COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence1 source 1..3020833 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA complement(2661..4214) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 tRNA complement(4459..4532) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 tRNA complement(4546..4619) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 tRNA complement(4637..4722) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 tRNA complement(4735..4807) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 tRNA complement(4816..4889) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 tRNA complement(4912..4984) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA complement(4993..5067) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 rRNA complement(5086..5196) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 rRNA complement(5283..8191) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 rRNA complement(8428..9982) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00040 tRNA complement(10227..10300) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA complement(10314..10387) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 tRNA complement(10405..10490) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 tRNA complement(10503..10575) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 tRNA complement(10584..10657) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 tRNA complement(10680..10752) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 tRNA complement(10761..10835) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 rRNA complement(10854..10964) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00050 rRNA complement(11051..13959) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00060 rRNA complement(14196..15750) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00070 tRNA complement(15995..16068) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 tRNA complement(16082..16155) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 tRNA complement(16173..16258) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 tRNA complement(16271..16343) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA complement(16352..16425) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 tRNA complement(16448..16520) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA complement(16529..16603) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 rRNA complement(16622..16732) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00080 rRNA complement(16819..19727) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00090 rRNA complement(19964..21518) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00100 CDS complement(22058..23551) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359372.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 gene lysS CDS complement(23650..24639) product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290055.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 gene dusB CDS complement(24655..25542) product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359370.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 gene hslO CDS complement(25652..27718) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363441.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 gene ftsH CDS complement(27795..28340) product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356260.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 gene hpt CDS complement(28359..29756) product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379219.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 gene tilS CDS complement(29826..30311) product S1 domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356258.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS complement(30353..30751) product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356257.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS complement(30825..31100) product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287407.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS complement(31115..32692) product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361558.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS complement(32706..36245) product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387517.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 gene mfd CDS complement(36261..36830) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379221.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 gene pth CDS 37136..38101 product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356251.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS 38359..39207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS 39422..40792 product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287397.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS complement(40833..41732) product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002393453.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS complement(41836..42228) product YxeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227084.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS complement(42339..42848) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365476.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS complement(42870..43415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS 43535..44068 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771287.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS 44092..44694 product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000882440.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 gene yqeK CDS 44712..44996 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS 45098..45640 product DUF1269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732639.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS 45746..46408 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861582.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS 46386..47318 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033956.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS complement(47358..51935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00260 note possible pseudo, frameshifted CDS complement(52175..53566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00270 note possible pseudo, frameshifted CDS complement(54104..54364) product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000418127.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS complement(54386..55078) product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381369.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS 55526..57124 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297081.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS 57124..57861 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356242.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS complement(57932..58453) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235430.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS 58560..58988 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS complement(59221..61278) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948168.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS complement(61437..62528) product C45 family autoproteolytic acyltransferase/hydolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285230.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS complement(62579..63406) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948696.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS complement(64126..71541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS complement(72098..73246) product class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286364.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS complement(73253..74392) product class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137604701.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS complement(74464..75993) product SpaH/EbpB family LPXTG-anchored major pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286774.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(75986..77005) product pilin N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286776.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS complement(77006..79414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS complement(79830..81236) product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207301.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 gene pepV CDS complement(81318..82046) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234935.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS complement(82116..83762) product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364837.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS complement(83865..86279) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285916.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 gene leuS CDS complement(86602..89541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS complement(89538..89723) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS 89828..90481 product DUF1700 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381265.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS 90478..91527 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS 91594..92247 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355669.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS 92253..93218 product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355668.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS 93211..93783 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285906.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS complement(93846..94028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS complement(94138..94413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS complement(94531..94926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS 95164..95313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS 95446..95835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS complement(95979..96221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS 96347..96583 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(96777..97109) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS complement(97238..97483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS complement(97688..98806) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510927.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS complement(98799..99491) product vancomycin resistance response regulator transcription factor VanR-I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461303.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 gene vanR CDS complement(99562..100476) product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459514.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS 100625..101182 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641446.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS complement(101229..102698) product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386972.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS complement(102762..103949) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355656.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 gene metK CDS 104137..104895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS 105118..105948 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860920.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS 105941..106447 product ClbS/DfsB family four-helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837148.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS 106569..107312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS complement(107334..107924) product type 1 glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289535.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS complement(108059..108766) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289197.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 gene deoD CDS complement(108778..109593) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356180.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS complement(109607..110779) product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387505.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 gene deoB CDS complement(110861..111814) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356172.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS complement(111818..112894) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289201.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(112887..114437) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289202.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS complement(114508..115563) product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356169.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS complement(115619..116014) product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289205.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS complement(116498..117799) product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356165.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS complement(117923..118933) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294322.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS 119137..120222 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002087.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS complement(120262..120474) product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354768.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS complement(120558..121217) product L-fuculose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926557.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS complement(121291..122343) product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017134.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS complement(122365..123567) product S-methyl-5-thioribose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017133.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 gene mtnK CDS complement(123569..124894) product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626870.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS 125219..125983 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719095.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS 126049..127218 product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903257.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS complement(127264..128205) product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289029.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 gene menA CDS complement(128221..129330) product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294811.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS complement(129450..130370) product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321666.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS 130658..132595 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354747.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS 132698..133222 product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289378.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS 133251..134237 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002372605.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS complement(134281..135912) product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810405.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS complement(135905..136735) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016296.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS complement(136728..137516) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810400.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS complement(137513..138535) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810402.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS complement(138549..139655) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810403.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS 140163..141782 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288381.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS complement(141824..142555) product peptidase C39 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355000.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS complement(142461..142688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS complement(142678..143550) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288377.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS complement(143632..144924) product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288375.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS complement(145042..146403) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381331.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 gene dnaB CDS complement(146432..146884) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288372.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 gene rplI CDS complement(147032..147274) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356021.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 gene rpsR CDS complement(147298..147819) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379277.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 gene ssb CDS complement(147862..148161) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356019.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 gene rpsF CDS complement(148424..150928) product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361457.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 gene gyrA CDS complement(150952..152907) product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359210.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 gene gyrB CDS complement(152920..154020) product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356016.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 gene recF CDS complement(154025..154258) product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356015.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 gene yaaA CDS complement(154473..155603) product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288361.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 gene dnaN CDS complement(155758..155931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01180 note possible pseudo, frameshifted CDS complement(155960..157102) product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288360.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 gene dnaA note possible pseudo, frameshifted CDS 157573..157707 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS 157827..158165 product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356011.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 gene rnpA CDS 158181..158996 product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295256.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS 159022..159771 product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295258.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS 160102..161796 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002370456.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 gene argS CDS complement(161869..162087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS 162327..163721 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295261.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 gene mnmE CDS 163738..165639 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355988.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 gene mnmG CDS complement(165709..166878) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287688.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS 167180..167983 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS 168152..169594 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109309.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS complement(169950..170378) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438356.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS 170518..170688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS 170824..171543 product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355977.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 gene rsmG CDS 171613..172380 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355976.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS 172367..173263 product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355975.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS 173451..173642 product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355974.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS 173662..174762 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293105.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 gene ychF CDS 174787..175485 product DUF1129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363563.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS 175610..177094 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295264.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 gene guaB CDS complement(177200..178477) product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355965.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 gene serS CDS complement(178797..179096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS complement(179120..180415) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386952.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS complement(180507..181769) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002299522.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS complement(181867..183027) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363566.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS complement(183017..183706) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355963.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 rRNA 184171..185725 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00110 tRNA 185811..185883 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 rRNA 186073..188981 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00120 rRNA 189067..189178 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00130 tRNA 189191..189265 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 tRNA 189274..189346 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 tRNA 189356..189438 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 tRNA 189452..189525 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 tRNA 189533..189606 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 tRNA 189617..189702 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA 189720..189793 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 tRNA 189808..189881 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 tRNA 189891..189966 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 tRNA 189984..190059 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 tRNA 190083..190172 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 tRNA 190183..190258 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 tRNA 190261..190333 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 tRNA 190348..190418 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 tRNA 190437..190510 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 tRNA 190524..190613 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 tRNA 190633..190704 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA 190717..190806 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 tRNA 190817..190892 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 tRNA 190895..190967 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 tRNA 190976..191049 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 tRNA 191063..191133 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 tRNA 191152..191225 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 tRNA 191239..191328 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 tRNA 191348..191419 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 CDS 191496..192842 product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294246.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 gene brnQ CDS complement(192861..193547) product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081133709.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 gene gpmA CDS complement(193567..194247) product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296865.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 gene rpiA CDS 194528..194941 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356190.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 gene rpsL CDS 194990..195460 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356191.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 gene rpsG CDS 195547..197634 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356192.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 gene fusA CDS 197759..198946 product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356194.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 gene tuf CDS 199102..199812 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS 200033..200341 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389727.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 gene rpsJ CDS 200362..200997 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356199.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 gene rplC CDS 201022..201645 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774252.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 gene rplD CDS 201645..201932 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356203.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS 201965..202798 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290451.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 gene rplB CDS 202844..203122 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288655.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 gene rpsS CDS 203141..203488 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288657.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 gene rplV CDS 203502..204158 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356207.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 gene rpsC CDS 204161..204595 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288661.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 gene rplP CDS 204585..204776 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288664.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 gene rpmC CDS 204800..205066 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359348.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 gene rpsQ CDS 205115..205483 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723686.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 gene rplN CDS 205518..205829 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356212.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 gene rplX CDS 205856..206395 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356213.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 gene rplE CDS 206414..206599 product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288673.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS 206634..207032 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356215.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 gene rpsH CDS 207062..207598 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288677.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 gene rplF CDS 207626..207982 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356218.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 gene rplR CDS 208003..208503 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288681.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 gene rpsE CDS 208515..208694 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288686.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 gene rpmD CDS 208737..209177 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288687.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 gene rplO CDS 209177..210475 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288688.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 gene secY CDS 210533..211186 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356223.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS 211392..211610 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356224.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 gene infA CDS 211775..212140 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288713.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 gene rpsM CDS 212170..212559 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356226.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 gene rpsK CDS 212641..213579 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288715.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS 213610..213996 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356228.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 gene rplQ CDS 214289..215131 product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359354.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS 215107..215979 product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381364.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS 215969..216766 product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288724.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS 216843..217586 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288727.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 gene truA CDS 217743..218186 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295975.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 gene rplM CDS 218200..218592 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287505.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 gene rpsI CDS complement(218697..219896) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219078.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS 220108..222465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS 222500..223033 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS 223218..223790 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290383.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS 223887..224891 product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001817700.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS complement(225085..225957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS complement(226472..227227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS 227474..228061 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273859.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS 228256..228468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS 228472..229950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS 230941..232800 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287725.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS 233511..233861 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS 233899..235311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS 235315..236655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS complement(237129..238406) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205010568.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS complement(238438..238713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS complement(238738..239817) product Rep family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546178.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS complement(240172..240456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS complement(240488..241108) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02060 note possible pseudo, internal stop codon, frameshifted CDS complement(241105..241782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02070 note possible pseudo, frameshifted CDS complement(241872..242192) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS 242393..243565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS complement(243636..243908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS complement(243932..246088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS 246222..246545 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS 246605..247534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS 247685..248230 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS 248227..248931 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS 248937..249917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS complement(250164..251210) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254116.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS complement(251573..252190) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02180 note possible pseudo, frameshifted CDS complement(252223..252810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02190 note possible pseudo, frameshifted CDS 252911..253717 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287017.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS 254052..254303 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS complement(254365..255534) product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104859673.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS complement(256044..256790) product lantibiotic immunity ABC transporter MutE/EpiE family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002265408.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS complement(256787..257101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02240 note possible pseudo, internal stop codon CDS complement(257168..257341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02250 note possible pseudo, internal stop codon CDS 258133..258468 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356136.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS 258465..258824 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02270 note possible pseudo, frameshifted CDS 258779..259144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02280 note possible pseudo, frameshifted CDS 259145..260080 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479611.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS 260639..261148 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS complement(263155..264930) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002374418.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS complement(264914..266674) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359874.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS 266798..267556 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285922.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS 267660..268352 product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287788.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS complement(268439..268879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02350 note possible pseudo, frameshifted CDS complement(268845..269606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02360 note possible pseudo, frameshifted CDS 269761..270039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS 270373..270927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02380 note possible pseudo, frameshifted CDS 270937..271317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02390 note possible pseudo, internal stop codon, frameshifted CDS 271363..271770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02400 note possible pseudo, internal stop codon CDS 272361..273200 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS 273319..273726 product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714149.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS 273728..276607 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126795678.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS 276720..277199 product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369322.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS complement(277200..277841) product transcriptional regulator YeiL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949096.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 gene yeiL CDS 277924..278112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS 278290..278724 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002366740.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS 278744..279709 product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381868.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS 279716..280633 product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234172.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS 280620..281228 product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287766.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS 281242..281841 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361880.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS complement(281894..282835) product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994130.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS 282950..283576 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS 283685..285463 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363211.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS complement(285505..287046) product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025189815.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS 287349..288320 product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706765.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS 288401..290194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS complement(290251..291348) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417572.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS 291533..292459 product DUF561 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722294.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS 292701..293699 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS 293803..294324 product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856821.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS 294396..295157 product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002373191.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS 295212..295427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02630 note possible pseudo, frameshifted CDS 295559..295894 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02640 note possible pseudo, frameshifted CDS 296078..297850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS 298186..300504 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193577188.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS complement(300543..300989) product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354908.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS 301133..301537 product DUF4809 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389555.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS 301679..302698 product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368573.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 gene add CDS 302808..303191 product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365398.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS 303347..303970 product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101939.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS complement(303986..304522) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02720 note possible pseudo, frameshifted CDS complement(304500..305141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02730 note possible pseudo, frameshifted CDS complement(305153..305902) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989898.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS complement(306022..306249) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS complement(306334..307071) product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296566.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS 307415..307927 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245754.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS 308115..309080 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877602.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS 309096..309839 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944147.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS 309832..310581 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811476.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS 310808..312007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS 312163..312759 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355475.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS 313246..313590 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262616.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS 313943..314209 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS complement(314320..314682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS 315092..316099 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562759.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS 316176..316628 product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371463.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 gene argR CDS 316648..318159 product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371464.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS 318167..318505 product nitrous oxide-stimulated promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263753.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS 318878..325603 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS complement(325651..326520) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321119.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS 326705..328840 product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002366159.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS 328908..329258 product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355518.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS 329355..330563 product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371470.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS 330560..333313 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286213.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS 333315..334256 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286211.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS complement(334267..335937) product IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095092556.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS complement(336085..336756) product class A sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296196.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS 337079..337855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287349.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS 337987..339039 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293424.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS 339092..340462 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025189821.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS 340590..342146 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355724.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS 342236..342589 product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379159.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 gene acpS CDS complement(342652..343032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS 343149..344849 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287350.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS 344851..345069 product YdbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287352.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS 345080..345964 product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387384.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS 346066..346680 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287358.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 gene gmk CDS 346684..346992 product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287365.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 gene rpoZ CDS 347067..347444 product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948047.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS 347597..350017 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378970.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 gene priA CDS 350031..350522 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287369.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 gene def CDS 350515..351456 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365369.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 gene fmt CDS 351449..352819 product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378969.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 gene rsmB CDS 352844..353599 product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287376.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS 353596..355464 product serine/threonine protein kinase IreK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387383.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 gene ireK CDS 355558..356439 product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287379.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 gene rsgA CDS 356457..357110 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354925.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 gene rpe CDS 357110..357763 product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378967.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS 357886..358299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS 358354..358767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS 359009..359704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS complement(359768..360796) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615578.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS 361097..362017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS 362119..363396 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774915.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS 363412..364320 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002939305.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS 364334..365161 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804269.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS 365340..366512 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972774.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS 366517..366981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS 366981..367967 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803699.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS 367967..368827 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332337.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS complement(368899..369288) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS complement(369309..369641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS 369843..370010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS complement(370066..371661) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681273.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS 371845..372045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS complement(372135..372623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS 372706..373062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS complement(373113..373301) product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720131.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 gene rpmB CDS 373517..373879 product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354933.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS 373941..375611 product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354936.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS 375712..377751 product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002370092.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 gene recG CDS 377804..378814 product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387382.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 gene plsX CDS 378909..379148 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294295.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 gene acpP CDS 379643..380647 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287889.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS 380647..381594 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287891.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS 381596..382558 product oligopeptide ABC transporter permease Opp2B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354943.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 gene opp2B CDS 382590..383483 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287893.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS 383507..385300 product oligopeptide ABC transporter substrate-binding protein Opp2A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378964.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 gene opp2A CDS 385422..386126 product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354946.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 gene rnc CDS 386145..389720 product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361019.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 gene smc CDS 389737..390549 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287898.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS 390561..391850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS 391978..392730 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002323503.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS 392727..393644 product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288484.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 gene pfkB CDS 393660..395567 product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002366176.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS 395713..397992 product bifunctional glutamate--cysteine ligase GshA/glutathione synthetase GshB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287901.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 gene gshAB CDS complement(398038..398418) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS complement(398457..399536) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101277.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS complement(399592..400047) product YueI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378959.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS 400199..401146 product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354960.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS 401143..402105 product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387376.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS 402105..402860 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354962.