COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..795003 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 75..166 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS complement(464..760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414755.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 tRNA 911..983 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS 1207..2052 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354705.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS 2049..2360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00030 note possible pseudo, internal stop codon CDS 2439..3473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00040 note possible pseudo, internal stop codon CDS 3470..4762 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355207.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 gene genB tRNA 4997..5069 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 tRNA 5072..5147 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS 5292..6491 product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548514.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 gene metK CDS 6521..7978 product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548513.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS complement(8276..9352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS complement(9402..10013) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939892.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS complement(10010..11200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS complement(11694..12140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS 12640..15054 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548508.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 gene leuS CDS 15150..16793 product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548498.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS complement(16968..18074) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355768.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS complement(18258..18479) product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475527.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 tRNA complement(18551..18637) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS 18734..20011 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254512.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS 20013..20858 product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254511.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS 20918..21532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS 21794..23479 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548463.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 gene argS CDS 23579..24493 product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254510.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 gene fba CDS 24649..25512 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547312.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS complement(25612..26181) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898317.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS complement(26296..27216) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645746.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS 27331..29157 product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101224.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS complement(29216..30586) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275523.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS 30776..32554 product oligopeptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547891.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS 32590..33504 product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550037.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS complement(33614..34435) product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728733.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS complement(34410..35204) product PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721639.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS complement(35206..36117) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS 36299..37543 product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767711.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS 37558..38274 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355690.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS complement(38322..39098) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548442.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS 39285..41342 product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548440.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS 41359..41709 product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548438.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS 41778..42935 product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548436.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS 42916..45411 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254507.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS 45411..46388 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254506.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS complement(46431..47330) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254505.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS complement(47457..47783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(47793..48224) product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548425.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS 48315..49055 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548423.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS 49048..50247 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613400.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS 50250..50909 product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548419.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 gene trmB CDS 50946..51266 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254504.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS 51288..51935 product DUF4479 and tRNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548415.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS 52101..53411 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548413.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 gene murC CDS 53508..54749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS 54901..56175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS 56336..59011 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548351.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 gene polA CDS 59024..59854 product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548349.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 gene mutM CDS 59851..60453 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548347.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 gene coaE CDS 60455..60922 product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548345.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 gene nrdR CDS 60925..62271 product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548343.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS 62280..63182 product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254494.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 gene dnaI CDS 63527..65464 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548338.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 gene thrS CDS 65663..66400 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641125.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS 66411..67232 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101188.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS 67229..67867 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644017.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS 67881..68537 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641128.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS 68788..69297 product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075917325.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 gene infC CDS 69324..69524 product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548328.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 gene rpmI CDS 69561..69917 product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548326.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 gene rplT CDS 70024..70548 product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254490.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS 70541..71656 product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548317.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 gene yqeH CDS 71665..72306 product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548315.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS 72299..72898 product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548313.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 gene yqeK CDS 72908..73255 product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548311.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 gene rsfS CDS 73262..74416 product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548309.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS 74418..74984 product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548307.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS 75127..75840 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548305.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS 75827..77386 product HAMP domain-containing histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254489.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS complement(77530..78501) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254488.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 gene yidC CDS complement(78538..78867) product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548299.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS 78971..79738 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548298.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS 79815..80165 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254487.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS 80461..81510 product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548296.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 gene pheS CDS 81510..83927 product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548294.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 gene pheT CDS 84005..84481 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548292.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 gene greA CDS complement(84536..85450) product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548278.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 85687..87780 product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254485.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS 87865..88014 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548272.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 gene rpmG CDS 88068..88640 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548253.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS 88651..89331 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254484.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS 89331..89549 product YqgQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548250.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS 89609..90013 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548248.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS 90097..91017 product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548247.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 gene miaA CDS 91010..92260 product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548246.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS 92454..93791 product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003627067.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 gene glnA CDS 93957..94976 product choloylglycine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367364.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS 95245..96429 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548117.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS 96476..97171 product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641990.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS complement(97267..97902) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548040.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 gene pyrE CDS complement(97903..98610) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548039.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 gene pyrF CDS 98855..99778 product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254443.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS 100015..100554 product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548034.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 gene pyrR CDS 100714..101670 product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548032.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS 101670..102944 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254442.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS 102945..104030 product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548026.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 gene carA CDS 104023..107205 product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254441.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 gene carB CDS complement(107263..109659) product Xaa-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548011.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS complement(109756..110112) product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254429.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS complement(110194..111231) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576070.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS 111662..112147 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01040 tRNA complement(112266..112341) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS 112529..114319 product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254424.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS 114410..115738 product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254421.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS 115855..116694 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547954.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS 116863..117177 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547952.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 gene rplU CDS 117191..117484 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254420.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 gene rpmA CDS 117612..118721 product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547949.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS 118793..119362 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547948.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 gene efp CDS 119381..119839 product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547946.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS 119817..120215 product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547945.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 gene nusB CDS 120266..121114 product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547942.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS 121104..122462 product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547941.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 gene xseA CDS 122452..122694 product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547938.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS 122696..123562 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547935.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS 123566..124375 product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547933.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS 124385..126070 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547931.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 gene recN CDS 126067..126930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS complement(126970..127245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS 127454..128068 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547929.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 gene gmk CDS 128071..128289 product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547927.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 gene rpoZ CDS 128353..130752 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547921.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 gene priA CDS 130767..131711 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547919.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 gene fmt CDS 131701..133023 product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254418.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 gene rsmB CDS 133028..133777 product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254417.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS 133774..135753 product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_056938256.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 gene pknB CDS 135750..136643 product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547915.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 gene rsgA CDS 136654..137304 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547914.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 gene rpe CDS 137304..137996 product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254415.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS complement(138082..138267) product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547911.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 gene rpmB CDS 138434..138796 product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547910.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS 138818..140476 product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547907.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS 140478..142514 product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254414.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 gene recG CDS 142533..143531 product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547901.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 gene plsX CDS 143555..143797 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547899.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 gene acpP CDS 143919..144932 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547898.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS 144935..145912 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547895.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS 145915..146874 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547894.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS 146887..147807 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547893.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS 147975..149747 product oligopeptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547891.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS 149935..150630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01430 note possible pseudo, internal stop codon CDS 150667..151707 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01440 note possible pseudo, internal stop codon CDS 151846..153612 product oligopeptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547891.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS 153792..155561 product oligopeptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547891.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS 155807..157576 product oligopeptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547891.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS 157708..158394 product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547887.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 gene rnc CDS 158407..161970 product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254411.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 gene smc CDS 161973..163226 product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547883.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 gene ftsY CDS 163261..164685 product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254410.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS complement(164748..166175) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254409.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS 166381..166722 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547875.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS 166726..168153 product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547873.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 gene ffh CDS 168239..168511 product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547870.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 gene rpsP CDS 168583..169098 product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254408.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 gene rimM CDS 169088..169813 product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254407.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 gene trmD CDS 169927..170274 product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003629071.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 gene rplS CDS 170387..171133 product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547367.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS complement(171404..172027) product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254404.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 gene lexA CDS 172157..172444 product DUF896 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547851.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS 172514..172729 product YneF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547849.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS 172801..174555 product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254403.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS 174557..176347 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613381.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS 176479..177879 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965834.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS complement(178043..179221) product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254401.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS complement(179320..179934) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547840.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS 179993..181024 product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547839.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS 181179..181964 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547837.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 gene rpsB CDS 181996..182871 product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565808.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 gene tsf CDS 183046..183198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS complement(183675..185162) product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387645.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS complement(185175..187034) product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120562.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS 187193..187930 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286051.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS complement(189316..190188) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421907.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS 190347..191207 product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002329655.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS 191209..192849 product malonate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287549.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 gene mdcA CDS 192865..193158 product malonate decarboxylase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287548.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS 193145..194815 product biotin-independent malonate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287546.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 gene mdcD CDS 194803..195465 product malonate decarboxylase holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287544.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS 195466..196266 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100893.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS 196522..197430 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254084.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS complement(197468..198355) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102052.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS 198463..199920 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102053.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS 200125..200850 product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254400.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 gene pyrH CDS 200850..201407 product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095341972.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 gene frr CDS 201410..202144 product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547825.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS 202156..202953 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547823.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS 202963..204219 product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547820.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 gene rseP CDS 204239..205939 product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547819.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS 205945..210252 product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547817.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS 210359..210832 product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254398.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 gene rimP CDS 210852..212066 product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254397.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 gene nusA CDS 212085..212381 product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547812.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS 212384..212695 product ribosomal L7Ae/L30e/S12e/Gadd45 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547810.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS 212700..215360 product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254396.