COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..1210113 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 175..250 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 tRNA 255..330 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 tRNA 342..415 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 tRNA 426..510 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 tRNA 544..618 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 tRNA 625..713 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA 734..808 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 tRNA 818..892 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA 918..993 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 tRNA 1034..1110 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 tRNA 1116..1192 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 tRNA 1207..1299 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 tRNA 1321..1392 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 tRNA 1417..1492 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 tRNA 1520..1595 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 tRNA 1600..1672 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 tRNA 1681..1761 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 tRNA 1769..1840 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA 1852..1927 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 tRNA 1931..2004 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA 2021..2091 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 tRNA 2108..2182 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 tRNA 2229..2312 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS 2412..2624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00010 note possible pseudo, internal stop codon CDS 2658..3134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00020 note possible pseudo, internal stop codon CDS 3226..4320 product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283968.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS 4317..5231 product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002071.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS 5322..7025 product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763048.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS complement(7067..7462) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243994.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS 7593..8996 product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930267.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS complement(9030..9830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS complement(9892..10134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS 10113..10319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS complement(10434..11729) product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451828.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS 12160..12690 product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724156.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS 12820..13509 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948485.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS 13591..14514 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948486.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS 14507..15274 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS 15293..16198 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948489.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS 16278..17603 product FAD-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484563.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS complement(17726..18280) product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226275.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS 18446..18802 product DUF6176 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027779.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(18925..20433) product ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153754.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 gene abc-f CDS 20729..21859 product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001793998.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 gene queG CDS 21876..22343 product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181394.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 gene trmL CDS 22356..22535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00230 note possible pseudo, frameshifted CDS 22670..23092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00240 note possible pseudo, frameshifted CDS complement(23139..23843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS 24326..24904 product glucosamine-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456349.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS 24978..26366 product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829862.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 gene fumC CDS 26377..27903 product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456666.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 gene ppx CDS 27944..30067 product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470194.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS complement(30145..30960) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669376.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS complement(30962..31456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS complement(31477..31884) product disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228417.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS 31997..33106 product GAF domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829819.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS 33107..33739 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829810.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS 33896..35218 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814826.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS 35434..35880 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375864.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS 35964..37094 product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082738.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS 37148..37498 product YlbF/YmcA family competence regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485196.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS 37588..38772 product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829843.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS 38780..41707 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456350.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS 41720..42658 product 3'-5' exoribonuclease YhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244175.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 gene yhaM CDS complement(42732..43853) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782121.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS complement(43960..44343) product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648118.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS complement(44390..44821) product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829828.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS 44911..45651 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216874.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS 45641..46843 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485189.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS complement(46840..47379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS 47554..48579 product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233526.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 gene hemE CDS 48576..49505 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485187.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 gene hemH CDS 49523..50896 product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002469574.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 gene hemY CDS 50969..51961 product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668818.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS 52041..54788 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544913.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(54895..55092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS 55317..59048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00540 tRNA 59340..59414 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 tRNA 59418..59507 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS 59674..59931 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS 60197..61531 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS 61534..63675 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS 63641..64114 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS complement(64682..65401) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181587.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS complement(65438..66076) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00600 note possible pseudo, frameshifted CDS complement(66034..66468) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00610 note possible pseudo, frameshifted CDS 66746..67435 product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132114.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS 67610..67810 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003719639.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS complement(68053..68916) product catechol 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233597.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 gene catE CDS 69046..69369 product catDE operon transcriptional regulator CatR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242888.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 gene catR CDS complement(69406..69972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS 70107..70838 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132220.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 tRNA 70978..71049 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 tRNA 71070..71145 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 tRNA 71166..71238 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA 71259..71332 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 tRNA 71343..71417 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 tRNA 71421..71494 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 tRNA 71531..71620 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS 72077..73489 product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931218.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS 73900..75465 product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001795358.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS 75483..76997 product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008400.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS 77046..78251 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000142199.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS 78300..80558 product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154537.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS 80591..81775 product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154619.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS complement(81863..82156) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS 82272..82682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS complement(82845..82982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS 83045..83515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS complement(83570..84145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(84222..85139) product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070966.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS 85256..86650 product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439285.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 86613..88280 product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001833068.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 gene menD CDS 88270..89061 product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869224.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 gene menH CDS 89058..89876 product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184945.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 gene menB CDS 89934..91304 product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348364.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 gene menE CDS complement(91337..91570) product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718107.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 gene yidD CDS 91647..92105 product nucleoside triphosphatase YtkD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672013.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 gene ytkD CDS complement(92212..93786) product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109906.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 gene pckA CDS 94255..95439 product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933820.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 gene metK CDS 95469..96377 product nuclease-related domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366163.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS 96455..97834 product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246615.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 gene gabD CDS complement(97974..98186) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS 98296..98790 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS 98805..99020 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894739.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS 99094..99942 product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789277.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS 100008..100748 product threonine/serine exporter ThrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832039.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS 100761..101216 product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498572.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS 101232..101807 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350628.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS 101873..102541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS 102654..104180 product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460243.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS complement(104234..104416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01000 note possible pseudo, internal stop codon CDS complement(104474..105151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01010 note possible pseudo, internal stop codon CDS 105241..105981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS 106054..107106 product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831524.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS 107217..108134 product NAD-dependent deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191954.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS 108138..109163 product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922342.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS 109219..110457 product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532461.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS 110484..110843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS 110905..111141 product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567888.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS 111237..111869 product DapH/DapD/GlmU-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970705.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS complement(111962..112324) product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476361.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 gene crcB CDS complement(112317..112682) product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858490.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 gene crcB CDS complement(112695..113687) product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196362.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS complement(113779..114282) product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640212.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS 114362..115168 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830886.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS complement(115225..115770) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764419.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS 115825..116577 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080881.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS 116552..118117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS 118119..118577 product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956700.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS 118821..121235 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108730.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 gene leuS CDS complement(121407..122660) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830813.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS 122746..124386 product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004335.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS 124386..125075 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989966.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS 125152..125835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS 125972..127381 product Mn(2+)-dependent dipeptidase Sapep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000265417.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 gene sapep CDS 127709..128500 product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830846.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS 128523..129155 product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002493957.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 gene trmB CDS 129243..130439 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861787.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS complement(130454..130750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS 130821..131894 product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484975.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS 131898..132887 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440236.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS 132903..133712 product DUF1444 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832670.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS 133734..134318 product DUF4479 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006759.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS 134331..136016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS 136071..137333 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150169.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 gene murC CDS 137430..137909 product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830868.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS 137944..138390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS 138530..139519 product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830844.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 gene ccpA CDS complement(139577..140722) product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092826.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 gene acuC CDS complement(140722..141357) product acetoin utilization AcuB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634583.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS complement(141376..142008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016004.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS 142227..143936 product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862095.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 gene acsA CDS 144077..145744 product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149407.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS complement(145851..148385) product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382391.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS 148812..150071 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186029.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 gene tyrS CDS complement(150147..151475) product YjiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986374.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS 151628..152575 product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732488.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS complement(152635..153126) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS 153242..154384 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026189.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS 154445..154714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS 155196..156401 product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193190.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS 156413..157087 product response regulator transcription factor GraR/ApsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166500.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 gene graR CDS 157094..158086 product two-component sensor histidine kinase BceS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398652.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 gene bceS CDS 158191..158952 product bacitracin ABC transporter ATP-binding protein BceA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229137.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 gene bceA CDS 158939..160888 product bacitracin ABC transporter permease BceB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229139.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 gene bceB CDS complement(160984..161628) product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080883.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS complement(161676..162164) product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832596.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 gene queF CDS 162369..163277 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548210.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS complement(163296..163511) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS 163592..164221 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS 164248..165423 product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970132.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS 165426..166709 product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705259.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS 166827..168368 product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000259555.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 gene pruA CDS 168528..169823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS 169991..170191 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059079.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS 170339..173143 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS complement(173202..173804) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090512.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 gene rpsD CDS complement(174024..174494) product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229311.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS 174608..176302 product septation ring formation regulator EzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830796.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 gene ezrA CDS 176360..177487 product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012840521.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS 177484..178686 product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872662.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 gene thiI CDS 178809..180134 product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562821.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS complement(180139..180939) product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399091.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS 181178..182179 product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989751.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 gene sppA CDS 182192..182773 product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229340.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS 182881..183780 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840576.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS 183786..184976 product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223511.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS 185148..185672 product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296667.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS complement(185834..186889) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972216.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS complement(186996..187493) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634175.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS 187638..188753 product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690007.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 gene ald CDS complement(188814..189389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS 189492..190178 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777188.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS 190301..191563 product DRTGG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830890.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS complement(191614..191982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS 192059..193015 product pApA hydrolase Pde2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626082.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 gene pde2 CDS 193030..196188 product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485290.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS 196255..197490 product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229415.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 gene maeB CDS 197493..197915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS 197934..198788 product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832673.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 gene accD CDS 198791..199738 product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229417.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 gene accA CDS 199873..200832 product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002440192.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 gene pfkA CDS 200847..202607 product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830831.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 gene pyk CDS 202626..203396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS 203720..204838 product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082708.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS 204873..206141 product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229433.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 gene icd CDS 206235..207809 product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903217.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS 208004..210607 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038317.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 gene polA CDS 210617..211480 product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114454.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 gene mutM CDS 211489..212082 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398928.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 gene coaE CDS 212156..213160 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830791.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 gene gap CDS 213243..213662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS 213849..214319 product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830825.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 gene nrdR CDS 214309..215655 product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415049.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS 215664..216584 product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808621.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 gene dnaI CDS 216900..218831 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435143.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 gene thrS CDS 219031..219561 product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001791162.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 gene infC CDS 219583..219786 product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830767.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 gene rpmI CDS 219808..220164 product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830839.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 gene rplT CDS 220335..221312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS 221598..222380 product YhfC family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254517.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS 222590..224146 product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570687.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS 224265..225341 product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076673.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS 225335..226078 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475968.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS 226372..227436 product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830082.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 gene pheS CDS 227423..229825 product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908969.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 gene pheT CDS complement(229926..230630) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS 230952..231221 product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082701.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 gene zapA CDS 231218..231751 product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622946.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS 231780..233492 product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161938.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 gene polX CDS 233485..235812 product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001833037.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS 235989..236303 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018928.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 gene trxA CDS 236356..238131 product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830175.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 gene uvrC CDS 238244..238855 product succinate dehydrogenase cytochrome b558 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830177.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS 238870..240621 product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818278.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 gene sdhA CDS 240645..241424 product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830165.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 gene sdhB CDS complement(241492..241797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS 242133..242576 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229573.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS 242569..243381 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830094.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 gene racE CDS 243378..243968 product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830169.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS 243982..244467 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485782.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS 244489..245028 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494669.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 tRNA 245114..245190 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS 245408..248926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02320 tRNA 249040..249115 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS 249439..250053 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032657.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS 250034..250984 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS 251065..252354 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229611.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 gene tig CDS 252487..253743 product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472302.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 gene clpX CDS 253792..254379 product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867697.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 gene yihA CDS 254478..255824 product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547860.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 gene hemA CDS 255840..256664 product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157329.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS 256679..257611 product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830811.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 gene hemC CDS 257598..258290 product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805951.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS 258287..259267 product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667126.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 gene hemB CDS 259269..260555 product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270865.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 gene hemL CDS 260631..261131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS 261212..262630 product cholic acid efflux MFS transporter MdrT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733258.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 gene mdrT CDS 263161..264228 product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177998.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS 264569..267199 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425353.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS 267203..268468 product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002440172.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS complement(268574..268960) product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910489.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 gene mscL CDS 269234..271930 product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456207.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 gene acnA CDS complement(272010..272600) product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831258.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 gene plsY CDS 272800..274779 product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456533.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 gene parE CDS 274757..277186 product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831210.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 gene parC CDS 277212..278675 product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651160.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS complement(278758..279426) product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485336.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS 279660..280181 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807782.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS 280211..280519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS 280614..281852 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243812.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS 281864..282055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS 282298..282933 product elongation factor G-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774153.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS complement(282993..283955) product DUF1002 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548693.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS complement(284154..284711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS complement(284922..285143) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS 285298..286293 product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831067.