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS 402880..403845 product siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002370087.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS complement(403900..404760) product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876600.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS 404905..405822 product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642887.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 gene murQ CDS 405822..406148 product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420747.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS 406174..406431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS 406446..407723 product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288817.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS 407775..408080 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898113.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS 408156..409253 product MupG family TIM beta-alpha barrel fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861793.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS 409260..410387 product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234976.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS 410396..411547 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100954.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS 411564..412418 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287653.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS 412433..412663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286598.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS complement(412714..414123) product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922487.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS 414225..414890 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180008.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS complement(414996..415859) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267146.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS 416061..417278 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837568.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS 417473..417898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS 417929..418606 product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379209.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS complement(418659..419516) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234236.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS complement(419650..420186) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS complement(420310..421656) product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369213.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS 421793..422062 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356545.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS 422360..424369 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289325.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 gene metG CDS 424452..425222 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294001.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS 425222..425800 product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002305490.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 gene rnmV CDS 425793..426677 product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358849.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 gene rsmA CDS 426755..427336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289506.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS complement(427409..428515) product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289507.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 gene ugpC CDS 428643..429029 product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289508.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 gene mgsA CDS 429227..429751 product folate family ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385065.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS complement(429790..430524) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905995.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS 430607..431095 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905994.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS 431119..431817 product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760203.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS 431878..432363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS complement(432437..434182) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002376122.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS complement(434187..435932) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294013.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS complement(436039..436518) product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288352.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS 436667..437773 product 3D domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355830.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS complement(437860..438000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS complement(438278..439030) product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994678.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS complement(439020..440129) product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002437110.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS 440254..440865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS 441001..441201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS 441471..442028 product energy-coupled thiamine transporter ThiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287348.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 gene thiT CDS complement(442236..442856) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356501.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS complement(442862..443410) product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359573.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 gene coaC CDS complement(443424..444179) product phosphopantothenate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379731.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 gene coaB CDS complement(444200..444829) product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379063.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS 444980..445780 product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297139.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS 445800..446195 product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354866.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS 446200..448788 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378992.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 gene mutS CDS 448810..450705 product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837650.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 gene mutL CDS 450717..451271 product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294256.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS 451289..451717 product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003598806.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 gene msrB CDS complement(451759..452649) product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963142.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS 452836..453453 product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002309787.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 gene ruvA CDS 453466..454476 product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381340.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 gene ruvB CDS complement(454497..455081) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS complement(455117..455374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS 455554..456588 product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355747.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 gene queA CDS 456608..457753 product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748618.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 gene tgt CDS 457836..458186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS 458224..458493 product post-transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364719.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS 458689..461292 product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355775.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 gene adhE CDS 461445..462308 product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287383.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 gene mreC CDS 462305..462820 product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287385.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 gene mreD CDS 463004..464257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS 464406..465059 product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876938.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS complement(465113..466927) product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025189810.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS 467044..467562 product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002391486.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS 467630..468355 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287391.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS complement(468409..468741) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071742188.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS 468867..469832 product competence type IV pilus ATPase ComGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364362.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 gene comGA CDS 469915..470829 product competence type IV pilus assembly protein ComGB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356990.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 gene comGB CDS 470832..471137 product competence type IV pilus major pilin ComGC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356991.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 gene comGC CDS 471191..471589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS 471576..471875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS 471908..472285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS 472248..472607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS 472723..473733 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286175.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS 473751..474935 product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357064.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS 475021..475272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS complement(475288..475767) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357065.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS complement(475792..476061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293648.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS complement(476391..477662) product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289088.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS 477772..478248 product DUF3013 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002388170.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS 478264..479211 product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109511.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 gene prmA CDS 479218..479970 product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289095.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS 480096..480776 product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966612.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS complement(480794..481162) product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367385.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS complement(481168..482394) product chloride channel family chloride transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819625.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS complement(482416..482679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS 482960..485176 product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289096.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS 485190..485636 product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289097.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 gene dtd CDS 485830..487341 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357138.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 gene glpK CDS 487391..488110 product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292560.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS complement(488153..489457) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723525.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS 489845..491611 product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379571.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 gene aspS CDS 491667..492551 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293644.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS 492619..493359 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490886.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS complement(493381..493653) product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304776.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS complement(493640..494386) product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356457.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS 494515..495147 product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356461.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS complement(495198..496043) product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704350.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS complement(496146..497303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS complement(497315..498010) product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090736.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS complement(498026..498970) product pseudouridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042318072.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS 499087..500175 product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113479.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS 500280..500546 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS 500653..501528 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010679823.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS 501541..502350 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732024.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS 502350..502979 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641758.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS 503084..504217 product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706825.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS 504228..507362 product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399936.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS 507374..510586 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362298.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS complement(510641..511393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS 511647..513362 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387172.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS 513510..513998 product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357086.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS 514105..515154 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381968.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS 515219..516892 product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357956.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS 516987..518411 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357746.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS 518635..519960 product DRTGG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382281.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS 519972..520919 product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357742.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS complement(520956..521816) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS complement(521873..522616) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016216.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS complement(522597..524195) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS 524358..526115 product urocanate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074216.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 gene urdA CDS 526456..526635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS complement(526685..526987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS 527180..528349 product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104859673.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS 528477..528926 product DUF3290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355544.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS 528929..529570 product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368017.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS 529853..532459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS 532474..532863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS complement(532996..533415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS complement(533499..534260) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002302142.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS complement(534260..534706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294107.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS 534898..535491 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943169.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS 535512..536189 product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030520.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS 536333..537163 product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289459.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS 537271..537690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949105.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS 537696..538052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS 538101..538526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS 538567..538881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS complement(538992..540623) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288864.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 gene groL CDS complement(540650..540934) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356531.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 gene groES CDS 541107..541748 product CPBP family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362272.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS complement(541787..542431) product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356528.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS 542628..544565 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287747.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS 544679..545314 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861582.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS 545316..546257 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033940.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS complement(546304..546744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS complement(546880..547089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS complement(547146..548294) product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286837.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 gene queG CDS 548408..549556 product competence protein CoiA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387170.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS 549582..551393 product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387169.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 gene pepF CDS complement(551439..552056) product ClpXP adapter SpxH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368840.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS complement(552151..552747) product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289849.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS 552883..553572 product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381475.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS 553569..554363 product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356486.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS 554389..555264 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294562.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS 555281..556648 product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362548.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 gene mgtE CDS 556764..557669 product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674064.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS complement(557717..558364) product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356490.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 gene cutC CDS 558486..559349 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359566.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS 559570..560073 product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774238.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 gene trmL CDS 560088..560708 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362550.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS 560776..563253 product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379735.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS complement(563297..564250) product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379732.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS 564414..564968 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357432.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS complement(565023..565481) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228335.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS 565645..566163 product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294548.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS complement(566218..566856) product cyclic di-AMP binding protein CbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365057.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 gene cbpA CDS 567019..567171 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356408.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 gene rpmG CDS 567293..567460 product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294579.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 gene secE CDS 567574..568116 product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384070.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 gene nusG CDS 568178..569026 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289897.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS 569381..570757 product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362971.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 gene nhaC CDS complement(570806..572116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS complement(572307..572828) product putative glycolipid-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948952.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS complement(572835..573707) product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362308.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 gene sdaAA CDS complement(573720..574379) product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294585.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 gene sdaAB CDS 574632..575867 product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296026.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS 575959..577011 product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287328.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 gene recA CDS 577229..578782 product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354863.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 gene rny CDS 578959..579606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS 579697..581451 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990058.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS 581466..582140 product DNA-binding heme response regulator HssR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249497.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 gene hssR CDS 582137..583186 product envelope stress sensor histidine kinase HitS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001231621.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 gene hitS CDS 583250..584125 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924049.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS 584205..585284 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989911.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS 585299..586009 product trehalose utilization protein ThuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731916.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS 586029..586997 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989909.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS 587017..588069 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930784.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS complement(588127..590091) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485723.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS complement(590240..590809) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287074.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS 591082..591504 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002291638.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 gene rplK CDS 591611..592300 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356425.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 gene rplA CDS 592499..592999 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002291634.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 gene rplJ CDS 593066..593434 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294588.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 gene rplL CDS 593590..595035 product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356538.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS complement(595089..597014) product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243329.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 gene fbp CDS 597149..597832 product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706832.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 tRNA complement(597883..597959) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 CDS 598219..598833 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101468.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS 599011..599319 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355866.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 gene rplU CDS 599344..599664 product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355867.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS 599686..599970 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289452.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 gene rpmA CDS 600100..601164 product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286665.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS 601389..601817 product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286664.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 601819..602244 product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286662.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 gene nusB CDS 602333..603178 product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355876.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS 603193..604536 product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286658.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 gene xseA CDS 604540..604770 product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286657.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS 604770..605666 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379200.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS 605666..606496 product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704070.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS 606520..606966 product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286653.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS 606981..608657 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387037.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 gene recN CDS complement(608718..608837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS 609137..609508 product DUF3397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383401.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS 609670..610101 product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355890.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 gene mraZ CDS 610125..611090 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286642.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 gene rsmH CDS 611096..611482 product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294542.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 gene ftsL CDS 611479..613371 product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381310.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS 613393..614361 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355894.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 gene mraY CDS 614377..615753 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379203.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 gene murD CDS 615750..616844 product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379204.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 gene murG CDS 616856..617818 product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368241.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS 617962..619293 product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355898.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 gene ftsA CDS 619315..620589 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355899.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 gene ftsZ CDS 620603..621322 product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286628.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS 621309..621860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS 621874..622152 product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355902.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS 622186..622968 product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355903.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS 622989..623798 product cell division protein DivIVA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355904.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 gene divIVA CDS 624055..626841 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381313.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 gene ileS CDS 627014..628201 product betaine/proline/choline family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355745.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS 628201..628836 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293405.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS 628836..629768 product osmoprotectant ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355743.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS 629768..630448 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363261.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS complement(630506..631993) product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355906.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 gene zwf CDS 632175..632906 product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287962.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 633020..634237 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303757.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS complement(634287..634472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357816.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS 634720..635868 product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289803.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 gene nagA CDS complement(636032..636616) product Type 1 glutamine amidotransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723214.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS complement(636639..637223) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714111.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS 637318..637902 product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837075.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS complement(637937..638311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS complement(638325..638993) product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382251.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS 639154..639855 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774180.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS 639866..642613 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706591.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS complement(642679..643089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS complement(643074..643520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS 643754..644275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357809.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS 644291..645757 product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297122.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS complement(645817..646449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 646560..647510 product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360063.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS 647627..648157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295457.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 648198..648950 product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321179.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS 648958..649587 product glycoside hydrolase family 73 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295461.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 649641..650330 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295463.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS 650354..651199 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS 651280..652107 product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364530.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 gene thiD CDS 652211..652594 product DUF1149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358717.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS 652667..653395 product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379384.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS 653377..655677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS 655681..657864 product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382246.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS 657864..658310 product SprT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382248.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 tRNA 658319..658404 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 CDS 658565..660025 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383114.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS 660330..660953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS 660966..662480 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468925.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS 662527..672819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06350 repeat_region 672002..672450 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cagatggttcagacggctcagac CDS 672884..674611 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS 674962..675528 product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367212.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 gene ahpC CDS 675608..677284 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706831.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS 677413..678873 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029133.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 gene thrC CDS 678933..679760 product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287960.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS 679774..680616 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287959.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS 680631..681134 product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287958.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS complement(681258..682046) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993757.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS complement(682055..682906) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922272.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(682894..683691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS complement(683657..684256) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399619.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS 684436..684996 product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949068.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS complement(685047..686402) product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002391510.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS 686745..688469 product septation ring formation regulator EzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287957.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS 688594..689745 product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358363.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS 689758..690975 product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287955.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 gene thiI CDS 691158..691820 product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365189.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS 691899..692390 product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378903.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 gene tpx CDS 692696..695335 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387315.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS 695358..696647 product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355117.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS 696648..697304 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355118.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS 697367..698047 product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706793.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 gene radC CDS 698220..698420 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294067.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS complement(698482..699645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS complement(699772..701445) product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355122.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS complement(701448..701663) product DNA-directed RNA polymerase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287947.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS complement(701981..702253) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356545.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS complement(702254..702520) product (4Fe-4S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356543.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS 702709..702867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS 703056..704786 product multidrug efflux ABC transporter subunit EfrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387312.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 gene efrA CDS 704783..706543 product multidrug efflux ABC transporter subunit EfrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365186.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 gene efrB CDS complement(706591..707352) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490911.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS 707434..707889 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461322.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS complement(707940..708293) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS 708435..708593 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS 708590..708778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS 708797..709504 product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002318601.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 gene sfsA CDS 709528..710541 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355910.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS 710560..711870 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379207.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS 711888..714557 product sigma-54-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002373633.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS 714644..714919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS 715151..716539 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003725004.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS 716552..716773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS 716791..716976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS 716963..717376 product DUF3284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355917.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS 717530..717850 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355913.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS 717855..718175 product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355919.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS complement(718289..719476) product NADH-dependent flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003588846.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS 719618..719995 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721437.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 tRNA 720240..720315 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 CDS complement(720368..721876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS 722344..723231 product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476418.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS 723747..724412 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964814.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS 724409..725788 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964815.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS 725781..726413 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS 726487..727323 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295129.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS 727585..729435 product tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964757.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 gene tet CDS complement(729432..729935) product DNA topology modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000720566.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS 730148..731188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS 731420..732472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS complement(732533..733771) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286469.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS 734025..734594 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356883.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS complement(734698..735147) product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286465.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS 735307..736056 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356886.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 gene map CDS 736072..736992 product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286461.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS complement(737008..737484) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905125.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS complement(737499..738125) product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101225.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS 738368..739240 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025189838.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS 739243..740163 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390124.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS 740193..740801 product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357907.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS 740817..742001 product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360528.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS complement(742044..743174) product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002366956.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS 743353..744516 product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356443.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS 744686..745765 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641921.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS 745854..746885 product teichoic acid glycerol-phosphate primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968271.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 gene tagB CDS 746882..747622 product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360559.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS 747637..748455 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722701.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS 748474..749649 product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362618.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS 749653..753198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS 753464..754576 product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172824465.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 gene wecB CDS 754629..755576 product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002338484.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS 755609..756304 product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002338483.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS 756326..757093 product tyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002338482.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS 757107..758921 product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902060.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS 758924..759538 product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902061.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS 759546..760436 product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902062.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS 760433..761563 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242735.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS 761626..762813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS 762816..763988 product EpsG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101305.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS 763989..765521 product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101306.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS 765523..766614 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101307.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS 766658..767608 product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289372.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS 767652..768059 product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646390.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 gene tagD CDS 768126..769016 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357314.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 gene galU CDS complement(769057..769872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS complement(769874..771112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS 771284..771976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS complement(772060..772854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS complement(772928..773140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS complement(773160..773369) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS complement(773451..773951) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643211.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS 774159..774929 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS 774985..775785 product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387182.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 gene recX CDS 775775..776980 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773812.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 gene mutY CDS 777078..777614 product biofilm phosphatase Bph inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355538.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 gene bph CDS 777757..778659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS complement(778702..779835) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379459.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS complement(779912..781612) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829283.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS complement(781691..782122) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290819.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS 782263..783486 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290821.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS 783483..784874 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295395.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS 784990..786852 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS 786853..787569 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027228.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS 787569..787913 product DUF2304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050394.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS 787915..788256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356899.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS 788432..790009 product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355543.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS 790048..790995 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378890.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS 791122..793812 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS complement(793915..794226) product DUF1827 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355547.