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 gene infB CDS 215379..215741 product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547807.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS 215785..216678 product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547805.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 gene truB CDS 216699..217631 product riboflavin biosynthesis protein RibF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547803.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 gene ribF CDS 217768..218817 product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547794.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 gene hrcA CDS 218830..219411 product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547792.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 gene grpE CDS 219430..221286 product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547791.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 gene dnaK CDS 221365..222504 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547790.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 gene dnaJ CDS 222645..224483 product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254395.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 gene lepA CDS 224651..226930 product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547786.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 gene recJ CDS 227020..227547 product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547784.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS 227856..228374 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643199.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS complement(228491..230764) product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254392.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS complement(230940..232226) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546959.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 gene eno CDS 232469..233302 product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546960.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS complement(233541..234122) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546962.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS 234318..234596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS 234605..234859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS 234811..234969 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS 235003..235152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS 235435..235578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS 235545..236369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS 236784..237455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS 238192..238359 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS 238361..238591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS 238620..238832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS 238927..239394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS 239354..239602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS complement(239880..240434) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS 240857..241342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02250 tRNA complement(241526..241614) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS 241793..242167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566163.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS complement(242222..242590) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732729.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS 242748..243152 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254740.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS 243311..243739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02290 note possible pseudo, internal stop codon CDS 243752..244018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02300 note possible pseudo, internal stop codon CDS 244058..244327 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02310 note possible pseudo, frameshifted CDS 244556..245710 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701155.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS 245896..246528 product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550046.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 gene pnuC CDS complement(246577..246888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS 247072..247581 product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546982.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS 247583..247774 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS 248123..248977 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254284.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS 249006..250067 product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546989.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS 250060..250761 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254285.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS complement(250840..251121) product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640587.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS complement(251280..252134) product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262299.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS 252306..252998 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS 253204..253923 product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641945.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS complement(253982..254863) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643641.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS 255051..256004 product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361636.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS 256027..256665 product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294560.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS 257099..258478 product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573816.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 gene brnQ CDS 258594..260648 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002437601.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS 260837..262240 product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546995.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS 262259..263656 product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546997.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS 263844..264773 product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547001.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS 264789..265487 product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085070.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS 265506..266972 product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254286.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS 266973..267770 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547007.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS 267904..268851 product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547009.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 gene citC CDS 268841..269137 product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547011.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 gene citD CDS 269138..270052 product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547014.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 gene citE CDS 270042..271580 product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547016.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 gene citF CDS 271654..272202 product citrate lyase holo-[acyl-carrier protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254390.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 gene citX CDS complement(272195..273142) product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547030.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS complement(273268..273768) product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254291.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 gene ybaK CDS 273829..274773 product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547033.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 gene prmA CDS 274833..275186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS 275201..277438 product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254292.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS 277438..277875 product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547036.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 gene dtd CDS 278146..279432 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547037.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 gene hisS CDS 279441..281285 product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547039.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 gene aspS CDS 281351..281851 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645055.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS 282284..283306 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861656.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 gene galE CDS complement(283991..284485) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702666.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS complement(284563..285759) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547041.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS 285907..286338 product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548013.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 gene msrB CDS complement(286387..287265) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547719.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS complement(287495..288040) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547717.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 gene msrA CDS complement(288161..288988) product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547712.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS 289167..289343 product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002880182.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 gene rpsU CDS 289477..289920 product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547630.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS 289938..290894 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254379.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS 290891..291418 product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547628.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 gene ybeY CDS 291418..292326 product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254378.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 gene era CDS 292329..293084 product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547622.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 gene recO CDS 293325..294242 product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547621.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 gene glyQ CDS 294235..296304 product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547620.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 gene glyS CDS 296326..298149 product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547619.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 gene dnaG CDS 298149..299270 product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254377.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 gene rpoD CDS complement(299369..299809) product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547614.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS complement(299862..300176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS 300283..301005 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547613.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS 300998..301795 product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547612.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS 301810..303054 product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547606.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 gene pepT CDS 303425..303778 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547604.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS 303790..304494 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547603.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS 304494..305315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254375.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS 305544..306248 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547603.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS 306539..307129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS complement(307205..307396) product LBP_cg2779 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547599.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS complement(307459..308037) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547598.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 gene lepB CDS 308121..308873 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254372.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS 308863..309828 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547594.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS 309821..311191 product RsmF rRNA methyltransferase first C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254371.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS 311211..311999 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367542.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS complement(312056..313072) product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254369.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 gene fni CDS complement(313081..314163) product phosphomevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254368.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS complement(314198..315157) product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547574.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 gene mvaD CDS complement(315157..316065) product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547572.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 gene mvk CDS 316143..319679 product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254367.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS 319683..323300 product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254366.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 gene addA CDS 323320..326130 product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254365.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 326099..326581 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254364.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS 326648..327946 product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547544.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 gene asnS CDS 328022..328663 product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547543.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS 328668..329297 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254362.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 gene nth CDS complement(329408..331747) product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254361.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS complement(331728..332369) product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254360.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 gene recU CDS 332439..333008 product DUF1273 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547535.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS 333100..333531 product cell division regulator GpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547534.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS 333991..335115 product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547533.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS 335112..336338 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254359.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS 336350..336688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS 336861..338537 product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254358.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS 338547..339005 product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613370.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 gene lspA CDS 339005..339913 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254356.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS 339918..340973 product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547524.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS 340976..344152 product carbamoyl phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254355.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS complement(344199..345887) product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547519.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS 346239..346652 product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254354.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS 346726..347601 product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254353.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS 347651..348286 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547344.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS complement(348305..349390) product tyrosine recombinase XerS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547513.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 gene xerS CDS 351083..351442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS complement(351521..352450) product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547481.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS complement(352510..353445) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547480.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS complement(353586..356039) product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547478.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 gene parC CDS complement(356053..358011) product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547476.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 gene parE CDS 358109..358744 product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547474.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 gene plsY CDS complement(358858..360228) product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101592.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS complement(360460..361350) product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547149.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS complement(361370..362779) product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254308.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 gene hslU CDS complement(362797..363321) product HslU--HslV peptidase proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254307.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 gene hslV CDS complement(363321..364250) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547143.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS complement(364253..365569) product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547141.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 gene trmFO CDS complement(365808..366482) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS complement(366779..366982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS complement(366979..367137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS complement(367232..369337) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547140.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 gene topA CDS complement(369416..370252) product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547135.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 gene dprA CDS complement(370298..371053) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254306.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS complement(371050..371889) product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547131.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 gene ylqF CDS complement(371934..372164) product YozE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547128.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS complement(372169..373029) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254305.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS 373152..373817 product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254304.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS complement(373814..375016) product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547116.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS 375185..375991 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547115.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS 376160..376879 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297012.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS complement(376922..378181) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547113.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS complement(378297..378572) product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547110.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS complement(378758..380068) product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254303.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 gene der CDS complement(380130..381338) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547091.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 gene rpsA CDS complement(381411..382085) product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254302.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 gene cmk CDS complement(382127..382606) product LysM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547087.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS complement(382712..383008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS complement(383152..384003) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643460.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS complement(384136..384810) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547084.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS complement(385055..385774) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547082.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS complement(385774..386382) product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547080.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 gene scpB CDS complement(386372..387109) product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547078.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS complement(387113..387466) product reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254301.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS complement(387475..388374) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547075.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 gene xerD CDS complement(388367..389254) product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254300.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS complement(389417..391186) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547072.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene pyk CDS complement(391217..392176) product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547070.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 gene pfkA CDS complement(392343..395471) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547069.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS 395577..395783 product YjzD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254299.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS complement(395827..397374) product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547066.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS complement(397446..397637) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547064.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 gene rpmF CDS complement(397752..397973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS complement(397982..398776) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547056.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS complement(398769..399710) product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547055.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 gene rnz CDS complement(399723..401642) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025015105.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS complement(401665..402969) product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254297.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 gene obgE CDS complement(403045..404847) product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547051.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 gene uvrC CDS 404996..405115 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS complement(405138..405722) product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546867.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 gene yihA CDS complement(405712..406983) product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546864.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 gene clpX CDS complement(407112..408434) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546863.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 gene tig CDS complement(408578..409768) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546862.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 gene tuf CDS complement(409953..410786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254267.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS complement(410788..412572) product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546860.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS complement(412738..413007) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546859.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 gene rpsO CDS 413207..413458 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546858.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 gene rpsT CDS complement(413527..414513) product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546856.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 gene holA CDS complement(414510..416798) product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546854.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS complement(416767..417480) product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546852.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS complement(417546..418589) product SepM family pheromone-processing serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546849.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS complement(418579..419073) product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546847.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 gene coaD CDS complement(419070..419624) product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546846.