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS 286567..287241 product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393128.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS 287254..287961 product type 8 capsular polysaccharide synthesis protein Cap8B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037332.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 gene cap8B CDS 287965..288753 product tyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099684015.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS 288770..290575 product type 8 capsular polysaccharide synthesis protein Cap8D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940790.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 gene cap8D CDS 290690..291322 product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902061.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS 291319..292176 product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902062.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS 292195..293415 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776619.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS 293438..294472 product type 8 capsular polysaccharide synthesis protein Cap8E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459062.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 gene cap8E CDS 294445..295566 product type 8 capsular polysaccharide synthesis protein Cap8F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028283.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 gene cap8F CDS 295570..296691 product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963417.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 gene wecB CDS 296692..297759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS 297773..298927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS 298966..300231 product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066597.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS 300379..301704 product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022298.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS 301727..303010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS 304221..304355 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS 304512..305471 product fatty-acid peroxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246284.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 gene cypC note possible pseudo, internal stop codon CDS complement(305533..305787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS 305871..306461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS complement(306547..306885) product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816745.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS 307021..307173 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS 307397..308716 product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099166.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 gene brnQ CDS complement(308808..310235) product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485467.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS 310513..310833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02880 note possible pseudo, frameshifted CDS 310830..311129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02890 note possible pseudo, frameshifted CDS 311274..311450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02900 note possible pseudo, internal stop codon CDS 311463..312035 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722299.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 note possible pseudo, internal stop codon CDS complement(312180..313223) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS complement(313563..314159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS complement(314210..314791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS 315103..316239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS 316458..317816 product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385794.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS 317866..318054 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS 318573..319835 product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831129.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS 319858..320112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS complement(320334..320576) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS complement(320875..321249) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03010 note possible pseudo, internal stop codon, frameshifted CDS 321881..323563 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104676.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS 323560..324441 product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770800.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS complement(325310..325990) product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804339.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS 326108..326677 product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063706.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS 326818..327597 product acetoin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002469273.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS 327912..329642 product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851097.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS complement(329814..330161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS complement(330367..332514) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485759.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS complement(332507..332875) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592531.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS complement(332999..333592) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS complement(333771..334451) product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804339.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS 334616..334876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS 335090..335944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS 336271..336972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS 337156..338403 product aminoacyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830979.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS 338425..339687 product glycine glycyltransferase FemB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673098.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 gene femB CDS 339709..340956 product glycine glycyltransferase FemA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673315.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 gene femA CDS 341503..341808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS complement(341957..342136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS 342749..343105 product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233729.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS complement(343222..343542) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171799.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS 343673..345478 product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439680.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 gene pepF CDS complement(345879..346751) product RNA-binding virulence regulatory protein CvfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485050.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 gene cvfB CDS 346941..348542 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830940.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS 348865..349842 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485055.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS 349855..350742 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831141.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 gene dapA CDS 350739..351452 product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830951.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 gene dapB CDS 351467..352183 product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249839.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 gene dapD CDS 352185..353333 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832789.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS 353352..354422 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831203.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS 354412..355689 product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216946.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 gene lysA CDS complement(356194..356394) product cold shock protein CspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809131.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 gene cspA CDS complement(356516..356806) product regulatory protein MsaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269923.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 gene msaA CDS 356930..357649 product 5-bromo-4-chloroindolyl phosphate hydrolysis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002476740.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS 357651..358844 product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485276.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS complement(359020..360333) product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039275.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 gene brnQ CDS complement(360429..360623) product DUF6501 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902175.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS complement(360703..361947) product dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115439.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 gene sucB CDS complement(361966..364764) product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456517.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS complement(364874..366247) product HAMP domain-containing histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831043.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS complement(366244..366918) product response regulator transcription factor ArlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192137.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 gene arlR CDS complement(367344..367964) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443797.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS complement(368058..368681) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831017.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS complement(368678..369754) product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160906.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS complement(369854..371422) product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831212.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS complement(371521..372234) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723411.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 gene deoD CDS complement(372248..372469) product YozE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547128.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS complement(372471..372905) product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439748.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 gene msrB CDS complement(372905..373426) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831118.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 gene msrA CDS complement(373440..373991) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS complement(373995..374471) product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175746.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS complement(374482..375435) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934894.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS complement(375637..376077) product BrxA/BrxB family bacilliredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457670.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS complement(376080..376844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03550 note possible pseudo, frameshifted CDS complement(376910..377191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03560 note possible pseudo, frameshifted CDS complement(377208..377378) product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358801.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS complement(377427..377831) product ribonuclease HI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831152.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS complement(377837..378712) product 5'-3' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830929.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS complement(378729..382112) product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608509.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS complement(382113..383237) product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831166.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS complement(383780..384106) product cell division regulator GpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286320.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 gene gpsB CDS complement(384118..384657) product DUF1273 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263051.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS complement(384654..384980) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS 385076..385666 product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002476769.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 gene recU CDS 385678..388131 product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831032.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS 388197..388481 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS complement(388601..389263) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253765.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 gene nth CDS complement(389250..389873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS complement(389931..391220) product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723006.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene asnS CDS complement(391235..392419) product aspartate transaminase AspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398489.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 gene aspB CDS complement(392455..394971) product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831318.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS complement(394984..395943) product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049921.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS complement(395897..397111) product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361540.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS complement(397089..398252) product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831222.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 gene bshA CDS complement(398391..399089) product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831045.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS complement(399145..399726) product DUF1405 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262825.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS complement(399775..400575) product menaquinol-cytochrome c reductase cytochrome b/c subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000554608.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 gene qcrC CDS complement(400591..401265) product menaquinol-cytochrome c reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932700.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 gene qcrB CDS complement(401277..401777) product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230627.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS complement(401922..402350) product YpiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246201.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS complement(402356..402832) product ReoY family proteolytic degradation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095925.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS complement(402813..404084) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700190.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS complement(404086..405375) product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664618.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 gene aroA CDS complement(405372..406418) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831320.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 gene aroB CDS complement(406420..407586) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269921.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 gene aroC CDS complement(407667..408113) product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415887.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 gene ndk CDS complement(408178..409131) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001817755.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS complement(409128..409829) product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774684.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS complement(409829..410335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS complement(410394..410666) product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043863.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS complement(410782..411501) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230571.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS complement(411494..411700) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS complement(411715..412767) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230566.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 gene gpsA CDS complement(412783..414096) product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165530.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 gene der CDS complement(414187..415437) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831057.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 gene rpsA CDS complement(415507..416085) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392843.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS complement(416091..416741) product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361264.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 gene cmk CDS complement(416759..417859) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS 418040..418294 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831262.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS complement(418797..419351) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186912.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS complement(419357..421054) product two-component system sensor histidine kinase SrrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987774.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 gene srrB CDS complement(421051..421761) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831066.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS complement(421780..422985) product cytochrome c biogenesis protein ResC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398799.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 gene resC CDS complement(422996..424633) product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230515.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 gene resB CDS complement(424645..425175) product thiol-disulfide oxidoreductase ResA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230513.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 gene resA CDS complement(425286..426008) product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398815.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 gene rluB CDS complement(426005..426541) product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368656.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 gene scpB CDS complement(426545..427255) product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831064.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS 427361..427819 product DUF309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831156.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS complement(428020..429192) product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197806.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 gene deoB CDS complement(429204..430091) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439987.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 gene xerD CDS complement(430084..430542) product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223972.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 gene fur CDS complement(430624..431178) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393013.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS 431289..432233 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398519.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS complement(432184..433110) product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454063.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 gene rnz CDS 433215..434060 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571108.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS complement(434218..435342) product tripeptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230352.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS complement(435582..436019) product bacilliredoxin BrxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226477.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 gene brxB CDS complement(436098..437357) product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406838.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS complement(437370..438353) product 3-methyl-2-oxobutanoate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290076.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 gene bfmBAB CDS complement(438346..439341) product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568351.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS complement(439355..440767) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291533.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 gene lpdA CDS complement(440760..441845) product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230311.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 gene buk CDS complement(441845..442942) product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171355.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS complement(442944..443849) product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594496.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS 444087..444344 product DUF2627 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230304.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS complement(444341..446005) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830981.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 gene recN CDS complement(446020..446472) product transcriptional regulator ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456185.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 gene argR CDS complement(446562..447350) product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704070.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS complement(447328..449220) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245985.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 gene dxs CDS complement(449313..450188) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002440017.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS complement(450178..450387) product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986443.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS complement(450374..451726) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002440019.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 gene xseA CDS complement(451733..452116) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230256.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 gene nusB CDS complement(452143..452493) product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807630.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS complement(452692..452931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS complement(453149..454498) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000756612.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 gene accC CDS complement(454495..454929) product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009516.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 gene accB CDS complement(455035..455592) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722482.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 gene efp CDS complement(455617..456672) product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831174.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS 456788..457348 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS 457363..458253 product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967716.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS 458268..458486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS 458518..458904 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831303.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS complement(458992..460074) product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093349.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 gene gcvT CDS complement(460315..460812) product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015120.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS complement(460822..461001) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS complement(460970..461392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS complement(461355..461612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS complement(461602..462000) product competence type IV pilus minor pilin ComGD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931729.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 gene comGD CDS complement(462011..462334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS complement(462352..463407) product competence type IV pilus assembly protein ComGB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776422.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 gene comGB CDS complement(463370..464362) product competence type IV pilus ATPase ComGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697220.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 gene comGA CDS 464587..464835 product DUF2626 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440716.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS complement(464884..465495) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831016.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS 465594..465830 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS complement(465887..467260) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066053.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 gene argH CDS complement(467253..468461) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832499.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS complement(468551..469960) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017867.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS complement(469950..470522) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831001.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS complement(470610..471263) product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974847.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 gene phoU CDS complement(471267..472109) product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226683.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 gene pstB CDS complement(472130..473008) product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831209.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 gene pstA CDS complement(473011..473934) product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204619.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 gene pstC CDS complement(474009..475070) product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759232.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS complement(475217..477400) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919769.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS complement(477512..478114) product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831217.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS 478247..478990 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS 479072..480187 product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886567.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 gene ispG CDS complement(480248..480661) product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831164.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS complement(480642..481487) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000564315.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS complement(481484..482266) product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213908.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS complement(482382..483287) product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924220.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS complement(483304..484638) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062176.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS 484780..485742 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246170.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS complement(485786..486865) product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683940.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS complement(486849..487541) product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624577.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS complement(487603..487983) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS complement(488080..489186) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002440071.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 gene rpoD CDS complement(489211..490965) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217257.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 gene dnaG CDS complement(490970..491794) product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411298.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS complement(491802..492419) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583757.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS 492735..494111 product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456487.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS 494174..494779 product cytochrome c oxidase assembly accessory protein ScuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245947.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 gene scuA CDS complement(494888..495634) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001557361.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 gene recO CDS complement(495649..496557) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134765.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 gene era CDS complement(496557..496964) product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830967.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 gene cdd CDS complement(496983..497234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS complement(497320..497781) product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494134.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 gene ybeY CDS complement(497778..498731) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117767.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS complement(498892..499587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS complement(499601..500608) product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000492108.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 gene floA CDS complement(500627..501289) product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831053.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS complement(501432..501608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS complement(501712..502377) product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028213.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 gene deoC CDS complement(502430..503146) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190120.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS complement(503146..504081) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104607.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 gene prmA CDS complement(504085..505203) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119021.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 gene dnaJ CDS complement(505288..507129) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398786.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 gene dnaK CDS complement(507157..507753) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230005.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 gene grpE CDS complement(507757..508725) product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246126.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 gene hrcA CDS complement(508819..509931) product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218103.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 gene hemW CDS complement(509986..511809) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831284.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 gene lepA CDS 511971..512216 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831221.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 gene rpsT CDS complement(512257..513219) product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468790.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 gene holA CDS 513309..513443 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS complement(513454..515709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS complement(515706..516167) product ComE operon protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831274.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS complement(516177..516800) product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002404879.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS complement(516907..517629) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084830.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS complement(517619..517957) product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229971.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 gene rsfS CDS complement(517962..518531) product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019324.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 gene yqeK CDS complement(518521..519084) product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831250.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS complement(519081..519374) product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226133.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 gene yhbY CDS complement(519374..520168) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666757.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 gene aroE CDS complement(520171..521277) product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140795.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 gene yqeH CDS complement(521279..521803) product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226126.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS complement(521984..522685) product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831322.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS complement(522678..523154) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431312.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 gene greA CDS complement(523192..523812) product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648617.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 gene udk CDS complement(523827..524435) product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342258.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS complement(524537..525667) product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572132.