4184505 gene locus_tag LOCUS_32050 4183597 4184505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 4185162 4185560 gene locus_tag LOCUS_32060 4185162 4185560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 4186232 4186768 gene locus_tag LOCUS_32070 4186232 4186768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 4186761 4187783 gene locus_tag LOCUS_32080 4186761 4187783 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816707.1 protein_id gnl|my_center|LOCUS_32080 4187759 4188808 gene locus_tag LOCUS_32090 4187759 4188808 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202260.1 protein_id gnl|my_center|LOCUS_32090 4188823 4189953 gene locus_tag LOCUS_32100 gene wecB 4188823 4189953 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817161.1 protein_id gnl|my_center|LOCUS_32100 4189965 4190822 gene locus_tag LOCUS_32110 4189965 4190822 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202924.1 protein_id gnl|my_center|LOCUS_32110 4191154 4192320 gene locus_tag LOCUS_32120 4191154 4192320 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202152.1 protein_id gnl|my_center|LOCUS_32120 4192320 4192931 gene locus_tag LOCUS_32130 4192320 4192931 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202153.1 protein_id gnl|my_center|LOCUS_32130 4192943 4194472 gene locus_tag LOCUS_32140 4192943 4194472 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858032.1 protein_id gnl|my_center|LOCUS_32140 4194465 4195268 gene locus_tag LOCUS_32150 4194465 4195268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 4195274 4195504 gene locus_tag LOCUS_32160 4195274 4195504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 4195504 4196568 gene locus_tag LOCUS_32170 4195504 4196568 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002789842.1 protein_id gnl|my_center|LOCUS_32170 4196571 4196789 gene locus_tag LOCUS_32180 4196571 4196789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 4196793 4197551 gene locus_tag LOCUS_32190 4196793 4197551 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103768.1 protein_id gnl|my_center|LOCUS_32190 4197561 4198304 gene locus_tag LOCUS_32200 4197561 4198304 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103768.1 protein_id gnl|my_center|LOCUS_32200 4198305 4198943 gene locus_tag LOCUS_32210 4198305 4198943 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454137.1 protein_id gnl|my_center|LOCUS_32210 4198933 4199592 gene locus_tag LOCUS_32220 4198933 4199592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 4199731 4200870 gene locus_tag LOCUS_32230 4199731 4200870 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202157.1 protein_id gnl|my_center|LOCUS_32230 4202527 4201169 gene locus_tag LOCUS_32240 4202527 4201169 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108882.1 protein_id gnl|my_center|LOCUS_32240 4203799 4202777 gene locus_tag LOCUS_32250 4203799 4202777 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803796.1 protein_id gnl|my_center|LOCUS_32250 4205380 4204628 gene locus_tag LOCUS_32260 4205380 4204628 CDS product DUF4846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765761.1 protein_id gnl|my_center|LOCUS_32260 4206069 4205539 gene locus_tag LOCUS_32270 4206069 4205539 CDS product 5'-3'-deoxyribonucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399368.1 protein_id gnl|my_center|LOCUS_32270 4206297 4207046 gene locus_tag LOCUS_32280 4206297 4207046 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226563.1 protein_id gnl|my_center|LOCUS_32280 4208703 4207105 gene locus_tag LOCUS_32290 4208703 4207105 CDS product TrkA C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788346.1 protein_id gnl|my_center|LOCUS_32290 4208952 4209968 gene locus_tag LOCUS_32300 4208952 4209968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 4209982 4212213 gene locus_tag LOCUS_32310 4209982 4212213 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107297.1 protein_id gnl|my_center|LOCUS_32310 4212245 4216399 gene locus_tag LOCUS_32320 4212245 4216399 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202977.1 protein_id gnl|my_center|LOCUS_32320 4216402 4217094 gene locus_tag LOCUS_32330 4216402 4217094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202978.1 protein_id gnl|my_center|LOCUS_32330 4217201 4217809 gene locus_tag LOCUS_32340 4217201 4217809 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763053.1 protein_id gnl|my_center|LOCUS_32340 4217799 4218131 gene locus_tag LOCUS_32350 4217799 4218131 CDS product DUF2149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778408.1 protein_id gnl|my_center|LOCUS_32350 4218885 4218217 gene locus_tag LOCUS_32360 4218885 4218217 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763050.1 protein_id gnl|my_center|LOCUS_32360 4219121 4220419 gene locus_tag LOCUS_32370 4219121 4220419 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815375.1 protein_id gnl|my_center|LOCUS_32370 4221421 4220585 gene locus_tag LOCUS_32380 4221421 4220585 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764604.1 protein_id gnl|my_center|LOCUS_32380 4222420 4221551 gene locus_tag LOCUS_32390 4222420 4221551 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763946.1 protein_id gnl|my_center|LOCUS_32390 4223948 4222461 gene locus_tag LOCUS_32400 4223948 4222461 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109263.1 protein_id gnl|my_center|LOCUS_32400 4225050 4223959 gene locus_tag LOCUS_32410 4225050 4223959 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764608.1 protein_id gnl|my_center|LOCUS_32410 4226458 4225475 gene locus_tag LOCUS_32420 4226458 4225475 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202921.1 protein_id gnl|my_center|LOCUS_32420 4227489 4226593 gene locus_tag LOCUS_32430 4227489 4226593 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202922.1 protein_id gnl|my_center|LOCUS_32430 4228281 4227496 gene locus_tag LOCUS_32440 4228281 4227496 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203385.1 protein_id gnl|my_center|LOCUS_32440 4229577 4228366 gene locus_tag LOCUS_32450 4229577 4228366 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203512.1 protein_id gnl|my_center|LOCUS_32450 4230347 4229577 gene locus_tag LOCUS_32460 4230347 4229577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 4231510 4230368 gene locus_tag LOCUS_32470 4231510 4230368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 4232598 4231498 gene locus_tag LOCUS_32480 4232598 4231498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 4233782 4232595 gene locus_tag LOCUS_32490 4233782 4232595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 4235202 4233790 gene locus_tag LOCUS_32500 4235202 4233790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 4236289 4235204 gene locus_tag LOCUS_32510 4236289 4235204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 4237644 4236598 gene locus_tag LOCUS_32520 4237644 4236598 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797323.1 protein_id gnl|my_center|LOCUS_32520 4238459 4237671 gene locus_tag LOCUS_32530 4238459 4237671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 4239245 4238613 gene locus_tag LOCUS_32540 4239245 4238613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 4239639 4239163 gene locus_tag LOCUS_32550 4239639 4239163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 4240643 4239645 gene locus_tag LOCUS_32560 4240643 4239645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965772.1 protein_id gnl|my_center|LOCUS_32560 4242156 4240717 gene locus_tag LOCUS_32570 4242156 4240717 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202937.1 protein_id gnl|my_center|LOCUS_32570 4243481 4242192 gene locus_tag LOCUS_32580 4243481 4242192 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795347.1 protein_id gnl|my_center|LOCUS_32580 4244077 4243598 gene locus_tag LOCUS_32590 4244077 4243598 CDS product UpxZ family transcription anti-terminator antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203398.1 protein_id gnl|my_center|LOCUS_32590 4244683 4244129 gene locus_tag LOCUS_32600 gene upfY 4244683 4244129 CDS product capsular polysaccharide transcription antiterminator UpfY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202460.1 protein_id gnl|my_center|LOCUS_32600 4246563 4245424 gene locus_tag LOCUS_32610 4246563 4245424 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202157.1 protein_id gnl|my_center|LOCUS_32610 4247576 4246917 gene locus_tag LOCUS_32620 4247576 4246917 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462476.1 protein_id gnl|my_center|LOCUS_32620 4248537 4247554 gene locus_tag LOCUS_32630 4248537 4247554 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462477.1 protein_id gnl|my_center|LOCUS_32630 4249150 4248542 gene locus_tag LOCUS_32640 4249150 4248542 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202264.1 protein_id gnl|my_center|LOCUS_32640 