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS complement(794406..796601) product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287598.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS 796794..796976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002366170.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS 797148..797414 product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287602.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 797414..799138 product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774175.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 gene ptsP CDS 799380..800402 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643293.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS 800418..801629 product cell wall glycolipid biosynthesis glucosyltransferase BgsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706866.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 gene bgsB CDS 801644..802684 product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704264.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS 802763..803629 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356274.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS 803729..803962 product YkuJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379802.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS 804071..804991 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003579029.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS 805096..806379 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355556.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 gene tig CDS 806601..807854 product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357154.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 gene clpX CDS 808062..808955 product phosphate ABC transporter substrate-binding protein PstS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289807.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS 809036..809743 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293705.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS 809740..811479 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109504.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS 811598..812029 product CopY/TcrY family copper transport repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379040.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 812048..814507 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714164.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS complement(815042..815623) product LysM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355317.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS 816177..817034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS complement(817208..819379) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092520565.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS complement(819380..820291) product DUF1837 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837429.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS 820692..821531 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005589479.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS complement(821588..822925) product NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361833.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS 823297..824787 product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011167004.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS 824809..825261 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011167001.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS 825325..827937 product mannosylglycerate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861603.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 gene mngB CDS 827950..828741 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028344.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS 828766..830142 product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035027539.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS 830161..831027 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360061.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS complement(831090..831497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS complement(831676..831867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS 832120..832527 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262616.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS complement(832604..833035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS complement(833092..833832) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013246136.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS 834029..834370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS 834471..834710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS complement(834864..835322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS complement(835324..835539) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722966.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS complement(835628..836617) product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379196.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS complement(836618..837280) product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355844.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 gene pgmB CDS complement(837394..839658) product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286373.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS 839874..842051 product PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379197.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS 842119..842940 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002370688.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS 842955..843968 product LacI family transcriptional regulator BopD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387027.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 gene bopD CDS 844167..845417 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287577.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS 845563..846102 product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168228.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS 846135..847940 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287775.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS 848096..849985 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386960.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS 850146..850943 product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774245.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS 851021..852169 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869908.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS 852180..852899 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860672.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS complement(852919..854649) product ABC transporter permease/substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287807.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS complement(854642..855850) product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287805.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS complement(856005..856637) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287801.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS 856891..858495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS 858592..859173 product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357155.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 gene yihA CDS complement(859227..859394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS complement(859439..860569) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904722.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS complement(860621..861064) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933079.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS 861392..861931 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08130 note possible pseudo, frameshifted CDS 861997..862503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08140 note possible pseudo, frameshifted CDS complement(862749..863645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS complement(863785..864051) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS complement(864134..865282) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355768.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS complement(865357..866079) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361352.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS complement(866072..867526) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358820.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS 867802..869466 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126779478.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS 869834..871486 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387374.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS 871496..872722 product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354968.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 gene pepT CDS 872927..873784 product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440056.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS 873895..875820 product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861834.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS 875832..877256 product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002375743.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS 877406..878395 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963715.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS 878579..879313 product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837540.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS 879320..879562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS 879578..880849 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002329694.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS 880871..881836 product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963717.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS 881833..882471 product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963718.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS 882455..882997 product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963719.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 gene hxlB CDS 883008..883634 product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288242.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS 883744..885258 product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930536.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS 885337..885642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS 885731..888559 product sigma-54-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387433.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS 888806..889303 product mannose/fructose/sorbose PTS transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289455.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS 889373..890341 product mannose/fructose/sorbose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890751.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS 890374..891183 product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890752.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS 891201..892118 product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721724.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS 892269..892655 product DUF956 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699888.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS 892890..894572 product oligopeptide ABC transporter substrate-binding protein Opp1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399736.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 gene opp1A CDS complement(894690..895034) product DUF3899 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379183.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS 895122..896066 product oligopeptide ABC transporter permease Opp1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381304.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 gene opp1B CDS 896066..897094 product oligopeptide ABC transporter permease Opp1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355787.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 gene opp1C CDS 897109..898146 product oligopeptide ABC transporter ATP-binding protein Opp1D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355794.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 gene opp1D CDS 898162..899115 product oligopeptide ABC transporter ATP-binding protein Opp1F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355795.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 gene opp1F CDS complement(899188..900141) product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361636.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS complement(900160..901467) product Sapep family Mn(2+)-dependent dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386630.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS 901712..902269 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356188.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS complement(902319..903077) product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356377.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 gene fetB CDS complement(903070..903729) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548243.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS 903885..904355 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS 904443..905075 product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355702.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 gene udk CDS 905119..905703 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355150.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS 905786..906154 product CvfD/Ygs/GSP13 family RNA-binding post-transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287231.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS 906233..906604 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385270.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 rRNA 906927..908481 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00140 tRNA 908567..908639 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 rRNA 908829..911737 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00150 rRNA 911812..911923 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00160 tRNA 911938..912011 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 CDS complement(912112..912486) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369612.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS 912636..912962 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356722.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS 912964..913893 product permease prefix domain 1-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387089.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS 913895..914392 product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742997.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS complement(914414..915202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS 915475..918222 product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382784.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS 918278..918763 product DUF5590 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382785.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS 918779..919969 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359774.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS 919993..921291 product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288767.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 gene asnS CDS 921412..921621 product copper chaperone CopZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289040.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 gene copZ CDS 921734..922375 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461502.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS 922440..923801 product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889706.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS complement(923845..925758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS complement(925755..925982) product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460459.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS 926138..927319 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476376.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS 927431..928366 product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390188.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS complement(928425..929759) product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101072.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS 929926..931920 product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379127.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 gene uvrB CDS 931933..934761 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361280.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 gene uvrA CDS complement(934809..935540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369334.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS complement(935552..936400) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002366745.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS complement(936397..936765) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357453.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS 936910..937806 product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355625.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 gene rapZ CDS 937860..938795 product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289697.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS 938816..939742 product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289698.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 gene whiA CDS 939906..941693 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881436.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS 941896..943233 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263116.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 gene lpdA CDS 943247..944212 product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897599.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS 944240..945262 product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897598.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS 945279..946478 product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263119.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS complement(946563..947078) product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773452.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS complement(947091..947684) product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355633.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 gene clpP CDS complement(947807..948631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS complement(948705..948839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08910 tRNA complement(948933..949006) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 CDS 949077..950414 product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295132.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 gene rpoN CDS 950599..951636 product sugar-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357092.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS 951680..952684 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357093.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 gene gap CDS 952775..953962 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989997.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS 953988..954743 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292815.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 gene tpiA CDS 954745..956271 product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930391.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 gene gpmI CDS 956375..957670 product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357098.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 gene eno CDS 957966..958232 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS 958373..958573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09000 note possible pseudo, internal stop codon, frameshifted CDS 958808..958960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09010 note possible pseudo, internal stop codon, frameshifted CDS 958981..959946 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS 959964..960494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS 960565..960984 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS 960981..962129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS 962198..963712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS 964299..965585 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379561.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS 965610..967094 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383114.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS 967312..968826 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357138.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 gene glpK CDS 968850..970670 product type 1 glycerol-3-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837394.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 gene glpO CDS 970672..971391 product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292560.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS 971608..972624 product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356704.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS 972637..973260 product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356705.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS 973339..973548 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS 973803..975302 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS 975307..976515 product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476434.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS 976521..977489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS 977506..978387 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS 978393..980036 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS 980056..980799 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS 980927..981928 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294322.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS 981925..982689 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356886.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 gene map CDS complement(982769..983407) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674892.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS complement(983574..984404) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246662.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS 984650..985219 product glycerol-3-phosphate responsive antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049765998.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS 985361..986806 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964632.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS 986807..988063 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964633.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS 988068..988424 product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964634.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS 988449..988892 product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356612.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS 988926..992462 product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714077.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 gene nifJ CDS 992625..992828 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS complement(992874..994208) product YjiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986374.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS complement(994219..995136) product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963590.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS 995329..996084 product HTH-type transcriptional repressor AllR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141266.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 gene allR CDS 996102..996509 product FosX/FosE/FosI family fosfomycin resistance hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208930268.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 gene fosX CDS complement(996568..997065) product LURP-one-related/scramblase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847065.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS 997631..997978 product ethanolamine utilization microcompartment protein EutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721543.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 gene eutS CDS 997989..998420 product EutP/PduV family microcompartment system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721544.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS complement(998463..999359) product PocR ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721549.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS 999671..999946 product propanediol utilization microcompartment protein PduA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388660.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 gene pduA CDS 999969..1000778 product propanediol utilization microcompartment protein PduB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816690.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 gene pduB CDS 1000801..1002462 product propanediol/glycerol family dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008947521.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS 1002477..1003145 product propanediol/glycerol family dehydratase medium subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989693.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS 1003159..1003671 product diol dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732740.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS 1003704..1005539 product diol dehydratase reactivase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931948.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS 1005532..1005888 product glycerol dehydratase reactivase beta/small subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989694.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS 1005902..1006327 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS 1006348..1006632 product propanediol utilization microcompartment protein PduA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009934191.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 gene pduA CDS 1006625..1007266 product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989695.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 gene pduL CDS 1007357..1007851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS 1007848..1008111 product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003736331.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS 1008122..1009132 product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931568.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS 1009122..1010513 product aldehyde dehydrogenase EutE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989697.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS 1010529..1011644 product 1-propanol dehydrogenase PduQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989698.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS 1011661..1012374 product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002907132.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS 1012397..1013581 product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836578.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS complement(1013617..1014546) product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949075.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS complement(1014550..1015053) product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358709.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS complement(1015196..1015954) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948093.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS complement(1015957..1017012) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669987.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS complement(1017033..1018019) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682022.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS complement(1018019..1018966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS 1019662..1021131 product ABC-F type ribosomal protection protein Msr(C) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287458.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 gene msr(C) CDS complement(1021187..1022521) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280110.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS 1022631..1023470 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986545.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS 1023569..1024738 product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104859673.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS 1025133..1026362 product NAD-dependent dihydropyrimidine dehydrogenase subunit PreT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136379.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 gene preT CDS 1026362..1027609 product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956071.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 gene preA CDS 1027767..1027952 product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147171.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS 1028051..1028287 product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356546.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 gene secG CDS 1028368..1029117 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384145.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS 1029120..1031480 product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289014.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 gene rnr CDS 1031486..1031950 product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356550.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 gene smpB CDS 1032213..1032932 product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356551.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 gene atpB CDS 1032972..1033184 product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356552.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 gene atpE CDS 1033259..1033780 product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289010.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 gene atpF CDS 1033773..1034312 product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356554.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 gene atpH CDS 1034343..1035881 product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289008.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 gene atpA CDS 1035898..1036815 product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359606.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS 1036834..1038237 product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356558.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 gene atpD CDS 1038255..1038689 product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356559.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS 1038880..1041390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS 1041493..1041729 product DUF1146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289004.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS 1041836..1043140 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289003.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 gene murA CDS 1043164..1043343 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS 1043418..1043705 product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357157.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 gene yidD CDS 1043830..1045002 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262675.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS 1045026..1045901 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941421.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS 1045911..1046879 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662293.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS 1046857..1047633 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186003.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS 1047633..1048337 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262679.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS 1048341..1048991 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268654.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS 1049116..1049349 product DUF2969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002316425.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 tRNA 1049418..1049500 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 tRNA 1049510..1049583 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 CDS 1049660..1049830 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS complement(1049875..1050645) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321321.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS 1050811..1051878 product L-ascorbate 6-phosphate lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288825.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 gene ulaG CDS 1051895..1052353 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288826.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS 1052369..1053853 product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288827.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS 1053878..1054183 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288830.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS 1054199..1054840 product 3-keto-L-gulonate-6-phosphate decarboxylase UlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288832.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS 1054843..1055700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10010 note possible pseudo, internal stop codon, frameshifted CDS 1055693..1056403 product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295327.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS complement(1056448..1057053) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357803.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS 1057230..1061477 product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382252.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS 1061568..1062275 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292782.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS complement(1062339..1062974) product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357285.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS 1063031..1063588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS complement(1063641..1064567) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387471.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS 1064670..1066001 product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774215.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS 1065998..1066705 product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369291.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS 1066841..1067395 product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289771.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 gene raiA CDS 1067537..1068607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS complement(1068906..1069889) product PocR ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721549.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS 1070170..1070466 product propanediol utilization microcompartment protein PduA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388660.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 gene pduA CDS 1070466..1071275 product propanediol utilization microcompartment protein PduB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816690.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 gene pduB CDS 1071296..1072960 product propanediol/glycerol family dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008947521.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS 1072985..1073683 product propanediol/glycerol family dehydratase medium subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405037.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS 1073699..1074211 product diol dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836574.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS 1074225..1076069 product diol dehydratase reactivase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931948.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS 1076059..1076388 product glycerol dehydratase reactivase beta/small subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816694.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS 1076401..1076931 product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721557.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS 1076954..1077229 product propanediol utilization microcompartment protein PduJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057752.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 gene pduJ CDS 1077254..1077877 product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989695.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 gene pduL CDS 1077976..1078491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS 1078470..1078742 product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003736331.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS 1078763..1079353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10260 note possible pseudo, internal stop codon, frameshifted CDS 1079346..1079810 product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836577.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS 1079813..1081228 product aldehyde dehydrogenase EutE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989697.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS 1081230..1082348 product 1-propanol dehydrogenase PduQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989698.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS 1082363..1083070 product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548130.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS 1083090..1084268 product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034578.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 gene ackA CDS 1084544..1087072 product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381826.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 gene secA CDS 1087250..1088239 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096948712.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 gene prfB CDS 1088372..1089058 product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292768.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 gene ftsE CDS 1089051..1089938 product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317241.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 gene ftsX CDS 1090381..1091235 product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357298.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS 1091259..1092179 product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002316421.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 gene pstC CDS 1092179..1093063 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357300.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 gene pstA CDS 1093077..1093886 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357302.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 gene pstB CDS 1093898..1094650 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357303.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 gene pstB CDS 1094674..1095357 product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357304.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 gene phoU CDS 1095532..1096797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS 1096968..1098563 product daptomycin-sensing surface protein LiaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369294.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 gene liaX CDS 1098590..1098907 product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357306.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS complement(1098981..1099220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS 1099422..1100354 product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357309.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 gene hprK CDS 1100359..1101189 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381830.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 gene lgt CDS 1101377..1102387 product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357312.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS 1102405..1103310 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357314.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 gene galU CDS 1103349..1104341 product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387246.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS complement(1104338..1105099) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109565.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS 1105263..1106969 product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356340.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 gene dnaX CDS 1106985..1107299 product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292337.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS 1107363..1107959 product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387203.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 gene recR CDS 1107980..1108624 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294039.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 gene tmk CDS 1108646..1108975 product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356367.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS 1108975..1109916 product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384059.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 gene holB CDS 1109934..1110761 product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288073.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS 1110763..1111095 product DNA replication initiation control protein YabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356372.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS 1111159..1112028 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359438.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 gene rsmI CDS 1112213..1113958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS 1113991..1115706 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS 1115890..1116471 product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295469.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS 1116798..1117925 product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288025.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 gene purK CDS 1117951..1118586 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721766.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS 1118607..1119524 product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732615.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS 1119549..1120415 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180642.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS 1120429..1121181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS 1121349..1122326 product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356720.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 gene guaC CDS complement(1122378..1123190) product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295119.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 gene yidA CDS complement(1123205..1124560) product dNTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357999.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS complement(1124560..1125408) product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390086.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS 1125555..1125992 product DUF1934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382132.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS 1126080..1126691 product DNA-directed RNA polymerase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304561.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 gene rpoE CDS 1126770..1127102 product DUF1622 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386965.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS 1127236..1128711 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379222.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS 1128867..1129733 product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290335.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS 1129923..1131188 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357969.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS 1131181..1132464 product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357968.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 gene rho CDS 1132555..1132818 product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290330.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(1132894..1133883) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989687.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS complement(1134002..1135090) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475860.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS 1135269..1136099 product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356540.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 gene nadE CDS 1136114..1137937 product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287279.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS 1137955..1138704 product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947991.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS 1138923..1141595 product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377094.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS 1141735..1142577 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644056.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS 1142668..1143108 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287278.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS 1143264..1143782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS 1143806..1146151 product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646275.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS complement(1146195..1147466) product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276276.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 gene kynU CDS complement(1147468..1148658) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462122.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS 1148924..1149370 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001178565.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS 1149724..1151274 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290558.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS 1151403..1152050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS 1152263..1154893 product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830624.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 gene ppdK CDS 1154909..1155532 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355926.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS 1155532..1156365 product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836893.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS complement(1156442..1156975) product DUF2179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361848.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS 1157142..1158800 product aerobic glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672833.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 gene glpD CDS complement(1158822..1159532) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289461.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS complement(1159566..1160378) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289327.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS 1160704..1162248 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966289.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS 1162333..1162644 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294651.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS 1162646..1164280 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387331.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS 1164315..1164584 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS 1164999..1166036 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304234.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS 1166029..1167576 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS 1167613..1168452 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287678.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS complement(1168509..1169414) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207332.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS 1169514..1170872 product acyclic terpene utilization AtuA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124268.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS 1170874..1171185 product DUF4387 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813947.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS complement(1171162..1171914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11130 note possible pseudo, frameshifted CDS complement(1171953..1172855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11140 note possible pseudo, frameshifted CDS complement(1173005..1174384) product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891344.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS complement(1174414..1174971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11160 note possible pseudo, frameshifted CDS complement(1174971..1175297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11170 note possible pseudo, frameshifted CDS complement(1175339..1176415) product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426912.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS 1177071..1178450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS 1178695..1179465 product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287679.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 gene sufC CDS 1179485..1180774 product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364433.