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 gene mltG CDS complement(525725..526030) product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830855.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS complement(526011..526463) product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830837.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 gene ruvX CDS complement(526456..526719) product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830883.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS complement(526778..529408) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734075.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 gene alaS CDS complement(529650..532022) product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484987.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS complement(532029..532673) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567017.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS complement(532673..533776) product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066097.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 gene mnmA CDS complement(533797..534930) product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830848.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS 535057..536064 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484988.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS complement(536123..536560) product DUF2188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288531.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS complement(536628..537500) product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073180.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 gene thrB CDS complement(537502..538563) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228697.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 gene thrC CDS complement(538566..539774) product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066908.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS 539920..541272 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868645.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS 541346..543031 product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460052.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS complement(543101..543517) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704116.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS 543601..544899 product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102729.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS complement(545008..545184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS complement(545561..546256) product global nitrogen regulator NtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920910.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 gene ntcA CDS 546372..546536 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS 546548..547039 product ba3-type cytochrome C oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173203.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 gene cbaB CDS 547032..548708 product b(o/a)3-type cytochrome-c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403093.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS complement(548731..549465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS complement(549529..551292) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840895.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 gene aspS CDS complement(551293..552555) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590826.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 gene hisS CDS complement(552863..553597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS complement(553597..554049) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830766.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 gene dtd CDS complement(554059..556239) product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832683.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS complement(556347..556865) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364542.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS complement(556879..559119) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002440152.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 gene recJ CDS complement(559177..561456) product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749795.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 gene secDF CDS complement(561554..561811) product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398708.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 gene yajC CDS complement(561830..562975) product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723534.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 gene tgt CDS complement(563003..564025) product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830755.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 gene queA CDS complement(564045..565043) product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830787.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 gene ruvB CDS complement(565057..565650) product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271550.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 gene ruvA CDS complement(565661..566941) product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000496100.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 gene obgE CDS complement(567028..567312) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222623.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 gene rpmA CDS complement(567324..567644) product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633692.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS complement(567644..567952) product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457386.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 gene rplU CDS complement(568078..568596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS complement(568602..569450) product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911041.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 gene mreC CDS complement(569522..570670) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625061.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS complement(570671..571477) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524312.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS complement(571478..572137) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342247.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS complement(572130..573143) product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622962.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS complement(573384..573854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS complement(574221..575093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459029.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS 575247..576422 product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017008.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS complement(576464..577531) product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946868.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS complement(577636..578484) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080532.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS 578632..579048 product NAD(+)--rifampin ADP-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811445.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 gene arr CDS complement(579062..579424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS complement(579789..580256) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS complement(580554..581048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS complement(581041..584070) product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368424.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS complement(584085..585266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS complement(585259..587046) product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918506.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS complement(587058..587258) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS 587584..587883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS 587883..588062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS complement(588192..588875) product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002440170.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS complement(589103..590335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS 590538..591728 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930973.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS 591770..592474 product DUF5058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426729.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS 592491..593135 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681846.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS complement(594359..595027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS complement(595153..595767) product cytochrome c oxidase assembly accessory protein ScuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245947.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 gene scuA CDS complement(595864..598866) product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485803.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS complement(598853..599968) product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830960.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS complement(600182..600394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS complement(600431..600631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS 600730..601233 product DUF2621 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889384.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS complement(601353..601850) product CcdC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723512.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS complement(601852..602556) product cytochrome c-type biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001152676.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 gene ccdA CDS complement(602635..604407) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229520.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS complement(604397..606181) product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989772.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS complement(606338..607876) product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903217.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS complement(608048..609736) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016360.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS complement(609899..611578) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016360.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS complement(612711..612953) product YneF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001548645.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS complement(613021..615006) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831061.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 gene tkt CDS complement(615039..615263) product DUF896 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071351.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS complement(615355..615678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS 615821..616438 product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208755.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 gene lexA CDS complement(616513..617502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS complement(617515..618354) product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163737.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 gene panC CDS complement(618355..619155) product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830671.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 gene panB CDS 619228..620109 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953572.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS complement(620255..621712) product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164930.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS 621886..622995 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980137.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS 623122..624198 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980137.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS 624411..625481 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832177.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS complement(625536..626474) product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868005.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 gene arcC CDS complement(626479..627243) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS complement(627244..628509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06190 note possible pseudo, internal stop codon, frameshifted CDS complement(628509..630260) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06200 note possible pseudo, internal stop codon, frameshifted CDS complement(630281..631330) product ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706746.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 gene allD CDS complement(631348..632376) product ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706746.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 gene allD CDS complement(632400..633191) product (S)-ureidoglycine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540997.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 gene allE CDS complement(633243..634466) product allantoate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383320.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 gene allC CDS 634639..635463 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136054.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS complement(635536..636900) product allantoinase AllB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399799.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 gene allB CDS 636998..637138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS 637139..638749 product PucR family transcriptional regulator ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365289.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS 638861..640114 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005062.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS complement(640253..641875) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS complement(642087..643319) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355251.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS 643546..644769 product (S)-ureidoglycine--glyoxylate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244520.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 gene pucG CDS complement(644893..645090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS 645171..645809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS complement(645813..646520) product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565310.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS 646753..647052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS complement(647214..648719) product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830674.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS complement(648734..649504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS complement(649927..650193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS complement(650300..650563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS complement(650696..651364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS complement(651442..651963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS complement(652172..653032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS complement(652999..653151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(653607..653768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS complement(654257..654952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS complement(654964..655671) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS complement(655894..657147) product type 8 capsular polysaccharide synthesis protein Cap8O inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779504.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 gene cap8O CDS complement(657179..657808) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS complement(657819..658340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS 658433..659107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS 659104..659394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS complement(659286..659612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(659697..660950) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000652047.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS complement(660943..661551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06550 note possible pseudo, frameshifted CDS complement(661653..662141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06560 note possible pseudo, frameshifted CDS 662260..662745 product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829502.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS complement(662779..662967) product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221097.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 gene hfq CDS complement(662968..663876) product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504940.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 gene miaA CDS complement(663863..664747) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102581.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS complement(664760..666616) product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439573.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 gene mutL CDS complement(666619..669156) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456219.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 gene mutS CDS complement(669209..669589) product energy coupling factor transporter S component ThiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842277.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 gene thiW CDS complement(670242..670676) product RicAFT regulatory complex protein RicA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870461.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS complement(670959..672776) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244082.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS complement(672769..674490) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243936.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS complement(674684..675442) product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832548.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS complement(675871..676860) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS complement(677465..679024) product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829512.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 gene rny CDS complement(679192..680256) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368166.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 gene recA CDS complement(680425..681012) product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439546.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 gene pgsA CDS complement(681019..681894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS complement(681911..682732) product YmfK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214890.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS complement(682729..683415) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439542.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS complement(683408..684703) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664775.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS complement(684693..685967) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089941.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS complement(685982..688429) product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439534.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS complement(688512..690185) product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457357.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS complement(690218..692350) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076690.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 gene pnp CDS complement(692990..693997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS complement(694142..694411) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018328.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 gene rpsO CDS complement(694548..695486) product riboflavin biosynthesis protein RibF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864185.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 gene ribF CDS complement(695473..696423) product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439525.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 gene truB CDS complement(696513..696863) product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428234.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 gene rbfA CDS complement(696866..698962) product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456223.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 gene infB CDS complement(698977..699273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS complement(699270..699554) product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727423.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS complement(699566..700621) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829457.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 gene nusA CDS complement(700638..701105) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036633.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 gene rimP CDS complement(701223..705506) product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456566.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS complement(705583..707277) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829513.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS complement(707290..708573) product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829501.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 gene rseP CDS complement(708579..709706) product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790373.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 gene dxr CDS complement(709722..710507) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829499.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS complement(710497..711258) product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473699.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS complement(711378..711935) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356762.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 gene frr CDS complement(711950..712675) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439511.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 gene pyrH CDS complement(712744..713622) product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439509.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 gene tsf CDS complement(713694..714473) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832557.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 gene rpsB CDS complement(714621..715391) product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002446289.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 gene codY CDS complement(715411..716790) product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379044.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 gene hslU CDS complement(716808..717335) product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724001.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 gene hslV CDS complement(717341..718195) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456225.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 gene xerC CDS complement(718617..720686) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829508.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 gene topA CDS complement(720796..721584) product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001803335.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 gene dprA CDS complement(721752..722660) product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110253.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 gene sucD CDS complement(722678..723847) product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020801.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 gene sucC CDS complement(724062..724811) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176393.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS complement(724816..725673) product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829495.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 gene ylqF CDS complement(725948..726922) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS complement(727104..727451) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186516.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 gene rplS CDS complement(727595..728266) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686892.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 gene trmD CDS complement(728266..728760) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832559.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 gene rimM CDS complement(728810..729037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS complement(729043..729318) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220815.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 gene rpsP CDS complement(729417..730763) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863468.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 gene ffh CDS complement(730777..731112) product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891062.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS complement(731102..732211) product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007678.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 gene ftsY CDS complement(732211..735765) product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262698.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 gene smc CDS complement(735771..736532) product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043238.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 gene rnc CDS complement(736617..736856) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426914.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS complement(736893..737630) product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830161.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 gene fabG CDS complement(737623..738540) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830062.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 gene fabD CDS complement(738524..739507) product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239753.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 gene plsX CDS complement(739511..740074) product transcription factor FapR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232044.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 gene fapR CDS complement(740176..740385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS complement(740424..741056) product class A sortase SrtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831599.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 gene srtA CDS complement(741078..743045) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151509.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 gene recG CDS complement(743045..743920) product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232049.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 gene sdaAA CDS complement(743925..744590) product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877446.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 gene sdaAB CDS complement(744649..746298) product fatty acid kinase catalytic subunit FakA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830116.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 gene fakA CDS complement(746320..746688) product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171418.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS complement(746898..747722) product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904083.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS complement(747719..747985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS 748260..748448 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720131.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 gene rpmB CDS complement(748512..749213) product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726296.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS complement(749224..749838) product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830164.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS complement(749839..750486) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830173.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 gene rpe CDS complement(750491..751351) product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723063.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 gene rsgA CDS 751447..751746 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS complement(751814..753082) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948711.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS complement(753149..755122) product serine/threonine protein kinase PrkC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232062.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 gene prkC CDS complement(755119..755865) product protein-serine/threonine phosphatase Stp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888486.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS complement(755888..757189) product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572235.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 gene rsmB CDS complement(757186..758124) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161291.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 gene fmt CDS complement(758135..760516) product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830152.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 gene priA CDS complement(760516..761703) product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830125.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 gene coaBC CDS complement(761761..761955) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830123.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 gene rpoZ CDS complement(761955..762578) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368226.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 gene gmk CDS 762710..764410 product NFACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468918.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS complement(764911..765516) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040248.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 gene pyrE CDS complement(765518..766213) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654067.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 gene pyrF CDS complement(766235..767146) product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016381.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS complement(767143..767901) product dihydroorotate oxidase B electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983358.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 gene pyrK CDS complement(767919..769181) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108367.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 gene pyrC CDS complement(769147..770070) product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830068.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS complement(770071..771378) product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001178619.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS complement(771397..771918) product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003870.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 gene pyrR CDS complement(772153..773058) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830176.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS complement(773055..773534) product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549207.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 gene lspA CDS complement(773538..776276) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384691.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 gene ileS CDS complement(776528..777007) product septum site-determining protein DivIVA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221468.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 gene divIVA CDS complement(777018..777803) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000232511.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS complement(777856..778161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS complement(778173..778754) product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018608.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS complement(778764..779393) product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001548498.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS complement(779393..780172) product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830118.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 gene pgeF CDS complement(780243..781424) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830170.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 gene ftsZ CDS complement(781449..782945) product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391031.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 gene ftsA CDS complement(783051..784250) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS complement(784272..785609) product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935991.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 gene murD CDS complement(785611..786573) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578458.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 gene mraY CDS complement(786582..788636) product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439409.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS complement(788716..789093) product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830073.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 gene ftsL CDS complement(789105..790034) product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830134.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 gene rsmH CDS complement(790047..790478) product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480800.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 gene mraZ CDS complement(790618..792183) product bacillithiol biosynthesis cysteine-adding enzyme BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485008.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 gene bshC CDS 792296..792748 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244940.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS complement(792900..793073) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830121.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 gene rpmF CDS complement(793073..793594) product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872158.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS 793731..794864 product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843611.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS complement(794851..795348) product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401377.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 gene coaD CDS complement(795352..795891) product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001263796.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 gene rsmD CDS 795951..796322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830114.