4250506 4249445 gene locus_tag LOCUS_32650 4250506 4249445 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225342.1 protein_id gnl|my_center|LOCUS_32650 4251716 4250532 gene locus_tag LOCUS_32660 4251716 4250532 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107919.1 protein_id gnl|my_center|LOCUS_32660 4252743 4251751 gene locus_tag LOCUS_32670 4252743 4251751 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964934.1 protein_id gnl|my_center|LOCUS_32670 4253162 4252743 gene locus_tag LOCUS_32680 gene tagD 4253162 4252743 CDS product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721506.1 protein_id gnl|my_center|LOCUS_32680 4254259 4253165 gene locus_tag LOCUS_32690 4254259 4253165 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675474.1 protein_id gnl|my_center|LOCUS_32690 4255325 4254270 gene locus_tag LOCUS_32700 4255325 4254270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 4256446 4255322 gene locus_tag LOCUS_32710 4256446 4255322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 4257798 4256686 gene locus_tag LOCUS_32720 4257798 4256686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 4258952 4257795 gene locus_tag LOCUS_32730 4258952 4257795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32730 4259327 4258968 gene locus_tag LOCUS_32740 4259327 4258968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 4260527 4259556 gene locus_tag LOCUS_32750 4260527 4259556 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070687.1 protein_id gnl|my_center|LOCUS_32750 4261782 4260514 gene locus_tag LOCUS_32760 4261782 4260514 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795347.1 protein_id gnl|my_center|LOCUS_32760 4262802 4261795 gene locus_tag LOCUS_32770 4262802 4261795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 4263779 4262799 gene locus_tag LOCUS_32780 4263779 4262799 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963429.1 protein_id gnl|my_center|LOCUS_32780 4264375 4263896 gene locus_tag LOCUS_32790 4264375 4263896 CDS product UpxZ family transcription anti-terminator antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202461.1 protein_id gnl|my_center|LOCUS_32790 4264925 4264383 gene locus_tag LOCUS_32800 gene upfY 4264925 4264383 CDS product capsular polysaccharide transcription antiterminator UpfY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202460.1 protein_id gnl|my_center|LOCUS_32800 4265731 4265907 gene locus_tag LOCUS_32810 4265731 4265907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 4266020 4268245 gene locus_tag LOCUS_32820 4266020 4268245 CDS product VapE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203399.1 protein_id gnl|my_center|LOCUS_32820 4268668 4268432 gene locus_tag LOCUS_32830 4268668 4268432 CDS product DUF4248 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761384.1 protein_id gnl|my_center|LOCUS_32830 4268886 4269350 gene locus_tag LOCUS_32840 4268886 4269350 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802390.1 protein_id gnl|my_center|LOCUS_32840 4271170 4269623 gene locus_tag LOCUS_32850 4271170 4269623 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055295205.1 protein_id gnl|my_center|LOCUS_32850 4271818 4271321 gene locus_tag LOCUS_32860 4271818 4271321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 4272093 4271890 gene locus_tag LOCUS_32870 4272093 4271890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 4275466 4272233 gene locus_tag LOCUS_32880 gene carB 4275466 4272233 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107320.1 protein_id gnl|my_center|LOCUS_32880 4276645 4275482 gene locus_tag LOCUS_32890 gene carA 4276645 4275482 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788241.1 protein_id gnl|my_center|LOCUS_32890 4278537 4276654 gene locus_tag LOCUS_32900 4278537 4276654 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202956.1 protein_id gnl|my_center|LOCUS_32900 4280393 4278549 gene locus_tag LOCUS_32910 gene glmS 4280393 4278549 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765067.1 protein_id gnl|my_center|LOCUS_32910 4280841 4282484 gene locus_tag LOCUS_32920 4280841 4282484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 4282555 4283316 gene locus_tag LOCUS_32930 4282555 4283316 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788251.1 protein_id gnl|my_center|LOCUS_32930 4283708 4283412 gene locus_tag LOCUS_32940 4283708 4283412 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788237.1 protein_id gnl|my_center|LOCUS_32940 4284348 4283776 gene locus_tag LOCUS_32950 4284348 4283776 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788262.1 protein_id gnl|my_center|LOCUS_32950 4285878 4284733 gene locus_tag LOCUS_32960 4285878 4284733 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202960.1 protein_id gnl|my_center|LOCUS_32960 4286120 4288516 gene locus_tag LOCUS_32970 4286120 4288516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 4290103 4291041 gene locus_tag LOCUS_32980 4290103 4291041 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203118.1 protein_id gnl|my_center|LOCUS_32980 4291500 4292690 gene locus_tag LOCUS_32990 gene trpB 4291500 4292690 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788278.1 protein_id gnl|my_center|LOCUS_32990 4292749 4294155 gene locus_tag LOCUS_33000 4292749 4294155 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107307.1 protein_id gnl|my_center|LOCUS_33000 4294394 4294957 gene locus_tag LOCUS_33010 4294394 4294957 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792933.1 protein_id gnl|my_center|LOCUS_33010 4294962 4295966 gene locus_tag LOCUS_33020 gene trpD 4294962 4295966 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803789.1 protein_id gnl|my_center|LOCUS_33020 4295963 4296748 gene locus_tag LOCUS_33030 gene trpC 4295963 4296748 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765048.1 protein_id gnl|my_center|LOCUS_33030 4296829 4297461 gene locus_tag LOCUS_33040 4296829 4297461 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765047.1 protein_id gnl|my_center|LOCUS_33040 4297458 4298228 gene locus_tag LOCUS_33050 gene trpA 4297458 4298228 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765046.1 protein_id gnl|my_center|LOCUS_33050 4298406 4299398 gene locus_tag LOCUS_33060 4298406 4299398 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765045.1 protein_id gnl|my_center|LOCUS_33060 4299569 4301836 gene locus_tag LOCUS_33070 4299569 4301836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 4302055 4302423 gene locus_tag LOCUS_33080 4302055 4302423 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763087.1 protein_id gnl|my_center|LOCUS_33080 4302489 4303586 gene locus_tag LOCUS_33090 4302489 4303586 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765042.1 protein_id gnl|my_center|LOCUS_33090 4303601 4304518 gene locus_tag LOCUS_33100 4303601 4304518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202966.1 protein_id gnl|my_center|LOCUS_33100 4304515 4305141 gene locus_tag LOCUS_33110 4304515 4305141 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202967.1 protein_id gnl|my_center|LOCUS_33110 4306438 4305365 gene locus_tag LOCUS_33120 4306438 4305365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764717.1 protein_id gnl|my_center|LOCUS_33120 4306859 4306452 gene locus_tag LOCUS_33130 4306859 4306452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764718.1 protein_id gnl|my_center|LOCUS_33130 4307419 4306856 gene locus_tag LOCUS_33140 4307419 4306856 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764719.1 protein_id gnl|my_center|LOCUS_33140 4307815 4307552 gene locus_tag LOCUS_33150 4307815 4307552 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791531.1 protein_id gnl|my_center|LOCUS_33150 4308115 4307873 gene locus_tag LOCUS_33160 4308115 4307873 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791529.1 protein_id gnl|my_center|LOCUS_33160 4310124 4308508 gene locus_tag LOCUS_33170 4310124 4308508 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763401.1 protein_id gnl|my_center|LOCUS_33170 4310306 4310929 gene locus_tag LOCUS_33180 4310306 4310929 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107672.1 protein_id gnl|my_center|LOCUS_33180 4310938 4312122 gene locus_tag LOCUS_33190 gene dnaJ 4310938 4312122 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763399.1 protein_id gnl|my_center|LOCUS_33190 4313766 4312156 gene locus_tag LOCUS_33200 4313766 4312156 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794975.1 protein_id gnl|my_center|LOCUS_33200 4316551 4313807 gene locus_tag LOCUS_33210 4316551 4313807 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202547.1 protein_id gnl|my_center|LOCUS_33210 4318754 4316691 gene locus_tag LOCUS_33220 4318754 4316691 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202541.1 protein_id gnl|my_center|LOCUS_33220 4319416 4318751 gene locus_tag