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 gene rsmD CDS complement(419621..419965) product YlbG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546844.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS complement(419949..421142) product putative peptidoglycan glycosyltransferase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254265.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS complement(421236..423077) product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254264.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 gene typA CDS 423335..423889 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546838.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 gene def CDS 424067..424291 product DNA-dependent RNA polymerase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546835.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS 424297..425976 product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546834.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS 426012..426959 product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546833.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS complement(426994..427311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS complement(427632..428423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS complement(428438..429145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS complement(429237..429617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS complement(429641..432004) product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546830.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS complement(431997..432647) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546828.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS complement(432644..433303) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546826.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS 433235..433426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(433446..434567) product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546824.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 gene mnmA CDS complement(434573..434914) product DUF1831 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546822.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS complement(434965..436122) product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101678.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS complement(436126..436821) product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254262.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS complement(436837..437196) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS complement(437198..437761) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254261.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS complement(437777..437983) product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546816.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS complement(437983..440772) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254260.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 gene ileS CDS complement(440994..441773) product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254259.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS complement(441740..442549) product YlmH/Sll1252 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546811.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS complement(442549..442851) product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906174.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS complement(442851..443291) product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254258.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 gene sepF CDS complement(443307..444632) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546805.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 gene ftsZ CDS complement(444647..446005) product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254257.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 gene ftsA CDS complement(446068..446919) product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546801.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS complement(446935..448044) product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254256.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 gene murG CDS complement(448046..449425) product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546797.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 gene murD CDS complement(449432..450394) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546795.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 gene mraY CDS complement(450402..452567) product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546793.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS complement(452567..452929) product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254255.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 gene ftsL CDS complement(452943..453896) product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546789.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 gene rsmH CDS complement(453899..454330) product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700457.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 gene mraZ CDS complement(454503..454829) product DUF3397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254254.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS 454932..455063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS complement(455106..455639) product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546782.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 gene mreD CDS complement(455639..456487) product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546779.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 gene mreC CDS complement(456539..457543) product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546776.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS complement(457641..458264) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546774.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 gene radC CDS complement(458303..458980) product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546772.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS complement(458970..460244) product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254253.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS complement(460247..462886) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254252.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS complement(463165..464382) product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546762.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 gene thiI CDS complement(464388..465545) product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546760.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS complement(465760..467475) product septation ring formation regulator EzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546759.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 gene ezrA CDS 467896..468507 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254249.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 gene rpsD CDS 468581..469051 product YueI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254248.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS 469051..470355 product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546755.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS complement(470425..480624) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS 481601..482053 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546753.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS complement(482110..483303) product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546752.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS complement(483320..483550) product DUF2969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546751.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS complement(483559..483852) product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564982.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 gene yidD CDS complement(483871..484860) product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546749.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS complement(484943..485173) product DUF1146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564975.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS complement(485245..485682) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546746.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS complement(485694..487133) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254247.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 gene atpD CDS complement(487158..488120) product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546744.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS complement(488131..489642) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254246.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 gene atpA CDS complement(489657..490205) product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546742.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS complement(490205..490717) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546741.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 gene atpF CDS complement(490759..490983) product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029779745.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 gene atpE CDS complement(491002..491715) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546739.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 gene atpB CDS complement(491834..492463) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546738.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 gene upp CDS complement(492548..493552) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546737.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS complement(493552..494400) product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546736.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 gene prmC CDS complement(494393..495481) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546735.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 gene prfA CDS complement(495499..496098) product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613340.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS 496246..497598 product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546733.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS 497807..498634 product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674397.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS 498649..500541 product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674396.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS 500534..501994 product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674395.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS complement(502213..502884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS 503227..503841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS complement(503996..504217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS complement(504290..504886) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS complement(504889..506502) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673980.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 tRNA complement(507014..507085) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA complement(507092..507165) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS 507379..508404 product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546711.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS complement(508440..508613) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS complement(508891..510357) product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920215.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS complement(510597..511571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04810 note possible pseudo, frameshifted CDS complement(511607..512005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS complement(512310..512627) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546926.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS complement(512639..514057) product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890696.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS complement(514060..515334) product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384702.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 gene celB CDS complement(515569..516762) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS complement(516935..517945) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613409.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 518094..519797 product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775581.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS 519810..522629 product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548204.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS 522610..523269 product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476249.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 gene pgmB CDS complement(523369..524457) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355369.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS complement(524697..526085) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254239.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS complement(526198..527544) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546706.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS complement(527626..528249) product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254238.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS 528394..530586 product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546703.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS 530626..531492 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548384.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS complement(531538..532968) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546698.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS complement(532996..533733) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254236.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS complement(534153..535121) product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546690.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 gene manA CDS complement(535541..536728) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS 537630..537959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS 538217..538456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS complement(538659..539351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS complement(539516..541258) product type 1 glycerol-3-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569144.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 gene glpO CDS complement(541291..542805) product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569146.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 gene glpK CDS 542955..543827 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS 544896..546710 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254166.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS 546774..547679 product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101784.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 tmRNA complement(549654..550018) product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(550094..550900) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641966.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS complement(551346..552530) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546683.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS complement(552575..553576) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546680.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS complement(553760..554230) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS complement(554241..554486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS complement(554503..554928) product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546675.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS complement(554918..555268) product competence type IV pilus major pilin ComGC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546673.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 gene comGC CDS complement(555281..556285) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721297.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS complement(556251..557225) product competence type IV pilus ATPase ComGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546670.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 gene comGA CDS complement(557357..558763) product C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052501.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 gene dcuC CDS complement(558782..559702) product ribonucleoside hydrolase RihC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052500.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 gene rihC CDS complement(560046..560771) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546668.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS 560988..562649 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546656.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS 562769..563581 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546391.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS 563626..564327 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837230.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS 564340..567114 product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837229.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS complement(567283..568845) product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102022.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS 568985..569194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS complement(569208..569576) product cupredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642310.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS 570255..571400 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254072.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS complement(571454..571879) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640626.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS complement(571883..573280) product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101592.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS complement(573429..574946) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642762.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS complement(575020..576537) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642121.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS complement(576711..578237) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642121.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS complement(578450..579163) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS complement(579198..579635) product CopY/TcrY family copper transport repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549441.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS complement(579660..580475) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546636.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS complement(580586..582397) product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546133.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 gene glmS CDS complement(582607..583959) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546635.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 gene glmM CDS complement(583980..584954) product CdaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546633.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS complement(584951..585796) product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254229.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 gene cdaA CDS complement(585831..586730) product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546624.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 gene murB CDS 586830..587363 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546623.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS complement(587411..587887) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546616.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 gene tsaE CDS complement(587887..588876) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254227.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 gene pta CDS complement(588885..589580) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546612.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS 589782..590657 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546611.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS 590668..591189 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254226.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS complement(591322..592551) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254348.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS complement(592819..593727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS complement(593705..593941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS complement(594097..594492) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566985.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS complement(594505..595359) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054736140.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS complement(595452..596027) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549286.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS complement(596096..596707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS complement(596900..597274) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS complement(597293..597481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS complement(597496..597966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS complement(598151..598906) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546605.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 gene tpiA CDS complement(598931..600142) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546602.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS complement(600246..601262) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546601.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 gene gap CDS complement(601315..602346) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546600.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 tRNA 602647..602720 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS complement(602774..603802) product putrescine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721659.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 gene ptcA CDS complement(604078..604809) product lantibiotic immunity ABC transporter MutG family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860831.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS complement(604802..605530) product lantibiotic immunity ABC transporter MutE/EpiE family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949125.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS complement(605523..606227) product lantibiotic protection ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922274.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS complement(606381..607907) product SH3-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546900.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS 608068..609507 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546599.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS 609605..610057 product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643467.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS complement(610095..611834) product SH3-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613331.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS 612007..612591 product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546597.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 gene clpP CDS complement(612646..613581) product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546596.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 gene whiA CDS complement(613585..614619) product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546595.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS complement(614624..615502) product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546593.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 gene rapZ CDS complement(615593..616135) product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546590.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS complement(616186..619038) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546588.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 gene uvrA CDS complement(619028..621070) product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546586.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 gene uvrB CDS complement(621170..622894) product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546584.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS complement(623027..623956) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254223.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 gene trxB CDS complement(624014..625033) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546563.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS complement(625065..625901) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613330.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 gene lgt CDS complement(625898..626860) product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546560.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 gene hprK CDS complement(626878..627162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS complement(627171..628169) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095522727.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 gene prfB CDS complement(628359..630758) product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254222.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 gene secA CDS complement(630888..631436) product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254221.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 gene raiA CDS complement(631518..632207) product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254220.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS complement(632204..633487) product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546538.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS 633535..634197 product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546537.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS complement(634211..635368) product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546535.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS complement(635480..637111) product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254219.