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 gene sufD CDS 1180776..1182008 product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002376739.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS 1181995..1182465 product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287684.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS 1182481..1183875 product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356769.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 gene sufB CDS complement(1183961..1184584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS 1184949..1186697 product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095325.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS complement(1187182..1188324) product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226917.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS 1188442..1189311 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614448.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS complement(1189633..1189920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS complement(1189922..1190893) product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361478.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS 1191181..1192029 product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045611195.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS complement(1192079..1192603) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS complement(1192605..1192874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS 1192990..1194183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11340 note possible pseudo, frameshifted CDS 1194195..1194494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS 1194635..1195093 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS 1195090..1196334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS 1196580..1197305 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143931.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS 1197445..1197873 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS 1197873..1199120 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS 1199303..1199611 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS 1199812..1200408 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS 1200553..1201119 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581032.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS 1201130..1202314 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114987.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS 1202379..1202876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS 1203013..1203510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS 1203531..1203836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS complement(1203867..1204439) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642750.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS complement(1204426..1205268) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364530.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 gene thiD CDS 1205388..1206821 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387088.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS 1206878..1207825 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565862.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS complement(1207898..1210675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS complement(1211208..1211627) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384928.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS complement(1211630..1211833) product YwbE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014310.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS 1211964..1212413 product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296550.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS 1212428..1212895 product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251731.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS complement(1212948..1214477) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930535.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS 1214631..1216388 product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356683.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 gene recQ CDS 1216469..1217416 product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409781.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS 1217490..1218167 product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017446.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 gene deoC CDS 1218496..1219320 product branched-chain phosphotransacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360223.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 gene ptb CDS 1219339..1220421 product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369343.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 gene buk CDS 1220436..1221848 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706660.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 gene lpdA CDS 1221866..1222852 product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369347.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS 1222883..1223869 product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357475.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS 1223899..1225191 product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369348.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS 1225335..1226387 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382353.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS complement(1226405..1227301) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369350.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS 1227506..1228447 product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002397331.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS 1228819..1229871 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382353.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS 1229908..1230846 product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002397331.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS 1230993..1231880 product DUF2877 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704655.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS 1231939..1233120 product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379231.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS 1233148..1233855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130677.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS complement(1233924..1235270) product citrate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356005.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS 1235619..1235954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263231.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS 1235948..1236346 product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386426.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS 1236377..1237498 product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263229.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS 1237537..1237680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS 1237698..1238693 product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361455.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 gene citC CDS 1238696..1239010 product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263227.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 gene citD CDS 1238998..1239885 product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922329.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 gene citE CDS 1239887..1241419 product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355996.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 gene citF CDS 1241412..1241963 product citrate lyase holo-[acyl-carrier protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381329.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 gene citX CDS 1241956..1243347 product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355994.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS 1243465..1244172 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356006.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS 1244159..1245016 product triphosphoribosyl-dephospho-CoA synthase CitG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922323.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 gene citG CDS complement(1245009..1245710) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069661899.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS 1245753..1247543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS 1247565..1248218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11900 note possible pseudo, internal stop codon CDS 1248243..1248488 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS 1248555..1248932 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS 1248937..1249572 product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898085.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS 1249569..1249949 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383105.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS 1250162..1253005 product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100911.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS complement(1253048..1254379) product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922546.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS complement(1254456..1255235) product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983637.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS complement(1255261..1255920) product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922545.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS complement(1255924..1256574) product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983642.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS complement(1256597..1257787) product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922544.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS 1258015..1258920 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922543.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS 1259130..1259570 product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390712.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS 1259579..1260772 product trans-2-enoyl-CoA reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963784.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS 1260784..1262340 product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626662.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS complement(1262401..1263291) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454990.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS 1263337..1264014 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS 1264128..1265099 product iron-hydroxamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001035548.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS 1265116..1266114 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234979.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS 1266107..1267129 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920450.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS 1267126..1267857 product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098345.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS 1267854..1268642 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861723.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS 1268731..1269141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS 1269361..1269729 product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354733.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 gene folB CDS 1269729..1270217 product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354734.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 gene folK CDS 1270221..1270784 product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381030.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 gene folE CDS 1270796..1271398 product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379022.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS 1271391..1272164 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387594.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 gene folP CDS 1272819..1274168 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897651.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS 1274255..1275367 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355728.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 gene alr CDS 1275549..1276973 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187104.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS 1277000..1278682 product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963689.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS 1278820..1279902 product ornithine racemase Orr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860813.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 gene orr CDS 1279933..1280991 product 2,4-diaminopentanoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895461.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 gene ord CDS 1281021..1281320 product 2-amino-4-oxopentanoate thiolase subunit OrtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860811.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 gene ortA CDS 1281320..1282726 product 2-amino-4-oxopentanoate thiolase subunit OrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032507361.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 gene ortB CDS 1282739..1283098 product ornithine aminomutase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434665.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS 1283101..1285320 product D-ornithine 4,5-aminomutase subunit OraE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895465.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 gene oraE CDS 1285322..1286725 product GlmL-related ornithine degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895468.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS complement(1287038..1287928) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785776.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS 1288122..1289033 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS 1289006..1290388 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12310 note possible pseudo, frameshifted CDS 1290460..1290687 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS 1290680..1291363 product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044887.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS 1291379..1291798 product DUF4430 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567167.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS 1291822..1292388 product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228501.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS complement(1292452..1293885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS complement(1293988..1294884) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948372.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS 1295008..1296198 product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948371.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS 1296492..1298033 product glutamate/gamma-aminobutyrate family transporter YjeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986430.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 gene yjeM CDS complement(1298094..1298720) product elongation factor G-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774153.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS 1298973..1299494 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387179.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS complement(1299498..1300196) product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379308.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS 1300332..1301486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287080.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS 1301683..1303167 product glutamate/gamma-aminobutyrate family transporter YjeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986430.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 gene yjeM CDS 1303207..1304439 product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286469.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS 1304677..1306179 product putative allantoin permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387337.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS 1306180..1307544 product allantoinase AllB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399799.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 gene allB CDS 1307669..1308904 product allantoate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001314542.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 gene allC CDS 1308917..1310161 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378762.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS 1310186..1310971 product (S)-ureidoglycine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540956.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 gene allE CDS 1310986..1312053 product ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706746.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 gene allD CDS 1312075..1313817 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12520 note possible pseudo, internal stop codon, frameshifted CDS 1313838..1315094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12530 note possible pseudo, internal stop codon, frameshifted CDS 1315170..1316096 product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868005.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 gene arcC CDS complement(1316153..1316977) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136054.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS complement(1316984..1318615) product PucR family transcriptional regulator ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365289.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS 1318785..1319999 product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387333.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS 1320233..1324792 product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714156.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS complement(1324815..1325009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS 1325135..1325425 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS 1325749..1326348 product MptD family putative ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054303.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS 1326348..1327043 product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054304.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS 1327043..1328437 product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461242.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS 1328513..1329577 product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003581107.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS 1329786..1331252 product DUF1958 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836696.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS 1331274..1332125 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254321.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS 1332234..1333766 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966588.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 gene cls CDS 1333904..1335049 product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295158.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS 1335120..1335464 product DUF1831 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356959.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS 1335620..1336378 product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365495.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS 1336391..1337863 product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365496.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS 1337856..1338563 product lactate utilization protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379317.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS complement(1338602..1339786) product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757967.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS 1340076..1341203 product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286726.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 gene mnmA CDS 1341550..1341990 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS 1342144..1342263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS 1342250..1342585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12770 note possible pseudo, frameshifted CDS 1342708..1344891 product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296188.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 gene mgtA note possible pseudo, frameshifted CDS 1345016..1345375 product DUF1033 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286704.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS 1345323..1347398 product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002392265.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS 1347499..1348884 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485248.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS 1348944..1351289 product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364367.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS complement(1351356..1353452) product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101165.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS 1353642..1354391 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381711.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS 1354381..1356258 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383725.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS 1356336..1356710 product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197242566.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS complement(1356725..1357507) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387085.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 gene proC CDS 1357648..1358373 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774917.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS 1358360..1359988 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921770.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS 1360306..1362255 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356319.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 gene thrS CDS 1362484..1364589 product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287654.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS 1364720..1364869 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356321.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 gene rpmG CDS complement(1365340..1365567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS 1365738..1366172 product MepB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387477.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS 1366265..1366837 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384041.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS 1366818..1367540 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362481.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS 1367638..1367850 product YqgQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983840.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS 1367847..1368809 product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288462.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS 1368839..1369240 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356334.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS complement(1369322..1369489) product DUF3042 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356337.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS 1369628..1370356 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289404.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS 1370356..1371297 product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002366931.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 gene miaA CDS 1371311..1372543 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379600.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 gene hflX CDS 1372657..1372983 product transcriptional repressor GlnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659548.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 gene glnR CDS 1373007..1374344 product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356929.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 gene glnA CDS 1374508..1375068 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355202.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 gene efp CDS 1375222..1376109 product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389035.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 gene cdaA CDS 1376109..1377137 product CdaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379597.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS 1377194..1378549 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287824.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 gene glmM CDS 1378692..1379267 product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295491.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 gene rsmD CDS 1379257..1379754 product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356693.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 gene coaD CDS 1379755..1380801 product SepM family pheromone-processing serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382735.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS 1380865..1381503 product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002404879.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS 1381535..1382029 product ComE operon protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356697.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS 1382166..1384319 product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083241703.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS 1384377..1385393 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362655.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 gene holA CDS complement(1385448..1385702) product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292188.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 gene rpsT CDS complement(1385815..1386666) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288847.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS complement(1386668..1387210) product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357951.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS complement(1387384..1389321) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289122.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS complement(1389478..1390311) product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289121.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS 1390495..1390992 product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706547.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS complement(1391038..1391667) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289118.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS 1391813..1393171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379697.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS complement(1393194..1393673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS complement(1393822..1394445) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565202.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS 1394616..1395179 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS 1395403..1396185 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356759.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 gene rpsB CDS 1396302..1397180 product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356760.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 gene tsf CDS 1397313..1398035 product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356761.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 gene pyrH CDS 1398037..1398594 product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356762.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 gene frr CDS 1398801..1399598 product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362225.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS 1399601..1400389 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359680.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS 1400418..1401698 product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359768.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 gene rseP CDS 1401727..1403427 product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288495.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS 1403507..1407841 product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382781.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS complement(1407884..1408705) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037684.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS 1408926..1409399 product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288499.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 gene rimP CDS 1409422..1410567 product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288500.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 gene nusA CDS 1410587..1410886 product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288501.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS 1410876..1411184 product YlxQ-related RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357860.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS 1411197..1413551 product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288511.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 gene infB CDS 1413577..1413930 product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288513.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 gene rbfA CDS complement(1413964..1415391) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382000.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS 1415577..1416539 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382786.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS complement(1416603..1417256) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002347025.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS complement(1417261..1418085) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295916.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS 1418324..1419241 product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294474.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 gene truB CDS 1419254..1420204 product riboflavin biosynthesis protein RibF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363808.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 gene ribF CDS 1420204..1421337 product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002410012.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 gene hemW CDS complement(1421379..1422896) product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949006.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS 1423172..1424218 product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289532.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 gene hrcA CDS 1424240..1424761 product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357827.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 gene grpE CDS 1424794..1426626 product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357825.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 gene dnaK CDS 1426765..1427913 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357822.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 gene dnaJ CDS 1428038..1428976 product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728914.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS 1429095..1429994 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964193.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS 1430096..1431523 product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295350.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 gene gndA CDS 1431665..1433383 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732111.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS 1433387..1435171 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732112.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS 1435412..1436101 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355954.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS 1436101..1437648 product HAMP domain-containing histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363430.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS 1437769..1438110 product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369323.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS 1438123..1439562 product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293709.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 gene ffh CDS 1439629..1440162 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065204181.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS 1440241..1441692 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387328.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS 1441823..1442932 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS 1442932..1444110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016386658.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS 1444126..1445007 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567269.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS 1445019..1445414 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431726.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS 1445542..1445817 product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290274.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 gene rpsP CDS 1445831..1446085 product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357435.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS 1446201..1446659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS 1446807..1447337 product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369214.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 gene rimM CDS 1447327..1448067 product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381776.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 gene trmD CDS 1448196..1448543 product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286913.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 gene rplS CDS 1448868..1449827 product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105383.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS complement(1449848..1450804) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732102.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS complement(1450821..1451120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS complement(1451269..1452447) product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356686.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS 1452657..1453505 product tetrahydrofolate dehydrogenase/cyclohydrolase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902122.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS 1453525..1454688 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002351560.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS 1454934..1456031 product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162675.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS complement(1456055..1456801) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213021.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS 1457007..1459319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS 1459470..1460435 product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357976.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS 1460464..1461831 product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963597.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS 1461866..1463053 product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS 1463054..1464409 product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228523.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 gene fumC CDS 1464479..1464700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS 1464826..1465356 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS 1465381..1466187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056248.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS 1466202..1466855 product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596401.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(1466901..1467311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS 1467451..1468509 product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293986.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 gene rlmN CDS 1468868..1469593 product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743346.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS 1469607..1471235 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010709260.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS 1471411..1472775 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286833.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS 1472969..1474051 product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002683018.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 gene gcvT CDS 1474074..1474454 product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222781.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 gene gcvH CDS 1474460..1475782 product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678346.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 gene gcvPA CDS 1475779..1477209 product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679310.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 gene gcvPB CDS 1477527..1478213 product DUF969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454809.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS 1478213..1479136 product DUF979 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985692.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS 1479159..1479806 product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002940685.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 gene pcp CDS 1479897..1480787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS complement(1480827..1481693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS 1481793..1482410 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903437.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS complement(1482454..1483743) product ectonucleotide pyrophosphatase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101973.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS 1484156..1485043 product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289627.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 gene aroE CDS 1485043..1486077 product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363948.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 gene aroF CDS 1486089..1487153 product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382321.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 gene aroB CDS 1487169..1488335 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357582.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 gene aroC CDS 1488360..1489463 product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382322.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS 1489473..1490762 product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025188841.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 gene aroA CDS 1490759..1491274 product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357579.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS 1491271..1492119 product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382323.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 gene pheA CDS 1492214..1493260 product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003729005.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS 1493312..1493989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14190 note possible pseudo, frameshifted CDS 1493937..1494182 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14200 note possible pseudo, frameshifted CDS 1494260..1495366 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355728.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 gene alr CDS 1495387..1496328 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582840.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS 1496377..1497723 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379408.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS complement(1497812..1498246) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243577.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS 1498311..1499234 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289735.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS 1499518..1502160 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357736.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 gene alaS CDS 1502410..1502673 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS 1502844..1502963 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS complement(1503025..1503225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14290 tmRNA complement(1503453..1503816) product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(1504113..1505312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS complement(1505327..1506214) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641901.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS complement(1506211..1506594) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548044.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS 1506796..1507350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14330 note possible pseudo, frameshifted CDS 1507320..1508231 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14340 note possible pseudo, frameshifted CDS 1508385..1508558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS 1508635..1509840 product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390196.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS 1509988..1511592 product IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095092556.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS complement(1511654..1511845) product YjzD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295359.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS complement(1511865..1512014) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS 1511975..1515298 product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379216.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 gene dnaE CDS 1515502..1516464 product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355947.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 gene pfkA CDS 1516519..1518273 product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714110.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 gene pyk CDS 1518402..1519577 product multidrug efflux MFS transporter EmeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358140.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 gene emeA CDS 1519619..1520335 product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732337.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS 1520322..1520657 product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721948.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS 1520673..1521221 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS 1521271..1522140 product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361792.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS 1522250..1522705 product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357640.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS complement(1522722..1523297) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837569.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS complement(1523313..1524059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS 1524219..1525112 product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294386.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 gene xerD CDS 1525133..1525885 product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382313.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS 1525898..1526497 product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357625.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 gene scpB CDS 1526497..1527219 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723596.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS 1527546..1528115 product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296977.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS 1528387..1530222 product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700513.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS complement(1530307..1530513) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357617.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS 1530540..1531592 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379439.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS 1531585..1533018 product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002311164.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS 1533083..1533718 product LysM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360346.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS 1533775..1534446 product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303123.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 gene cmk CDS 1534547..1535725 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360341.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 gene rpsA CDS 1535848..1537158 product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296982.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 gene der CDS 1537396..1537671 product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357604.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS complement(1537716..1538471) product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965150.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS complement(1538490..1539257) product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386207.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 gene motA CDS 1539675..1540064 product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392289.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 gene flgB CDS 1540079..1540498 product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986962.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 gene flgC CDS 1540525..1540854 product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986961.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 gene fliE CDS 1540886..1542565 product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965461.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 gene fliF CDS 1542574..1543578 product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965460.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 gene fliG CDS 1543562..1544413 product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668471.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 gene fliH CDS 1544406..1545719 product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047906.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 gene fliI CDS 1545750..1546184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS 1546206..1547576 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS 1547591..1548028 product flagellar hook capping FlgD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392298.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS 1548073..1548975 product flagellar hook-basal body complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986954.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS 1549020..1549223 product flagellar FlbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870069.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS 1549240..1549740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS 1549757..1550137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS 1550121..1550873 product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359303.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 gene fliP CDS 1550888..1551151 product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392308.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 gene fliQ CDS 1551164..1551922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14830 note possible pseudo, frameshifted CDS 1551927..1552994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14840 note possible pseudo, frameshifted CDS 1553076..1555145 product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359159.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 gene flhA CDS 1555212..1555922 product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404508.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS 1555919..1556626 product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965439.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS 1556659..1557396 product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930325.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 gene flgG CDS 1557412..1558122 product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361935.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 gene ftsE CDS 1558224..1560284 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964123.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS 1560458..1562509 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964123.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS 1562582..1563112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS 1563097..1563585 product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541375.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS 1563602..1564615 product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987036.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS 1564591..1565382 product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359187.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS 1565404..1567413 product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245734.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 gene cheA CDS 1567413..1568006 product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965517.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS 1568022..1568384 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359271.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS 1568419..1568829 product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965515.