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS complement(796324..796587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS 796675..797595 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830132.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS complement(797687..798124) product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724095.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS 798251..798613 product YugN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160952.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS complement(798670..799137) product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830117.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS complement(799150..800109) product cytochrome c oxidase assembly factor CtaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069017.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 gene ctaG CDS complement(800248..800589) product cytochrome c oxidase subunit IVB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985698.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 gene ctaF CDS complement(800590..801216) product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557860.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 gene ctaE CDS complement(801216..803135) product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011371630.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 gene ctaD CDS complement(803138..804271) product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745268.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 gene coxB CDS complement(804302..805222) product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031401.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 gene cyoE CDS 805540..806436 product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470218.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS 806561..807571 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733112.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS complement(807609..808796) product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830097.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS complement(808836..809126) product YlaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830079.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS 809283..809768 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614712.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS complement(809818..810192) product YlaH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893654.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS complement(810217..812043) product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182654.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 gene typA CDS 812180..812371 product DUF5325 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810620.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS 812538..813098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS complement(813409..814221) product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082650.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS 814300..814914 product YktB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170603.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS complement(814978..815955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS complement(815979..816575) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229606.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 gene leuD CDS complement(816587..817999) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229604.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 gene leuC CDS complement(818022..819080) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399139.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 gene leuB CDS complement(819096..820661) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967929.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS complement(820691..821689) product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151741.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 gene ilvC CDS complement(821724..822239) product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399096.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 gene ilvN CDS complement(822227..823957) product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398643.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 gene ilvB CDS complement(824540..826252) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002937428.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 gene ilvD CDS complement(826291..827274) product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399225.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS complement(827517..828392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS complement(828461..828736) product UPF0223 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455597.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS complement(828801..830207) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000260117.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 gene lpdA CDS complement(830213..831523) product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002467591.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS complement(831548..832525) product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068176.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS complement(832528..833634) product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000035320.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 gene pdhA CDS complement(833798..834427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS 834536..835087 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957037.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 gene def CDS complement(835138..835410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS 835703..835921 product DNA-dependent RNA polymerase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257888.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS 835921..837606 product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831649.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS complement(837666..839279) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289289.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS complement(839298..840182) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289288.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS complement(840211..840624) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS complement(840952..841614) product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000514290.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS complement(841639..842664) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485881.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS complement(842661..844043) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485341.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS complement(844155..845456) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986777.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS complement(845538..847262) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000040051.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 gene ptsP CDS complement(847262..847528) product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437472.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS complement(847586..848062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS complement(848129..849022) product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207977.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 gene hutG CDS complement(849000..850259) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831698.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS complement(850520..851791) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101899.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 gene purD CDS 851964..852815 product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225836.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 gene folD CDS complement(852907..853869) product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783471.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS 853962..854684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS complement(854731..855243) product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163283.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS complement(855340..856017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS complement(856116..857894) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101381.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS complement(857992..858789) product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724008.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS 858888..859598 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627596.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS complement(859726..861093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS complement(861106..861927) product teichoic acids export ABC transporter permease subunit TagG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227928.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 gene tagG CDS complement(861965..863158) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS 863253..863648 product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721506.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 gene tagD CDS 863641..864792 product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989658.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS complement(864824..867478) product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103372260.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(867585..868772) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582958.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS complement(868854..870017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS 870125..871561 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS 871581..872045 product DUF2538 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831729.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS 872055..872480 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491986.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS complement(872504..874675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS complement(874685..874894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS complement(874907..875815) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS complement(875838..877925) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS complement(877925..878548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS complement(878548..878919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS complement(878885..880057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS complement(880070..880879) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362627.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS complement(881112..882074) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272436.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS complement(882061..882867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS complement(882864..884387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS complement(884390..884884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS 885103..885570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS 885645..885857 product DUF2187 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829339.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS 885977..887056 product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001833067.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS complement(887114..887971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS complement(887991..889340) product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021865.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS complement(889442..890893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS complement(890972..891748) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722856.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS complement(891999..893555) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049950.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS complement(893539..893799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS complement(893774..895273) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340119.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS complement(895402..896226) product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390125.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 gene tatC CDS complement(896238..897968) product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851097.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS complement(898145..898942) product gluconate 2-dehydrogenase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857555.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS complement(899032..900048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08850 note possible pseudo, internal stop codon CDS complement(900097..900315) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08860 note possible pseudo, internal stop codon CDS complement(900536..900694) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS 900711..901103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS complement(901124..901900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS complement(902046..903143) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829303.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS 903286..904011 product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288675.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS 904078..904587 product YjcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439146.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS complement(904623..905390) product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933195.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 gene fabI CDS complement(905473..906846) product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829287.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 gene mgtE CDS complement(906874..907668) product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270834.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS complement(907686..908306) product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077683.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS 908460..909047 product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224619.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS 909047..909415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043381.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS 909448..910248 product protease adaptor protein YjbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896697.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 gene yjbH CDS 910336..911022 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942636.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS complement(911023..911595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS complement(911595..912218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS complement(912248..913882) product b(o/a)3-type cytochrome-c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903627.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS complement(913887..914357) product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258287.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS complement(914376..914525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS complement(914835..916640) product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485413.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 gene pepF CDS complement(916695..917669) product competence protein CoiA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000959282.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS complement(917735..918403) product adaptor protein MecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217728.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 gene mecA CDS complement(918575..918973) product transcriptional regulator SpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829294.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 gene spxA CDS 919341..920342 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829285.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 gene trpS CDS complement(920820..922061) product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829324.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 gene fabF CDS complement(922061..923017) product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100526.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS complement(923168..925018) product oligopeptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287894.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS complement(925192..926280) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000960845.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS complement(926294..927256) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000265442.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS complement(927265..928197) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196374.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS complement(928194..929243) product oligopeptide ABC transporter ATP-binding protein Opp2D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365359.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 gene opp2D CDS 929546..929743 product YjzD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829320.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS 929850..931349 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439580.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 gene glpK CDS 931378..933036 product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439581.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS complement(933141..935732) product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829334.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 gene clpB CDS 935896..936720 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434794.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS complement(936763..937071) product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390575.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS 937196..938017 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182436.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS 938031..938873 product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245785.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS 938876..940213 product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829263.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS complement(940271..941698) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS complement(941853..942239) product YisL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902805.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS complement(942293..943183) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670752.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS complement(943234..944337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS complement(944330..947788) product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154921.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 gene addA CDS complement(947781..951260) product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172350.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 gene addB CDS complement(951333..951863) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831955.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 gene lepB CDS complement(951876..952475) product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732411.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS complement(952588..953376) product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000537825.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 gene trpA CDS complement(953369..954577) product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105014.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 gene trpB CDS complement(954570..955142) product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723935.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS complement(955177..955953) product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000536690.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 gene trpC CDS complement(955950..956993) product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723937.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 gene trpD CDS complement(958124..959368) product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138487.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS complement(959426..960625) product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167314.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS complement(960896..961273) product S1 domain-containing post-transcriptional regulator Ygs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067294.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 gene ygs CDS complement(961466..961672) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS complement(961832..962422) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000035058.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS 962629..965028 product Na+/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832516.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS 965012..965479 product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228819.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS 965479..965820 product Na+/H+ antiporter Mnh1 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831949.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 gene mnhC1 CDS 965810..967303 product Na+/H+ antiporter Mnh1 subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573077.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 gene mnhD1 CDS 967304..967783 product Na+/H+ antiporter Mnh1 subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290674.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 gene mnhE1 CDS 967780..968079 product Na(+)/H(+) antiporter subunit F1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722409.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS 968051..968473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS complement(968522..968896) product 1,4-dihydroxy-2-naphthoyl-CoA thioesterase MenI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722411.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 gene menI CDS complement(968889..970379) product M17 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009692.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS complement(970392..970715) product YuiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027016.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS complement(970782..971993) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046076.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS complement(972098..972457) product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143495.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS complement(972543..972788) product YuzB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831896.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS complement(972847..973089) product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431159.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS complement(973184..973714) product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963535.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS complement(973805..974566) product TIGR01457 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831998.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS complement(974559..974987) product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831932.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS complement(975047..975388) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS complement(975443..977026) product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048829.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS complement(977313..978632) product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831906.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS complement(978644..979465) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000927632.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS complement(979478..980326) product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608129.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS 980376..981077 product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232774.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS 981077..981832 product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232776.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 gene fetB CDS 981829..982761 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072362001.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS complement(982813..984255) product D-xylose transporter XylE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202803.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 gene xylE CDS complement(984276..985757) product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245233.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 gene xylB CDS complement(985760..987082) product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245235.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 gene xylA CDS 987217..988365 product xylose repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244935.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS complement(988414..989421) product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS complement(989560..990111) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002445400.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS complement(990178..990573) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS complement(990696..992117) product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889640.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS complement(992260..993657) product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484542.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 gene sufB CDS complement(993677..994117) product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831954.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS complement(994107..995333) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006450.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS complement(995354..996667) product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205567.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 gene sufD CDS complement(996683..997468) product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929158.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 gene sufC CDS complement(997689..998033) product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206114.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS complement(998151..998507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS 998675..999580 product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015052.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 gene ctaB CDS complement(999708..1000550) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732324.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS complement(1000588..1001280) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000520231.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS complement(1001277..1002299) product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242531.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 gene metN CDS complement(1002523..1002837) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831936.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS complement(1002788..1003195) product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831968.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS complement(1003292..1003672) product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290491.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 gene gcvH CDS complement(1003740..1004096) product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831965.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS complement(1004312..1005028) product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831974.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 gene aroD CDS complement(1005361..1005768) product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457221.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS complement(1005857..1006057) product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831967.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 tmRNA complement(1006192..1006549) product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(1006620..1007090) product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829588.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 gene smpB CDS complement(1007097..1009388) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050048.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 gene rnr CDS complement(1009410..1010159) product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829672.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS complement(1010290..1010520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS 1010718..1011620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS complement(1012053..1013351) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228333.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 gene eno CDS complement(1013388..1014908) product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829591.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 gene gpmI CDS complement(1014905..1015660) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829574.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 gene tpiA CDS complement(1015665..1016861) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357094.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS complement(1017096..1017350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS complement(1017355..1017816) product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829634.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS complement(1017827..1018615) product threonine/serine exporter ThrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113406.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 tRNA complement(1018636..1018708) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS 1018907..1019491 product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829659.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 gene clpP CDS 1019594..1020511 product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684382.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS complement(1020572..1021516) product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438915.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 gene whiA CDS complement(1021544..1022518) product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248939.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS complement(1022505..1023389) product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829594.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 gene rapZ CDS complement(1023496..1024431) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134963.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 gene trxB CDS complement(1024491..1025912) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057543.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS complement(1025909..1026394) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832606.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS complement(1026396..1027286) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513305.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 gene lgt CDS complement(1027283..1028215) product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829649.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 gene hprK CDS complement(1028317..1029468) product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732499.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS complement(1029481..1032309) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485563.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 gene uvrA CDS complement(1032315..1034288) product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229241.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 gene uvrB CDS complement(1034366..1034611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS complement(1034616..1035251) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468687.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS complement(1035252..1035839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS complement(1036057..1036227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS complement(1036675..1038159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS complement(1038478..1038795) product cytochrome c-551 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727964.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 gene cccB CDS complement(1038816..1039865) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010959142.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 gene prfB CDS complement(1039933..1042458) product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829572.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 gene secA CDS complement(1042598..1043158) product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829676.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 gene raiA CDS complement(1043202..1043885) product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057965.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS complement(1043882..1045126) product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171004420.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS complement(1045186..1046058) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722646.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS 1046136..1046765 product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829639.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS complement(1046766..1047692) product undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829686.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS 1047959..1049008 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002494710.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS complement(1049037..1049357) product bacillithiol system redox-active protein YtxJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985617.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 gene ytxJ CDS 1049464..1049715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS complement(1049720..1050613) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS 1050745..1051668 product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608433.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 gene murB CDS 1051692..1051877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS complement(1051900..1053033) product siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754443.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS complement(1053141..1053956) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889549.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS complement(1053953..1054906) product petrobactin ABC transporter permease YclO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246705.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 gene yclO CDS complement(1054899..1055864) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438902.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS complement(1056010..1056681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS complement(1056731..1057144) product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398648.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS complement(1057324..1058292) product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829597.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 gene nrdF CDS complement(1058306..1060411) product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855514.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 gene nrdE CDS complement(1060395..1060790) product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829589.