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 gene rny CDS complement(637242..638354) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546531.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 gene recA CDS complement(638507..639166) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673961.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS complement(639166..640101) product osmoprotectant ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562594.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS complement(640115..640738) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568628.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS complement(640740..641915) product betaine/proline/choline family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673962.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS complement(642070..642630) product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546529.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 gene pgsA CDS complement(642665..643723) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546527.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS complement(643802..644530) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546523.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS complement(644702..647149) product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546517.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS complement(647169..647561) product DUF1149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546515.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS complement(647561..648121) product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546513.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS complement(648170..649372) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546511.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS complement(649386..649766) product PTS glucitol/sorbitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546509.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS complement(649848..652604) product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546507.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 652766..653800 product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546505.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS complement(653828..654727) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546500.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS complement(654714..655520) product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254215.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS complement(655520..656149) product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546495.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS 656650..657273 product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546493.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS 657347..657988 product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546492.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS complement(657963..658823) product competence protein CoiA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254214.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS complement(658888..659613) product adaptor protein MecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546487.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS complement(659718..660116) product transcriptional regulator SpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254213.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 gene spxA CDS complement(660325..662058) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254212.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 gene ptsP CDS complement(662058..662324) product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546482.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS complement(662437..662619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS 662799..664994 product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254211.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS 665120..665401 product DUF1827 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546474.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS complement(665441..667012) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546473.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS complement(667012..667881) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546472.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS 667982..668443 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS complement(668450..668929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254210.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS complement(668939..669754) product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546469.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 gene recX CDS 669880..671256 product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546467.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 gene rlmD CDS complement(671538..672494) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254232.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS 672564..672848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254209.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS complement(673160..673348) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS complement(673839..675002) product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546460.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS complement(675002..676213) product hydroxymethylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546459.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS complement(676217..677368) product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546457.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS complement(677505..678401) product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546456.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 gene galU CDS complement(678461..679384) product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546451.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS complement(679390..680217) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254208.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 gene map CDS 680357..680803 product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546448.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS 680796..681329 product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546446.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS complement(681370..682512) product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254207.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 gene wecB CDS 682604..682792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS 682925..683161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS complement(683385..684290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS complement(684724..684879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS 685958..687238 product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015670.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS 687231..687854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06420 tRNA complement(688111..688183) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS complement(688235..689563) product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546442.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS complement(689560..690798) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546440.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(690798..691505) product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546437.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS complement(691626..692627) product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475675.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS complement(692837..694021) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135960345.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS complement(694406..694891) product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428667.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS complement(694913..696046) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890771.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS complement(696321..697208) product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101571.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS complement(697399..700407) product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476043.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS complement(700426..701595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS complement(701616..703193) product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476042.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(703326..704666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS complement(704703..705239) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948624.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS complement(705282..705848) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943758.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS 706076..706510 product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700966.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS complement(707090..707455) product TIGR02328 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674081.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS complement(707452..707832) product YbgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101596.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS complement(708099..709346) product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876134.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS complement(709386..711212) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS complement(711761..713113) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546298.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 gene rlmD CDS 713289..714002 product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640270.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS 714229..715236 product linear amide C-N hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906161.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS complement(715298..716218) product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546288.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS complement(716249..717679) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254176.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 gene gatB CDS complement(717683..719122) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546285.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 gene gatA CDS complement(719122..719424) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546283.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 gene gatC CDS complement(719437..720606) product CamS family sex pheromone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546280.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS complement(720590..722602) product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546277.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 gene ligA CDS complement(722646..724892) product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546275.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 gene pcrA CDS complement(724972..725619) product glycoside hydrolase family 73 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546273.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 tRNA complement(725775..725862) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS complement(725926..727677) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990058.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS complement(727746..728432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS complement(728560..729033) product SprT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296402.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS complement(729014..729712) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546270.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS complement(729715..731145) product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254175.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS complement(731149..732294) product CDP-glycerol--glycerophosphate glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546266.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS complement(732494..733342) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549471.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS 733550..734296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS complement(734365..735126) product transcriptional regulator FrlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228628.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 gene frlR CDS complement(735252..735785) product ClbS/DfsB family four-helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140224180.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS complement(735877..736776) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548861.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS complement(736766..737845) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854337.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS complement(737854..738762) product oligopeptide ABC transporter permease OppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232954.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 gene oppC CDS complement(738764..739696) product oligopeptide ABC transporter permease Opp1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381304.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 gene opp1B CDS complement(739765..741387) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824544.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS complement(741674..743296) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101336.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS complement(743312..744127) product fructosamine kinase FrlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228626.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 gene frlD CDS complement(744138..745115) product fructosamine deglycase FrlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243688.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 gene frlB CDS complement(745331..745984) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641128.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS complement(746001..746639) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644017.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS complement(746636..747451) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101188.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS complement(747463..748200) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641125.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS 748530..748973 product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549015.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS complement(749071..751740) product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546265.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS complement(751919..753091) product nucleoside transporter C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706846.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS complement(753102..754295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS 754503..755861 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS complement(755940..758342) product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254199.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS 758628..759392 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546400.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS 759558..759773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07020 note possible pseudo, frameshifted CDS complement(759834..760559) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546381.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS complement(760572..761492) product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546379.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS complement(761556..762251) product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254196.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 gene rpiA CDS complement(762377..762847) product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003587210.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS complement(762953..763537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS complement(763647..764264) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289703.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS 764363..764677 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435954.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS complement(764764..766125) product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014565762.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 gene celB CDS complement(766211..766711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254277.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS 766864..768309 product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546921.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS complement(768490..768849) product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546929.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS complement(768864..769199) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546926.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS complement(769327..769563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS complement(769763..770188) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989863.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS complement(770195..771190) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989864.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS complement(771219..772289) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989865.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS complement(772309..773130) product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723163.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS complement(773111..773932) product PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723164.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS complement(773943..774410) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732004.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS complement(774424..775113) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930481.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS complement(775113..775835) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989866.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS 776158..776799 product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546365.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 gene udk CDS complement(776842..777330) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381091.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS complement(777373..778119) product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675028.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS complement(778248..778826) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546364.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS complement(779026..780108) product M42 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546357.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS 780352..780918 product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254205.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 gene hpt CDS complement(780973..782322) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546431.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS complement(782399..783055) product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546429.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS complement(783442..783900) product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550138.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 gene smpB CDS complement(783910..786240) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550136.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 gene rnr CDS complement(786311..786544) product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254157.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 gene secG CDS complement(786615..788678) product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254156.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS complement(788748..789773) product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550130.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS complement(789773..790816) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550128.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS complement(790809..791984) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550126.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 tRNA complement(792101..792187) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 tRNA complement(792230..792300) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 tRNA complement(792320..792394) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 tRNA complement(792400..792473) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 tRNA complement(792486..792558) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 tRNA complement(792561..792644) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA complement(792649..792724) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 tRNA complement(792729..792804) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA complement(792806..792881) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 tRNA complement(792892..792978) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 tRNA complement(793008..793079) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 tRNA complement(793508..793599) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 tRNA complement(793611..793684) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 tRNA complement(793689..793759) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 tRNA complement(793779..793853) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 tRNA complement(793858..793933) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA complement(793935..794010) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 tRNA complement(794047..794120) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 tRNA complement(794133..794208) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 tRNA complement(794238..794311) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 tRNA complement(794316..794391) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 tRNA complement(794398..794486) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 tRNA complement(794496..794567) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 tRNA complement(794578..794652) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 tRNA complement(794687..794770) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 tRNA complement(794782..794854) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 tRNA complement(794858..794932) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 sequence02 source 1..311939 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(267..728) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS complement(1011..1271) product SemiSWEET family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291476.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS complement(1502..3433) product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989451.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS complement(3475..6096) product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861780.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS complement(6105..8774) product mannosylglycerate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861603.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 gene mngB CDS complement(8851..9951) product PTS fructose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008946817.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS complement(9954..10271) product PTS fructose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003729043.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS complement(10274..10723) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897772.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS 11118..11612 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131379.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS 11609..12892 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131380.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS complement(12960..14033) product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592702.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS complement(14162..15031) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS complement(15034..15681) product DUF1700 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102079.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS complement(15838..15987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS 16232..16912 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357457.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS 16912..18177 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357458.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS complement(18318..23582) product SpaA isopeptide-forming pilin-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905155.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS complement(24054..24401) product DUF6176 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547349.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS complement(24514..24909) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549055.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 gene rpsI CDS complement(24923..25366) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549054.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 gene rplM CDS complement(25473..26258) product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549053.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 gene truA CDS complement(26258..27055) product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549052.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS complement(27062..27907) product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549051.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS complement(27883..28734) product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549050.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS complement(29186..29569) product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549049.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 gene rplQ CDS complement(29596..30534) product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549048.