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS 1568826..1569824 product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987033.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 gene fliM CDS 1569826..1570869 product flagellar motor switch phosphatase FliY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231962.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 gene fliY CDS 1571078..1571377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS 1571364..1571726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS 1571795..1573315 product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392267.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 gene flgK CDS 1573320..1574279 product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392268.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 gene flgL CDS complement(1574311..1574859) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS 1575062..1576189 product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272513.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS 1576274..1576651 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS 1576657..1578156 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS 1578175..1578510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS 1578532..1578894 product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080180.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 gene fliS CDS 1578906..1579700 product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748663.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS 1579800..1580042 product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286666.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS 1580119..1581171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298135.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS 1581181..1582434 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377424.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS 1582440..1582988 product ReoY family proteolytic degradation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289878.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS complement(1583008..1583883) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357595.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS 1584010..1584357 product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363944.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS 1584395..1585597 product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365655.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS 1585607..1585963 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS 1586074..1586532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357586.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS 1586654..1588546 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365663.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS 1588559..1589506 product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357569.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS 1589537..1590031 product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288392.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS complement(1590068..1590622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358943.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS complement(1590823..1591467) product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357443.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS 1591583..1592422 product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357444.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS 1592476..1593354 product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365717.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS 1593373..1594032 product YpmS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706662.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS 1594034..1594573 product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357448.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 gene msrA CDS 1594563..1594781 product YozE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364020.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS 1594798..1596243 product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390869.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS 1596334..1596876 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294418.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 gene lepB CDS 1597327..1599231 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS 1599228..1601486 product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202292.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS 1601496..1602194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS 1602384..1602794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS 1602794..1602955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS 1603014..1604423 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS 1604488..1605345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS 1605400..1605648 product excisionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905405.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS 1605730..1606986 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905403.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS 1607078..1607926 product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357480.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 gene ylqF CDS 1607919..1608686 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296990.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS 1608739..1609617 product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382350.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 gene dprA CDS 1609728..1611809 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357484.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 gene topA CDS 1611917..1613221 product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357486.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 gene trmFO CDS 1613427..1614317 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357488.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 gene xerC CDS 1614334..1614882 product HslU--HslV peptidase proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288419.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 gene hslV CDS 1614895..1616292 product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288421.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 gene hslU CDS 1616325..1617125 product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290223.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 gene codY CDS 1617138..1618010 product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296994.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS complement(1618064..1618897) product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002326754.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS 1618983..1619423 product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287322.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS 1619536..1619712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS 1619740..1620183 product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356741.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS 1620310..1621269 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356743.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS 1621300..1623498 product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356744.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS 1623501..1623977 product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387079.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 gene ybeY CDS 1623955..1624356 product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002330764.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS 1624370..1625275 product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288753.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 gene era CDS 1625367..1626140 product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359746.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 gene recO CDS 1626422..1627318 product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706545.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 gene glyQ CDS 1627320..1629395 product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288758.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 gene glyS CDS 1629534..1631090 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287129.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS 1631105..1631779 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986489.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS 1631772..1633310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS 1633466..1635778 product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109494.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS 1635918..1637753 product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361790.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 gene dnaG CDS 1637775..1638896 product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289498.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 gene rpoD CDS 1639018..1639719 product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382286.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS 1639716..1640837 product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288338.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS 1640855..1642087 product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360428.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 gene pepT CDS 1642211..1644796 product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356811.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 gene clpB CDS 1645218..1646717 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS 1646745..1650383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS 1650457..1652169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS 1652147..1654036 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS 1654033..1654587 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS 1654571..1655464 product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812450.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS 1655437..1657137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS 1657130..1657831 product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044887.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS 1657832..1658782 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250797.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS 1658775..1659923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS 1659940..1662306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS complement(1662357..1663580) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356813.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS 1663704..1665542 product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706535.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 gene lepA CDS complement(1665709..1666560) product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801979.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS complement(1666779..1667291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS complement(1667442..1667957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS complement(1667971..1668954) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS complement(1668970..1670151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS complement(1670323..1671306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS 1672083..1676114 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS 1676180..1676332 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS 1676435..1676743 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS 1676859..1682030 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS complement(1682078..1682461) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510901.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS 1682586..1683269 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530083.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS complement(1683303..1684616) product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224435027.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS complement(1684619..1684990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224434963.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS complement(1684987..1685256) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390607.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS 1685390..1686334 product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949031.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS complement(1686391..1686909) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905072.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS complement(1686959..1687279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS complement(1687341..1687616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS 1687777..1689291 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371461.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS 1689354..1691381 product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288183.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS complement(1691432..1692673) product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674763.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS complement(1692676..1693299) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383117.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS 1693382..1694032 product transcriptional regulator YeiL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379563.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 gene yeiL CDS complement(1694059..1695120) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296820.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS complement(1695117..1695791) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286323.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS 1695920..1698262 product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286325.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS 1698370..1698786 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS 1698799..1699335 product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948519.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 gene cobC CDS 1699353..1699679 product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723189.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS 1699698..1700186 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948661.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS 1700149..1701018 product aminoglycoside nucleotidyltransferase ANT(6)-Ia inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255866.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 gene ant(6) CDS 1701061..1701618 product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161851.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS 1701634..1701918 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS 1702396..1703277 product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903684.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS 1703283..1704074 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837476.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS 1704055..1705035 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061734.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS complement(1705097..1706746) product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674608.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS 1706888..1707229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS 1707267..1707773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS 1707863..1708507 product type A chloramphenicol O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668557.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 gene catA CDS complement(1708551..1709639) product tyrosine recombinase XerS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984598.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 gene xerS CDS 1710014..1710883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS 1711571..1711858 product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388148.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS complement(1711908..1712084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS complement(1712166..1713140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS complement(1713124..1713708) product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158435.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS complement(1713866..1714381) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495432.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS complement(1714394..1714990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS complement(1715087..1716034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288609.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS complement(1716115..1716864) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289629.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS complement(1716866..1717726) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371274.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS complement(1717723..1718733) product tryptophan ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002391629.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 gene trpX CDS complement(1719060..1719692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS 1719876..1720469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS 1720448..1721488 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS 1721574..1723283 product fibronectin-binding protein EfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379361.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 gene efbA CDS 1723280..1724509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS 1724709..1726139 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642526.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS 1726287..1728014 product IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095092556.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS complement(1728019..1728219) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293303.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS complement(1728409..1729035) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288886.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS complement(1729102..1729512) product phosphate-starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355869.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 gene psiE CDS complement(1729639..1731486) product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905518.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS complement(1731503..1733905) product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476256.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS complement(1733945..1735375) product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836716.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 gene glgA CDS complement(1735380..1736534) product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476258.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 gene glgD CDS complement(1736521..1737663) product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004563805.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS complement(1737713..1739629) product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476259.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 gene glgB CDS 1740028..1742286 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS 1742539..1742742 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893537.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS 1742732..1743262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS 1743420..1745114 product IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095092556.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS complement(1745096..1747720) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS complement(1747872..1748492) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288884.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 gene pyrE CDS complement(1748496..1749206) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369313.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 gene pyrF CDS complement(1749206..1750123) product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288880.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS complement(1750120..1750899) product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365731.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS complement(1750918..1754094) product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288878.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 gene carB CDS complement(1754087..1755169) product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360175.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS complement(1755173..1756453) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288875.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS complement(1756463..1757389) product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357411.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS complement(1757419..1758711) product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357410.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS complement(1758860..1759399) product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357409.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 gene pyrR CDS complement(1759599..1760513) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295861.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS complement(1760599..1760952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS complement(1760965..1761309) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244013.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS complement(1761376..1762329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS complement(1762405..1763331) product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289263.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS complement(1763403..1763717) product multidrug efflux SMR transporter subunit YkkD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245695.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 gene ykkD CDS complement(1763718..1764056) product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706751.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS complement(1764350..1765111) product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357530.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 gene pflA CDS complement(1765181..1767427) product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357529.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 gene pflB CDS complement(1767734..1770175) product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357527.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 gene parC CDS complement(1770200..1772206) product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381887.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 gene parE CDS 1772525..1773724 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930971.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS complement(1773760..1774326) product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028429.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS complement(1774333..1774977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS complement(1775029..1775463) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205510.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS 1775589..1776173 product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861779.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS complement(1776218..1776613) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000788358.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS complement(1776847..1778391) product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378886.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS complement(1778404..1779213) product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905273.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 gene phnE CDS complement(1779229..1780041) product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131699.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 gene phnE CDS complement(1780043..1780795) product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905272.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 gene phnC CDS complement(1780875..1781915) product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905271.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS 1782237..1782551 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643453.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS 1782548..1783123 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS 1783123..1783290 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS 1783438..1784067 product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296995.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 gene plsY CDS complement(1784177..1784356) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355952.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 gene rpmF CDS complement(1784414..1784977) product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295352.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS complement(1785067..1785999) product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355760.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 gene dnaI CDS complement(1785999..1787423) product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288329.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS complement(1787441..1787905) product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381296.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 gene nrdR CDS complement(1788142..1788753) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475784.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 gene coaE CDS complement(1788759..1789598) product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355756.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 gene mutM CDS complement(1789644..1792295) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355755.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 gene polA CDS complement(1792421..1793110) product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357165.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS complement(1793097..1793579) product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296398.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS complement(1793604..1794941) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357163.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 gene murC CDS complement(1795070..1795870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289257.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS complement(1795978..1796310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS complement(1796425..1797762) product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889706.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS complement(1797828..1798478) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056290.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS complement(1798585..1799022) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393392.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS complement(1799206..1800180) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966323.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS complement(1800409..1801755) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288574.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS complement(1801874..1803223) product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379420.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 gene gdhA CDS 1803354..1804628 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288576.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS complement(1804695..1805183) product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002404288.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 gene ybaK CDS complement(1805161..1805958) product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897376.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 gene aroD CDS complement(1805989..1807167) product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288581.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS 1807388..1809541 product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288584.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS 1809649..1810443 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS 1810440..1811000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS complement(1811047..1811676) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837226.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS 1811820..1812164 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965858.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS complement(1812200..1813576) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000914611.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 gene rlmD CDS complement(1813595..1814617) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355572.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS complement(1814641..1816071) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358703.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 gene gatB CDS complement(1816071..1817540) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288475.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 gene gatA CDS complement(1817540..1817845) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355569.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 gene gatC CDS complement(1817899..1819920) product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361258.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 gene ligA CDS complement(1819935..1822193) product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002319708.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 gene pcrA CDS complement(1822370..1824211) product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288735.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 gene typA CDS complement(1824349..1825113) product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356680.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS complement(1825110..1825397) product UPF0223 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356679.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS complement(1825531..1826961) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357872.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS complement(1826961..1827683) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381953.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS complement(1827658..1828080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS 1828273..1828428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357118.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS complement(1828520..1829020) product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295450.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS complement(1829139..1829489) product DUF2200 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360043.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS complement(1829491..1829787) product DUF1905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286335.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS 1829919..1830881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS complement(1830855..1832549) product IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095092556.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS complement(1832666..1833133) product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369299.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS complement(1833247..1834269) product DUF1002 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643525.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS complement(1834375..1835580) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS 1835693..1836664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS complement(1836715..1837884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS complement(1837909..1838613) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS complement(1838751..1839857) product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901067.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 gene cobT CDS 1839977..1840765 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278967.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS complement(1840777..1842408) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932493.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS complement(1842401..1844134) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721531.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS complement(1844124..1844537) product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355126.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS complement(1844674..1845471) product DUF2785 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284391.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS complement(1845502..1845963) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722820.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS 1846312..1846776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS complement(1846809..1848017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS complement(1848164..1848580) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS complement(1848743..1849051) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS complement(1849240..1850436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS complement(1850574..1850702) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS complement(1850860..1851321) product DUF2798 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287457.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS complement(1851467..1851646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS complement(1851708..1852412) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103807.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS 1852502..1853029 product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813807.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS complement(1853902..1856070) product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102206.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS complement(1856092..1857465) product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861836.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS complement(1857428..1858909) product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861839.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS complement(1859120..1859968) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431317.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS complement(1860153..1860485) product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131392.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS complement(1860640..1861431) product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362363.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS complement(1861421..1862299) product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773830.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 gene accD CDS complement(1862320..1863678) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384028.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS complement(1863682..1864113) product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355197.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 gene fabZ CDS complement(1864124..1864588) product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379800.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 gene accB CDS complement(1864591..1865829) product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356284.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 gene fabF CDS complement(1865840..1866574) product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356283.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 gene fabG CDS complement(1866577..1867524) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356280.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 gene fabD CDS complement(1867535..1868500) product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002373895.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 gene fabK CDS complement(1868584..1868829) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356278.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS complement(1868858..1869835) product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365153.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS complement(1869857..1870297) product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362455.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS complement(1870517..1871422) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289114.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS complement(1871560..1871964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643513.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS complement(1872168..1874582) product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288046.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 gene pheT CDS complement(1874587..1875633) product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288048.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 gene pheS CDS complement(1875944..1876282) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303789.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS complement(1876371..1876871) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356666.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS complement(1876990..1877751) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002299518.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS 1877866..1878138 product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289551.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS 1878225..1879142 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304673.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 gene yidC CDS complement(1879205..1880068) product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387081.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 gene thrB CDS complement(1880084..1881364) product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359742.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS complement(1881473..1881778) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002391570.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS complement(1881815..1883533) product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706546.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS complement(1883728..1884645) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357780.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 gene trxB CDS 1884941..1886179 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003738285.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS 1886352..1887506 product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357833.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS complement(1887548..1888366) product DUF1189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009926061.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS complement(1888379..1889227) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288156.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS complement(1889229..1890530) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722384.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS complement(1890599..1891855) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724548.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS complement(1891954..1893714) product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288160.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS complement(1893728..1895392) product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641769.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS complement(1895624..1896577) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289258.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS complement(1896706..1897860) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS complement(1897941..1899722) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289169.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS complement(1899722..1901473) product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369303.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS complement(1901579..1901809) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS complement(1901903..1902799) product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357396.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS 1902945..1903574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS 1903613..1905994 product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382391.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS complement(1906041..1907042) product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357319.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 gene ccpA CDS complement(1907231..1907683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS complement(1907703..1908128) product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289575.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS 1908265..1909158 product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386626.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS complement(1909213..1909731) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358013.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS complement(1909835..1910350) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288030.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS complement(1910347..1911705) product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369622.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 gene rph CDS complement(1911722..1912528) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706575.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 gene racE CDS 1912711..1913412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS complement(1913450..1914478) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002370457.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 gene tsaD CDS complement(1914491..1914940) product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002370458.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 gene rimI CDS complement(1914937..1915464) product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387121.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 gene rimI CDS complement(1915448..1916176) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002326250.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 gene tsaB CDS complement(1916311..1916835) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807782.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS complement(1916854..1918149) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289278.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS complement(1918276..1918983) product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832343.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS complement(1919006..1920271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS complement(1920290..1921273) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293897.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 gene galE CDS complement(1921436..1922143) product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287787.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 gene nagB CDS complement(1922213..1923781) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286153.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS complement(1923867..1924007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS complement(1924082..1925923) product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287825.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 gene glmS CDS complement(1926266..1926619) product YlbG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297107.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS complement(1926609..1927037) product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356689.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS complement(1927027..1928178) product CAP-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706552.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS complement(1928209..1931637) product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288741.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS complement(1931653..1932882) product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356686.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS complement(1932888..1933193) product YlaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356684.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS complement(1933375..1933983) product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387688.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS 1934168..1934983 product DUF1189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355344.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS complement(1935010..1935297) product iron-sulfur cluster biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381169.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS complement(1935370..1936035) product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355139.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS complement(1936072..1936704) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355137.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS complement(1936697..1937776) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365182.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS complement(1937773..1938504) product cell wall-active antibiotics response protein LiaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381168.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 gene liaF CDS complement(1938749..1939198) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355133.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 gene greA CDS complement(1939374..1940669) product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289159.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 gene mltG CDS 1940903..1941241 product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357741.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS complement(1941421..1943781) product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949155.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 tRNA complement(1943957..1944030) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00560 CDS 1944128..1944949 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617037.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS 1945032..1945598 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016073.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS complement(1945627..1946139) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295813.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS complement(1946136..1948454) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109501.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 gene recJ CDS 1948619..1949494 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244194.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS complement(1949550..1950173) product cell wall hydrolase Pmp23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476383.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 gene pmp23 CDS complement(1950333..1951457) product D-alanyl-lipoteichoic acid biosynthesis protein DltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288094.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 gene dltD CDS complement(1951592..1951831) product D-alanine--poly(phosphoribitol) ligase subunit DltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356389.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 gene dltC CDS complement(1951842..1953071) product D-alanyl-lipoteichoic acid biosynthesis protein DltB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288090.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 gene dltB CDS complement(1953071..1954579) product D-alanine--poly(phosphoribitol) ligase subunit DltA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356385.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 gene dltA CDS complement(1954596..1954751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18640 tRNA complement(1954944..1955015) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00570 tRNA complement(1955021..1955095) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00580 tRNA complement(1955111..1955193) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00590 tRNA complement(1955202..1955274) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00600 tRNA complement(1955311..1955382) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00610 tRNA complement(1955397..1955488) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00620 tRNA complement(1955520..1955593) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00630 tRNA complement(1955632..1955717) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00640 tRNA complement(1955736..1955806) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00650 tRNA complement(1955813..1955884) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00660 tRNA complement(1955890..1955964) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00670 tRNA complement(1955975..1956047) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00680 tRNA complement(1956069..1956152) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00690 tRNA complement(1956161..1956233) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00700 tRNA complement(1956242..1956316) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00710 tRNA complement(1956329..1956403) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00720 tRNA complement(1956422..1956495) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00730 tRNA complement(1956502..1956575) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00740 rRNA complement(1956590..1956701) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00170 rRNA complement(1956776..1959683) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00180 tRNA complement(1959873..1959945) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00750 rRNA complement(1960031..1961585) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00190 CDS complement(1962128..1962565) product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357560.