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 gene nrdI CDS 1061151..1062023 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861195.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS complement(1062536..1064323) product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983677.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 gene recQ CDS complement(1064504..1065451) product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830359.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS complement(1065453..1065710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS complement(1065724..1065930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS complement(1065939..1067618) product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722110.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 gene pabB CDS complement(1067596..1068198) product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880323.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS 1068353..1069537 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503245.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS 1069628..1069888 product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641172.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS complement(1069865..1070404) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS complement(1070459..1070899) product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001856133.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS complement(1070906..1072636) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116641.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS complement(1072633..1074369) product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493192.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS complement(1074705..1075694) product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399251.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS complement(1075718..1076125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS 1076334..1076822 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS 1076961..1078268 product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385652.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS complement(1078324..1079292) product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723587.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS complement(1079440..1080861) product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111696045.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 gene nhaC CDS complement(1080878..1082026) product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048339.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 gene iadA CDS complement(1082219..1083397) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114987.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS complement(1083419..1083628) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS complement(1083647..1084549) product transcriptional regulator BsdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246552.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 gene bsdA CDS 1084674..1085897 product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114593.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS complement(1085915..1086790) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814413.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS 1086964..1087803 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402219.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS complement(1088245..1088415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS complement(1088412..1088741) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS complement(1088748..1089182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS complement(1089186..1089647) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228335.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS complement(1089669..1089866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS 1089980..1090543 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767065.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS 1090565..1090759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS complement(1090814..1091230) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS complement(1091301..1092005) product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821952.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS 1092161..1093417 product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837693.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS 1093458..1094183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS 1094176..1094667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS 1094695..1095141 product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837587.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS 1095330..1096412 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829303.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS complement(1096484..1097227) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003782.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS complement(1097321..1098154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS complement(1098410..1099660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS complement(1099825..1100658) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136699529.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS complement(1100674..1101384) product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821952.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS complement(1101425..1101691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10950 note possible pseudo, frameshifted CDS complement(1101654..1101953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS 1102127..1102741 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS complement(1102794..1103282) product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101517.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS complement(1103381..1103866) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222818.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS complement(1103886..1105502) product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272455.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS 1105964..1106941 product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680783.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 gene rsgA CDS 1106988..1108538 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288026.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS complement(1108624..1109568) product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385089.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS complement(1109862..1110713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS 1110937..1112589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS 1112589..1112888 product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075358.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS complement(1112959..1113378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS complement(1113375..1113524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS complement(1113544..1114035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS complement(1114407..1114688) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159787.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS complement(1114855..1115487) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065051.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS complement(1115634..1116455) product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261175.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS complement(1116475..1117758) product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975184.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS complement(1117755..1118255) product 2,3-diketo-L-gulonate TRAP transporter small permease YiaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821445.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 gene yiaM CDS complement(1118267..1119274) product 2,3-diketo-L-gulonate transporter substrate-binding protein YiaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776911.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 gene yiaO CDS complement(1119276..1119953) product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562698.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS 1120507..1120812 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11170 note possible pseudo, internal stop codon CDS 1120884..1121813 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101217.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS complement(1121890..1123284) product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228420.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 gene hydA CDS complement(1123301..1123606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS complement(1123719..1125077) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450257.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS complement(1125295..1126842) product amino acid ABC transporter ATP-binding/permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857598.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS complement(1126839..1128404) product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737162.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS complement(1128462..1129487) product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230173.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 gene moaA CDS complement(1129499..1130065) product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049464.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS complement(1130067..1130300) product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438518.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 gene moaD CDS complement(1130301..1130744) product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808495.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS complement(1130731..1131201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS complement(1131202..1132461) product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000259717.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS 1132561..1133037 product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094151.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 gene moaC CDS complement(1133449..1133955) product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503822.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS complement(1133968..1134969) product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076930.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS 1135175..1135867 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990006.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS 1135868..1137649 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722633.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS complement(1137754..1138437) product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401352.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 gene ric CDS 1138575..1139543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS 1139569..1140150 product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366891.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS complement(1140181..1140744) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989729.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(1140765..1141100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS complement(1141113..1141364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS complement(1141470..1143149) product glutathione ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211308.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS complement(1143501..1145177) product glutathione ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211308.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS complement(1145663..1146634) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922580.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS complement(1146664..1147329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS complement(1147331..1148605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS complement(1148724..1149503) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS complement(1149549..1151225) product dipeptide ABC transporter substrate-binding protein DppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222871.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 gene dppA CDS 1151536..1152444 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453817.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS 1152457..1153377 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928488.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS 1153393..1154400 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034325.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS 1154390..1155493 product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108438.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS complement(1155634..1156116) product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152582.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS complement(1156116..1157321) product sugar efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832093.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS complement(1157337..1158197) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832044.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(1158244..1158780) product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832140.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS complement(1158878..1160836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS complement(1160808..1161713) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385582.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS complement(1161710..1162090) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987070.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS 1162306..1163313 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356130.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene argF CDS 1163335..1164375 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393773.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 gene argC CDS 1164388..1165611 product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393772.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 gene argJ CDS 1165622..1166527 product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940826.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 gene argB CDS 1166524..1167735 product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082331.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS complement(1167786..1168571) product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403503.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS complement(1168590..1169309) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832120.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS complement(1169356..1170270) product auxiliary protein GraX/ApsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802955.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 gene graX CDS complement(1170281..1171432) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873235.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS complement(1171538..1172728) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706715.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS complement(1172799..1173302) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405853.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS 1173416..1173697 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS complement(1173755..1174393) product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549576.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS 1174566..1175552 product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246230.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS 1175920..1176444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11730 note possible pseudo, internal stop codon CDS 1176517..1176921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS 1176918..1178228 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973025.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS 1178420..1179859 product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706437.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(1180119..1181096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS complement(1181428..1182177) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047750.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS complement(1182344..1182742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS complement(1182949..1183587) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227736.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS 1183684..1184163 product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002404288.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 gene ybaK CDS complement(1184212..1186347) product ATP-dependent protease ATP-binding subunit ClpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967104.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 gene clpE CDS 1186647..1187015 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427427.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS 1187008..1187889 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804332.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS 1187876..1188568 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS complement(1188555..1188737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS complement(1189136..1190095) product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272954.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS complement(1190135..1191076) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101884.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS complement(1191174..1192142) product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243992.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS complement(1192254..1192583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS complement(1192782..1194278) product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993830.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS 1194390..1195217 product multidrug efflux transcriptional regulator BltR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229881.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 gene bltR CDS 1195295..1195453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS complement(1195553..1196362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS complement(1196557..1198023) product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722477.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 gene gcvPB CDS complement(1198016..1199368) product aminomethyl-transferring glycine dehydrogenase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903240.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 gene gcvPA CDS 1199700..1200320 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861647.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS complement(1200364..1202166) product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334463.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 gene glmS CDS complement(1202755..1202949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS 1203120..1203653 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228444.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS complement(1203715..1205067) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457133.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 gene glmM CDS complement(1205092..1206039) product YbbR-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894032.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS complement(1206026..1206880) product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829928.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 gene cdaA CDS complement(1206870..1207817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS 1207960..1208406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS complement(1208430..1209335) product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167867.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 gene rocF tRNA complement(1209475..1209547) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 tRNA complement(1209564..1209637) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 tRNA complement(1209644..1209727) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 tRNA complement(1209737..1209811) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA complement(1209832..1209906) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 tRNA complement(1209918..1209992) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 sequence02 source 1..434568 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(389..985) product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559159.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 gene recR CDS complement(986..1309) product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213992.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS complement(1380..3017) product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109040.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 gene dnaX CDS complement(3447..4433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(4426..5226) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930637.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS complement(5345..5800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS 5993..6910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS 7000..7446 product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369299.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS complement(7472..8707) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674341.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS complement(8726..10081) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564318.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS complement(10088..10909) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569669.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS complement(10920..11813) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564323.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS complement(11803..12858) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674342.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS 13186..13602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS complement(13709..15445) product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851097.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS complement(15464..16252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS 16422..16865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS complement(17110..17895) product VLRF1 family aeRF1-type release factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399450.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS complement(18001..19203) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905157.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS complement(19287..20699) product FAD/NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261668.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS 20921..21445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS 21457..21978 product spermidine/spermine N(1)-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244000.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 gene paiA CDS 21998..23194 product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989624.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS complement(23239..23463) product DUF896 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721282.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS 23611..24147 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026192141.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS complement(24167..24766) product two-component system response regulator DesR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399356.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 gene desR CDS complement(24759..25895) product two-component sensor histidine kinase DesK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231271.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 gene desK CDS complement(25994..27022) product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171504.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS complement(27124..27885) product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870429.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS complement(27941..29161) product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121855.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS complement(29184..30125) product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227545.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 gene speB CDS complement(30204..31043) product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244033.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS complement(31094..33232) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106518812.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS complement(33336..34613) product homocysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392822.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS 34775..35572 product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867951.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS complement(35610..35936) product branched-chain amino acid transporter AzlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245988.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 gene azlD CDS complement(35936..36643) product azaleucine resistance protein AzlC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969035.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 gene azlC CDS complement(36669..37223) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071745902.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS complement(37335..37805) product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293607.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS complement(37851..39287) product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843974.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 gene nhaC CDS complement(39306..40052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS complement(40064..41065) product proline racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260278.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS complement(41062..42240) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001215247.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS 42391..43755 product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885717.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS 43813..44091 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182232.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS 44084..44416 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087065.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS 44409..45575 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286089.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS 45710..46909 product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002662392.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 gene rpoN CDS complement(46962..47843) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169452.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 gene dapA CDS complement(47936..48466) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357340.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS complement(48491..49978) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920973.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS complement(50131..50400) product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831302.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 gene rpsN CDS complement(50483..50830) product DUF2200 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288180.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS 50925..51818 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS 51917..52699 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS 52861..54039 product N-acetyl amino acid acetylase SndC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245681.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 gene sndC CDS 54056..54853 product DUF3100 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016874.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS 54858..55310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029492212.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS complement(55460..55858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS complement(55999..57645) product glycine betaine transporter OpuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229220.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 gene opuD CDS 58071..58538 product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016571.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 repeat_region 58587..59804 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gctttaccactttctaaacgatcatagttctaaaac CDS complement(59867..60736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS complement(60733..61041) product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475522.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 gene cas2 CDS complement(61065..61940) product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681291.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 gene cas1 CDS complement(61942..66012) product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040087.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 gene cas9 CDS complement(66310..67209) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765521.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS complement(67360..67800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS complement(67868..69277) product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966488.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS 69701..70981 product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986589.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 gene codB CDS 70971..72230 product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417767.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS 72334..72573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS 72655..72810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS 72810..73457 product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687920.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS complement(73987..75126) product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861810.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS 75268..76260 product acryloyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233163.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS complement(76302..77669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029515.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS complement(77699..79297) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049572.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS 79545..80225 product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242513.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 tRNA 80280..80352 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 CDS complement(80392..81030) product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687254.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS complement(81215..82243) product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836873.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS complement(82324..82623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS complement(82707..83555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS complement(83572..85443) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582658.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS complement(85969..87726) product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851097.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS complement(87726..88535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS 89264..89458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS 89498..90226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS 90337..92481 product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047293.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 gene topB CDS complement(92537..93223) product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808611.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS complement(93388..94308) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706198.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS 94441..95355 product DNA-3-methyladenine glycosidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234926.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 gene alkA CDS 95426..96895 product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711525.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 gene nhaC CDS 97215..97352 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS 97368..98261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS 98270..98497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS 98517..98957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS 98983..100158 product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994025.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 gene pepQ CDS 100182..101306 product tyramine oxidase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014462.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS complement(101344..102339) product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939915.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS complement(102465..104009) product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829351.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 gene guaA CDS complement(104024..105493) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829407.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 gene guaB CDS 105755..106135 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS complement(106152..106700) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS complement(106712..106843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS complement(106968..107720) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS 107847..108446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS 108503..109240 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563450.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS complement(109326..110060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS complement(110220..110459) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831354.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 gene rpsR CDS complement(110601..111383) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956429.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS complement(111385..111711) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116416.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS complement(112048..112692) product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014906541.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 gene modB CDS complement(112718..113503) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243706.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 gene modA CDS complement(113619..114515) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775841.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 gene modA CDS complement(114737..115237) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831333.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 gene ssb CDS complement(115264..115566) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244064.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 gene rpsF CDS complement(115763..116863) product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524657.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 gene ychF CDS complement(116877..117065) product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728659.