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS complement(30580..30963) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613292.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 gene rpsK CDS complement(30988..31335) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549046.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 gene rpsM CDS complement(31490..31711) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002878178.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 gene infA CDS complement(31783..32433) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549045.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS complement(32444..33739) product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549044.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 gene secY CDS complement(33739..34179) product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549043.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 gene rplO CDS complement(34203..34388) product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549042.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 gene rpmD CDS complement(34402..34908) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549041.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 gene rpsE CDS complement(34925..35284) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549040.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 gene rplR CDS complement(35309..35839) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549039.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 gene rplF CDS complement(35864..36262) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549038.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 gene rpsH CDS complement(36285..36470) product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549037.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS complement(36483..37025) product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549036.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 gene rplE CDS complement(37040..37291) product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549035.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS complement(37309..37677) product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549034.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 gene rplN CDS complement(37710..37976) product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254114.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 gene rpsQ CDS complement(37995..38192) product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549032.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 gene rpmC CDS complement(38182..38622) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549031.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 gene rplP CDS complement(38622..39293) product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254113.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 gene rpsC CDS complement(39307..39660) product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549029.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 gene rplV CDS complement(39680..39961) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638064.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 gene rpsS CDS complement(39980..40816) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254111.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 gene rplB CDS complement(40832..41137) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549026.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 gene rplW CDS complement(41134..41766) product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549025.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 gene rplD CDS complement(41781..42410) product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549024.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 gene rplC CDS complement(42436..42744) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549023.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 gene rpsJ CDS complement(43131..45233) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549022.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 gene fusA CDS complement(45257..45727) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549021.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 gene rpsG CDS complement(45743..46150) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549020.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 gene rpsL CDS 46331..47020 product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254110.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS complement(46946..47134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS 47193..47561 product DUF3021 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263287.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS complement(47629..51288) product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254109.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 gene rpoC CDS complement(51305..54937) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254108.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS complement(55149..57653) product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549016.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS complement(58031..58615) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08000 tRNA complement(58917..58990) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 tRNA complement(59037..59111) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 CDS 59239..60060 product DUF2785 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100861.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS complement(60142..61689) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254107.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 gene lysS CDS complement(61716..62726) product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254106.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 gene dusB CDS complement(62826..63458) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476385.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS complement(63572..64444) product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549012.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 gene hslO CDS complement(64493..66700) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254105.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 gene ftsH CDS complement(66788..68047) product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549010.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 gene tilS CDS complement(68037..68402) product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549009.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS complement(68402..68776) product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254103.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS complement(68856..69098) product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254102.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS complement(69110..72601) product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254101.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 gene mfd CDS complement(72603..73169) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549001.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 gene pth CDS 73393..74100 product cyclic di-AMP binding protein CbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254100.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 gene cbpA CDS complement(74166..76079) product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146623251.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS complement(76090..77523) product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021368039.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS complement(77629..78462) product transcriptional antiterminator LicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242598.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 gene licT CDS complement(78621..79751) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548996.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 gene alr CDS complement(79754..80107) product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254099.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 gene acpS CDS complement(80185..81717) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548992.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS complement(81728..83095) product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548990.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS complement(83226..83471) product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548978.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS complement(83587..84432) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254325.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS complement(84442..85182) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547328.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS complement(85188..85865) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547325.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS complement(85846..86505) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547323.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS complement(86894..87802) product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644197.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS complement(87921..88835) product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641604.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 gene rbsK CDS 89061..90368 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296108.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS 90757..91185 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728424.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS 91187..91741 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399299.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS complement(91935..92951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS complement(93358..94092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS complement(94118..94873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS complement(95205..96755) product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548925.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 gene guaA CDS 96995..97747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS 97984..98562 product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254090.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS 98562..99848 product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548915.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS complement(99968..100846) product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475838.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS 101042..102457 product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674698.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS complement(102568..104229) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS complement(104219..105520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS complement(105872..106744) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130103.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS complement(106865..107242) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289210.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS complement(107258..108667) product beta-fructofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296814.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS complement(108685..109095) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289214.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS complement(109111..109599) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042958160.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS complement(109611..110399) product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289216.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS complement(110392..111165) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289217.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS complement(111309..114044) product sigma-54-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287111.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS complement(114434..114820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS complement(115383..116306) product DUF4065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906204.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS complement(116320..116610) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS complement(116828..122803) product PII-type proteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674840.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 gene prtP CDS 123096..124001 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674841.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(124467..125741) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254086.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS complement(125872..127491) product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254085.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS complement(127610..128155) product DNA-directed RNA polymerase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548904.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 gene rpoE CDS complement(128202..128606) product DUF1934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548902.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS 129075..129311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS complement(129602..130432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS 130624..131991 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548899.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS complement(132058..133650) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547496.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS complement(133653..135242) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547498.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS complement(135431..136402) product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254080.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS complement(136567..137463) product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254545.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 gene murQ CDS complement(137473..139446) product glucose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549932.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS complement(139555..140028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS complement(140129..141178) product MupG family TIM beta-alpha barrel fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549580.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS complement(141295..142395) product MupG family TIM beta-alpha barrel fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675035.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS complement(142422..143777) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568213.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS complement(144090..145658) product SLAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548886.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS complement(145811..147196) product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548882.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 gene glmU CDS complement(147247..148077) product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548880.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 gene purR CDS complement(148202..148447) product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548879.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS complement(148530..149420) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548878.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 gene rsmA CDS complement(149413..149985) product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548877.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 gene rnmV CDS complement(149972..150739) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548876.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS complement(150739..152715) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254078.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 gene metG CDS complement(152828..155518) product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548873.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 gene mgtA CDS complement(155832..156431) product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548872.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS complement(156418..156897) product ComE operon protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548871.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS complement(156903..157922) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548870.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 gene trpS CDS 158019..158624 product SOS response-associated peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548869.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 tRNA 158727..158797 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 CDS complement(158855..159517) product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254077.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS complement(159626..160942) product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564452.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS complement(161019..161480) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548866.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 gene greA CDS 161705..162127 product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254076.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS 162273..163589 product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254075.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS complement(163652..164590) product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254272.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS complement(164599..165555) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549473.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS complement(165555..166688) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549477.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS complement(166681..168216) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549479.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS complement(168295..169365) product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549489.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS complement(169491..170582) product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549489.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 170928..171428 product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905425.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS complement(171429..172082) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254070.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 tRNA complement(172108..172180) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 CDS complement(172238..172561) product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563651.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS complement(172671..173060) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837254.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS complement(173162..174427) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548823.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 gene tyrS CDS complement(174693..177602) product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548819.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS complement(177709..178326) product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548818.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS complement(178346..179443) product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548816.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS complement(179544..180110) product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548814.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS complement(180448..180735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS complement(180982..182427) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100971.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS complement(182702..184801) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642905.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS complement(184839..185129) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453958.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS complement(185148..186548) product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887822.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS complement(186569..187024) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892531.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS complement(187125..187865) product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642916.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS 188140..189405 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549861.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 gene hflX CDS complement(189454..190368) product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549855.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS complement(190524..191261) product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549854.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS complement(191465..191956) product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254605.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS complement(192096..192644) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041814911.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS 192739..193068 product DUF2187 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549842.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS complement(193184..193846) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565531.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS complement(193857..195866) product bacteriocin-associated integral membrane family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713731.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS complement(196075..196389) product YxeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831610.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS 197002..198351 product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549839.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS 198503..198922 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475487.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS 198919..199065 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS 199218..199595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09230 note possible pseudo, frameshifted CDS complement(199736..200356) product LVIS_2131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549837.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS complement(200451..200993) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254564.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS 201355..203016 product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003585581.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS 203181..203891 product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721394.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS complement(204115..204591) product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549820.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS complement(204594..205370) product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549818.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS complement(205382..206929) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549817.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS complement(207349..207708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549816.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS complement(207754..208962) product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549814.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS 209107..210912 product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549813.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 gene pepF CDS complement(210954..212096) product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989388.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS complement(212111..212860) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701149.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS complement(212853..214349) product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640791.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS complement(214525..215754) product lactate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674866.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS complement(215927..216724) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613417.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS complement(216724..217377) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254570.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS complement(217401..218543) product SLAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548796.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS complement(218563..219453) product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254571.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS complement(219914..221884) product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549797.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS complement(221901..222815) product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549796.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 gene pfkB CDS complement(222815..223570) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549794.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS complement(223737..225134) product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286343.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS complement(225192..225644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS 225933..227168 product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547031.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS 227361..228383 product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477206.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS complement(228466..229911) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102053.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS complement(229937..231802) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102053.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS complement(231842..233059) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392828.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS complement(233087..234571) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101721463.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS complement(234777..235688) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089308.