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS complement(1962667..1963584) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244491.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 gene cysK CDS complement(1963586..1964041) product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295859.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 gene lspA CDS complement(1964051..1964737) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360173.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS 1964878..1965099 product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357404.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS complement(1965100..1965537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS 1965620..1966021 product ribonuclease HI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369306.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS complement(1966018..1966677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18720 note possible pseudo, frameshifted CDS complement(1966743..1966967) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18730 note possible pseudo, frameshifted CDS complement(1967093..1967386) product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720075.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS complement(1967376..1968764) product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363118.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 gene nhaC CDS complement(1968851..1970713) product tyrosine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286400.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 gene tdc CDS complement(1970736..1972145) product tyrosine-tyramine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286392.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 gene tyrP CDS 1972820..1974088 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021122.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 gene tyrS CDS complement(1974148..1974408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS 1974546..1975949 product Ktr system potassium uptake protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385738.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS complement(1975991..1976383) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002401676.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS complement(1976383..1977288) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544125.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS complement(1977281..1978174) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966904.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS complement(1978178..1979005) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986232.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS complement(1979005..1979961) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278786.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS complement(1980048..1981604) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948862.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS 1981844..1983187 product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287244.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS 1983190..1983876 product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287245.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS 1984028..1985140 product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219742.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 gene ald CDS complement(1985195..1986160) product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379715.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 gene manA CDS complement(1986207..1987220) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287263.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS complement(1987338..1988210) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358647.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS complement(1988352..1990205) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359616.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS complement(1990202..1991920) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379719.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS complement(1991936..1992610) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287269.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS 1992761..1993747 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722416.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS 1993812..1994300 product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355457.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS complement(1994314..1994961) product TIGR01906 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287161.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS complement(1994964..1995728) product TIGR01457 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287159.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS complement(1995739..1996335) product YutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287156.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS complement(1996338..1997717) product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386634.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS 1997813..1998295 product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289775.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS complement(1998324..1999073) product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386997.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS complement(1999190..1999861) product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296327.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS complement(1999937..2000692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS complement(2000695..2001567) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002366745.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS complement(2001807..2002382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS complement(2002620..2003300) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286851.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS complement(2003411..2004397) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379155.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS complement(2004406..2005149) product KDGP aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378063.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS complement(2005152..2006255) product DgaE family pyridoxal phosphate-dependent ammonia lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288304.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS complement(2006242..2007363) product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774176.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS complement(2007378..2008463) product MupG family TIM beta-alpha barrel fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379152.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS complement(2008456..2008728) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS complement(2008777..2010063) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358780.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS complement(2010137..2010832) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364244.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS complement(2011023..2011913) product fructose bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890749.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS complement(2012074..2013408) product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304549.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS complement(2013611..2015863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS complement(2016108..2016884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19200 note possible pseudo, internal stop codon, frameshifted CDS complement(2016851..2017198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS complement(2017342..2018202) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476352.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS complement(2018360..2019862) product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379331.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS complement(2019864..2021021) product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357989.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS complement(2021496..2021921) product cell division regulator GpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295835.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 gene gpsB CDS 2022281..2022805 product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289604.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 gene recU CDS 2022802..2025072 product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360569.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS complement(2025089..2025751) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357985.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 gene nth CDS complement(2025764..2026468) product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357986.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS complement(2026591..2027220) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294095.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 gene upp CDS complement(2027300..2028538) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356623.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS complement(2028590..2029621) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356622.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS complement(2029637..2030479) product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379699.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 gene prmC CDS complement(2030472..2031542) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289676.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 gene prfA CDS complement(2031579..2032163) product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387135.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS 2032347..2032958 product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287272.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS complement(2032986..2034167) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381494.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS complement(2034180..2034530) product PTS glucitol/sorbitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294113.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS 2034690..2035718 product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287276.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS complement(2035761..2036705) product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355148.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS 2036831..2037376 product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364165.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS complement(2037409..2037786) product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107769.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS complement(2037830..2038645) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002373539.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS 2038759..2039766 product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289776.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS complement(2039838..2040383) product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286753.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS complement(2040402..2041091) product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356454.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS complement(2041113..2041301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS complement(2041312..2041860) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002325125.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS 2042064..2042771 product 5-bromo-4-chloroindolyl phosphate hydrolysis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286764.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS 2042772..2043983 product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286766.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS complement(2044022..2045149) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362328.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 gene dinB CDS complement(2045394..2046251) product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475557.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS complement(2046316..2050077) product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002416113.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 gene addA CDS complement(2050067..2053627) product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386608.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS complement(2053833..2054390) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358039.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 gene lepB CDS 2054573..2055922 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427463.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS 2056075..2058264 product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285980.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS complement(2058324..2058689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS 2058763..2059629 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357267.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS 2059629..2060192 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658049.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS 2060245..2061411 product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989624.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS complement(2061455..2062525) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983707.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS 2062682..2063980 product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016173124.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS 2064001..2066697 product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285985.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS complement(2066768..2067976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS complement(2068122..2070119) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295818.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 gene tkt CDS complement(2070226..2070468) product DUF896 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295816.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS 2070618..2071238 product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357566.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 gene lexA CDS 2071343..2071552 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297436.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS 2071788..2072972 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355211.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 CDS 2073101..2074135 product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775666.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 CDS 2074496..2075113 product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289745.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS 2075293..2076465 product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732325.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS 2076478..2077755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS 2077891..2079078 product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355284.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS 2079080..2079838 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436744.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS 2079831..2081051 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429753.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS complement(2081463..2082983) product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002302627.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS 2083227..2085014 product aminopeptidase P family N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986733.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS complement(2085076..2086035) product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289187.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS complement(2086074..2087270) product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289186.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS complement(2087438..2089036) product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286999.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS 2089279..2089800 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397309.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS complement(2089844..2091250) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382270.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 gene lpdA CDS complement(2091263..2092852) product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363856.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS complement(2092896..2093873) product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289688.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS complement(2093877..2094989) product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289692.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 gene pdhA CDS complement(2095465..2098071) product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002388982.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 gene mgtA CDS 2098463..2099095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS complement(2099146..2099379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362220.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS complement(2099477..2100655) product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460999.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS complement(2100857..2102485) product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382265.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS complement(2102506..2103357) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051830.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS complement(2103354..2104226) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051829.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS complement(2104238..2105491) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254464.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS complement(2105617..2106642) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582593.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS 2106779..2107327 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279620.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS 2107453..2108367 product DUF5692 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948196.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS complement(2108412..2108897) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381091.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS 2109053..2109691 product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294164.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS complement(2109743..2110060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS complement(2110279..2110779) product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287154.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 gene tadA CDS 2110889..2111737 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383772.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS complement(2111734..2112435) product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383773.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS 2112702..2114204 product M protein trans-acting positive regulator PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140224321.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS 2114215..2115387 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722298.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS complement(2115437..2118973) product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714077.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 gene nifJ CDS complement(2119064..2119510) product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356612.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS complement(2119679..2119963) product glycine cleavage system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359677.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS complement(2119979..2120338) product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359675.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS 2120489..2121142 product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954654.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS complement(2121188..2122384) product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002291183.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS complement(2122452..2122865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS complement(2122879..2123682) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357438.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS complement(2123694..2124626) product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295809.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 gene rnz CDS complement(2124784..2125728) product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356954.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS complement(2125715..2126572) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364373.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS complement(2126572..2127360) product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360005.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS 2127657..2129375 product IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095092556.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS complement(2129334..2130647) product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002306800.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 gene obgE CDS complement(2130848..2131939) product DUF871 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360357.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS 2132098..2132859 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002374887.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS complement(2132889..2133914) product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989632.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS 2134081..2134332 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS 2134325..2135677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS 2135704..2136648 product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262028.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 gene mvk CDS 2136648..2137646 product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921869.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 gene mvaD CDS 2137660..2138769 product phosphomevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355777.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS 2138772..2139818 product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399734.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 gene fni CDS complement(2139860..2140066) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974619.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS complement(2140081..2140545) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS complement(2140558..2140782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS complement(2140913..2141242) product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321527.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS complement(2141239..2142423) product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002394037.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS complement(2142491..2143225) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836605.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS complement(2143228..2143596) product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721994.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 gene rsfS CDS complement(2143597..2144181) product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287635.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 gene yqeK CDS complement(2144171..2144827) product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365150.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS complement(2144843..2145154) product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356298.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 gene yhbY CDS complement(2145170..2146279) product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287628.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 gene yqeH CDS complement(2146272..2146802) product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356296.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS complement(2146935..2147612) product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000289136.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS 2147762..2148772 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161236.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 gene gap CDS complement(2148891..2150144) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288007.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 gene purD CDS complement(2150158..2151699) product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288009.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 gene purH CDS complement(2151696..2152271) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369276.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 gene purN CDS complement(2152268..2153314) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288011.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 gene purM CDS complement(2153327..2154739) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288013.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 gene purF CDS complement(2154724..2156946) product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288015.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 gene purL CDS complement(2156949..2157626) product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002302316.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 gene purQ CDS complement(2157628..2157879) product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357271.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 gene purS CDS complement(2157883..2158596) product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288021.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS complement(2158850..2160019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS complement(2160020..2161138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS complement(2161116..2161796) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831756.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS complement(2161816..2162826) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS complement(2163065..2164357) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359782.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 gene purB CDS complement(2164371..2165492) product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288025.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 gene purK CDS complement(2165485..2165970) product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722253.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 gene purE CDS complement(2166058..2167452) product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968422.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 gene gntK CDS complement(2167579..2167926) product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965797.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS complement(2167919..2168281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS complement(2168283..2169257) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002388090.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS complement(2169387..2172431) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836506.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS complement(2172680..2174704) product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836512.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 CDS 2174978..2176243 product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836513.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 gene hutI CDS complement(2176291..2177169) product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640443.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS complement(2177251..2177715) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS complement(2177728..2178612) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293644.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS complement(2178630..2179928) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002366882.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 gene hisS CDS complement(2180053..2181603) product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032916282.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 gene hutH CDS complement(2181724..2183064) product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898305.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS complement(2183269..2183856) product HutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836508.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS complement(2183872..2185548) product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836509.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS complement(2185592..2186218) product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836510.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS complement(2186234..2187133) product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922735.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 gene ftcD CDS 2187780..2189165 product methylaspartate mutase accessory protein GlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015877.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 gene glmL CDS complement(2189237..2190568) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362058.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS complement(2190686..2191402) product trehalose operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294254.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 gene treR CDS complement(2191505..2194087) product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025189781.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS 2194338..2196296 product PTS system trehalose-specific EIIBC component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297133.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 gene treP CDS complement(2196349..2198571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS 2198908..2200305 product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371462.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 gene pepV CDS 2200428..2202368 product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861201.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS 2202349..2202708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566913.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS 2202848..2203507 product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642580.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS complement(2203573..2204109) product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924525.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS complement(2204185..2205165) product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358973.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS complement(2205264..2205917) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288036.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS complement(2205936..2206580) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288038.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS complement(2206595..2207401) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288041.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS complement(2207413..2208144) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288042.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS complement(2208343..2210157) product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680980.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS complement(2210282..2211268) product choloylglycine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643511.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS 2211632..2213131 product ABC-F type ribosomal protection-like protein Eat(A) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296175.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 gene eat(A) CDS complement(2213179..2215416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS complement(2215619..2216332) product amino acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702044.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS complement(2216338..2217591) product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475459.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS complement(2217614..2219449) product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703387.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 gene asnB CDS complement(2219593..2221098) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943962.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS complement(2221098..2221772) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459569.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS 2221864..2222247 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS 2222352..2223473 product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128039.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS complement(2223520..2225748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS complement(2225826..2227325) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989469.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 CDS complement(2227337..2228920) product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296509.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS complement(2228910..2229665) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287741.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS complement(2229808..2230956) product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921836.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS 2231101..2231457 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016728.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS complement(2231509..2233302) product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986569.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS complement(2233454..2234026) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358306.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS complement(2234085..2234558) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966218.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS complement(2234697..2236085) product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897684.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 gene selA CDS complement(2236085..2237248) product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681891.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS complement(2237260..2239152) product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454786.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 gene selB CDS complement(2239158..2239418) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS complement(2239430..2240029) product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681889.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 gene yedF CDS complement(2240046..2241068) product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462047.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 gene selD CDS complement(2241200..2242072) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048169.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS complement(2242092..2243108) product proline racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422090.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS complement(2243139..2243609) product glycine/sarcosine/betaine reductase component B subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422094.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS complement(2243640..2244380) product proline reductase cluster protein PrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428092.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 gene prdD CDS complement(2244422..2245147) product D-proline reductase (dithiol) protein PrdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861888.1 transl_table 11 codon_start 1 transl_except (pos:2244695..2244697,aa:Sec) note codon on position 151 is selenocysteine opal codon. locus_tag LOCUS_21230 gene prdB CDS complement(2245151..2245444) product CBO2463/CBO2479 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422102.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS complement(2245464..2247362) product D-proline reductase (dithiol) proprotein PrdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422104.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 gene prdA CDS complement(2247525..2248697) product proline reductase-associated electron transfer protein PrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431873.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 gene prdC CDS complement(2248996..2249745) product putative 2-hydroxyacyl-CoA dehydratase activator YjiL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602675.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 gene yjiL CDS complement(2249749..2250912) product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298064.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS complement(2251165..2252610) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004450718.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 gene proS tRNA complement(2252868..2252961) product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00760 CDS complement(2253094..2254593) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387242.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS complement(2254607..2256289) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356857.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS complement(2256309..2256935) product DUF624 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362905.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS complement(2257069..2258532) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002995654.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS complement(2258557..2259480) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359877.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS complement(2259495..2260436) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389270.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS complement(2260633..2261856) product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948582.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS complement(2261948..2263462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS complement(2263493..2264062) product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682263.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS 2264290..2264925 product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007478804.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS complement(2264966..2265142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS complement(2265230..2266177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS complement(2266340..2267320) product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358614.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS complement(2267343..2268221) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382920.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS complement(2268224..2269033) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358617.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS 2269406..2270062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS 2270062..2270784 product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132595.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS 2270784..2271497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS complement(2271543..2272832) product DUF438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906058.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS complement(2272835..2273062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS complement(2273197..2274084) product GRP family sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378904.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS complement(2274110..2274505) product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359153.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 gene rbsD CDS complement(2274522..2275427) product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014525052.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 gene rbsK CDS 2275639..2276541 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128974497.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS 2276525..2277220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS 2277220..2277951 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS complement(2278003..2279280) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082232609.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS complement(2279277..2279951) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651982.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS complement(2279964..2280956) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298484.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS complement(2281052..2283151) product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095443517.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 CDS complement(2283141..2284142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS complement(2284148..2285083) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989474.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 CDS 2285243..2287393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS complement(2287438..2288049) product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385242.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 CDS 2288482..2289492 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288045.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 gene trpS CDS 2289544..2291457 product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286747.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS complement(2291510..2292841) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254535.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS complement(2292834..2293529) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550031.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 CDS complement(2293681..2295159) product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243023.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 gene dbpA CDS complement(2295276..2296265) product Rgg/GadR/MutR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568246.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS 2296361..2297617 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101066.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 CDS complement(2297662..2299494) product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288735.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 gene typA CDS complement(2299695..2300486) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256055.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS complement(2300489..2301448) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081632.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS complement(2301591..2315150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS complement(2315564..2316343) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390209.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS complement(2316486..2317046) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS complement(2317046..2318452) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS complement(2318534..2322952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS complement(2322963..2323688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS complement(2323705..2324568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS complement(2324655..2325377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS complement(2325413..2326804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS complement(2326895..2327701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS complement(2328130..2328900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS complement(2329057..2329434) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665817.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS complement(2329582..2330400) product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924506.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 gene rhaD CDS complement(2330410..2331564) product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288246.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 gene fucO CDS complement(2331571..2333238) product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229500.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 gene araB CDS complement(2333361..2335145) product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779363.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 gene fucI CDS complement(2335181..2336278) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582802.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS complement(2336290..2337303) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582801.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS complement(2337303..2338805) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582800.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 gene gguA CDS complement(2338823..2339251) product RbsD/FucU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912113.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS complement(2339264..2340721) product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388551.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS complement(2340740..2341426) product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948893.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS 2341582..2342346 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588546.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS complement(2342408..2343235) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362487.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 gene thiD CDS complement(2343225..2343881) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714091.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 gene thiE CDS complement(2343878..2344720) product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674046.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS complement(2344686..2345240) product energy coupling factor transporter S component ThiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563188.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 gene thiW CDS complement(2345221..2345907) product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255229.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 gene tenA CDS complement(2345919..2346575) product CbiQ family ECF transporter T component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362491.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS complement(2346547..2347938) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365067.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS complement(2347935..2348501) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387204.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS 2349097..2350536 product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321387.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 CDS complement(2350583..2350903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS complement(2350917..2351816) product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622462.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS complement(2351833..2352999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS complement(2353141..2354061) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765521.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS complement(2354198..2355148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS complement(2355298..2355954) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS complement(2356031..2356690) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865977.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS complement(2356733..2357776) product transmembrane protein ElrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387174.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 gene elrE CDS complement(2357848..2358507) product WxL domain-containing protein ElrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362542.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 gene elrD CDS complement(2358514..2358855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS complement(2358865..2361435) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS 2361822..2362616 product multidrug efflux transcriptional regulator BmrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230325.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 gene bmrR CDS complement(2362655..2363464) product multidrug efflux transcriptional regulator BmrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230325.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 gene bmrR CDS complement(2363589..2365160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22190 CDS complement(2365294..2365992) product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296656.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS 2366131..2367873 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387172.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 CDS complement(2367923..2368477) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836545.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS complement(2368478..2369227) product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836544.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 gene cobS CDS complement(2369224..2369820) product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836543.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 gene cobU CDS complement(2369836..2370576) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924995.