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS complement(117069..117998) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832526.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS complement(118017..118790) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485220.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS complement(118889..119701) product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831794.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 gene noc CDS complement(119718..120431) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019628.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 gene rsmG CDS complement(120428..122311) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831818.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 gene mnmG CDS complement(122329..123705) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831768.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 gene mnmE CDS complement(123719..124549) product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387430.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS complement(124565..124903) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723727.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 gene rnpA CDS complement(125016..125153) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS 125591..126934 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242674.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 gene dnaA CDS 127104..128237 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831813.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 gene dnaN CDS 128428..128646 product ribosome maturation protein RlbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226810.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 gene rlbA CDS 128643..129746 product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831795.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 gene recF CDS 129761..131680 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831817.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 gene gyrB CDS 131697..134264 product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831812.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 gene gyrA CDS complement(134994..135203) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816366.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS complement(135200..135667) product DUF2975 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295138.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS 135834..136277 product hut operon transcriptional regulator HutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926516.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 gene hutP CDS 136375..137865 product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177465.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 gene hutH CDS 137914..139572 product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226823.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 gene hutU CDS 139572..140804 product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998753.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 gene hutI CDS 141109..142386 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485584.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 gene serS CDS 142462..143382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS 143385..145361 product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072710106.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS 145358..145804 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226915.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 gene rplI CDS 145829..147217 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831779.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 gene dnaB CDS 147335..148621 product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470559.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 tRNA 149238..149310 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 tRNA 149342..149417 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 CDS 149538..150236 product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831816.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 gene yycF CDS 150237..152087 product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871607.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 gene walK CDS 152080..153396 product YycH family regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831744.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS 153396..154133 product two-component system regulatory protein YycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831750.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 gene yycI CDS 154139..154927 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088649.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS 155243..155722 product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002458513.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 gene rlmH CDS complement(155947..156246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS complement(156246..156554) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS 156715..157425 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS 157562..158014 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS complement(158310..159476) product malate:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078186907.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS complement(159439..159744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS complement(159857..160540) product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832367.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS complement(160537..160923) product holin-like murein hydrolase modulator CidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549734.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 gene cidA CDS complement(161078..161962) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832366.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS complement(162564..164369) product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287387.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS complement(164646..164957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS complement(164977..166695) product bifunctional glycosyltransferase family 2 protein/CDP-glycerol:glycerophosphate glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485939.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 note possible pseudo, frameshifted CDS complement(166688..168289) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832460.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS complement(168582..168893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS complement(168944..169291) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000556078.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS complement(169403..170125) product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244958.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS complement(170263..171009) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682266.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS complement(171009..172127) product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 gene ugpC CDS complement(172157..173047) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963750.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS complement(173040..173951) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963749.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS complement(174072..175409) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963751.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS complement(175447..176268) product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258662.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS 176534..177100 product glycerol-3-phosphate responsive antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472011.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS 177465..178466 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804399.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS complement(178596..179453) product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778349.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS 179620..180204 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13830 tRNA complement(180284..180367) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 CDS 180502..181149 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355190.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS complement(181201..182157) product 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002477137.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS complement(182295..183014) product lytic transglycosylase SceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000752005.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 gene sceD CDS complement(183333..184940) product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831122.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS complement(185098..186750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS 186894..187484 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943862.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS 187603..188025 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000475805.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS complement(188068..189153) product maltodextrin ABC transporter ATP-binding protein MsmX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242648.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 gene msmX CDS 189309..189731 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000475805.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS 189763..191244 product L-lactate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829441.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 gene lqo CDS complement(191752..192885) product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839746.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS 193032..193322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS complement(193379..194113) product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726296.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS complement(194292..195419) product NADH-dependent flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838029.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS complement(195516..197774) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829332.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS 197913..198302 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS 198450..199997 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000038527.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS 200023..201243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS 201240..202346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS 202339..202995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS 203107..203598 product trimethoprim-sensitive dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360302.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 gene dfr CDS complement(203644..204225) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181746.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS 204369..207605 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS complement(207659..208225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS 208369..209214 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398819.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS complement(209328..209960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS 210078..210812 product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224298.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS 211086..211679 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886529.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS 211763..212644 product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242581.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS complement(212707..213273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS complement(213479..214561) product diglucosyl diacylglycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258645.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS complement(214731..215522) product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002489230.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS complement(215515..216921) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485331.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS complement(216924..217505) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831663.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS complement(217717..218127) product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263290.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 gene queD CDS 218290..220050 product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231470.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 gene ggt CDS complement(220097..221299) product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831403.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 gene gltS CDS 221454..221705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS 221929..222111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS complement(222122..222508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS complement(222625..224118) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056367.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS complement(224202..224465) product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616592.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS 224600..225019 product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071904.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS 225129..226463 product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126606.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 gene glnA CDS complement(226507..227235) product (S)-benzoin forming benzil reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271070.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS complement(227274..228713) product polyphosphate--AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830598.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS 229160..230206 product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002495598.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 gene ribD CDS 230191..230805 product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987155.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 gene ribE CDS 230798..231967 product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456445.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 gene ribB CDS 231981..232448 product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008549.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 gene ribE CDS 232466..232945 product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803711.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS complement(232991..236008) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803933.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS complement(236138..236479) product DUF6176 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027779.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS 236646..238097 product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117523.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS 238116..238520 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282781.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS 238657..240177 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035359.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS 240178..240513 product DUF779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057670999.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS complement(240562..242781) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS complement(242864..243070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS 243231..243545 product As(III)-sensing metalloregulatory transcriptional repressor ArsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120603.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 gene arsR CDS 243546..244835 product arsenite efflux transporter membrane subunit ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186433708.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 gene arsB CDS 244848..245249 product thioredoxin-dependent arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358995.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS complement(245292..246563) product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014902978.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS complement(246587..247642) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832177.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS complement(247655..248761) product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403270.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 gene menC CDS complement(248758..249564) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042382595.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS 249770..250210 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111427.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS 250229..250786 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14510 note possible pseudo, frameshifted CDS 250770..251183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14520 note possible pseudo, frameshifted CDS 251198..252091 product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234172.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS 252103..252717 product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287766.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS 252736..253335 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400021.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS 253446..254153 product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016437.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS 254235..254945 product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861815.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS 255033..256709 product glutathione ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211308.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS complement(256750..257430) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003739396.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS 257544..258176 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123715.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS 258195..259547 product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232543.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 gene mgtE CDS complement(259577..260608) product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905873.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS 260746..261528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS complement(261640..262212) product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002994966.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS 262333..262977 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476586.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS 263116..264969 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102165.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS 265059..265280 product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703288.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS 265376..265726 product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116259.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS complement(265772..266677) product iron-hydroxamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732576.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS complement(266773..267804) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072771516.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS complement(267801..268856) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733843.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS complement(268849..269652) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212068.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS complement(269774..270256) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS 270417..271274 product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005523.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS 271284..271871 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289673.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS 271893..272711 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831948.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS 272754..273602 product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183854.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS 273775..274644 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019127.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS complement(274696..274980) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS complement(275043..275957) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222593.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS 276079..277170 product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930625.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS 277185..278543 product aromatic acid/H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206209.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS 278717..279859 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954799.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS complement(279903..280367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS complement(280379..281716) product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763119.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS 281851..282528 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781969.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS 282525..283910 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839485.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS 283993..285021 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477770.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS 285024..285698 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286060.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS 285804..287213 product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889640.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS complement(287262..287927) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485259.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS complement(287965..289326) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861492.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS 289454..290392 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589248.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS 290389..291906 product ABC transporter permease/substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180991.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS complement(292001..292843) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003709302.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS complement(292918..294012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830606.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS complement(294024..295127) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485476.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS 295316..296044 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768018.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS 296192..297700 product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460243.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS complement(297804..299762) product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438166.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS complement(299881..300909) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145775434.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS complement(301219..301506) product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219429.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS 301651..302457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS 302454..303059 product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944149.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 gene hisG CDS 303056..304288 product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829419.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 gene hisD CDS 304290..305276 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639184.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS 305269..305853 product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640266.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 gene hisB CDS 305895..306596 product 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829444.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 gene hisA CDS 306593..307354 product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829431.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 gene hisF CDS 307354..307977 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15100 note possible pseudo, frameshifted CDS complement(308042..308200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS complement(308217..308909) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS complement(308910..309113) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS 309301..309546 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15140 note possible pseudo, frameshifted CDS 309620..309961 product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536339.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS complement(309998..310462) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356863.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS complement(310478..310831) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829969.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS complement(310880..311416) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174573.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS complement(311429..312046) product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255551.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS 312276..313730 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832531.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS 313765..314109 product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944052.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS complement(314138..314686) product DUF4256 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138383.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS 314773..315561 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637470.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS 315762..316085 product multidrug efflux SMR transporter subunit YkkC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232583.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 gene ykkC CDS 316082..316399 product multidrug efflux SMR transporter subunit YkkD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245695.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 gene ykkD CDS complement(316461..317450) product ferredoxin--NADP reductase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220618.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 gene yumC CDS complement(317593..318756) product multidrug efflux MFS transporter NorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458987.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 gene norA CDS 318851..319768 product CDF family zinc transporter CzcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229873.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 gene czcD CDS 319782..320888 product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173644.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS complement(320936..322564) product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088978.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS complement(322762..324033) product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705259.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS complement(324056..325591) product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868784.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS 325803..326675 product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922353.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS 326744..327517 product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521698.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS 327646..328548 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS 328652..329326 product two-component system response regulator YkoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232551.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 gene ykoG CDS 329331..330704 product two-component system sensor histidine kinase YkoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245526.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 gene ykoH CDS 330688..331512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS 331584..332018 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000376235.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS 332126..332635 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704720.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS 332666..333865 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243239.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS complement(333932..335359) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001206093.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS complement(335455..335802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS 335988..337013 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002469429.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS 337235..338743 product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438863.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS complement(338798..339787) product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829391.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS 339954..340949 product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878139.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS 340954..341469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS 341473..343692 product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195227.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS complement(343758..345326) product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957020.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 gene putP CDS complement(345565..346005) product YtoQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229263.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS 346110..346778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS 346789..347121 product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832425.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS 347295..348800 product malate:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078186907.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS complement(348849..349937) product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485214.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS 350132..351016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS 351155..352138 product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432434.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 gene guaC CDS complement(352680..353528) product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428643.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS 353949..354986 product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964210.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 gene aroF CDS 355001..355291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS complement(355318..356241) product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462040.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 gene metA CDS 356372..357685 product Na+/H+ antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606324.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS 357892..358068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS 358148..358930 product N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002477136.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS complement(359063..359860) product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227709.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 gene fdhD CDS 359977..361239 product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938460.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS 361279..363636 product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256094.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS 363755..365101 product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972545.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS 365244..366581 product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126606.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 gene glnA CDS complement(366626..368293) product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001800966.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS 368522..369637 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721699.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS complement(369720..371318) product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830903.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 gene serA CDS complement(371305..372453) product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291420.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS complement(372515..373567) product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906251.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS complement(373638..373886) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS 373955..375205 product lipid II:glycine glycyltransferase FemX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438530.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS complement(375283..375558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS complement(375571..375888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS complement(375885..377039) product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932658.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS complement(377057..377224) product SE1832 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829790.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS 377441..378079 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246558.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS 378103..379434 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800700.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS 379728..380036 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118667.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 gene rpsJ CDS 380060..380722 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160212.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 gene rplC CDS 380744..381364 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829775.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 gene rplD CDS 381364..381636 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829755.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 gene rplW CDS 381671..382501 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985472.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 gene rplB CDS 382556..382831 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829710.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 gene rpsS CDS 382867..383250 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829734.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 gene rplV CDS 383272..383913 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829791.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 gene rpsC CDS 383932..384366 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926310.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 gene rplP CDS 384356..384565 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644737.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 gene rpmC CDS 384584..384847 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829723.