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS complement(235785..237593) product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101224.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS complement(237872..238840) product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642578.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS complement(238951..239118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09560 note possible pseudo, internal stop codon CDS complement(239271..239684) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642288.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS complement(239674..240111) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644761.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS 240342..240998 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642363.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS 240999..242819 product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102049.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 gene lepA CDS complement(242932..243321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS complement(243337..244119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS complement(244222..244914) product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548802.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS 245075..245869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548799.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS 245994..246809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS 246828..247796 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548798.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS complement(247848..249671) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254067.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS 249859..250302 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942966.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS complement(250371..251507) product SLAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548796.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS complement(251553..252770) product beta-N-acetylglucosaminidase AcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548795.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 gene acmB CDS complement(252893..253384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS complement(253622..254410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS complement(254596..256365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS complement(256867..257142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS complement(257190..257414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS 257632..258504 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS 258746..259174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548785.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS 259297..261327 product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254197.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS complement(261404..262045) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549558.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 gene lepB CDS complement(262149..262913) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287088.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS complement(262923..263678) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485509.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS complement(263683..264573) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567248.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS 264873..265514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS complement(265629..267578) product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548782.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS complement(267673..268893) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548780.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS complement(269061..270323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548775.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS complement(270339..272288) product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548773.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 gene asnB CDS complement(272398..273795) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254060.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS complement(273850..274335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548767.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS 274545..275111 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254059.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS complement(275174..275986) product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548762.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 gene phnE CDS complement(275986..276789) product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254058.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 gene phnE CDS complement(276782..277555) product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548759.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 gene phnC CDS complement(277575..278510) product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254057.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS complement(278547..278690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS complement(278836..279771) product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254057.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS complement(280222..280689) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548753.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS 280831..281631 product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548752.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS 281651..282127 product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613286.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS complement(282681..283349) product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641684.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS complement(283567..284721) product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254054.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 gene nagA CDS 284876..287866 product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548741.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS complement(287931..288863) product cytochrome C5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549662.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS 289101..290249 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044005378.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS complement(290293..291543) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837568.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS 291648..292508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS 292595..293227 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS complement(293442..294266) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721303.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS complement(294294..295742) product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642889.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS complement(295805..297250) product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642889.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS complement(297279..299258) product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645674.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS complement(299393..300283) product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645673.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS 300545..301498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS 301801..303312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS 303476..305593 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS complement(305772..305948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS 306177..306923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS 307673..308023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS 308033..308167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10190 sequence03 source 1..208617 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 5955..6176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS 7318..9528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS 9904..12207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS complement(12515..13021) product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549649.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS complement(13113..13886) product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549621.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS complement(13920..15422) product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549614.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 gene glpK CDS 15570..16382 product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549612.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 gene thiD CDS 16451..17119 product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549605.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS 17233..18207 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS 18359..18667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS 18667..19929 product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643568.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS 19929..21023 product MupG family TIM beta-alpha barrel fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440077.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS 21034..21372 product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722139.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS 21435..22664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS complement(22824..23843) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700619.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 gene gap CDS 23947..24678 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003077559.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS complement(24719..25561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978259.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS complement(25554..26282) product LiaF-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549154.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS complement(26285..26743) product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721270.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS complement(26898..28193) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254607.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 gene purB CDS complement(28197..29486) product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549585.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS 29681..30673 product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254608.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS complement(30855..31979) product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317128.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS complement(31988..32392) product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002312636.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS complement(32402..33220) product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002350294.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS complement(33222..34013) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002312633.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS complement(34015..34509) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002312631.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS complement(34683..37403) product sigma-54-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287111.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS complement(37499..38398) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403856.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS 38500..39942 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102053.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS complement(40010..40738) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS complement(41288..42769) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101721463.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS complement(42780..44033) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461387.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS 44162..45079 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS complement(45239..46942) product adenine deaminase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384673.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS complement(46997..48049) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379352.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS complement(48075..49115) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002413403.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS complement(49127..49915) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357916.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS complement(49908..50738) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382189.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS complement(50939..52000) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254270.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS complement(51997..53187) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546886.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS complement(53198..53962) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546885.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 gene dapB CDS complement(53962..54885) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546883.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 gene dapA CDS complement(54911..56050) product N-acetyldiaminopimelate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546881.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS complement(56055..56765) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546878.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 gene dapD CDS complement(56775..58085) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254268.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 gene lysA CDS complement(58205..58408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS 58534..59901 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546873.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS 59898..60884 product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592633.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 gene dapF CDS 61083..61979 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547989.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS 62045..62914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS complement(62978..63346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS 63276..64184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS complement(64249..64641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS complement(64690..66093) product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549571.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS complement(66109..66837) product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254611.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS complement(67071..67511) product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476013.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS complement(67550..68035) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032908745.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS complement(68168..69055) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296675.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS 69222..69587 product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640442.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS 69754..70311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(70491..71660) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201247498.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS complement(71663..72553) product DUF3737 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546685.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS complement(72739..73038) product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966108.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS complement(73166..74023) product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643570.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS complement(74033..74449) product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002312636.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS complement(74452..75273) product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476535.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS complement(75266..76054) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002312633.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS complement(76057..76551) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002312631.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS complement(76706..77785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS complement(77938..78603) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072535403.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS 78783..79340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS complement(79384..80406) product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547958.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS complement(80646..82745) product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254615.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS complement(82953..85484) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674953.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS complement(85481..86371) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549553.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS complement(86371..87681) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549552.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS 87838..88065 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS complement(88183..89253) product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254572.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS complement(89491..90177) product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254619.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS complement(90450..91400) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549527.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS complement(91400..92695) product D-alanyl-lipoteichoic acid biosynthesis protein DltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549525.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 gene dltD CDS complement(92688..92927) product D-alanine--poly(phosphoribitol) ligase subunit DltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549523.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 gene dltC CDS complement(92955..94193) product D-alanyl-lipoteichoic acid biosynthesis protein DltB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254621.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 gene dltB CDS complement(94193..95707) product D-alanine--poly(phosphoribitol) ligase subunit DltA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549519.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 gene dltA CDS complement(95719..95871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS complement(95999..96310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS 96882..97361 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549510.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS 97656..98204 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS 98408..100276 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549508.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS complement(100357..101034) product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549496.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS 101291..102379 product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254625.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS 102560..104905 product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254626.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS 105091..105816 product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549469.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 gene nagB CDS 105979..106533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS 106545..106733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS 106754..107254 product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011241736.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS 107526..108176 product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549467.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS 108188..108874 product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549464.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS 109088..109729 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700466.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS 109745..110398 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700465.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS 110399..111244 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641494.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS complement(111245..112039) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549462.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS 112267..113574 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549459.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS 113643..115097 product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641299.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS 115220..116530 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025014283.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS complement(116691..118076) product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254636.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 gene gndA CDS complement(118183..119994) product pyruvate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254637.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 gene spxB CDS complement(120271..122166) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549419.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 gene mnmG CDS complement(122175..123560) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549418.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 gene mnmE CDS complement(123667..124533) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254638.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS complement(124535..124903) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549413.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 gene rnpA CDS complement(124956..125096) product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549412.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 gene rpmH CDS complement(125542..125823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS 126471..127838 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011253999.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 gene dnaA CDS 128014..129144 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549381.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 gene dnaN CDS 129371..129586 product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254000.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 gene yaaA CDS 129592..130737 product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549377.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 gene recF CDS 130721..132685 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549374.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 gene gyrB CDS 132695..135190 product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549372.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 gene gyrA CDS 135391..135684 product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549370.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 gene rpsF CDS 135737..136258 product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254001.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 gene ssb CDS 136281..136520 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549366.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 gene rpsR CDS 136868..138967 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS 138964..139596 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571333.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS 139755..141776 product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549345.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS 141791..142246 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549343.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 gene rplI CDS 142285..143670 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549341.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 gene dnaB CDS 143828..143986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS complement(144057..145256) product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254005.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS complement(145373..146074) product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906063.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS 146315..146515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11510 tRNA 146744..146818 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 CDS 147180..148478 product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100950.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 gene celB CDS 148498..149214 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722126.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS 149458..150411 product 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193507.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(150500..150895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS 151060..151551 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364114.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS 151554..152384 product PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721639.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS 152371..153207 product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728733.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS 153480..154490 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296414.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS 154505..155932 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS 155947..157413 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS 157700..157885 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS complement(157930..159186) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775182.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS 159312..160169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS 160355..162301 product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548782.