LOCUS_33230 4319416 4318751 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786661.1 protein_id gnl|my_center|LOCUS_33230 4320470 4319436 gene locus_tag LOCUS_33240 4320470 4319436 CDS product cyclically-permuted mutarotase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055295062.1 protein_id gnl|my_center|LOCUS_33240 4321593 4320835 gene locus_tag LOCUS_33250 4321593 4320835 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794868.1 protein_id gnl|my_center|LOCUS_33250 4322851 4321616 gene locus_tag LOCUS_33260 4322851 4321616 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793004.1 protein_id gnl|my_center|LOCUS_33260 4324087 4322900 gene locus_tag LOCUS_33270 4324087 4322900 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202525.1 protein_id gnl|my_center|LOCUS_33270 4325020 4324103 gene locus_tag LOCUS_33280 4325020 4324103 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786611.1 protein_id gnl|my_center|LOCUS_33280 4325273 4326478 gene locus_tag LOCUS_33290 4325273 4326478 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107265.1 protein_id gnl|my_center|LOCUS_33290 4326939 4326475 gene locus_tag LOCUS_33300 4326939 4326475 CDS product WbuC family cupin fold metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786607.1 protein_id gnl|my_center|LOCUS_33300 4327330 4326944 gene locus_tag LOCUS_33310 4327330 4326944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 4328418 4327306 gene locus_tag LOCUS_33320 4328418 4327306 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786605.1 protein_id gnl|my_center|LOCUS_33320 4330840 4328426 gene locus_tag LOCUS_33330 4330840 4328426 CDS product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202522.1 protein_id gnl|my_center|LOCUS_33330 4331441 4331514 gene locus_tag LOCUS_t00670 4331441 4331514 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4331544 4332407 gene locus_tag LOCUS_33340 4331544 4332407 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766067.1 protein_id gnl|my_center|LOCUS_33340 4332553 4333590 gene locus_tag LOCUS_33350 gene mltG 4332553 4333590 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202520.1 protein_id gnl|my_center|LOCUS_33350 4333676 4335268 gene locus_tag LOCUS_33360 4333676 4335268 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766069.1 protein_id gnl|my_center|LOCUS_33360 4335272 4335853 gene locus_tag LOCUS_33370 4335272 4335853 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760706.1 protein_id gnl|my_center|LOCUS_33370 4336157 4336636 gene locus_tag LOCUS_33380 gene xpt 4336157 4336636 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760704.1 protein_id gnl|my_center|LOCUS_33380 4337136 4336714 gene locus_tag LOCUS_33390 4337136 4336714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 4338186 4337836 gene locus_tag LOCUS_33400 gene rplT 4338186 4337836 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297540.1 protein_id gnl|my_center|LOCUS_33400 4339161 4338553 gene locus_tag LOCUS_33410 gene infC 4339161 4338553 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768315.1 protein_id gnl|my_center|LOCUS_33410 4341172 4339232 gene locus_tag LOCUS_33420 gene thrS 4341172 4339232 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786570.1 protein_id gnl|my_center|LOCUS_33420 4343276 4341252 gene locus_tag LOCUS_33430 4343276 4341252 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107261.1 protein_id gnl|my_center|LOCUS_33430 4344029 4343475 gene locus_tag LOCUS_33440 gene def 4344029 4343475 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760700.1 protein_id gnl|my_center|LOCUS_33440 4344491 4344063 gene locus_tag LOCUS_33450 gene ruvX 4344491 4344063 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786562.1 protein_id gnl|my_center|LOCUS_33450 4345821 4344610 gene locus_tag LOCUS_33460 4345821 4344610 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202514.1 protein_id gnl|my_center|LOCUS_33460 4346508 4345873 gene locus_tag LOCUS_33470 4346508 4345873 CDS product YjbH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202515.1 protein_id gnl|my_center|LOCUS_33470 4349219 4346673 gene locus_tag LOCUS_33480 4349219 4346673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 4350474 4349230 gene locus_tag LOCUS_33490 4350474 4349230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786554.1 protein_id gnl|my_center|LOCUS_33490 4350645 4350484 gene locus_tag LOCUS_33500 4350645 4350484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 4352056 4350914 gene locus_tag LOCUS_33510 4352056 4350914 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768312.1 protein_id gnl|my_center|LOCUS_33510 4352387 4353331 gene locus_tag LOCUS_33520 4352387 4353331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786548.1 protein_id gnl|my_center|LOCUS_33520 4353342 4355252 gene locus_tag LOCUS_33530 4353342 4355252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 4355401 4356036 gene locus_tag LOCUS_33540 4355401 4356036 CDS product YjbH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202515.1 protein_id gnl|my_center|LOCUS_33540 4356088 4357293 gene locus_tag LOCUS_33550 4356088 4357293 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202514.1 protein_id gnl|my_center|LOCUS_33550 4358574 4357594 gene locus_tag LOCUS_33560 4358574 4357594 CDS product PCMD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107259.1 protein_id gnl|my_center|LOCUS_33560 4359681 4358575 gene locus_tag LOCUS_33570 4359681 4358575 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760696.1 protein_id gnl|my_center|LOCUS_33570 4361180 4359750 gene locus_tag LOCUS_33580 gene cysN 4361180 4359750 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786535.1 protein_id gnl|my_center|LOCUS_33580 4362121 4361210 gene locus_tag LOCUS_33590 gene cysD 4362121 4361210 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776455.1 protein_id gnl|my_center|LOCUS_33590 4362758 4362153 gene locus_tag LOCUS_33600 gene cysC 4362758 4362153 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107257.1 protein_id gnl|my_center|LOCUS_33600 4364328 4362772 gene locus_tag LOCUS_33610 4364328 4362772 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786530.1 protein_id gnl|my_center|LOCUS_33610 4365168 4364344 gene locus_tag LOCUS_33620 gene cysQ 4365168 4364344 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786528.1 protein_id gnl|my_center|LOCUS_33620 4365956 4365456 gene locus_tag LOCUS_33630 4365956 4365456 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786521.1 protein_id gnl|my_center|LOCUS_33630 4366393 4365986 gene locus_tag LOCUS_33640 4366393 4365986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 4367166 4366399 gene locus_tag LOCUS_33650 4367166 4366399 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786519.1 protein_id gnl|my_center|LOCUS_33650 4367344 4368612 gene locus_tag LOCUS_33660 4367344 4368612 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 protein_id gnl|my_center|LOCUS_33660 4368942 4369148 gene locus_tag LOCUS_33670 4368942 4369148 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776445.1 protein_id gnl|my_center|LOCUS_33670 4369174 4369536 gene locus_tag LOCUS_33680 4369174 4369536 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760687.1 protein_id gnl|my_center|LOCUS_33680 4369536 4369802 gene locus_tag LOCUS_33690 4369536 4369802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760686.1 protein_id gnl|my_center|LOCUS_33690 4370039 4371286 gene locus_tag LOCUS_33700 4370039 4371286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 4371549 4372772 gene locus_tag LOCUS_33710 4371549 4372772 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200755826.1 protein_id gnl|my_center|LOCUS_33710 4372769 4373158 gene locus_tag LOCUS_33720 4372769 4373158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 4373436 4374641 gene locus_tag LOCUS_33730 4373436 4374641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 4374899 4375837 gene locus_tag LOCUS_33740 4374899 4375837 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816488.1 protein_id gnl|my_center|LOCUS_33740 4376014 4376379 gene locus_tag LOCUS_33750 4376014 4376379 CDS product mobilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108661.1 protein_id gnl|my_center|LOCUS_33750 4376376 4377323 gene locus_tag LOCUS_33760 4376376 4377323 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005944378.1 protein_id gnl|my_center|LOCUS_33760 4377905 4377345 gene locus_tag LOCUS_33770 4377905 4377345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 4378067 4378216 gene locus_tag LOCUS_33780 4378067 4378216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 4379163 4378264 gene locus_tag LOCUS_33790 4379163 4378264 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768221.1 protein_id gnl|my_center|LOCUS_33790 4379294 4380070 gene locus_tag LOCUS_33800 4379294 4380070 