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 CDS complement(2370566..2371876) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398699.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 gene hemL CDS complement(2371883..2372857) product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732575.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 gene hemB CDS complement(2372859..2373575) product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931590.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS complement(2373523..2374500) product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886587.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 gene hemC CDS complement(2374490..2375776) product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836538.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 gene hemA CDS complement(2375790..2376224) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009659744.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS complement(2376193..2376798) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836537.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS complement(2376800..2378299) product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836536.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS complement(2378304..2379107) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989706.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS complement(2379122..2379802) product energy-coupling factor ABC transporter transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157634.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 CDS complement(2379789..2380085) product energy-coupling factor ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721603.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 CDS complement(2380082..2380816) product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901131.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS complement(2380831..2381535) product cobalt-factor II C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836533.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS complement(2381536..2382312) product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721600.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS complement(2382312..2383739) product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836532.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 gene cobA CDS complement(2383736..2384485) product precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896460.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 gene cobK CDS complement(2384482..2385207) product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896461.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 gene cobJ CDS complement(2385212..2386252) product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721596.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 gene cbiG CDS complement(2386252..2387010) product cobalt-precorrin-4 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896463.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS complement(2387011..2387568) product decarboxylating cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721594.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS complement(2387558..2388166) product cobalt-precorrin-7 (C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721593.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS complement(2388163..2389287) product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836528.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 gene cbiD CDS complement(2389290..2389937) product cobalt-precorrin-8 methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721591.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS complement(2389965..2390921) product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898268.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 gene cbiB CDS complement(2390921..2392291) product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989704.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS complement(2392293..2393171) product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896400.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS complement(2393152..2394234) product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009926914.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 gene cobD CDS complement(2394238..2394753) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009934281.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS complement(2395194..2395655) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS complement(2395680..2396510) product ethanolamine utilization protein EutJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989696.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 gene eutJ CDS complement(2396531..2396986) product ethanolamine utilization protein EutQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357522.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 CDS complement(2396986..2398095) product ethanolamine utilization protein EutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721584.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 gene eutH CDS complement(2398141..2398413) product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721582.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS complement(2398416..2399021) product TIGR02536 family ethanolamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931342.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS complement(2399014..2399667) product ethanolamine utilization phosphate acetyltransferase EutD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721580.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 gene eutD CDS complement(2399704..2400381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS complement(2400430..2400708) product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003719393.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS complement(2400767..2402263) product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721578.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 CDS complement(2402277..2402729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS complement(2402763..2403419) product ethanolamine utilization microcompartment protein EutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009659835.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 gene eutL CDS complement(2403446..2404357) product ethanolamine ammonia-lyase subunit EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363986.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 gene eutC CDS complement(2404376..2405743) product ethanolamine ammonia-lyase subunit EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002903902.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 CDS complement(2405805..2407238) product ethanolamine ammonia-lyase reactivating factor EutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989701.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 gene eutA CDS complement(2407354..2408769) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721572.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS complement(2408762..2409334) product ANTAR domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724712.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS complement(2409378..2409722) product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898216.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS complement(2409800..2410912) product 1-propanol dehydrogenase PduQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989700.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS complement(2411377..2411940) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836563.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS complement(2411940..2412383) product EutP/PduV family microcompartment system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836561.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS complement(2412409..2412753) product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002345864.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS complement(2412778..2413893) product NADH-dependent flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292552.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS 2414182..2415534 product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989691.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS 2415537..2416091 product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933856.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS complement(2416214..2418349) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338082.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS complement(2418352..2419680) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272228.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS complement(2419670..2421949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS complement(2422096..2423253) product glycine/sarcosine/betaine reductase complex component C subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430750.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 gene grdD CDS complement(2423265..2424803) product glycine/sarcosine/betaine reductase complex component C subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897537.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 gene grdC CDS complement(2424873..2425343) product glycine/sarcosine/betaine reductase complex selenoprotein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986236.1 transl_table 11 codon_start 1 transl_except (pos:2425212..2425214,aa:Sec) note codon on position 44 is selenocysteine opal codon. locus_tag LOCUS_22840 gene grdA CDS complement(2425378..2425701) product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416870.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS complement(2425716..2426681) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416869.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 gene trxB CDS complement(2426714..2428015) product glycine reductase complex selenoprotein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861534.1 transl_table 11 codon_start 1 transl_except (pos:2426972..2426974,aa:Sec) note codon on position 348 is selenocysteine opal codon. locus_tag LOCUS_22870 gene grdB CDS complement(2428044..2428514) product glycine/sarcosine/betaine reductase complex selenoprotein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986236.1 transl_table 11 codon_start 1 transl_except (pos:2428383..2428385,aa:Sec) note codon on position 44 is selenocysteine opal codon. locus_tag LOCUS_22880 gene grdA CDS complement(2428550..2429836) product glycine/sarcosine/betaine reductase component B subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416871.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS complement(2429937..2430317) product GrdX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897539.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS complement(2430765..2431700) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033940.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 CDS complement(2431822..2432508) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287133.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS complement(2432534..2433271) product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294728.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 gene truA CDS 2433689..2433856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS complement(2433899..2434375) product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428667.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 CDS complement(2435722..2437314) product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377961.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS 2437541..2438011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS 2438179..2438469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22980 note possible pseudo, frameshifted CDS 2438511..2439308 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22990 note possible pseudo, frameshifted CDS complement(2439378..2439668) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS complement(2439901..2441070) product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104859673.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS complement(2441174..2441788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS complement(2441975..2442421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS complement(2442912..2443820) product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002380928.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS complement(2443810..2444313) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017723.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS complement(2444431..2445147) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287641.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS complement(2445271..2445981) product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222169.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 gene rluF CDS complement(2446080..2446520) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021829.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS complement(2446553..2446735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS 2446927..2447775 product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964372.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 gene rocF CDS complement(2447824..2450157) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705665.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS 2450336..2451586 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813994.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS 2451613..2452821 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732150.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS 2452960..2453955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23140 CDS complement(2454014..2454829) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS 2454930..2455055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS 2455121..2455435 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23170 CDS complement(2455459..2455797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS complement(2455971..2459150) product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287735.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS 2459485..2460027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS complement(2459985..2460905) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476040.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS complement(2460987..2462201) product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905481.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS complement(2462194..2463786) product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819001.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS 2463975..2464829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23240 note possible pseudo, internal stop codon CDS 2464932..2465411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS 2465475..2466812 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294399.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS complement(2466864..2467517) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963740.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS complement(2467523..2468428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS 2468511..2468978 product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837431.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS complement(2468991..2469905) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS complement(2469975..2470361) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877650.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS 2470487..2471419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS 2471555..2473303 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582658.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 CDS 2473323..2474075 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358617.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 CDS complement(2474122..2474811) product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124727.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 gene trpA CDS complement(2474812..2476092) product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222248.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS complement(2476124..2476399) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435756.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 CDS complement(2476413..2478434) product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986653.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 CDS complement(2478661..2481336) product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294372.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS 2481919..2482968 product PTS transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200684.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 CDS 2482993..2483988 product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702981.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 CDS complement(2483974..2484576) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167797511.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS complement(2484622..2485659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23430 note possible pseudo, internal stop codon CDS complement(2485860..2486876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23440 CDS complement(2486981..2488189) product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003597374.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 CDS complement(2488194..2489351) product YhfX family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674095.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS complement(2489353..2489703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS complement(2489715..2490635) product GntR family transcriptional regulator YhfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005177131.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 gene yhfZ CDS complement(2490646..2491743) product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674094.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS complement(2491749..2492630) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003597368.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS complement(2492649..2493965) product YhfT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573503.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS complement(2493991..2494353) product DUF2620 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573501.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS complement(2494618..2495349) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931165.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS complement(2495462..2495941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23540 CDS complement(2495943..2496740) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435784.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 CDS complement(2496828..2497415) product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130597.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 CDS complement(2497439..2498326) product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704270.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS complement(2498392..2499762) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037254.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS complement(2499755..2500405) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865972.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS complement(2500418..2501269) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130766.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS complement(2501407..2502051) product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873297.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 gene fsa CDS complement(2502276..2503244) product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206433.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS complement(2503273..2504823) product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259464.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS complement(2504840..2506018) product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259064.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS complement(2506031..2508334) product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486377.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS complement(2508343..2509629) product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944264.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 CDS complement(2509650..2510432) product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903503.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS complement(2510457..2511215) product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183923.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS 2511464..2512081 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23690 CDS complement(2512116..2513516) product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021359802.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 CDS complement(2513529..2515448) product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861834.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS complement(2515588..2516445) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261394.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 CDS complement(2516470..2517015) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427638.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 CDS 2517275..2518561 product D-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658347.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 gene dsdA CDS 2518581..2519912 product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901885.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS 2519934..2520311 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379711.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 CDS complement(2520507..2521676) product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104859673.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 CDS complement(2522113..2523966) product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931606.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS complement(2524012..2525307) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724230.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 CDS complement(2525310..2525600) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722919.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 CDS complement(2525613..2527007) product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989407.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 CDS complement(2527000..2527329) product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724232.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS complement(2527514..2528686) product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387505.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 gene deoB CDS complement(2528703..2529470) product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182060.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 gene udp CDS complement(2529495..2530853) product tetracycline efflux MFS transporter Tet(K) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000492283.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 gene tet(K) CDS complement(2531006..2531734) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125581.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS complement(2531805..2532236) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367049.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS complement(2532237..2533013) product aminoglycoside nucleotidyltransferase ANT(9)-Ia inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067268.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 gene ant(9) CDS complement(2533029..2533466) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102671.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS complement(2533545..2534306) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383586.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS 2534435..2536183 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359874.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS 2536167..2537945 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002374418.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS complement(2537996..2538367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS complement(2538372..2538809) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172426.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS complement(2538827..2539516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23950 CDS complement(2539628..2540152) product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948551.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS complement(2540172..2541509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS complement(2541543..2542037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS complement(2542176..2543711) product mannonate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095164.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS complement(2544116..2545837) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358584.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS complement(2545821..2547575) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358583.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 CDS 2547742..2548713 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122904.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS complement(2548710..2549255) product cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258897.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 CDS complement(2549329..2549643) product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002474345.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS complement(2549645..2549974) product quaternary ammonium compound efflux SMR transporter SugE1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003736027.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 gene sugE1 CDS complement(2550131..2550868) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861599.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 CDS complement(2550872..2552122) product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897756.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 CDS complement(2552125..2552406) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454867.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 CDS complement(2552421..2552846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24090 CDS complement(2552847..2554490) product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439865.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 CDS 2554839..2555726 product fructose bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890749.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 CDS complement(2555817..2556986) product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104859673.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 CDS complement(2557166..2558383) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379298.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS complement(2558380..2559633) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025189831.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 CDS complement(2559799..2561796) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295818.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 gene tkt CDS complement(2561815..2562582) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989434.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 CDS complement(2562584..2563369) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989434.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS complement(2563372..2563746) product PTS glucitol/sorbitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430855.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 CDS complement(2563763..2564728) product 2-keto-3-deoxygluconate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395562.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS complement(2564747..2566087) product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047749.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS complement(2566100..2567101) product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047748.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 gene pdxA CDS complement(2567117..2567761) product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873297.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 gene fsa CDS complement(2567764..2568219) product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389089.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 gene rpiB CDS 2568386..2569144 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723203.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS complement(2569264..2569815) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225731.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS 2569935..2571005 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296464.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS 2571017..2571721 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906419.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS 2571836..2572945 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355728.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 gene alr CDS 2573190..2573582 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262616.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS 2573604..2573915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24300 CDS complement(2573961..2574476) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964865.1 transl_table 11 codon_start 1 locus_tag LOCUS_24310 CDS complement(2574569..2575000) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721525.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 CDS complement(2575173..2575643) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379268.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 CDS 2575721..2576677 product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385468.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 CDS 2576808..2578520 product IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095092556.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 CDS complement(2578463..2579302) product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071679.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 CDS 2579420..2579764 product DUF6176 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027779.1 transl_table 11 codon_start 1 locus_tag LOCUS_24370 CDS 2579865..2580857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24380 CDS 2580989..2581411 product PTS mannose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354802.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 CDS 2581424..2581921 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354800.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 CDS 2581939..2582751 product PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365419.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 CDS 2582748..2583575 product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354796.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 CDS 2583754..2586282 product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819093.1 transl_table 11 codon_start 1 locus_tag LOCUS_24430 CDS complement(2586330..2587487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24440 CDS complement(2587516..2588802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS 2589028..2589450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24460 CDS 2589571..2589750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24470 CDS 2590381..2591649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24480 CDS complement(2591722..2596341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24490 CDS complement(2596701..2597105) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905884.1 transl_table 11 codon_start 1 locus_tag LOCUS_24500 CDS complement(2597201..2598136) product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100868.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 CDS 2598217..2598852 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100869.1 transl_table 11 codon_start 1 locus_tag LOCUS_24520 CDS complement(2598912..2599112) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288762.1 transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS complement(2599309..2601504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24540 CDS complement(2601530..2602765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24550 CDS complement(2603148..2604020) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544219.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 CDS complement(2604317..2606236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24570 CDS complement(2606524..2607354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24580 CDS 2607616..2608320 product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399975.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 CDS complement(2608574..2608831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24600 CDS 2608869..2609624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24610 CDS complement(2609656..2610390) product accessory regulator AgrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126792602.1 transl_table 11 codon_start 1 locus_tag LOCUS_24620 CDS complement(2610362..2611075) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378341.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS complement(2611084..2611842) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819358.1 transl_table 11 codon_start 1 locus_tag LOCUS_24640 CDS complement(2611814..2612764) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379390.1 transl_table 11 codon_start 1 locus_tag LOCUS_24650 CDS complement(2612787..2613659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382253.1 transl_table 11 codon_start 1 locus_tag LOCUS_24660 CDS complement(2613623..2614756) product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379387.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS 2615137..2615925 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24680 note possible pseudo, frameshifted CDS complement(2616153..2616401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24690 CDS complement(2616448..2616927) product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355021.1 transl_table 11 codon_start 1 locus_tag LOCUS_24700 gene rlmH CDS 2617258..2618619 product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290101.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 CDS complement(2618675..2619478) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288854.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS complement(2619535..2620365) product two-component system regulatory protein YycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365516.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 CDS complement(2620369..2621658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385989.1 transl_table 11 codon_start 1 locus_tag LOCUS_24740 CDS complement(2621655..2623481) product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379340.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 gene walK CDS complement(2623496..2624200) product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722907.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 gene yycF CDS complement(2624728..2625378) product diphthine--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002372215.1 transl_table 11 codon_start 1 locus_tag LOCUS_24770 CDS complement(2625752..2625889) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS complement(2625865..2626122) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24790 CDS complement(2626401..2626568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24800 CDS complement(2626592..2626987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS 2627105..2627254 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321680.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS 2627659..2627943 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS 2628309..2628848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24840 CDS 2628896..2629402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24850 note possible pseudo, frameshifted CDS 2629390..2630049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24860 note possible pseudo, frameshifted tRNA complement(2630149..2630221) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00770 CDS complement(2630267..2630857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24870 CDS complement(2631002..2631403) product YxeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101730.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS complement(2631508..2631633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24890 CDS complement(2631644..2633794) product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399646.1 transl_table 11 codon_start 1 locus_tag LOCUS_24900 gene feoB CDS complement(2633794..2634270) product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287797.1 transl_table 11 codon_start 1 locus_tag LOCUS_24910 CDS 2634631..2634864 product redoxin NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355360.1 transl_table 11 codon_start 1 locus_tag LOCUS_24920 CDS 2634866..2635249 product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355359.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 gene nrdI CDS 2635230..2637392 product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355358.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 gene nrdE CDS 2637411..2638373 product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287792.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 gene nrdF CDS complement(2638383..2638895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24960 CDS complement(2638973..2639653) product adaptor protein MecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356478.1 transl_table 11 codon_start 1 locus_tag LOCUS_24970 CDS complement(2639812..2640210) product transcriptional regulator SpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296384.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 gene spxA CDS 2640575..2641585 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378619.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 gene trpS CDS 2641648..2642217 product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721539.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 CDS complement(2642260..2642892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25010 CDS complement(2642889..2643800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25020 CDS complement(2643901..2644908) product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356394.1 transl_table 11 codon_start 1 locus_tag LOCUS_25030 CDS complement(2644923..2645660) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356393.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 CDS 2645915..2646994 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286061.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 CDS 2646999..2647679 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286060.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 CDS 2647744..2648340 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286057.1 transl_table 11 codon_start 1 locus_tag LOCUS_25070 CDS complement(2648393..2650945) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS complement(2651153..2652238) product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288096.1 transl_table 11 codon_start 1 locus_tag LOCUS_25090 CDS complement(2652289..2654871) product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387314.1 transl_table 11 codon_start 1 locus_tag LOCUS_25100 CDS complement(2655006..2657072) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288087.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS complement(2657059..2657826) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356382.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 CDS complement(2657971..2658462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25130 CDS 2658657..2659328 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358841.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS 2659335..2660375 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379189.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 CDS complement(2660544..2660873) product quaternary ammonium compound efflux SMR transporter QacH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010730188.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 gene qacH CDS 2661003..2662022 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25170 CDS complement(2662048..2663664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25180 CDS complement(2663823..2665451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25190 CDS complement(2665598..2666176) product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288081.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 gene nrdG CDS complement(2666252..2668444) product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288083.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 gene nrdD CDS complement(2668682..2669476) product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774239.1 transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS complement(2669558..2670394) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387408.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS complement(2670401..2671063) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354825.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS complement(2671060..2671794) product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354824.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 CDS complement(2671787..2672818) product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594521.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 CDS complement(2673069..2673506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680353.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 CDS complement(2673641..2674000) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355799.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 gene rplT CDS complement(2674069..2674269) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355798.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 gene rpmI CDS complement(2674294..2674815) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355797.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 gene infC CDS 2675099..2675752 product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294161.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 CDS complement(2675791..2676987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25320 CDS complement(2676965..2677414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS 2677662..2678456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706768.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 CDS complement(2678557..2681697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25350 CDS complement(2681920..2682912) product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722647.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 gene dhaK CDS complement(2683065..2684201) product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948659.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 CDS complement(2684226..2684594) product dihydroxyacetone kinase phosphoryl donor subunit DhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704317.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 gene dhaM CDS complement(2684597..2685175) product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027842.1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 gene dhaL CDS complement(2685190..2686176) product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027841.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 gene dhaK CDS 2686266..2686889 product dihydroxyacetone kinase transcriptional activator DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204220.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 gene dhaS CDS complement(2686931..2689657) product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296556.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 CDS complement(2689670..2690143) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641234.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 CDS complement(2690375..2691568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS complement(2691580..2692467) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641901.1 transl_table 11 codon_start 1 locus_tag LOCUS_25450 CDS complement(2692471..2692848) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548044.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 CDS 2693114..2693677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25470 CDS complement(2693728..2695251) product SpaH/EbpB family LPXTG-anchored major pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286774.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 CDS complement(2695244..2696299) product pilin N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286776.1 transl_table 11 codon_start 1 locus_tag LOCUS_25490 CDS complement(2696300..2699800) product MucBP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989917.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 CDS 2700328..2701806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25510 CDS complement(2701884..2704016) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378800.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 gene pnp CDS complement(2704187..2704456) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289282.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 gene rpsO CDS 2704701..2705270 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289284.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 gene def CDS complement(2705310..2706086) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361040.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 CDS 2706307..2708544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25560 CDS complement(2708622..2709413) product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774245.1 transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS 2709769..2710380 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294265.1 transl_table 11 codon_start 1 locus_tag LOCUS_25580 gene rpsD CDS complement(2710696..2711940) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357698.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 CDS complement(2711933..2712835) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357699.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 CDS complement(2712847..2713536) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25610 CDS complement(2713520..2713849) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948327.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 CDS complement(2714019..2715224) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360017.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 CDS complement(2715327..2715623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25640 CDS complement(2715692..2717476) product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296457.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 gene uvrC CDS complement(2717572..2717883) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357703.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 gene trxA CDS complement(2717968..2720340) product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382291.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 CDS complement(2720455..2721003) product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295088.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 CDS complement(2721027..2721482) product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295087.1 transl_table 11 codon_start 1 locus_tag LOCUS_25690 gene zapA CDS 2721669..2722598 product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386662.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 gene rnhC CDS 2722683..2723009 product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357933.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS complement(2723052..2723462) product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296503.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 gene ruvX CDS complement(2723471..2723737) product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290885.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 CDS complement(2723826..2724455) product DUF4479 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361057.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 CDS complement(2724521..2724976) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385249.1 transl_table 11 codon_start 1 locus_tag LOCUS_25750 CDS complement(2724992..2725303) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355015.1 transl_table 11 codon_start 1 locus_tag LOCUS_25760 CDS complement(2725312..2726388) product glutamyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355013.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 gene pepA CDS 2726554..2726907 product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399791.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 CDS 2727077..2727715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25790 CDS complement(2727783..2728454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25800 CDS complement(2728989..2729480) product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002393496.1 transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS 2729593..2730039 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289110.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 CDS complement(2730295..2730612) product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355464.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 CDS 2730678..2731259 product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002394583.1 transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS complement(2731256..2731909) product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286189.1 transl_table 11 codon_start 1 locus_tag LOCUS_25850 gene trmB CDS complement(2731998..2732777) product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286194.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 CDS complement(2732880..2734106) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371475.