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS 162491..163462 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209628184.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS complement(163648..165834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS 166072..166686 product Type 1 glutamine amidotransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016912.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS 166823..167104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS 167353..167652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS complement(167724..169529) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809087.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS 169653..170558 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965978.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS complement(170596..171426) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086430.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS 171571..173790 product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002391620.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS 173917..175320 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS 175388..176935 product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830011.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(177158..178810) product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100943.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 gene treC CDS complement(178807..179538) product trehalose operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703413.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 gene treR CDS 179739..181724 product PTS glucose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674207.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS 181861..182538 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024095.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS 182673..183566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS 183739..184683 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674907.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS 184683..185453 product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674906.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS 185456..186232 product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674905.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS complement(186407..187093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS complement(187113..188000) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254160.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS 188223..188576 product aldehyde stress transcriptional regulator AdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398725.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 gene adhR CDS complement(188580..189443) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172824466.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS complement(189473..191218) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549091.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS 191410..192258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS 192322..193185 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475455.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS complement(193266..193808) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254011.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS complement(193805..194320) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549293.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS complement(194330..194719) product DUF4430 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567167.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS complement(194755..196989) product ribonucleoside-triphosphate reductase, adenosylcobalamin-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549289.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 gene nrdJ CDS complement(197243..197428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS 197610..198317 product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025079808.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS 198383..199246 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254321.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS 199271..200035 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387085.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 gene proC CDS complement(200122..201699) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254623.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS complement(202086..203096) product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613274.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS 203422..204249 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549252.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS 204331..207180 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254017.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS complement(207227..208354) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025079807.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 sequence04 source 1..193668 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(124..1050) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643099.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS 1169..3049 product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187364788.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS complement(3120..3944) product triphosphoribosyl-dephospho-CoA synthase CitG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547775.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 gene citG CDS 4104..5498 product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379675.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 gene guaD CDS 5482..6828 product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356719.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS complement(6924..8111) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188891678.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(8362..8592) product cytochrome b5 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548562.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS complement(8666..9553) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548564.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS complement(9550..10497) product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254020.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS complement(10522..11367) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254021.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS complement(11383..12144) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254023.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS 12416..12583 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS complement(12641..13807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS complement(14167..14889) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS complement(15029..15937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS complement(16224..16847) product DUF1700 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475525.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS complement(16831..17154) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643453.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 tRNA complement(17350..17425) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 tRNA complement(17814..17889) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 CDS 18026..18742 product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548578.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 gene yycF CDS 18800..20662 product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254027.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 gene walK CDS 20652..21971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548582.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS 21973..22794 product two-component system regulatory protein YycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548584.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS 22809..23606 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254029.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS 23664..24878 product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613276.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS 25369..25848 product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548590.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 gene rlmH CDS 25979..27391 product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063445845.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS 27641..29239 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547498.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS 29229..30809 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547496.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS complement(30852..31505) product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548607.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS complement(31514..32740) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548609.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS 33174..34112 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548611.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS complement(34165..35058) product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254032.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 gene htpX CDS complement(35070..35639) product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254033.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS complement(35752..36852) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254034.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS 37044..37406 product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548621.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS 37597..37737 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548644.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS 37848..38774 product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254041.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS 38816..40756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS complement(40826..42349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS 42530..44365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS complement(44430..45953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS complement(46151..47674) product SLAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014565478.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS 47836..49158 product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562821.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS complement(49246..49647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS complement(49837..50301) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024999.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS complement(50395..51144) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548674.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS complement(51144..52763) product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254042.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS complement(53155..53787) product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254043.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS 53833..54192 product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548679.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS complement(54193..54966) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548681.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(55088..55792) product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613281.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS 56023..56664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS complement(56793..57806) product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549578.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 gene asnA CDS 58238..58714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254045.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS complement(58775..60232) product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548687.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 gene cls CDS complement(60250..61182) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548688.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS 61255..62055 product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548691.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS complement(62056..63021) product DUF1002 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548693.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS 63163..64008 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254046.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS 64005..64661 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254047.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS 64793..65773 product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548712.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS 65914..66597 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254049.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS 66609..67436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548717.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS 67485..67958 product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359788.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS complement(68000..68986) product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254051.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS 69110..70147 product class III bacteriocin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548389.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS 70387..71472 product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548727.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS 71500..72279 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254052.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS 72389..73525 product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548730.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS 73522..74283 product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548732.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS 74280..75095 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254053.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS 75266..75532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS 75605..76135 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645282.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS complement(76189..76554) product aggregation promoting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549663.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS 76714..79251 product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549665.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS complement(79346..80557) product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549671.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS 80664..81452 product DUF4931 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549672.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS 81580..82194 product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254627.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS 82344..83093 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549987.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS 83105..84931 product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549988.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS 84960..86771 product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549988.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS 87170..88366 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101996.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS 88415..89293 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642246.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS 89302..90258 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563086.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS 90262..91044 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642244.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS 91045..91755 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027478.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS complement(91825..92415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS complement(92632..93279) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549989.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS complement(93308..93943) product matrixin family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549990.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS 94149..96443 product RNA polymerase recycling motor HelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_056990024.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 gene helD CDS 96455..96904 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550006.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS 97010..97924 product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550009.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 gene coaA CDS 98071..98643 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550017.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 gene efp CDS 98885..99382 product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101189.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS 99396..100247 product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644019.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS 100240..101652 product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644020.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS 101662..102426 product ChbG/HpnK family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644021.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS complement(102490..102936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS 103114..103236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13020 note possible pseudo, frameshifted CDS 103233..103460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS complement(103503..104159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549674.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS 104222..104989 product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254594.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 gene yaaA CDS 105019..105624 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549678.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS 105782..106297 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254592.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS 106303..107364 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254591.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS 107366..108040 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254590.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS 108487..108705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007126009.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS 108774..109412 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549687.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS 109556..110095 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549688.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS 110107..110655 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549689.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS 110740..111531 product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549690.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS 111539..112468 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549691.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS complement(112572..113660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS complement(113824..114360) product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549693.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS 114519..115241 product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549696.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 gene rsmG CDS 115257..116093 product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254588.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 gene noc CDS 116101..116889 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254587.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS 116867..117754 product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549701.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS 117747..118022 product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549703.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS 118050..119150 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549709.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 gene ychF CDS 119160..119939 product DUF1129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549711.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS 120082..121806 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254586.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS 121810..123678 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721608.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS 123895..125421 product ABC transporter permease/substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643770.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS 125423..126403 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641941.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS 126569..127255 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549720.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS 127262..128416 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549721.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS 128460..130028 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254584.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS 130045..130791 product amino acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549723.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS 130887..131594 product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921993.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 gene cofE CDS 131707..131835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS 132006..132809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13350 note possible pseudo, frameshifted CDS 132830..133549 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027298.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS 133736..136420 product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861895.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS 136499..136918 product PTS mannose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432377.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS 136911..137393 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898441.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS 137400..138203 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453987.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS 138196..139005 product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432375.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS 139015..140073 product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432374.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS complement(140149..140874) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437811.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS 141035..141514 product PTS galactosamine transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101867.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 gene agaB CDS 141524..142321 product PTS galactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101866.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 gene agaC CDS 142311..143108 product PTS galactosamine transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534347.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 gene agaD CDS 143127..143555 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922041.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS 143574..144650 product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989865.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS 145020..146381 product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456317.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS 146409..146894 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438383.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS complement(146935..147738) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289388.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS complement(147716..148498) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289390.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS complement(148664..149635) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289394.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS complement(150038..151009) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289394.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS 151493..152755 product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819250.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 gene rpoN CDS 152843..153862 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS complement(153972..154913) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642346.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS 155111..156016 product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644197.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS 156135..156521 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13590 note possible pseudo, internal stop codon CDS 156540..156983 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13600 note possible pseudo, internal stop codon CDS complement(157120..158373) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063846573.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS complement(158562..159476) product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550037.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS 159635..160204 product DUF3290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550049.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS 160217..160852 product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550051.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS 160866..161690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550052.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS 161700..162653 product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550053.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS 162756..163643 product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550055.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS complement(163885..164709) product Rgg/GadR/MutR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732480.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS 165551..166636 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254531.