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931028.1 protein_id gnl|my_center|LOCUS_33800 4380067 4380735 gene locus_tag LOCUS_33810 4380067 4380735 CDS product radical SAM mobile pair protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679436.1 protein_id gnl|my_center|LOCUS_33810 4380732 4381607 gene locus_tag LOCUS_33820 4380732 4381607 CDS product radical SAM mobile pair protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679438.1 protein_id gnl|my_center|LOCUS_33820 4381656 4382912 gene locus_tag LOCUS_33830 4381656 4382912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33830 4382902 4384095 gene locus_tag LOCUS_33840 4382902 4384095 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065539461.1 protein_id gnl|my_center|LOCUS_33840 4384647 4385060 gene locus_tag LOCUS_33850 4384647 4385060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 4385227 4387197 gene locus_tag LOCUS_33860 4385227 4387197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 4387613 4390321 gene locus_tag LOCUS_33870 4387613 4390321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 4390447 4392186 gene locus_tag LOCUS_33880 4390447 4392186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 4393254 4392283 gene locus_tag LOCUS_33890 4393254 4392283 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760658.1 protein_id gnl|my_center|LOCUS_33890 4393457 4394617 gene locus_tag LOCUS_33900 4393457 4394617 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766110.1 protein_id gnl|my_center|LOCUS_33900 4394667 4395986 gene locus_tag LOCUS_33910 4394667 4395986 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786507.1 protein_id gnl|my_center|LOCUS_33910 4396035 4397189 gene locus_tag LOCUS_33920 gene galK 4396035 4397189 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800633.1 protein_id gnl|my_center|LOCUS_33920 4397405 4399414 gene locus_tag LOCUS_33930 4397405 4399414 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786503.1 protein_id gnl|my_center|LOCUS_33930 4399414 4399848 gene locus_tag LOCUS_33940 gene rpiB 4399414 4399848 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786501.1 protein_id gnl|my_center|LOCUS_33940 4400139 4400417 gene locus_tag LOCUS_33950 4400139 4400417 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786499.1 protein_id gnl|my_center|LOCUS_33950 4400439 4400666 gene locus_tag LOCUS_33960 4400439 4400666 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776432.1 protein_id gnl|my_center|LOCUS_33960 4400678 4401760 gene locus_tag LOCUS_33970 4400678 4401760 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786497.1 protein_id gnl|my_center|LOCUS_33970 4401955 4402719 gene locus_tag LOCUS_33980 4401955 4402719 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760623.1 protein_id gnl|my_center|LOCUS_33980 4402739 4403281 gene locus_tag LOCUS_33990 4402739 4403281 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786493.1 protein_id gnl|my_center|LOCUS_33990 4403534 4405597 gene locus_tag LOCUS_34000 4403534 4405597 CDS product putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795080.1 protein_id gnl|my_center|LOCUS_34000 4405612 4406442 gene locus_tag LOCUS_34010 4405612 4406442 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202508.1 protein_id gnl|my_center|LOCUS_34010 4407638 4407411 gene locus_tag LOCUS_34020 4407638 4407411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 4407814 4408398 gene locus_tag LOCUS_34030 4407814 4408398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 4408669 4409928 gene locus_tag LOCUS_34040 4408669 4409928 CDS product DUF3575 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080707197.1 protein_id gnl|my_center|LOCUS_34040 4409952 4410956 gene locus_tag LOCUS_34050 4409952 4410956 CDS product DUF5119 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927908.1 protein_id gnl|my_center|LOCUS_34050 4411007 4412722 gene locus_tag LOCUS_34060 4411007 4412722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 4412743 4414233 gene locus_tag LOCUS_34070 4412743 4414233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 4415053 4416039 gene locus_tag LOCUS_34080 4415053 4416039 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760615.1 protein_id gnl|my_center|LOCUS_34080 4416457 4416978 gene locus_tag LOCUS_34090 4416457 4416978 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760619.1 protein_id gnl|my_center|LOCUS_34090 4416975 4417397 gene locus_tag LOCUS_34100 4416975 4417397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768304.1 protein_id gnl|my_center|LOCUS_34100 4417423 4417887 gene locus_tag LOCUS_34110 4417423 4417887 CDS product DUF6108 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786482.1 protein_id gnl|my_center|LOCUS_34110 4417900 4418790 gene locus_tag LOCUS_34120 4417900 4418790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107199.1 protein_id gnl|my_center|LOCUS_34120 4419447 4418938 gene locus_tag LOCUS_34130 4419447 4418938 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800645.1 protein_id gnl|my_center|LOCUS_34130 4421521 4419485 gene locus_tag LOCUS_34140 4421521 4419485 CDS product alpha-ketoacid dehydrogenase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766152.1 protein_id gnl|my_center|LOCUS_34140 4422984 4421656 gene locus_tag LOCUS_34150 4422984 4421656 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766153.1 protein_id gnl|my_center|LOCUS_34150 4425344 4423863 gene locus_tag LOCUS_34160 gene nrfA 4425344 4423863 CDS product ammonia-forming cytochrome c nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201986.1 protein_id gnl|my_center|LOCUS_34160 4427746 4425380 gene locus_tag LOCUS_34170 4427746 4425380 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795582.1 protein_id gnl|my_center|LOCUS_34170 4428883 4427975 gene locus_tag LOCUS_34180 4428883 4427975 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203118.1 protein_id gnl|my_center|LOCUS_34180 4429714 4428956 gene locus_tag LOCUS_34190 4429714 4428956 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766154.1 protein_id gnl|my_center|LOCUS_34190 4431063 4429714 gene locus_tag LOCUS_34200 gene lpdA 4431063 4429714 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786461.1 protein_id gnl|my_center|LOCUS_34200 4434184 4431383 gene locus_tag LOCUS_34210 4434184 4431383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 4435760 4434441 gene locus_tag LOCUS_34220 4435760 4434441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 4436248 4435757 gene locus_tag LOCUS_34230 4436248 4435757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 4438531 4436372 gene locus_tag LOCUS_34240 4438531 4436372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 4441940 4438707 gene locus_tag LOCUS_34250 4441940 4438707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 4443956 4442040 gene locus_tag LOCUS_34260 4443956 4442040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 4444636 4445103 gene locus_tag LOCUS_34270 4444636 4445103 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768302.1 protein_id gnl|my_center|LOCUS_34270 4446806 4445196 gene locus_tag LOCUS_34280 4446806 4445196 CDS product hemin receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795092.1 protein_id gnl|my_center|LOCUS_34280 4448077 4446839 gene locus_tag LOCUS_34290 4448077 4446839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 4448281 4449123 gene locus_tag LOCUS_34300 gene prmA 4448281 4449123 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795115.1 protein_id gnl|my_center|LOCUS_34300 4450098 4449253 gene locus_tag LOCUS_34310 4450098 4449253 CDS product glycoside hydrolase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788900.1 protein_id gnl|my_center|LOCUS_34310 4451833 4450190 gene locus_tag LOCUS_34320 4451833 4450190 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760603.1 protein_id gnl|my_center|LOCUS_34320 4453647 4452262 gene locus_tag LOCUS_34330 4453647 4452262 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798684.1 protein_id gnl|my_center|LOCUS_34330 4456793 4453650 gene locus_tag LOCUS_34340 4456793 4453650 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766158.1 protein_id gnl|my_center|LOCUS_34340 4457983 4456808 gene locus_tag LOCUS_34350 4457983 4456808 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788929.1 protein_id gnl|my_center|LOCUS_34350 4458351 4460468 gene locus_tag LOCUS_34360 4458351 4460468 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203451.1 protein_id gnl|my_center|LOCUS_34360 4460549 4460818 gene locus_tag LOCUS_34370 4460549 4460818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766192.1 protein_id gnl|my_center|LOCUS_34370 4460821 4461378 gene locus_tag LOCUS_34380 4460821 4461378 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788935.1 protein_id gnl|my_center|LOCUS_34380 4461404 4462183 gene locus_tag LOCUS_34390 4461404 4462183 