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 gene rpsQ CDS 384878..385246 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829742.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 gene rplN CDS 385274..385582 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558200.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 gene rplX CDS 385608..386147 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080824.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 gene rplE CDS 386167..386352 product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829713.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS 386382..386780 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829768.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 gene rpsH CDS 386807..387343 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091975.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 gene rplF CDS 387368..387730 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829747.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 gene rplR CDS 387752..388255 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113851.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 gene rpsE CDS 388270..388449 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096577.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 gene rpmD CDS 388477..388917 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766074.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 gene rplO CDS 388917..390218 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616784.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 gene secY CDS 390237..390884 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021468.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS 391024..391242 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118443.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 gene infA CDS 391411..391776 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829703.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 gene rpsM CDS 391806..392195 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101625.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 gene rpsK CDS 392276..393220 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569649.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS 393240..393638 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829718.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 gene rplQ CDS 393788..394576 product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255784.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS 394573..395433 product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406513.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS 395426..396223 product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399656.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS 396229..396963 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221853.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 gene truA CDS 397139..397576 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250038.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 gene rplM CDS 397596..397988 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829714.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 gene rpsI CDS complement(398038..398421) product methylglyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243237.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 gene glxB CDS 398553..399233 product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816741.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS 399302..400018 product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399223.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS 400152..401135 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS complement(401188..402570) product uracil/xanthine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298336.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS 402771..403214 product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708761.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS 403230..404153 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497489.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS complement(404205..404582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS complement(404626..405036) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889137.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS 405270..406916 product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461634.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS 407069..408466 product NCS1 family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272625.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS 408558..409493 product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185431.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 gene corA CDS 409494..409868 product iron chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989448.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS 410012..410956 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS 410967..411947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16310 note possible pseudo, frameshifted CDS 411992..412132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS 412206..412715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS complement(412809..414257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS 414482..414763 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS 414767..415729 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594067.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS complement(415783..416961) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002437853.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS 417338..418438 product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930625.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS 418505..419098 product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889235.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS 419116..419523 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS 419545..420324 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998268.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS 420527..420991 product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070866.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS complement(421049..421708) product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701679.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS complement(421787..422638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS complement(422635..423510) product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458883.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS complement(423498..424232) product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902059.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS complement(424245..425171) product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775387.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS complement(425298..426011) product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399223.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS 426123..426443 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830950.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS 426459..427760 product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243952.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS 427782..428930 product UDPGP type 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485391.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS 428930..429640 product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047255.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS 429708..430508 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779749.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 gene proC CDS 430577..432127 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229333.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS 432218..433267 product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958531.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS 433264..434031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16560 sequence03 source 1..248755 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 174..1418 product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812829.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS 1415..2044 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243137.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 gene tmk CDS 2044..2373 product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832200.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS 2375..3280 product DNA polymerase III subunit delta' C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468610.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS 3290..4099 product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001134194.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS 4099..4410 product DNA replication initiation control protein YabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832238.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 gene yabA CDS 4449..5189 product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457100.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS 5176..5430 product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903691.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS 5433..6245 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279926.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 gene rsmI CDS complement(6283..6561) product transition state genes transcriptional regulator AbrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226760.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 gene abrB CDS 6786..8750 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355813.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 gene metG CDS 8767..9531 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002458670.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS 9648..10205 product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226752.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 gene rnmV CDS 10202..11086 product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832224.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 gene rsmA CDS 11162..11428 product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832193.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS 11542..12633 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417572.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS 12633..13196 product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028429.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS complement(13445..14008) product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856821.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS 14182..15087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS 15100..15801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS 15976..16821 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170849.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS 16822..17523 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS 17706..18551 product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832203.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 gene ispE CDS 18614..19444 product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269643.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 gene purR CDS 19475..19849 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832217.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS 19930..20373 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS 20478..21833 product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832214.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 gene glmU CDS 21850..22827 product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107420.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS 22943..23596 product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485035.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS 23663..24235 product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226727.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 gene pth CDS 24228..27698 product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484485.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 gene mfd CDS 27695..28873 product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832236.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS 28860..29132 product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194330.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS 29210..29599 product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476303.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS 29681..30061 product S1 domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218379.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS 30129..31385 product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176709.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 gene tilS CDS 31369..31911 product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551283.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 gene hpt CDS 31984..34062 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167888.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 gene ftsH CDS 34200..35072 product redox-regulated molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226695.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 gene hslO CDS 35143..36078 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244491.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 gene cysK CDS 36222..37019 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167944.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 gene folP CDS 37012..37386 product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027113.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 gene folB CDS 37377..37853 product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582990.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 gene folK CDS 37901..39388 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288202.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 gene lysS tRNA 39511..39586 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 tRNA 39607..39681 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 tRNA 39703..39777 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 CDS complement(39875..41197) product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287244.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS 41321..42130 product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS complement(42179..43390) product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547794.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS 43609..44076 product CtsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551762.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS 44081..44593 product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942740.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS 44586..45599 product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149502.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS 45602..48046 product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897132.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS complement(48096..49574) product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246124.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 gene trpE CDS 49787..51166 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002445730.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 gene radA CDS 51182..52234 product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832313.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS 52231..52902 product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288284.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 gene ispD CDS 52910..53392 product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488386.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 gene ispF CDS 53392..54843 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283792.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 gene gltX CDS 55090..55746 product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476500.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 gene cysE CDS 55730..57124 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631969.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 gene cysS CDS 57117..57518 product mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399685.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS 57515..58258 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002494715.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 gene rlmB CDS 58261..58785 product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664737.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS 58846..59499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS 59665..59841 product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074473.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 gene secE CDS 59860..60399 product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288302.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 gene nusG CDS 60549..60974 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003718336.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 gene rplK CDS 61037..61735 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832314.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 gene rplA CDS 61954..62460 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832306.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 gene rplJ CDS 62506..62871 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273586.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 gene rplL CDS 62962..63549 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304012.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS 63786..67328 product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918667.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 gene rpoB CDS 67368..70988 product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438689.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 gene rpoC CDS 71298..71717 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142337.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 gene rpsL CDS 71787..72257 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137495.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 gene rpsG CDS 72317..74398 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832287.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 gene fusA CDS 74525..75709 product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832289.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 gene tuf CDS complement(75776..76951) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732150.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS complement(76951..78138) product N-acetyl amino acid acetylase SndC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245681.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 gene sndC CDS complement(78129..79316) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002494717.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS 79480..80670 product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250823.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS 80702..81655 product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723301.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS 81689..82390 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416645.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS 82383..82856 product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832295.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 gene tadA CDS complement(82894..83772) product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134236.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 gene folE2 CDS complement(83784..84458) product bacillithiol biosynthesis deacetylase BshB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000129068.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 gene bshB2 CDS complement(84470..84838) product YojF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001557152.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS complement(84902..85735) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185462.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 gene thiD CDS 85856..86521 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455256.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS 86514..86756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS 86771..87043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS 87064..87429 product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765183.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS 87595..87969 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462187.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS 87966..88844 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462188.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS 88848..89516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS complement(89586..90071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS 90342..91322 product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989636.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS 91452..91649 product PLD nuclease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562727.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS complement(91651..92373) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948045.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS complement(92439..92558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS 92795..93781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS complement(94214..94963) product heme-dependent peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075704.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS 95095..96084 product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774281.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 gene pta CDS 96074..96889 product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047550126.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS 96939..98117 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438524.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS 98189..99490 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180234.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS 99502..100011 product YwhD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438753.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS 100207..100605 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS 100608..102260 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021144.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 gene argS CDS 102432..103304 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832114.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS 103297..104250 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485368.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS 104285..106243 product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243690.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS 106262..107350 product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830888.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS 107372..108781 product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562145.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 gene aspA CDS complement(108889..109347) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS 109502..110851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS 110863..111645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS 111667..112857 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930973.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS complement(112979..113815) product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789758.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS complement(113982..115004) product tellurite resistance/C4-dicarboxylate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063658.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS 115273..115473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17760 note possible pseudo, internal stop codon CDS 115559..115717 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS complement(115766..116050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS complement(116075..116944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS complement(117076..118017) product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563259.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS complement(118038..119348) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015489.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 tRNA 119505..119578 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 CDS 119700..120422 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002505902.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS 120419..121495 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082555.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS 121515..121898 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413436.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS 121909..122358 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571271.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS 122516..125395 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476114.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS 125480..127393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS 127383..128234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS 128224..128964 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS complement(128995..130854) product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962335.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS 131084..132478 product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966488.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS 132499..133626 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258369.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS 133749..134924 product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943093.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS complement(134970..135857) product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288550.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 tRNA 135975..136045 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 CDS 136068..136361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS complement(136696..137385) product YsnF/AvaK domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229586.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS 137502..138275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS 138300..138821 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016514.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS 139212..139892 product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666827.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 gene tenA CDS 140034..140231 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS complement(140315..140734) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016519.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS complement(140724..141944) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016518.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS 142066..142968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS 143077..144327 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901956.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS 144342..145616 product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067192.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS 145655..145972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS 146095..146913 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484942.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS 147591..148037 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS complement(148069..148308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS complement(148357..148791) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495810.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS 148924..149781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS 149778..150497 product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185849.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS complement(150536..151303) product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831870.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS complement(151369..152058) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000398941.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS complement(152060..152986) product osmoprotectant ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721551.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS complement(152997..153632) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831629.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS complement(153629..154783) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831407.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS 155049..155963 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721396.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS 156172..156753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS 156811..157083 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS 157102..158445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS complement(158550..159707) product aminotransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434569.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS 159844..160842 product DctP family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976088.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS 160844..161305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS 161306..162595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS 162596..162931 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943036.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS 162987..163727 product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102282.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS complement(163810..164664) product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034728.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 gene pdxS CDS 164760..166091 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830028.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS complement(166141..167220) product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832304.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS 167431..168531 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS 168681..170207 product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202034.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS 170294..171463 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888346.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS 171583..171879 product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349637.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS 171892..174276 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024139.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS 174316..174522 product copper chaperone CopZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832344.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 gene copZ CDS 174639..175880 product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582326.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS 175896..176756 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037684.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS complement(176806..177945) product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398737.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 gene menC CDS complement(177965..179383) product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966488.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS 179474..180586 product M20 peptidase aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246319.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS 180664..181548 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009912616.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS complement(181995..182573) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS complement(182671..182916) product DUF5683 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023253.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS complement(182986..185625) product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242658.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS complement(185609..186091) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242874.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS 186240..187229 product lytic regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495671.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS 187347..188270 product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535550.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 gene rarD CDS 188340..189176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS complement(189252..190178) product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609346.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS 190253..190891 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000975492.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS complement(190886..191737) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829896.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS 191860..192900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS 192957..193505 product chromate resistance efflux protein ChrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227840.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 gene chrA CDS 193502..194032 product chromate resistance efflux protein ChrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227840.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 gene chrA CDS 194116..194622 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002366315.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS 194716..195060 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088514.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS 195084..195500 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549988.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS 195502..196209 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868387.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS complement(196202..196996) product type II pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862728.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 gene coaW CDS complement(197075..198658) product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002495210.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS 198824..199654 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468299.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS 199728..200237 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS 200368..201987 product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159960.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS 202190..202831 product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227626.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 gene fsa CDS 202870..204138 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046602.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS 204332..205297 product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442341.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 gene glpX CDS 205485..206804 product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115101.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 gene rho CDS 206921..207181 product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829959.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS 207282..208361 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460242.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 gene prfA CDS 208348..209202 product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379699.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 gene prmC CDS 209195..210244 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829923.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS 210237..210647 product low molecular weight protein arginine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697334.