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS 166636..167502 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550063.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS 167503..168327 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254529.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS 168311..169606 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550067.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS 169657..170970 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550069.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS complement(171028..171939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS 172051..173298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS 173310..174812 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101721463.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS 175064..176374 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550069.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS 176511..177428 product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721382.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS 177442..178371 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254527.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS 178557..179120 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254526.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS 179135..182083 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS 182379..183935 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100919.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS 184032..185066 product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550081.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS complement(185116..186492) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254522.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS complement(186607..187395) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254520.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS 187638..188243 product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550094.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS 188243..188770 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550097.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS 188967..190610 product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003601491.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS 190617..191582 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101262.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS 192000..193307 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254519.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 gene serS sequence05 source 1..78758 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(240..773) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS complement(1008..2369) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549176.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS complement(2362..3318) product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254146.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(3373..4509) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549172.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 gene dinB CDS complement(4502..5950) product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549170.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 gene zwf CDS complement(6071..6508) product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613305.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 gene yajC CDS complement(6580..7596) product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549167.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 gene ruvB CDS complement(7631..8215) product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549165.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 gene ruvA CDS complement(8219..10102) product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549162.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 gene mutL CDS complement(10105..12708) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254144.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 gene mutS CDS complement(12849..13496) product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592791.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 gene pcp CDS complement(13518..14441) product DUF979 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003577393.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS complement(14442..15110) product DUF969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674016.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS complement(15287..16915) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549158.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 gene groL CDS complement(16933..17217) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549156.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 gene groES CDS complement(17396..18040) product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549143.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS complement(18073..18258) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS 18340..20271 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549141.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS complement(20309..21178) product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207225.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS 21392..21796 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566583.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS complement(21841..22890) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549127.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 gene tsaD CDS complement(22883..23344) product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549125.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 gene rimI CDS complement(23439..24179) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549123.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 gene tsaB CDS complement(24206..24724) product folate family ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613301.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS complement(24778..25515) product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254136.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS complement(25525..26379) product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549119.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 gene rsmI CDS complement(26393..26731) product DNA replication initiation control protein YabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254135.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 gene yabA CDS complement(26740..27600) product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549117.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS complement(27600..27923) product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549116.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS complement(27929..28576) product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254134.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 gene tmk CDS complement(28679..28909) product YaaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549114.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS complement(28909..29508) product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549113.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 gene recR CDS complement(29509..29838) product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549112.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS complement(29858..31681) product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549111.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 gene dnaX CDS complement(31861..32379) product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254132.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 gene tadA CDS complement(32379..32999) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254130.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS complement(33107..33994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS complement(34245..34610) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254128.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 gene rplL CDS complement(34659..35168) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549105.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 gene rplJ CDS complement(35409..36140) product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549102.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 gene phoU CDS complement(36156..36911) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549101.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 gene pstB CDS complement(36924..37724) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613297.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 gene pstB CDS complement(37735..38628) product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549099.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 gene pstA CDS complement(38636..39628) product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549098.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 gene pstC CDS complement(39630..40496) product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254125.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS complement(40641..41333) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549096.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 gene rplA CDS complement(41405..41830) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549095.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 gene rplK CDS complement(41957..42505) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549094.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 gene nusG CDS complement(42606..42776) product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549093.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 gene secE CDS complement(43115..43333) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549087.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS complement(43401..43979) product DNA-directed RNA polymerase subunit sigma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254124.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS complement(44177..44938) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254123.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 gene rlmB CDS complement(44919..45362) product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549083.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS complement(45355..46779) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549082.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 gene cysS CDS complement(46926..48431) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254122.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 gene gltX CDS complement(48507..49883) product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549080.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 gene radA CDS complement(49884..50432) product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254121.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS 50631..50939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549078.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS 51085..52431 product aminopeptidase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549077.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 gene pepC CDS complement(52518..53996) product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475726.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 gene galT CDS complement(54010..55176) product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704250.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS complement(55323..56258) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549076.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS complement(56364..57038) product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721658.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS complement(57041..57223) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS complement(57225..58121) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549073.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS complement(58176..58856) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549072.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS complement(58893..59654) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549071.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS 59728..60384 product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549070.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS 60421..61005 product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549069.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS complement(61050..62210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS complement(62477..62947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS complement(62944..63534) product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287520.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS complement(63885..64928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS complement(64933..66096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS complement(66099..66713) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939892.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS 67315..67509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS 67640..68674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS complement(69456..70085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS complement(70215..71546) product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097450.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS complement(71565..72926) product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546946.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS 73053..73766 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254276.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS complement(73866..78479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14720 sequence06 source 1..75327 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 240..1244 product mannose/fructose/sorbose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546107.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS 1263..2069 product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254158.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS 2097..3011 product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254159.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS 3096..3377 product DUF956 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546115.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS complement(3500..4870) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546123.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS 5014..5571 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641446.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS complement(5597..6589) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548187.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 gene galE CDS 6726..7490 product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546159.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 tRNA 7610..7682 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 CDS complement(7918..8100) product YlcI/YnfO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702092.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS 8989..9861 product streptodornase Sda3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011285611.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 gene sda3 CDS 10030..10737 product SMUG2 DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990078.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS 10778..11524 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS complement(11602..12027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS complement(12472..13434) product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476165.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS 13686..14807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS 14818..15285 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359087.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS 15299..16090 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287115.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS 16080..16913 product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723163.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS 16937..17956 product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236585662.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS complement(18016..18789) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635556.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS complement(18803..19498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS 19672..20100 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236585661.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS 20116..20898 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287115.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS 21484..22482 product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321171.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS 22670..23386 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774988.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS 23417..24580 product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898687.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS 24732..25220 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364114.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS 25231..26145 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357253.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS 26132..26950 product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357254.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS 27015..27416 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836305.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS complement(27472..29490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS 29962..32661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS 32837..33829 product tagatose 1,6-diphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567744.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS 34546..35208 product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546204.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS complement(35290..36009) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861086.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS 36194..37189 product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966767.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS 37448..37870 product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071854935.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS 37867..38337 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298375.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS 38355..39143 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071854933.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS 39153..39989 product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298371.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS 40042..41019 product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002322451.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS 41130..42107 product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288613.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS 42129..42833 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572570.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS 42980..44038 product SEC10/PgrA surface exclusion domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546206.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS 44140..44655 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254447.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 tRNA 44774..44845 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 CDS 45120..45884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS 46707..47888 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475674.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 tRNA 47951..48032 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 tRNA 48040..48111 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 CDS 48266..49381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546248.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS 49463..50161 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546250.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS complement(50237..50623) product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254173.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 gene tagD CDS 50749..51480 product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546254.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS 51483..52583 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546257.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS 52656..54134 product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254174.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS 54131..54964 product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546262.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 gene nadE CDS 55291..57927 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549179.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 gene alaS CDS 57980..58237 product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549189.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS 58237..58665 product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549192.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 gene ruvX CDS 58667..58972 product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549194.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS 59026..61386 product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549197.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS 61470..61781 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254147.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 gene trxA CDS complement(61859..62233) product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254148.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 gene mscL CDS complement(62306..62713) product YslB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549202.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS 62793..63581 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549203.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 gene murI CDS 63594..64208 product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549206.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS complement(64272..65087) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674287.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS 65201..65632 product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549209.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS 65652..66029 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549212.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS complement(66103..67209) product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549213.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS 67356..68357 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549214.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS complement(68406..69776) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549215.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS 69860..70192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613308.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS 70203..71603 product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254152.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS 71578..72165 product YutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549221.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS 72166..72942 product TIGR01457 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549224.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS 72939..73547 product TIGR01906 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254154.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS complement(73560..74210) product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549229.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS complement(74222..75223) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014565583.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 sequence07 source 1..7440 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 6780..7085 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15500 sequence08 source 1..6037 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..904 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010990081.1:class 1 internalin InlJ locus_tag LOCUS_15510 CDS complement(1230..2303) product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867209.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS complement(2433..2903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS complement(2852..6037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15540 sequence09 source 1..6018 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence10 source 1..2182 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence11 source 1..1963 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ repeat_region 43..1910 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccatccgatccgtctgaaccgtc sequence12 source 1..1929 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence13 source 1..1772 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA complement(29..1590) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 sequence14 source 1..1756 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence15 source 1..1553 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence16 source 1..1517 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence17 source 1..1312 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(232..1269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15550 sequence18 source 1..1130 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(27..635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15560 sequence19 source 1..1120 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence20 source 1..1044 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence21 source 1..1023 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence22 source 1..760 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence23 source 1..674 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence24 source 1..645 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence25 source 1..632 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence26 source 1..615 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence27 source 1..609 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence28 source 1..533 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence29 source 1..500 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@