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766194.1 protein_id gnl|my_center|LOCUS_34390 4462359 4464350 gene locus_tag LOCUS_34400 4462359 4464350 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203149.1 protein_id gnl|my_center|LOCUS_34400 4464436 4465161 gene locus_tag LOCUS_34410 4464436 4465161 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203150.1 protein_id gnl|my_center|LOCUS_34410 4465231 4468125 gene locus_tag LOCUS_34420 4465231 4468125 CDS product xanthan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766196.1 protein_id gnl|my_center|LOCUS_34420 4468307 4468624 gene locus_tag LOCUS_34430 4468307 4468624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769696.1 protein_id gnl|my_center|LOCUS_34430 4468621 4468839 gene locus_tag LOCUS_34440 4468621 4468839 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760553.1 protein_id gnl|my_center|LOCUS_34440 4468865 4469341 gene locus_tag LOCUS_34450 4468865 4469341 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788959.1 protein_id gnl|my_center|LOCUS_34450 4469366 4471177 gene locus_tag LOCUS_34460 4469366 4471177 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788960.1 protein_id gnl|my_center|LOCUS_34460 4474891 4471523 gene locus_tag LOCUS_34470 gene mfd 4474891 4471523 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766199.1 protein_id gnl|my_center|LOCUS_34470 4475005 4475769 gene locus_tag LOCUS_34480 4475005 4475769 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203156.1 protein_id gnl|my_center|LOCUS_34480 4475766 4477106 gene locus_tag LOCUS_34490 4475766 4477106 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766200.1 protein_id gnl|my_center|LOCUS_34490 4477103 4477993 gene locus_tag LOCUS_34500 4477103 4477993 CDS product vitamin B12 dependent-methionine synthase activation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660983.1 protein_id gnl|my_center|LOCUS_34500 4478841 4478008 gene locus_tag LOCUS_34510 4478841 4478008 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788975.1 protein_id gnl|my_center|LOCUS_34510 4479776 4478907 gene locus_tag LOCUS_34520 4479776 4478907 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788978.1 protein_id gnl|my_center|LOCUS_34520 4480582 4479800 gene locus_tag LOCUS_34530 4480582 4479800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 4487887 4480757 gene locus_tag LOCUS_34540 4487887 4480757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 4491805 4487906 gene locus_tag LOCUS_34550 4491805 4487906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 4492830 4493342 gene locus_tag LOCUS_34560 4492830 4493342 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107186.1 protein_id gnl|my_center|LOCUS_34560 4493348 4493932 gene locus_tag LOCUS_34570 4493348 4493932 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760546.1 protein_id gnl|my_center|LOCUS_34570 4496884 4494005 gene locus_tag LOCUS_34580 4496884 4494005 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203160.1 protein_id gnl|my_center|LOCUS_34580 4498124 4496859 gene locus_tag LOCUS_34590 4498124 4496859 CDS product exonuclease SbcCD subunit D C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203161.1 protein_id gnl|my_center|LOCUS_34590 4499996 4498149 gene locus_tag LOCUS_34600 4499996 4498149 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203188.1 protein_id gnl|my_center|LOCUS_34600 4501894 4500110 gene locus_tag LOCUS_34610 4501894 4500110 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203187.1 protein_id gnl|my_center|LOCUS_34610 4502320 4503078 gene locus_tag LOCUS_34620 4502320 4503078 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789007.1 protein_id gnl|my_center|LOCUS_34620 4504212 4503319 gene locus_tag LOCUS_34630 4504212 4503319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 4504641 4504219 gene locus_tag LOCUS_34640 4504641 4504219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 4506552 4504807 gene locus_tag LOCUS_34650 4506552 4504807 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766209.1 protein_id gnl|my_center|LOCUS_34650 4507241 4506597 gene locus_tag LOCUS_34660 4507241 4506597 CDS product DUF4369 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789092.1 protein_id gnl|my_center|LOCUS_34660 4507244 4507525 gene locus_tag LOCUS_34670 4507244 4507525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 4507558 4508796 gene locus_tag LOCUS_34680 4507558 4508796 CDS product anaerobic sulfatase-maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789094.1 protein_id gnl|my_center|LOCUS_34680 4508827 4510995 gene locus_tag LOCUS_34690 4508827 4510995 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789096.1 protein_id gnl|my_center|LOCUS_34690 4510992 4513154 gene locus_tag LOCUS_34700 4510992 4513154 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203170.1 protein_id gnl|my_center|LOCUS_34700 4513529 4513347 gene locus_tag LOCUS_34710 4513529 4513347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 4514650 4513526 gene locus_tag LOCUS_34720 4514650 4513526 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203171.1 protein_id gnl|my_center|LOCUS_34720 4514860 4515165 gene locus_tag LOCUS_34730 gene trxA 4514860 4515165 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760534.1 protein_id gnl|my_center|LOCUS_34730 4515168 4515635 gene locus_tag LOCUS_34740 4515168 4515635 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766216.1 protein_id gnl|my_center|LOCUS_34740 4516369 4515734 gene locus_tag LOCUS_34750 4516369 4515734 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760532.1 protein_id gnl|my_center|LOCUS_34750 4517067 4516510 gene locus_tag LOCUS_34760 4517067 4516510 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780311.1 protein_id gnl|my_center|LOCUS_34760 4517508 4517089 gene locus_tag LOCUS_34770 4517508 4517089 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815090.1 protein_id gnl|my_center|LOCUS_34770 4517722 4519650 gene locus_tag LOCUS_34780 4517722 4519650 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_34780 4519727 4520182 gene locus_tag LOCUS_34790 4519727 4520182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 4520602 4521120 gene locus_tag LOCUS_34800 4520602 4521120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 4521352 4522314 gene locus_tag LOCUS_34810 4521352 4522314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 4522461 4522982 gene locus_tag LOCUS_34820 4522461 4522982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 4522984 4523673 gene locus_tag LOCUS_34830 4522984 4523673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 4524436 4524023 gene locus_tag LOCUS_34840 4524436 4524023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 4525732 4524605 gene locus_tag LOCUS_34850 gene hisB 4525732 4524605 CDS product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789124.1 protein_id gnl|my_center|LOCUS_34850 4526791 4525754 gene locus_tag LOCUS_34860 gene hisC 4526791 4525754 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766231.1 protein_id gnl|my_center|LOCUS_34860 4528096 4526798 gene locus_tag LOCUS_34870 gene hisD 4528096 4526798 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766232.1 protein_id gnl|my_center|LOCUS_34870 4528959 4528108 gene locus_tag LOCUS_34880 gene hisG 4528959 4528108 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789131.1 protein_id gnl|my_center|LOCUS_34880 4529685 4529194 gene locus_tag LOCUS_34890 4529685 4529194 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766233.1 protein_id gnl|my_center|LOCUS_34890 4531230 4529701 gene locus_tag LOCUS_34900 4531230 4529701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 4531779 4531306 gene locus_tag LOCUS_34910 4531779 4531306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 4531963 4532130 gene locus_tag LOCUS_34920 4531963 4532130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 4532245 4533984 gene locus_tag LOCUS_34930 4532245 4533984 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161799616.1 protein_id gnl|my_center|LOCUS_34930 4534091 4534546 gene locus_tag LOCUS_34940 4534091 4534546 CDS product radical SAM-associated putative lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107305.1 protein_id gnl|my_center|LOCUS_34940 4534536 4535615 gene locus_tag LOCUS_34950 4534536 4535615 CDS product TIGR04133 family radical SAM/SPASM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765031.1 protein_id gnl|my_center|LOCUS_34950 4535683 4536390 gene locus_tag LOCUS_34960 4535683 4536390 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789136.1 protein_id gnl|my_center|LOCUS_34960 4538931 4536490 gene locus_tag LOCUS_34970 4538931 4536490 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658103.1 protein_id gnl|my_center|LOCUS_34970 4541392 4538963 gene locus_tag LOCUS_34980 4541392 4538963 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658103.1 