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 CDS complement(2734109..2734843) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363160.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 CDS 2734981..2735403 product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355527.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 CDS 2735405..2735773 product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286203.1 transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS 2735945..2736949 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371473.1 transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS complement(2736997..2737470) product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387365.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 CDS complement(2737531..2737791) product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356060.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS complement(2737947..2738528) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356059.1 transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS complement(2738636..2739154) product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356058.1 transl_table 11 codon_start 1 locus_tag LOCUS_25950 CDS complement(2739172..2739945) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287441.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 gene rlmB CDS complement(2739935..2740342) product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356056.1 transl_table 11 codon_start 1 locus_tag LOCUS_25970 CDS complement(2740342..2741748) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287445.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 gene cysS CDS complement(2741762..2742277) product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356054.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 gene cysE CDS complement(2742548..2744011) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706819.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 gene gltX CDS complement(2744119..2745216) product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368622.1 transl_table 11 codon_start 1 locus_tag LOCUS_26010 CDS complement(2745235..2746605) product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361473.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 gene radA CDS complement(2746734..2747261) product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287450.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 CDS complement(2747441..2749408) product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321207.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 CDS complement(2749663..2750106) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775651.1 transl_table 11 codon_start 1 locus_tag LOCUS_26050 CDS complement(2750222..2750617) product YjdF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886487.1 transl_table 11 codon_start 1 locus_tag LOCUS_26060 CDS 2750890..2753499 product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361467.1 transl_table 11 codon_start 1 locus_tag LOCUS_26070 CDS complement(2753547..2754392) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723815.1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS complement(2754477..2755946) product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931832.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 CDS complement(2755992..2757851) product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102197.1 transl_table 11 codon_start 1 locus_tag LOCUS_26100 CDS complement(2757980..2758834) product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948570.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 CDS complement(2758978..2759796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26120 CDS complement(2759925..2760386) product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354782.1 transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS complement(2760458..2761168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26140 CDS complement(2761377..2761559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26150 CDS complement(2762035..2765685) product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354777.1 transl_table 11 codon_start 1 locus_tag LOCUS_26160 gene rpoC CDS complement(2765740..2769315) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389470.1 transl_table 11 codon_start 1 locus_tag LOCUS_26170 gene rpoB CDS complement(2770407..2771006) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387500.1 transl_table 11 codon_start 1 locus_tag LOCUS_26180 CDS complement(2771017..2771571) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356161.1 transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS 2771663..2772211 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385758.1 transl_table 11 codon_start 1 locus_tag LOCUS_26200 CDS 2772214..2773137 product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356160.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 gene coaA CDS 2773166..2774722 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356158.1 transl_table 11 codon_start 1 locus_tag LOCUS_26220 gene guaA CDS complement(2774817..2775020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26230 note possible pseudo, internal stop codon, frameshifted CDS complement(2775423..2775794) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26240 CDS complement(2775910..2776137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26250 CDS complement(2776134..2777216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26260 CDS complement(2777307..2777498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26270 CDS complement(2777898..2778878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064475.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 CDS complement(2779545..2780264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26290 CDS complement(2780269..2780739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26300 CDS complement(2780714..2782459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26310 CDS complement(2782462..2783460) product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814808.1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 CDS complement(2784054..2785790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26330 CDS complement(2785777..2788962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26340 CDS complement(2789041..2789313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS 2789453..2789695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26360 CDS complement(2790072..2790254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26370 CDS complement(2790330..2790899) product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082850.1 transl_table 11 codon_start 1 locus_tag LOCUS_26380 CDS complement(2790884..2791816) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047813471.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 CDS complement(2791907..2792836) product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949098.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 CDS complement(2792946..2793848) product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357252.1 transl_table 11 codon_start 1 locus_tag LOCUS_26410 gene ptb CDS complement(2793835..2794965) product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420702.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 gene buk CDS complement(2794993..2796024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26430 CDS complement(2796055..2797284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26440 CDS 2797560..2798195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26450 CDS complement(2798403..2801789) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26460 CDS complement(2801940..2802515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26470 CDS complement(2802575..2803579) product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674917.1 transl_table 11 codon_start 1 locus_tag LOCUS_26480 CDS complement(2803802..2804896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26490 CDS complement(2805019..2805150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26500 CDS 2805226..2805675 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172426.1 transl_table 11 codon_start 1 locus_tag LOCUS_26510 CDS 2805752..2806216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355960.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 CDS complement(2806258..2806797) product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009910909.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 CDS complement(2806813..2807343) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000464126.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 CDS complement(2807356..2807952) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948348.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 CDS 2808146..2808286 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521645.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 CDS 2808472..2809602 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111696510.1 transl_table 11 codon_start 1 locus_tag LOCUS_26570 CDS 2809707..2810303 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289673.1 transl_table 11 codon_start 1 locus_tag LOCUS_26580 CDS complement(2810364..2811245) product PhzF family phenazine biosynthesis isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000849352.1 transl_table 11 codon_start 1 locus_tag LOCUS_26590 CDS complement(2811307..2812533) product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932658.1 transl_table 11 codon_start 1 locus_tag LOCUS_26600 CDS complement(2812688..2813155) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030904.1 transl_table 11 codon_start 1 locus_tag LOCUS_26610 CDS complement(2813194..2813934) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240990.1 transl_table 11 codon_start 1 locus_tag LOCUS_26620 CDS complement(2814030..2815406) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721367.1 transl_table 11 codon_start 1 locus_tag LOCUS_26630 CDS 2815761..2816507 product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100877.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 gene yaaA CDS 2816522..2817286 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26650 CDS 2817468..2818004 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704195.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 CDS complement(2818049..2819005) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922180.1 transl_table 11 codon_start 1 locus_tag LOCUS_26670 CDS 2819244..2820578 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676360.1 transl_table 11 codon_start 1 locus_tag LOCUS_26680 CDS 2820689..2821243 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053025875.1 transl_table 11 codon_start 1 locus_tag LOCUS_26690 CDS complement(2821280..2822050) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287492.1 transl_table 11 codon_start 1 locus_tag LOCUS_26700 CDS complement(2822043..2822981) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721785.1 transl_table 11 codon_start 1 locus_tag LOCUS_26710 CDS complement(2822983..2823264) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222020.1 transl_table 11 codon_start 1 locus_tag LOCUS_26720 CDS complement(2823358..2824230) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004121002.1 transl_table 11 codon_start 1 locus_tag LOCUS_26730 CDS complement(2824395..2825582) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289463.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 gene tuf CDS complement(2825796..2827175) product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989992.1 transl_table 11 codon_start 1 locus_tag LOCUS_26750 CDS complement(2827283..2828311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26760 CDS complement(2828301..2828759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26770 CDS complement(2828814..2829269) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000967631.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 CDS complement(2829285..2829707) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282269.1 transl_table 11 codon_start 1 locus_tag LOCUS_26790 CDS 2829810..2830496 product transcriptional regulator YeiL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949096.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 gene yeiL CDS 2830641..2831987 product IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095092556.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 note possible pseudo, frameshifted CDS complement(2832307..2832828) product menaquinone-dependent protoporphyrinogen IX dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073509.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 gene hemG CDS complement(2832897..2833400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26830 CDS complement(2833402..2834415) product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296309.1 transl_table 11 codon_start 1 locus_tag LOCUS_26840 gene sppA CDS 2834800..2835393 product DUF2441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005956.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 CDS complement(2835436..2835783) product iron chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721468.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 CDS complement(2835820..2837157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26870 CDS complement(2837231..2837719) product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761975.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 CDS complement(2837788..2838330) product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948277.1 transl_table 11 codon_start 1 locus_tag LOCUS_26890 CDS 2838428..2839330 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359341.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 CDS complement(2839367..2839747) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379711.1 transl_table 11 codon_start 1 locus_tag LOCUS_26910 CDS complement(2839810..2840502) product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355354.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 CDS 2840653..2843169 product bifunctional lysylphosphatidylglycerol flippase/synthetase MprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831275.1 transl_table 11 codon_start 1 locus_tag LOCUS_26930 gene mprF CDS complement(2843248..2845356) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002437601.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 CDS complement(2845450..2845632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26950 CDS 2845794..2847278 product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002437604.1 transl_table 11 codon_start 1 locus_tag LOCUS_26960 CDS 2847299..2847982 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948057.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 CDS 2848123..2849370 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050761141.1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 CDS complement(2849416..2851524) product serine racemase VanT catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893196.1 transl_table 11 codon_start 1 locus_tag LOCUS_26990 gene vanT CDS complement(2851514..2852095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27000 CDS complement(2852067..2853128) product D-alanine--(R)-lactate ligase VanI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461304.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 gene vanI CDS complement(2853279..2855237) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27020 CDS complement(2855386..2856282) product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195924.1 transl_table 11 codon_start 1 locus_tag LOCUS_27030 gene gnd CDS complement(2856583..2857482) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380395.1 transl_table 11 codon_start 1 locus_tag LOCUS_27040 CDS complement(2857501..2858835) product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001228021.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 CDS complement(2858915..2859364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27060 CDS complement(2859472..2860458) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294322.1 transl_table 11 codon_start 1 locus_tag LOCUS_27070 CDS complement(2860539..2861105) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701817.1 transl_table 11 codon_start 1 locus_tag LOCUS_27080 CDS complement(2861148..2861933) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948103.1 transl_table 11 codon_start 1 locus_tag LOCUS_27090 CDS complement(2861943..2862947) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948102.1 transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS complement(2862947..2863963) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948101.1 transl_table 11 codon_start 1 locus_tag LOCUS_27110 CDS complement(2864034..2864960) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948100.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 CDS 2865176..2866180 product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549578.1 transl_table 11 codon_start 1 locus_tag LOCUS_27130 gene asnA CDS complement(2866238..2867365) product DUF1648 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948932.1 transl_table 11 codon_start 1 locus_tag LOCUS_27140 CDS complement(2867358..2867741) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358748.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 CDS 2867883..2868527 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27160 CDS complement(2868880..2869179) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356871.1 transl_table 11 codon_start 1 locus_tag LOCUS_27170 CDS 2869350..2869526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27180 CDS complement(2869519..2869839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27190 CDS 2869933..2870460 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027149.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 CDS 2870482..2870856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27210 CDS complement(2871166..2871795) product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045612793.1 transl_table 11 codon_start 1 locus_tag LOCUS_27220 CDS complement(2871838..2872497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27230 CDS 2872660..2873022 product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287552.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 CDS 2873117..2873512 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905027.1 transl_table 11 codon_start 1 locus_tag LOCUS_27250 CDS 2873703..2874233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27260 CDS 2874344..2875948 product IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095092556.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 CDS 2876007..2876243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27280 CDS 2876180..2876335 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27290 CDS complement(2877075..2878271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27300 CDS complement(2878349..2879404) product DUF916 and DUF3324 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989514.1 transl_table 11 codon_start 1 locus_tag LOCUS_27310 CDS complement(2879448..2880260) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27320 CDS complement(2880257..2880565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27330 CDS complement(2880581..2882884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27340 CDS complement(2882909..2883856) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086430.1 transl_table 11 codon_start 1 locus_tag LOCUS_27350 CDS complement(2884753..2885370) product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294697.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 CDS complement(2885370..2886233) product class II fructose-bisphosphate aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294699.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 CDS complement(2886265..2886660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002329646.1 transl_table 11 codon_start 1 locus_tag LOCUS_27380 CDS complement(2886679..2887968) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296769.1 transl_table 11 codon_start 1 locus_tag LOCUS_27390 CDS complement(2887990..2888292) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292534.1 transl_table 11 codon_start 1 locus_tag LOCUS_27400 CDS complement(2888310..2890409) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287536.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 CDS complement(2890541..2890867) product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293844.1 transl_table 11 codon_start 1 locus_tag LOCUS_27420 CDS 2890972..2893740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27430 CDS complement(2893783..2893962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27440 CDS complement(2893963..2895165) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356101.1 transl_table 11 codon_start 1 locus_tag LOCUS_27450 CDS 2895383..2896039 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356081.1 transl_table 11 codon_start 1 locus_tag LOCUS_27460 CDS complement(2896969..2897364) product effector binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932617.1 transl_table 11 codon_start 1 locus_tag LOCUS_27470 CDS 2897441..2898373 product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385468.1 transl_table 11 codon_start 1 locus_tag LOCUS_27480 CDS complement(2898374..2898643) product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085659.1 transl_table 11 codon_start 1 locus_tag LOCUS_27490 gene rpsN CDS complement(2898959..2899723) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016616.1 transl_table 11 codon_start 1 locus_tag LOCUS_27500 CDS complement(2899866..2900762) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287059.1 transl_table 11 codon_start 1 locus_tag LOCUS_27510 CDS complement(2900799..2901536) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027603.1 transl_table 11 codon_start 1 locus_tag LOCUS_27520 CDS complement(2901520..2902434) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837471.1 transl_table 11 codon_start 1 locus_tag LOCUS_27530 CDS complement(2902431..2902892) product DUF3021 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460271.1 transl_table 11 codon_start 1 locus_tag LOCUS_27540 CDS complement(2902889..2903323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27550 CDS complement(2903471..2904223) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27560 CDS complement(2904342..2905307) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877602.1 transl_table 11 codon_start 1 locus_tag LOCUS_27570 CDS complement(2905320..2906060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27580 CDS 2906156..2906884 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877601.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 CDS 2906871..2907611 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877600.1 transl_table 11 codon_start 1 locus_tag LOCUS_27600 CDS 2907731..2908087 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027520.1 transl_table 11 codon_start 1 locus_tag LOCUS_27610 CDS 2908062..2908880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27620 CDS complement(2908926..2909372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27630 CDS complement(2909470..2911419) product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932388.1 transl_table 11 codon_start 1 locus_tag LOCUS_27640 CDS complement(2911507..2912028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355833.1 transl_table 11 codon_start 1 locus_tag LOCUS_27650 CDS complement(2912054..2912923) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383369.1 transl_table 11 codon_start 1 locus_tag LOCUS_27660 CDS 2913029..2913697 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387025.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 CDS 2913850..2914833 product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355836.1 transl_table 11 codon_start 1 locus_tag LOCUS_27680 gene pta CDS 2914976..2915464 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002395673.1 transl_table 11 codon_start 1 locus_tag LOCUS_27690 gene tsaE CDS 2915457..2915975 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002366315.1 transl_table 11 codon_start 1 locus_tag LOCUS_27700 CDS complement(2916017..2916550) product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002291442.1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 CDS complement(2916563..2917555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27720 CDS complement(2917578..2918330) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387194.1 transl_table 11 codon_start 1 locus_tag LOCUS_27730 CDS 2918529..2919431 product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356404.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 gene murB CDS complement(2919482..2920684) product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021362269.1 transl_table 11 codon_start 1 locus_tag LOCUS_27750 CDS complement(2920854..2921858) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078295.1 transl_table 11 codon_start 1 locus_tag LOCUS_27760 CDS complement(2922007..2923020) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078275.1 transl_table 11 codon_start 1 locus_tag LOCUS_27770 CDS 2923425..2924051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27780 note possible pseudo, internal stop codon, frameshifted CDS 2924213..2924710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27790 note possible pseudo, internal stop codon, frameshifted CDS 2924736..2926178 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096862.1 transl_table 11 codon_start 1 locus_tag LOCUS_27800 CDS complement(2926315..2927310) product YhdH/YhfP family quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356506.1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 CDS 2927507..2928049 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287040.1 transl_table 11 codon_start 1 locus_tag LOCUS_27820 CDS 2928064..2929152 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356508.1 transl_table 11 codon_start 1 locus_tag LOCUS_27830 CDS 2929164..2929976 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356510.1 transl_table 11 codon_start 1 locus_tag LOCUS_27840 CDS 2929973..2930794 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287036.1 transl_table 11 codon_start 1 locus_tag LOCUS_27850 CDS 2930808..2930960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27860 note possible pseudo, frameshifted CDS 2931023..2931880 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002376560.1 transl_table 11 codon_start 1 locus_tag LOCUS_27870 note possible pseudo, frameshifted CDS 2932149..2933006 product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321008.1 transl_table 11 codon_start 1 locus_tag LOCUS_27880 gene ispE CDS complement(2933058..2934104) product DUF916 and DUF3324 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989514.1 transl_table 11 codon_start 1 locus_tag LOCUS_27890 CDS complement(2934212..2935000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27900 CDS 2935454..2936134 product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287343.1 transl_table 11 codon_start 1 locus_tag LOCUS_27910 CDS 2936107..2936913 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287344.1 transl_table 11 codon_start 1 locus_tag LOCUS_27920 CDS complement(2936981..2937835) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27930 CDS 2938158..2938748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27940 CDS 2938887..2942375 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27950 CDS 2942620..2943450 product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287345.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 gene purR CDS 2943556..2944929 product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706816.1 transl_table 11 codon_start 1 locus_tag LOCUS_27970 gene glmU CDS 2945024..2945992 product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287347.1 transl_table 11 codon_start 1 locus_tag LOCUS_27980 CDS complement(2946037..2946480) product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354883.1 transl_table 11 codon_start 1 locus_tag LOCUS_27990 gene mscL CDS 2946763..2948028 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387388.1 transl_table 11 codon_start 1 locus_tag LOCUS_28000 CDS 2948031..2949320 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387387.1 transl_table 11 codon_start 1 locus_tag LOCUS_28010 CDS 2949487..2950443 product DUF4115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359020.1 transl_table 11 codon_start 1 locus_tag LOCUS_28020 CDS 2950445..2951023 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365382.1 transl_table 11 codon_start 1 locus_tag LOCUS_28030 gene pgsA CDS 2951111..2951644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28040 CDS 2951656..2952027 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358720.1 transl_table 11 codon_start 1 locus_tag LOCUS_28050 CDS complement(2952017..2952445) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28060 note possible pseudo, internal stop codon CDS complement(2952470..2952682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28070 CDS complement(2952699..2953763) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288167.1 transl_table 11 codon_start 1 locus_tag LOCUS_28080 CDS complement(2953834..2954376) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999314.1 transl_table 11 codon_start 1 locus_tag LOCUS_28090 CDS 2954486..2955019 product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355209.1 transl_table 11 codon_start 1 locus_tag LOCUS_28100 CDS 2955308..2956810 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922517.1 transl_table 11 codon_start 1 locus_tag LOCUS_28110 CDS complement(2956829..2957770) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674839.1 transl_table 11 codon_start 1 locus_tag LOCUS_28120 CDS complement(2957832..2958224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28130 CDS complement(2958394..2958720) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28140 CDS 2958834..2960489 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287495.1 transl_table 11 codon_start 1 locus_tag LOCUS_28150 CDS 2960535..2961089 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358039.1 transl_table 11 codon_start 1 locus_tag LOCUS_28160 gene lepB CDS complement(2961371..2961979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28170 CDS complement(2962153..2962359) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721916.1 transl_table 11 codon_start 1 locus_tag LOCUS_28180 CDS complement(2962376..2962843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28190 CDS complement(2962940..2963818) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731865.1 transl_table 11 codon_start 1 locus_tag LOCUS_28200 CDS complement(2964147..2964971) product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262299.1 transl_table 11 codon_start 1 locus_tag LOCUS_28210 CDS complement(2965068..2965493) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706572.1 transl_table 11 codon_start 1 locus_tag LOCUS_28220 CDS complement(2965550..2966179) product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357673.1 transl_table 11 codon_start 1 locus_tag LOCUS_28230 CDS complement(2966189..2967562) product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292842.1 transl_table 11 codon_start 1 locus_tag LOCUS_28240 CDS complement(2967555..2969339) product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295101.1 transl_table 11 codon_start 1 locus_tag LOCUS_28250 CDS complement(2969371..2969682) product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292844.1 transl_table 11 codon_start 1 locus_tag LOCUS_28260 CDS complement(2969672..2970676) product V-type ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774209.1 transl_table 11 codon_start 1 locus_tag LOCUS_28270 CDS complement(2970676..2971290) product V-type ATPase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365627.1 transl_table 11 codon_start 1 locus_tag LOCUS_28280 CDS complement(2971308..2971778) product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363905.1 transl_table 11 codon_start 1 locus_tag LOCUS_28290 CDS complement(2971800..2973746) product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379422.1 transl_table 11 codon_start 1 locus_tag LOCUS_28300 CDS complement(2973733..2974056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28310 CDS complement(2974340..2975377) product trifunctional transcriptional activator/DNA repair protein Ada/methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444602.1 transl_table 11 codon_start 1 locus_tag LOCUS_28320 CDS complement(2975540..2976520) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100665.1 transl_table 11 codon_start 1 locus_tag LOCUS_28330 CDS 2976655..2977563 product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360016.1 transl_table 11 codon_start 1 locus_tag LOCUS_28340 CDS 2977639..2977851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28350 CDS complement(2977894..2978910) product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206182.1 transl_table 11 codon_start 1 locus_tag LOCUS_28360 CDS 2979170..2980228 product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016458.1 transl_table 11 codon_start 1 locus_tag LOCUS_28370 CDS complement(2980251..2980694) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577672.1 transl_table 11 codon_start 1 locus_tag LOCUS_28380 CDS 2981103..2981498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28390 CDS complement(2981778..2982266) product NINE protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448282.1 transl_table 11 codon_start 1 locus_tag LOCUS_28400 CDS complement(2983076..2983471) product DUF1093 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565715.1 transl_table 11 codon_start 1 locus_tag LOCUS_28410 CDS complement(2983753..2984967) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28420 CDS complement(2984969..2986117) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28430 CDS complement(2986120..2986968) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948651.1 transl_table 11 codon_start 1 locus_tag LOCUS_28440 CDS complement(2986955..2987752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28450 CDS complement(2987742..2988278) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861377.1 transl_table 11 codon_start 1 locus_tag LOCUS_28460 CDS 2988626..2989525 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287911.1 transl_table 11 codon_start 1 locus_tag LOCUS_28470 CDS complement(2989562..2989795) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28480 CDS complement(2989810..2990016) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28490 CDS complement(2990016..2990609) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948871.1 transl_table 11 codon_start 1 locus_tag LOCUS_28500 CDS complement(2990773..2991954) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286589.1 transl_table 11 codon_start 1 locus_tag LOCUS_28510 CDS complement(2992027..2993217) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706679.1 transl_table 11 codon_start 1 locus_tag LOCUS_28520 CDS complement(2993229..2993654) product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775307.1 transl_table 11 codon_start 1 locus_tag LOCUS_28530 CDS 2993842..2994807 product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009909407.1 transl_table 11 codon_start 1 locus_tag LOCUS_28540 CDS 2994962..2996131 product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295931.1 transl_table 11 codon_start 1 locus_tag LOCUS_28550 CDS complement(2996128..2997522) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113358.1 transl_table 11 codon_start 1 locus_tag LOCUS_28560 CDS complement(2997538..2998296) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005948026.1 transl_table 11 codon_start 1 locus_tag LOCUS_28570 CDS complement(2998290..2999321) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948092.1 transl_table 11 codon_start 1 locus_tag LOCUS_28580 CDS complement(2999325..3000287) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948091.1 transl_table 11 codon_start 1 locus_tag LOCUS_28590 CDS 3000328..3000960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28600 CDS complement(3001060..3001446) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018306633.1 transl_table 11 codon_start 1 locus_tag LOCUS_28610 CDS complement(3001513..3003999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28620 CDS complement(3004220..3006844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28630 CDS complement(3006915..3008672) product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383727.1 transl_table 11 codon_start 1 locus_tag LOCUS_28640 gene cydC CDS complement(3008674..3010398) product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378477.1 transl_table 11 codon_start 1 locus_tag LOCUS_28650 gene cydD CDS complement(3010419..3011435) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641325.1 transl_table 11 codon_start 1 locus_tag LOCUS_28660 gene cydB CDS complement(3011437..3012846) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641324.1 transl_table 11 codon_start 1 locus_tag LOCUS_28670 CDS complement(3012970..3014316) product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354732.1 transl_table 11 codon_start 1 locus_tag LOCUS_28680 gene gor CDS complement(3014330..3015568) product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304804.1 transl_table 11 codon_start 1 locus_tag LOCUS_28690 CDS complement(3015584..3016504) product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289033.1 transl_table 11 codon_start 1 locus_tag LOCUS_28700 CDS complement(3016616..3018280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28710 note possible pseudo, frameshifted CDS complement(3018277..3019095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28720 note possible pseudo, frameshifted CDS complement(3019100..3019567) product CtsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354715.1 transl_table 11 codon_start 1 locus_tag LOCUS_28730 tRNA complement(3019705..3019790) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00780 tRNA complement(3019803..3019875) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00790 tRNA complement(3019884..3019957) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00800 tRNA complement(3019980..3020052) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00810 tRNA complement(3020061..3020135) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00820 rRNA complement(3020154..3020264) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00200 sequence2 source 1..61957 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(386..904) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28740 CDS complement(907..3411) product type IV secretory pathway, VirB4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003582237.1 transl_table 11 codon_start 1 locus_tag LOCUS_28750 CDS complement(3423..3704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28760 CDS complement(3701..5590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28770 CDS complement(5583..7823) product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674157.1 transl_table 11 codon_start 1 locus_tag LOCUS_28780 CDS complement(8010..9449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28790 CDS complement(9459..10565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28800 CDS complement(10578..10805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28810 CDS complement(10817..11023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28820 CDS complement(11042..11956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28830 CDS complement(12249..13622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28840 CDS complement(13645..14070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28850 CDS complement(14018..14623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28860 CDS complement(14631..18371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28870 CDS complement(18574..19881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28880 CDS complement(19971..20267) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28890 CDS complement(20425..20637) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28900 CDS complement(21134..21403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28910 CDS 22388..23347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28920 CDS 23362..24516 product TraB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365950.1 transl_table 11 codon_start 1 locus_tag LOCUS_28930 CDS complement(24822..26333) product primase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387943.1 transl_table 11 codon_start 1 locus_tag LOCUS_28940 CDS complement(26869..27255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28950 CDS complement(27260..28087) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287942.1 transl_table 11 codon_start 1 locus_tag LOCUS_28960 CDS 28408..28995 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126796224.1 transl_table 11 codon_start 1 locus_tag LOCUS_28970 CDS 29464..29754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28980 CDS 29861..32008 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28990 CDS 32005..32640 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571333.1 transl_table 11 codon_start 1 locus_tag LOCUS_29000 CDS 32703..33083 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29010 CDS 33089..34579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29020 CDS complement(34786..35100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29030 CDS 35913..36476 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690625.1 transl_table 11 codon_start 1 locus_tag LOCUS_29040 CDS 36533..37567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29050 CDS 38166..38846 product IS6-like element IS1216 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015311.1 transl_table 11 codon_start 1 locus_tag LOCUS_29060 CDS complement(38869..39084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29070 note possible pseudo, internal stop codon CDS complement(39097..39456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29080 note possible pseudo, internal stop codon CDS complement(39656..40000) product multidrug efflux SMR transporter subunit EbrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245163.1 transl_table 11 codon_start 1 locus_tag LOCUS_29090 gene ebrB CDS complement(40018..40335) product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119361310.1 transl_table 11 codon_start 1 locus_tag LOCUS_29100 CDS complement(40347..40886) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028020.1 transl_table 11 codon_start 1 locus_tag LOCUS_29110 CDS complement(41584..41835) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29120 CDS complement(41875..42528) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29130 CDS 42640..43320 product IS6-like element IS1216 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015311.1 transl_table 11 codon_start 1 locus_tag LOCUS_29140 CDS 43378..44007 product IS6-like element IS1216 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015311.1 transl_table 11 codon_start 1 locus_tag LOCUS_29150 CDS complement(44348..44704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224434963.1 transl_table 11 codon_start 1 locus_tag LOCUS_29160 CDS complement(44717..44917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29170 CDS complement(44914..46221) product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002406534.1 transl_table 11 codon_start 1 locus_tag LOCUS_29180 CDS complement(46481..46642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29190 CDS 47056..47289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29200 CDS 47360..47737 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29210 CDS complement(47839..48240) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29220 CDS complement(48233..48616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29230 CDS complement(48618..48920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29240 CDS complement(48988..56055) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29250 CDS complement(56116..56571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29260 CDS complement(56589..58235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29270 CDS complement(58269..59474) product MobP2 family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674165.1 transl_table 11 codon_start 1 locus_tag LOCUS_29280 gene mobP2 CDS complement(59471..59914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29290 CDS complement(59919..60203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29300 CDS complement(60506..61291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29310 misc_feature complement(61307..>61957) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_062284982.1:peptidoglycan DD-metalloendopeptidase family protein locus_tag LOCUS_29320 sequence3 source 1..45823 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 377..1000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29330 CDS 1279..1479 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355647.1 transl_table 11 codon_start 1 locus_tag LOCUS_29340 CDS 1690..2037 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29350 CDS complement(2196..3140) product N(5)-(carboxyethyl)ornithine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131029.1 transl_table 11 codon_start 1 locus_tag LOCUS_29360 CDS 3457..3867 product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288163.1 transl_table 11 codon_start 1 locus_tag LOCUS_29370 CDS 4619..5053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29380 CDS 5171..5587 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29390 CDS complement(5880..6665) product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888398.1 transl_table 11 codon_start 1 locus_tag LOCUS_29400 CDS complement(7129..8130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29410 CDS complement(8289..8555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29420 CDS complement(8545..8901) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766756.1 transl_table 11 codon_start 1 locus_tag LOCUS_29430 CDS complement(8984..9763) product abortive infection family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109507.1 transl_table 11 codon_start 1 locus_tag LOCUS_29440 CDS complement(9777..10493) product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225856.1 transl_table 11 codon_start 1 locus_tag LOCUS_29450 CDS complement(10542..11141) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949169.1 transl_table 11 codon_start 1 locus_tag LOCUS_29460 CDS 11887..12846 product IS30-like element IS6770 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389992.1 transl_table 11 codon_start 1 locus_tag LOCUS_29470 CDS complement(13336..14148) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160701.1 transl_table 11 codon_start 1 locus_tag LOCUS_29480 CDS complement(14141..15589) product Mu transposase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790712.1 transl_table 11 codon_start 1 locus_tag LOCUS_29490 CDS complement(15635..16189) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273859.1 transl_table 11 codon_start 1 locus_tag LOCUS_29500 CDS complement(16436..18379) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485723.1 transl_table 11 codon_start 1 locus_tag LOCUS_29510 CDS 18738..19052 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321425.1 transl_table 11 codon_start 1 locus_tag LOCUS_29520 CDS 19184..19999 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906055.1 transl_table 11 codon_start 1 locus_tag LOCUS_29530 CDS complement(21268..22389) product class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286364.1 transl_table 11 codon_start 1 locus_tag LOCUS_29540 CDS complement(22386..23582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29550 CDS complement(23668..25155) product SpaH/EbpB family LPXTG-anchored major pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286774.1 transl_table 11 codon_start 1 locus_tag LOCUS_29560 CDS complement(25220..25951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29570 CDS complement(25953..29612) product SpaA isopeptide-forming pilin-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286055.1 transl_table 11 codon_start 1 locus_tag LOCUS_29580 CDS 30568..30885 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29590 CDS complement(30927..31241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29600 CDS complement(31245..31532) product PrgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298753.1 transl_table 11 codon_start 1 locus_tag LOCUS_29610 CDS complement(31668..33167) product primase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298755.1 transl_table 11 codon_start 1 locus_tag LOCUS_29620 CDS complement(33536..33862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29630 CDS 34249..35214 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701079.1 transl_table 11 codon_start 1 locus_tag LOCUS_29640 CDS 35214..35678 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29650 CDS 36051..36629 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29660 note possible pseudo, frameshifted CDS 36626..36928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29670 note possible pseudo, frameshifted CDS complement(36951..37631) product IS6-like element IS1216 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061086363.1 transl_table 11 codon_start 1 locus_tag LOCUS_29680 CDS complement(37738..37986) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29690 CDS complement(38046..38495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29700 CDS 38918..39127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29710 CDS 39564..40454 product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287225.1 transl_table 11 codon_start 1 locus_tag LOCUS_29720 CDS complement(40558..41727) product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104859673.1 transl_table 11 codon_start 1 locus_tag LOCUS_29730 CDS complement(42132..42326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29740 CDS complement(42356..42601) product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568375.1 transl_table 11 codon_start 1 locus_tag LOCUS_29750 CDS complement(42630..43160) product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356090.1 transl_table 11 codon_start 1 locus_tag LOCUS_29760 CDS complement(43195..43371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29770 CDS complement(43385..43945) product alkaline shock response membrane anchor protein AmaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893930.1 transl_table 11 codon_start 1 locus_tag LOCUS_29780 gene amaP CDS complement(44070..45239) product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104859673.1 transl_table 11 codon_start 1 locus_tag LOCUS_29790