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS 210711..211139 product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221910.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 gene rpiB CDS 211108..211656 product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829927.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS 211670..212905 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001981400.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 gene glyA CDS 212967..213596 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829916.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 gene upp CDS 213616..214755 product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723418.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 gene wecB CDS 214881..215243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS 215248..215982 product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349655.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 gene atpB CDS 216030..216245 product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029779745.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 gene atpE CDS 216345..216863 product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462233.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 gene atpF CDS 216863..217405 product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241344.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS 217421..218929 product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829913.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 gene atpA CDS 218960..219835 product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157696.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 gene atpG CDS 219857..221272 product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829930.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 gene atpD CDS 221289..221693 product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094394.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS 221749..221979 product DUF1146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384523.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS 222050..223342 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227695.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 gene murA CDS 223355..223543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS 223552..223998 product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829953.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 gene fabZ CDS complement(224045..224479) product YwpF-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227794.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS 224673..225209 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS 225644..226513 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS 226809..227603 product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832736.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 gene thiD CDS 227609..228379 product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202458.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 gene thiM CDS 228372..228986 product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002505076.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 gene thiE CDS 229086..229952 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725802.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 gene yidC CDS complement(229990..231474) product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571549.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 gene cls CDS 231600..231749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS complement(231791..232978) product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002486299.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS 233073..234425 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457113.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS 234412..235125 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721422.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS 235192..236697 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485310.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS 236789..237253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS 237246..238820 product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457110.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS 238765..239250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS 239247..239600 product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457108.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 gene acpS CDS 239597..240748 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457107.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 gene alr CDS 240829..241014 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS 241015..241392 product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621175.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS 241438..242457 product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390829.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS 242544..242870 product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052491.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS 242874..243347 product anti-sigma B factor RsbW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011447044.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 gene rsbW CDS 243325..244104 product RNA polymerase sigma factor SigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002440602.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 gene sigB CDS 244165..246306 product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000370122.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS complement(246351..247850) product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831169.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 tRNA 248165..248239 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 tRNA 248447..248535 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 tRNA 248563..248636 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 sequence04 source 1..203041 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 167..628 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956572.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 gene tsaE CDS 609..1250 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086737.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 gene tsaB CDS 1232..1684 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829994.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 gene rimI CDS 1677..2699 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830015.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 gene tsaD CDS 2968..4419 product ABC-F type ribosomal protection protein Msr(C) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287458.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 gene msr(C) CDS 4476..4913 product glyoxalase/bleomycin resistance/extradiol dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125705.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS complement(5269..7185) product ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602057.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 gene abc-f CDS 7312..7944 product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830017.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS 7956..8213 product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001794540.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS 8257..9009 product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886426.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 gene tatC CDS 9031..10488 product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830011.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS 10630..11466 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289254.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS 11621..12838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS 12965..14020 product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234436.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS complement(14328..14654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19320 note possible pseudo, internal stop codon CDS complement(14902..16602) product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008577.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS 16765..17364 product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272666.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS 17364..18212 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS complement(18403..19167) product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485136.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS 19359..19643 product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830378.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 gene groES CDS 19683..21308 product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830447.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 gene groL CDS 21592..22863 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379246.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS complement(22909..23358) product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737071.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS complement(23411..24184) product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404272.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS complement(24171..24848) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892161.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS 24980..26419 product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207627.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS complement(26482..27027) product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816782.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS complement(27085..27975) product fructose bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031409.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS 28125..29063 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002469173.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS complement(29106..29261) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS complement(29315..30445) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681920.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS complement(30432..31484) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS complement(31484..32413) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681918.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS 32528..33589 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963562.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS 33567..34166 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666641.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS 34217..35161 product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823221.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS 35154..36089 product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014554495.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS 36111..36995 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132865.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 gene rbsK CDS complement(37044..37568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS complement(37724..38185) product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164421.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS complement(38310..39596) product xanthine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230748.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 gene pbuX CDS complement(39596..40177) product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866485.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS 40382..41122 product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002194085.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 gene phnF CDS 41326..41745 product phosphonate C-P lyase system protein PhnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892105.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 gene phnG CDS 41756..42316 product phosphonate C-P lyase system protein PhnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861994.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 gene phnH CDS 42317..43396 product carbon-phosphorus lyase complex subunit PhnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267544.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS 43393..44244 product alpha-D-ribose 1-methylphosphonate 5-phosphate C-P-lyase PhnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435861.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS 44231..45073 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435860.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS 45087..46262 product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435857.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS 46273..46971 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892101.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS 46968..47786 product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435856.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS 47881..48945 product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258842.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS 49033..49950 product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258841.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 gene phnC CDS 49961..50773 product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258840.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 gene phnE CDS 50773..51594 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640973.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS complement(51673..51939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS 52051..52896 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459069.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS 52893..53483 product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243940.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS 53484..53648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS 53755..55104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS 55101..56399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS 56683..58089 product allantoin permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206466.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS complement(58263..59489) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071202.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS complement(59467..60333) product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038038884.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 gene pheA CDS complement(60650..62365) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944619.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS 62529..63587 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816930.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 gene ddlA CDS 63605..64111 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228963.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS 64128..65348 product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244314.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 gene pepT CDS complement(65401..66882) product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174766976.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS complement(66953..67129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS 67249..68040 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858661.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS 68376..68525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS complement(68588..68965) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063587.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS 69095..69832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS 69825..70511 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354825.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS 70527..71366 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387408.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS 71366..72208 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387408.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS 72315..73271 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608770.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS 73261..74454 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS 74454..75635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS 75730..76881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124794627.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS 76898..78124 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224419.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS 78224..79117 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044662.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS complement(79187..79993) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031328.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS complement(80081..80626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS complement(80620..81246) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101103.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS complement(81256..82194) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209769.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS complement(82191..82796) product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104477.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS complement(82834..83256) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS 83408..83833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS 83860..84588 product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869461.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 gene pxpB CDS 84578..85567 product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023319.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS 85572..86003 product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832766.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS 86006..87352 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048423.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS 87365..88129 product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261793.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 gene pxpA CDS 88144..89355 product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831227.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS 89364..90131 product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886407.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS 90281..90763 product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831735.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 gene purE CDS 90750..91874 product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831674.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 gene purK CDS 91944..94112 product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032740.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 gene purL CDS 94070..95509 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233947.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 gene purF CDS 95512..96531 product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030811.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 gene purM CDS 96524..97093 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088589.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 gene purN CDS 97097..98572 product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485342.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 gene purH CDS 98593..99843 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485333.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 gene purD CDS 99950..101524 product glutathione ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211308.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS complement(101602..102447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS 102587..102850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS 102984..103589 product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868563.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS 103599..104318 product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228092.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 gene nagB CDS 104372..104551 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS complement(104620..104982) product DUF6176 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027779.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS complement(105177..106379) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548702.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS complement(106372..107064) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524830.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 note possible pseudo, frameshifted CDS complement(107078..107272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20320 note possible pseudo, internal stop codon, frameshifted CDS 107372..109111 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990058.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS 109126..109692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS 109707..110084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS 110153..111085 product iron-hydroxamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243725.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS 111087..111950 product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044441.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS 111952..113073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS complement(113070..113249) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS 113329..113634 product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829496.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS 113702..114004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS 114026..115132 product 1-propanol dehydrogenase PduQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091449.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 gene pduQ CDS 115148..115558 product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115312693.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS 115588..115758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS complement(115802..116743) product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047796704.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS 116984..117133 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001265708.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 gene rpmG CDS 117246..118118 product bifunctional 5,10-methylenetetrahydrofolate dehydrogenase/5,10-methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583984.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS complement(118122..118508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS 118625..118912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS complement(118985..119911) product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830428.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS 120097..121548 product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830368.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS 121554..122372 product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832476.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 gene nadE CDS 122397..123053 product DUF2179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011542.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS 123019..123228 product NETI motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219403.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS 123225..124520 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002440416.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 gene purB CDS 124522..125199 product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082532.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS 125300..125965 product heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830396.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS 125984..128158 product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457083.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 gene pcrA CDS 128165..130135 product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484896.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 gene ligA CDS 130139..131347 product CamS family sex pheromone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831700.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS 131428..131721 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170162.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 gene gatC CDS 131737..133215 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002458553.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 gene gatA CDS 133217..134647 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545370.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 gene gatB CDS complement(134713..135486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS 135607..136113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20650 CDS 136136..137083 product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484891.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS 137118..138884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS 138910..140262 product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147865.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 gene rlmD CDS 140274..141101 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262695.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS 141222..142442 product DUF819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889545.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS complement(142505..143464) product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192803849.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS 143599..144300 product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000289136.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS 144338..145360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS 145376..145675 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS 146305..146433 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20750 note possible pseudo, internal stop codon, frameshifted CDS complement(146755..147534) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229890.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS complement(147534..148895) product persulfide dioxygenase-sulfurtransferase CstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000465472.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 gene cstB CDS complement(148922..150019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS complement(150134..150415) product persulfide-sensing transcriptional repressor CstR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105088.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 gene cstR CDS complement(150694..150918) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20800 note possible pseudo, internal stop codon, frameshifted CDS 151411..151698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS 151787..152491 product cytochrome c-type biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001152676.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 gene ccdA CDS 152601..153107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS 153365..155413 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877664.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS 155522..155953 product CopY/TcrY family copper transport repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379040.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS 156091..156342 product copper chaperone CopZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436973.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 gene copZ CDS complement(156522..157145) product YdhK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242997.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS 157380..157535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS 157853..158851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20890 note possible pseudo, frameshifted CDS 158887..159240 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20900 note possible pseudo, frameshifted CDS 159233..159904 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565463.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS complement(160015..160341) product four-helix bundle copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966950.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS 160607..161077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS complement(161236..162261) product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461666.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS 162361..163257 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099971.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS 163429..164643 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861787.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS 164754..165299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS 165374..166147 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS 166662..166913 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS complement(166930..167523) product DUF2812 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181533.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS complement(167525..167833) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194196.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS 168032..169240 product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814294.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS 169387..170325 product iron-hydroxamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379233.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS 170341..171369 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078275.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS 171515..172918 product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233892.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 gene rlmD CDS complement(172969..173976) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829756.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS complement(174008..175192) product NADH-dependent flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286459.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS 175354..175776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS 175795..176823 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922345.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS 176826..177158 product glycine cleavage system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984553.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS 177303..178025 product protein-ADP-ribose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449069.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS 178030..178896 product NAD-dependent deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219401.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS 178916..179938 product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280799.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS 180049..180558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS 180637..180864 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS complement(180937..181980) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844385.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS 182055..182621 product DUF3267 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989534.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS 182672..183742 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830390.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 gene dinB CDS 183791..184546 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457092.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 gene map CDS complement(184598..185167) product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838169.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS complement(185169..186194) product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037068.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS complement(186251..186568) product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428172.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS 186752..186952 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS 186957..188189 product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232341.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS 188274..188429 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS 188490..188999 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244690.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS 189005..189775 product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830417.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 gene recX CDS 189768..190094 product YfhH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435806.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS 190094..191581 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535834.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS 191592..192353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS complement(192367..193344) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244136.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS 193409..194446 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284765.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 gene mutY CDS 194511..195047 product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251253.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS 195098..196834 product SAV1866 family putative multidrug efflux ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597238.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS 196852..197460 product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966252.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS complement(197495..198604) product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457098.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS complement(198616..199908) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830429.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS 200057..200503 product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939521.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 gene bcp CDS 200510..201442 product glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989785.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS 201523..201969 product peroxide-responsive transcriptional repressor PerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223285.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 gene perR CDS complement(202061..202456) product YgzB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243536.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 sequence05 source 1..3261 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 54..1601 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 tRNA 1736..1812 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 tRNA 1827..1902 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 sequence06 source 1..2052 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence07 source 1..1500 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence08 source 1..1402 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence09 source 1..998 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(296..913) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21420 sequence10 source 1..905 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(78..350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21430 sequence11 source 1..902 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(190..738) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21440 sequence12 source 1..648 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence13 source 1..588 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence14 source 1..574 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(134..562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21450 sequence15 source 1..555 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 51..446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21460