protein_id gnl|my_center|LOCUS_34980 4543693 4541666 gene locus_tag LOCUS_34990 4543693 4541666 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203179.1 protein_id gnl|my_center|LOCUS_34990 4544051 4543752 gene locus_tag LOCUS_35000 4544051 4543752 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760502.1 protein_id gnl|my_center|LOCUS_35000 4544153 4544761 gene locus_tag LOCUS_35010 gene udk 4544153 4544761 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789145.1 protein_id gnl|my_center|LOCUS_35010 4544787 4546181 gene locus_tag LOCUS_35020 4544787 4546181 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802904.1 protein_id gnl|my_center|LOCUS_35020 4546378 4547736 gene locus_tag LOCUS_35030 4546378 4547736 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108882.1 protein_id gnl|my_center|LOCUS_35030 4548554 4547961 gene locus_tag LOCUS_35040 4548554 4547961 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766706.1 protein_id gnl|my_center|LOCUS_35040 4551315 4548565 gene locus_tag LOCUS_35050 gene metH 4551315 4548565 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107153.1 protein_id gnl|my_center|LOCUS_35050 4551797 4551345 gene locus_tag LOCUS_35060 gene smpB 4551797 4551345 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780358.1 protein_id gnl|my_center|LOCUS_35060 4552380 4551805 gene locus_tag LOCUS_35070 4552380 4551805 CDS product Yip1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769654.1 protein_id gnl|my_center|LOCUS_35070 4553106 4552381 gene locus_tag LOCUS_35080 4553106 4552381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 4553689 4553189 gene locus_tag LOCUS_35090 4553689 4553189 CDS product DMP19 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789167.1 protein_id gnl|my_center|LOCUS_35090 4554600 4554196 gene locus_tag LOCUS_35100 4554600 4554196 CDS product HsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789172.1 protein_id gnl|my_center|LOCUS_35100 4554590 4554769 gene locus_tag LOCUS_35110 4554590 4554769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 4554819 4555520 gene locus_tag LOCUS_35120 4554819 4555520 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780363.1 protein_id gnl|my_center|LOCUS_35120 4555541 4556551 gene locus_tag LOCUS_35130 4555541 4556551 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780364.1 protein_id gnl|my_center|LOCUS_35130 4556628 4557197 gene locus_tag LOCUS_35140 4556628 4557197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813511.1 protein_id gnl|my_center|LOCUS_35140 4557599 4557850 gene locus_tag LOCUS_35150 4557599 4557850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 4557831 4558112 gene locus_tag LOCUS_35160 4557831 4558112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 4558899 4558117 gene locus_tag LOCUS_35170 4558899 4558117 CDS product DUF5131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695943.1 protein_id gnl|my_center|LOCUS_35170 4559260 4559925 gene locus_tag LOCUS_35180 4559260 4559925 CDS product DUF6198 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107754.1 protein_id gnl|my_center|LOCUS_35180 4560069 4561760 gene locus_tag LOCUS_35190 4560069 4561760 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766785.1 protein_id gnl|my_center|LOCUS_35190 4561922 4567504 gene locus_tag LOCUS_35200 4561922 4567504 CDS product MG2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202408.1 protein_id gnl|my_center|LOCUS_35200 4567706 4569904 gene locus_tag LOCUS_35210 gene pbpC 4567706 4569904 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992445.1 protein_id gnl|my_center|LOCUS_35210 4570550 4571725 gene locus_tag LOCUS_35220 4570550 4571725 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786133.1 protein_id gnl|my_center|LOCUS_35220 4571779 4572225 gene locus_tag LOCUS_35230 4571779 4572225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800831.1 protein_id gnl|my_center|LOCUS_35230 4572227 4573099 gene locus_tag LOCUS_35240 4572227 4573099 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786129.1 protein_id gnl|my_center|LOCUS_35240 4573201 4573791 gene locus_tag LOCUS_35250 4573201 4573791 CDS product DUF4251 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766721.1 protein_id gnl|my_center|LOCUS_35250 4573919 4574584 gene locus_tag LOCUS_35260 4573919 4574584 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760474.1 protein_id gnl|my_center|LOCUS_35260 4575680 4574613 gene locus_tag LOCUS_35270 gene mnmA 4575680 4574613 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107145.1 protein_id gnl|my_center|LOCUS_35270 4575876 4577213 gene locus_tag LOCUS_35280 4575876 4577213 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107144.1 protein_id gnl|my_center|LOCUS_35280 4577237 4578100 gene locus_tag LOCUS_35290 4577237 4578100 CDS product DUF4595 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659124.1 protein_id gnl|my_center|LOCUS_35290 4579693 4578278 gene locus_tag LOCUS_35300 4579693 4578278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 4581537 4579807 gene locus_tag LOCUS_35310 4581537 4579807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 4582592 4581588 gene locus_tag LOCUS_35320 4582592 4581588 CDS product DUF5119 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927908.1 protein_id gnl|my_center|LOCUS_35320 4583875 4582616 gene locus_tag LOCUS_35330 4583875 4582616 CDS product DUF3575 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080707197.1 protein_id gnl|my_center|LOCUS_35330 4585195 4584146 gene locus_tag LOCUS_35340 4585195 4584146 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039969.1 protein_id gnl|my_center|LOCUS_35340 4586081 4585350 gene locus_tag LOCUS_35350 4586081 4585350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 4587990 4587175 gene locus_tag LOCUS_35360 4587990 4587175 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786111.1 protein_id gnl|my_center|LOCUS_35360 4588095 4590470 gene locus_tag LOCUS_35370 4588095 4590470 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202406.1 protein_id gnl|my_center|LOCUS_35370 4590540 4591313 gene locus_tag LOCUS_35380 4590540 4591313 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786103.1 protein_id gnl|my_center|LOCUS_35380 4591404 4592693 gene locus_tag LOCUS_35390 4591404 4592693 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202405.1 protein_id gnl|my_center|LOCUS_35390 4592750 4593211 gene locus_tag LOCUS_35400 4592750 4593211 CDS product copper resistance protein NlpE N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768150.1 protein_id gnl|my_center|LOCUS_35400 4593835 4593509 gene locus_tag LOCUS_35410 4593835 4593509 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795584.1 protein_id gnl|my_center|LOCUS_35410 4594705 4594190 gene locus_tag LOCUS_35420 4594705 4594190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292012.1 protein_id gnl|my_center|LOCUS_35420 4595328 4594744 gene locus_tag LOCUS_35430 4595328 4594744 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643829.1 protein_id gnl|my_center|LOCUS_35430 4596076 4595330 gene locus_tag LOCUS_35440 4596076 4595330 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986663.1 protein_id gnl|my_center|LOCUS_35440 4596420 4596335 gene locus_tag LOCUS_t00680 4596420 4596335 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4596662 4598890 gene locus_tag LOCUS_35450 gene pflB 4596662 4598890 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766750.1 protein_id gnl|my_center|LOCUS_35450 4598903 4599628 gene locus_tag LOCUS_35460 gene pflA 4598903 4599628 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202364.1 protein_id gnl|my_center|LOCUS_35460 4601294 4600014 gene locus_tag LOCUS_35470 4601294 4600014 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766767.1 protein_id gnl|my_center|LOCUS_35470 4601842 4601291 gene locus_tag LOCUS_35480 4601842 4601291 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_35480 4602008 4602802 gene locus_tag LOCUS_35490 4602008 4602802 CDS product NigD-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786065.1 protein_id gnl|my_center|LOCUS_35490 4603839 4602913 gene locus_tag LOCUS_35500 4603839 4602913 CDS product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766770.1 protein_id gnl|my_center|LOCUS_35500 4603973 4604449 gene locus_tag LOCUS_35510 4603973 4604449 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766771.1 protein_id gnl|my_center|LOCUS_35510 4605838 4604567 gene locus_tag LOCUS_35520 4605838 4604567 CDS product aspartyl protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202958.1 protein_id gnl|my_center|LOCUS_35520 4608028 4605965 gene locus_tag LOCUS_35530 4608028 4605965 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202545.1 protein_id gnl|my_center|LOCUS_35530 4610395 4608146 gene locus_tag LOCUS_35540 4610395 4608146 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107585.1 protein_id gnl|my_center|LOCUS_35540 4611446 4610478 gene locus_tag LOCUS_35550 4611446 4610478 CDS product 1,4-beta-mannosyl-N-acetylglucosamine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107586.1 protein_id gnl|my_center|LOCUS_35550 4612790 4611480 gene locus_tag LOCUS_35560 4612790 4611480 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107587.1 protein_id gnl|my_center|LOCUS_35560 4615455 4612942 gene locus_tag LOCUS_35570 gene galB 4615455 4612942 CDS product beta-galactosidase GalB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202546.1 protein_id gnl|my_center|LOCUS_35570 4615670 4618039 gene locus_tag LOCUS_35580 4615670 4618039 CDS product glycoside hydrolase family 20 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107277.1 protein_id gnl|my_center|LOCUS_35580 4619413 4618214 gene locus_tag LOCUS_35590 4619413 4618214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 4622639 4619565 gene locus_tag LOCUS_35600 4622639 4619565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 4624494 4622722 gene locus_tag LOCUS_35610 4624494 4622722 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786046.1 protein_id gnl|my_center|LOCUS_35610 4627970 4624521 gene locus_tag LOCUS_35620 4627970 4624521 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203657.1 protein_id gnl|my_center|LOCUS_35620 4629310 4628324 gene locus_tag LOCUS_35630 4629310 4628324 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768135.1 protein_id gnl|my_center|LOCUS_35630 4629474 4630067 gene locus_tag LOCUS_35640 4629474 4630067 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786040.1 protein_id gnl|my_center|LOCUS_35640 4631218 4630082 gene locus_tag LOCUS_35650 4631218 4630082 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786035.1 protein_id gnl|my_center|LOCUS_35650 4632200 4631181 gene locus_tag LOCUS_35660 4632200 4631181 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202359.1 protein_id gnl|my_center|LOCUS_35660 4633084 4632260 gene locus_tag LOCUS_35670 gene menB 4633084 4632260 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795543.1 protein_id gnl|my_center|LOCUS_35670 4634680 4633139 gene locus_tag LOCUS_35680 gene menD 4634680 4633139 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766783.1 protein_id gnl|my_center|LOCUS_35680 4636008 4634911 gene locus_tag LOCUS_35690 4636008 4634911 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760411.1 protein_id gnl|my_center|LOCUS_35690 4637237 4636005 gene locus_tag LOCUS_35700 4637237 4636005 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760410.1 protein_id gnl|my_center|LOCUS_35700 4639753 4637489 gene locus_tag LOCUS_35710 4639753 4637489 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202125.1 protein_id gnl|my_center|LOCUS_35710 4640257 4639892 gene locus_tag LOCUS_35720 4640257 4639892 CDS product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202355.1 protein_id gnl|my_center|LOCUS_35720 4641110 4641022 gene locus_tag LOCUS_t00690 4641110 4641022 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4641971 4643254 gene locus_tag LOCUS_35730 4641971 4643254 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005677642.1 protein_id gnl|my_center|LOCUS_35730 4643321 4644613 gene locus_tag LOCUS_35740 4643321 4644613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 4644624 4645643 gene locus_tag LOCUS_35750 4644624 4645643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057250942.1 protein_id gnl|my_center|LOCUS_35750 4645867 4646175 gene locus_tag LOCUS_35760 4645867 4646175 CDS product DUF3853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809723.1 protein_id gnl|my_center|LOCUS_35760 4646175 4647266 gene locus_tag LOCUS_35770 4646175 4647266 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816490.1 protein_id gnl|my_center|LOCUS_35770 4647483 4648442 gene locus_tag LOCUS_35780 4647483 4648442 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816488.1 protein_id gnl|my_center|LOCUS_35780 4648654 4650057 gene locus_tag LOCUS_35790 4648654 4650057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 4650146 4650499 gene locus_tag LOCUS_35800 4650146 4650499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 4650762 4650571 gene locus_tag LOCUS_35810 4650762 4650571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35810 4651459 4650947 gene locus_tag LOCUS_35820 4651459 4650947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 4651936 4651484 gene locus_tag LOCUS_35830 4651936 4651484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 4653100 4653015 gene locus_tag LOCUS_t00700 4653100 4653015 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4653278 4655773 gene locus_tag LOCUS_35840 4653278 4655773 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109374.1 protein_id gnl|my_center|LOCUS_35840 4655834 4656886 gene locus_tag LOCUS_35850 gene corA 4655834 4656886 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785927.1 protein_id gnl|my_center|LOCUS_35850 4656925 4658133 gene locus_tag LOCUS_35860 4656925 4658133 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022470187.1 protein_id gnl|my_center|LOCUS_35860 4658638 4658144 gene locus_tag LOCUS_35870 4658638 4658144 CDS product PepSY-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760392.1 protein_id gnl|my_center|LOCUS_35870 4659099 4658659 gene locus_tag LOCUS_35880 4659099 4658659 CDS product PepSY-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760391.1 protein_id gnl|my_center|LOCUS_35880 4660276 4659728 gene locus_tag LOCUS_35890 4660276 4659728 CDS product DUF4738 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760389.1 protein_id gnl|my_center|LOCUS_35890 4660814 4660365 gene locus_tag LOCUS_35900 4660814 4660365 CDS product DUF4890 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108962.1 protein_id gnl|my_center|LOCUS_35900 4661052 4661891 gene locus_tag LOCUS_35910 gene nfo 4661052 4661891 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795638.1 protein_id gnl|my_center|LOCUS_35910 4663487 4661916 gene locus_tag LOCUS_35920 4663487 4661916 CDS product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202333.1 protein_id gnl|my_center|LOCUS_35920 4663870 4664364 gene locus_tag LOCUS_35930 4663870 4664364 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948438.1 protein_id gnl|my_center|LOCUS_35930 4664568 4664392 gene locus_tag LOCUS_35940 4664568 4664392 CDS product DUF4250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766883.1 protein_id gnl|my_center|LOCUS_35940 4665056 4664661 gene locus_tag LOCUS_35950 4665056 4664661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788164.1 protein_id gnl|my_center|LOCUS_35950 4665233 4667122 gene locus_tag LOCUS_35960 4665233 4667122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108178.1 protein_id gnl|my_center|LOCUS_35960 4667275 4667012 gene locus_tag LOCUS_35970 4667275 4667012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 4667337 4669283 gene locus_tag LOCUS_35980 4667337 4669283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 4669411 4671261 gene locus_tag LOCUS_35990 4669411 4671261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 4671299 4672678 gene locus_tag LOCUS_36000 4671299 4672678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 4672993 4673205 gene locus_tag LOCUS_36010 4672993 4673205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36010 4673267 4673518 gene locus_tag LOCUS_36020 4673267 4673518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 4673508 4674566 gene locus_tag LOCUS_36030 gene dcm 4673508 4674566 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964364.1 protein_id gnl|my_center|LOCUS_36030 4674563 4676392 gene locus_tag LOCUS_36040 4674563 4676392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 4676405 4678606 gene locus_tag LOCUS_36050 4676405 4678606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 4679524 4680141 gene locus_tag LOCUS_36060 4679524 4680141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 4680240 4680446 gene locus_tag LOCUS_36070 4680240 4680446 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202295.1 protein_id gnl|my_center|LOCUS_36070 4680461 4682776 gene locus_tag LOCUS_36080 4680461 4682776 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027389.1 protein_id gnl|my_center|LOCUS_36080 4682779 4684287 gene locus_tag LOCUS_36090 4682779 4684287 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775649.1 protein_id gnl|my_center|LOCUS_36090 4684303 4685319 gene locus_tag LOCUS_36100 4684303 4685319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 4685312 4685791 gene locus_tag LOCUS_36110 4685312 4685791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 4685794 4686291 gene locus_tag LOCUS_36120 4685794 4686291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 >Feature sequence2 2401 1244 gene locus_tag LOCUS_36130 2401 1244 CDS product replication initiation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011199178.1 protein_id gnl|my_center|LOCUS_36130 2776 2564 gene locus_tag LOCUS_36140 2776 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008671645.1 protein_id gnl|my_center|LOCUS_36140 3248 2766 gene locus_tag LOCUS_36150 3248 2766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011199175.1 protein_id gnl|my_center|LOCUS_36150 3599 3282 gene locus_tag LOCUS_36160 3599 3282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 3836 3618 gene locus_tag LOCUS_36170 3836 3618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 4073 3867 gene locus_tag LOCUS_36180 4073 3867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 4277 4086 gene locus_tag LOCUS_36190 4277 4086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 4473 4294 gene locus_tag LOCUS_36200 4473 4294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 4909 4520 gene locus_tag LOCUS_36210 4909 4520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 5196 4981 gene locus_tag LOCUS_36220 5196 4981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 5482 5231 gene locus_tag LOCUS_36230 5482 5231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 7600 6590 gene locus_tag LOCUS_36240 7600 6590 CDS product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011199171.1 protein_id gnl|my_center|LOCUS_36240 8633 8025 gene locus_tag LOCUS_36250 8633 8025 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948274.1 protein_id gnl|my_center|LOCUS_36250 8764 9105 gene locus_tag LOCUS_36260 8764 9105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011199139.1 protein_id gnl|my_center|LOCUS_36260 9125 9439 gene locus_tag LOCUS_36270 9125 9439 CDS product DUF4134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295370.1 protein_id gnl|my_center|LOCUS_36270 9441 9740 gene locus_tag LOCUS_36280 9441 9740 CDS product DUF4133 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011199141.1 protein_id gnl|my_center|LOCUS_36280 9746 12586 gene locus_tag LOCUS_36290 9746 12586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011199142.1 protein_id gnl|my_center|LOCUS_36290 12684 13271 gene locus_tag LOCUS_36300 12684 13271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011199143.1 protein_id gnl|my_center|LOCUS_36300 13339 13929 gene locus_tag LOCUS_36310 13339 13929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011199144.1 protein_id gnl|my_center|LOCUS_36310 13922 14944 gene locus_tag LOCUS_36320 13922 14944 CDS product plasmid transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011199145.1 protein_id gnl|my_center|LOCUS_36320 14977 15591 gene locus_tag LOCUS_36330 gene traK 14977 15591 CDS product conjugative transposon protein TraK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011199146.1 protein_id gnl|my_center|LOCUS_36330 15591 16022 gene locus_tag LOCUS_36340 15591 16022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 16026 17135 gene locus_tag LOCUS_36350 gene traM 16026 17135 CDS product conjugative transposon protein TraM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011199148.1 protein_id gnl|my_center|LOCUS_36350 17137 17976 gene locus_tag LOCUS_36360 gene traN 17137 17976 CDS product conjugative transposon protein TraN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011199149.1 protein_id gnl|my_center|LOCUS_36360 18040 18492 gene locus_tag LOCUS_36370 18040 18492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780944.1 protein_id gnl|my_center|LOCUS_36370 18495 19154 gene locus_tag LOCUS_36380 18495 19154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011199151.1 protein_id gnl|my_center|LOCUS_36380 19157 19798 gene locus_tag LOCUS_36390 19157 19798 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011199152.1 protein_id gnl|my_center|LOCUS_36390 20384 20557 gene locus_tag LOCUS_36400 20384 20557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 20618 20845 gene locus_tag LOCUS_36410 20618 20845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 20917 21366 gene locus_tag LOCUS_36420 20917 21366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 21363 21842 gene locus_tag LOCUS_36430 21363 21842 CDS product DUF3990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390171.1 protein_id gnl|my_center|LOCUS_36430 21864 22124 gene locus_tag LOCUS_36440 21864 22124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 22111 22977 gene locus_tag LOCUS_36450 22111 22977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 23689 23024 gene locus_tag LOCUS_36460 23689 23024 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011199157.1 protein_id gnl|my_center|LOCUS_36460 23730 24449 gene locus_tag LOCUS_36470 23730 24449 CDS product DUF4099 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011199158.1 protein_id gnl|my_center|LOCUS_36470 24451 26010 gene locus_tag LOCUS_36480 24451 26010 CDS product DUF3945 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011199159.1 protein_id gnl|my_center|LOCUS_36480 26015 27124 gene locus_tag LOCUS_36490 26015 27124 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011199160.1 protein_id gnl|my_center|LOCUS_36490 27121 27624 gene locus_tag LOCUS_36500 27121 27624 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011199161.1 protein_id gnl|my_center|LOCUS_36500 27605 28312 gene locus_tag LOCUS_36510 27605 28312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011199162.1 protein_id gnl|my_center|LOCUS_36510 28313 29149 gene locus_tag LOCUS_36520 28313 29149 CDS product topoisomerase C-terminal repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011199163.1 protein_id gnl|my_center|LOCUS_36520 29146 29499 gene locus_tag LOCUS_36530 29146 29499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011199164.1 protein_id gnl|my_center|LOCUS_36530 29511 29789 gene locus_tag LOCUS_36540 29511 29789 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011199165.1 protein_id gnl|my_center|LOCUS_36540 29780 30052 gene locus_tag LOCUS_36550 29780 30052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 30063 30506 gene locus_tag LOCUS_36560 30063 30506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 30681 30905 gene locus_tag LOCUS_36570 30681 30905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 30909 32864 gene locus_tag LOCUS_36580 30909 32864 CDS product type IV secretion system DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011199167.1 protein_id gnl|my_center|LOCUS_36580 32857 33243 gene locus_tag LOCUS_36590 32857 33243 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011199168.1 protein_id gnl|my_center|LOCUS_36590 34106 33678 gene locus_tag LOCUS_36600 34106 33678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108827.1 protein_id gnl|my_center|LOCUS_36600 35829 34150 gene locus_tag LOCUS_36610 35829 34150 CDS product MAC/perforin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108828.1 protein_id gnl|my_center|LOCUS_36610 37161 35839 gene locus_tag LOCUS_36620 37161 35839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108831.1 protein_id gnl|my_center|LOCUS_36620 38371 37373 gene locus_tag LOCUS_36630 38371 37373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 38540 39775 gene locus_tag LOCUS_36640 38540 39775 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084205626.1 protein_id gnl|my_center|LOCUS_36640 39778 40500 gene locus_tag LOCUS_36650 39778 40500 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992806.1 protein_id gnl|my_center|LOCUS_36650 41023 40589 gene locus_tag LOCUS_36660 41023 40589 CDS product DUF3408 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011199138.1 protein_id gnl|my_center|LOCUS_36660 41705 41082 gene locus_tag LOCUS_36670 41705 41082 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011199137.1 protein_id gnl|my_center|LOCUS_36670 43284 41722 gene locus_tag LOCUS_36680 43284 41722 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007559083.1 protein_id gnl|my_center|LOCUS_36680 >Feature sequence3 106 1131 gene locus_tag LOCUS_36690 106 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 1263 1907 gene locus_tag LOCUS_36700 1263 1907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 2392 1943 gene locus_tag LOCUS_36710 2392 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 3143 2349 gene locus_tag LOCUS_36720 3143 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 3928 3746 gene locus_tag LOCUS_36730 3928 3746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 4236 3958 gene locus_tag LOCUS_36740 4236 3958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 4486 4220 gene locus_tag LOCUS_36750 4486 4220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 >Feature sequence4 31 654 gene locus_tag LOCUS_36760 31 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 1274 2377 gene locus_tag LOCUS_36770 1274 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770